WorldWideScience

Sample records for 23s rrna nucleotide

  1. 23S rRNA nucleotides in the peptidyl transferase center are essential for tryptophanase operon induction.

    Yang, Rui; Cruz-Vera, Luis R; Yanofsky, Charles

    2009-06-01

    Distinct features of the ribosomal peptide exit tunnel are known to be essential for recognition of specific amino acids of a nascent peptidyl-tRNA. Thus, a tryptophan residue at position 12 of the peptidyl-tRNA TnaC-tRNA(Pro) leads to the creation of a free tryptophan binding site within the ribosome at which bound tryptophan inhibits normal ribosome functions. The ribosomal processes that are inhibited are hydrolysis of TnaC-tRNA(Pro) by release factor 2 and peptidyl transfer of TnaC of TnaC-tRNA(Pro) to puromycin. These events are normally performed in the ribosomal peptidyl transferase center. In the present study, changes of 23S rRNA nucleotides in the 2585 region of the peptidyl transferase center, G2583A and U2584C, were observed to reduce maximum induction of tna operon expression by tryptophan in vivo without affecting the concentration of tryptophan necessary to obtain 50% induction. The growth rate of strains with ribosomes with either of these changes was not altered appreciably. In vitro analyses with mutant ribosomes with these changes showed that tryptophan was not as efficient in protecting TnaC-tRNA(Pro) from puromycin action as wild-type ribosomes. However, added tryptophan did prevent sparsomycin action as it normally does with wild-type ribosomes. These findings suggest that these two mutational changes act by reducing the ability of ribosome-bound tryptophan to inhibit peptidyl transferase activity rather than by reducing the ability of the ribosome to bind tryptophan. Thus, the present study identifies specific nucleotides within the ribosomal peptidyl transferase center that appear to be essential for effective tryptophan induction of tna operon expression. PMID:19329641

  2. Mapping important nucleotides in the peptidyl transferase centre of 23 S rRNA using a random mutagenesis approach

    Porse, B T; Garrett, R A

    1995-01-01

    Random mutations were generated in the lower half of the peptidyl transferase loop in domain V of 23 S rRNA from Escherichia coli using a polymerase chain reaction (PCR) approach, a rapid procedure for identifying mutants and a plasmid-based expression system. The effects of 21 single......-site mutations, at 18 different positions, on cell growth, mutant rRNA incorporation into ribosomes and peptidyl transferase activity of the mutant ribosomes were analysed. The general importance of the whole region for the peptidyl transferase centre was emphasized by the finding that 14 of the mutants were...... sick, or very sick, when ribosomes containing chromosomal-encoded 23 S rRNA were inhibited by erythromycin, and all except one of these exhibited low levels of peptidyl transferase activity in their mutated ribosomes. Two mutations, psi 2580-->C and U2584-->G that both yielded inactive ribosomes were...

  3. YgdE is the 2'-O-ribose methyltransferase RlmM specific for nucleotide C2498 in bacterial 23S rRNA

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M;

    2009-01-01

    The rRNAs of Escherichia coli contain four 2'-O-methylated nucleotides. Similar to other bacterial species and in contrast with Archaea and Eukaryota, the E. coli rRNA modifications are catalysed by specific methyltransferases that find their nucleotide targets without being guided by small...... ribosomes. Nucleotide C2498 is situated within a highly conserved and heavily modified rRNA sequence, and YgdE's activity is influenced by other modification enzymes that target this region. Phylogenetically, YgdE is placed in the cluster of orthologous groups COG2933 together with S...... complementary RNAs. We show here that the ygdE gene encodes the methyltransferase that catalyses 2'-O-methylation at nucleotide C2498 in the peptidyl transferase loop of E. coli 23S rRNA. Analyses of rRNAs using MALDI mass spectrometry showed that inactivation of the ygdE gene leads to loss of methylation at...

  4. The conformation of 23S rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase

    Vester, B; Hansen, L H; Douthwaite, S

    1995-01-01

    it was shown that the A2057 and U2611 mutations alone and in combination alter the reactivity of A2058 and adjacent bases. However, mutagenizing position G-->A2032 in an adjacent loop, which has been implicated to interact with A2058, alters neither the ErmE methylation at A2058 nor the accessibility...... effects of mutations around position A2058 on methylation. Mutagenizing A2058 (to G or U) completely abolishes methylation of 23S rRNA by ErmE. No methylation occurred at other sites in the rRNA, demonstrating the fidelity of ErmE for A2058. Breaking the neighboring G2057-C2611 Watson-Crick base pair by...... introducing either an A2057 or a U2611 mutation, greatly reduces the rate of methylation at A2058. Methylation remains impaired after these mutations have been combined to create a new A2057-U2611 Watson-Crick base interaction. The conformation of this region in 23S rRNA was probed with chemical reagents and...

  5. YccW is the m5C methyltransferase specific for 23S rRNA nucleotide 1962

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M;

    2008-01-01

    . However, YccW does not methylate assembled 50S subunits, and this is somewhat surprising as the published crystal structures show nucleotide C1962 to be fully accessible at the subunit interface. YccW-directed methylation at nucleotide C1962 is conserved in bacteria, and loss of this methylation in E....... coli marginally reduces its growth rate. YccW had previously eluded identification because it displays only limited sequence similarity to the m(5)C methyltransferases RsmB and RsmF and is in fact more similar to known m(5)U (5-methyluridine) RNA methyltransferases. In keeping with the previously...... proposed nomenclature system for bacterial rRNA methyltransferases, yccW is now designated as the rRNA large subunit methyltransferase gene rlmI....

  6. Identification of 5-hydroxycytidine at position 2501 concludes characterization of modified nucleotides in E. coli 23S rRNA

    Havelund, Jesper Foged; Giessing, Anders Michael Bernth; Hansen, Trine Møller;

    2011-01-01

    modification as 5-hydroxycytidine-a novel modification in RNA. Identification of 5-hydroxycytidine was completed by liquid chromatography under nonoxidizing conditions using a graphitized carbon stationary phase in combination with ion trap tandem mass spectrometry and by comparing the fragmentation behavior...... rRNA-has previously been characterized in the bacterium Escherichia coli. Despite a first report nearly 20 years ago, the chemical nature of the modification at position 2501 has remained elusive, and attempts to isolate it have so far been unsuccessful. We unambiguously identify this last unknown...... of the natural nucleoside with that of a chemically synthesized ditto. Furthermore, we show that 5-hydroxycytidine is also present in the equivalent position of 23S rRNA from the bacterium Deinococcus radiodurans. Given the unstable nature of 5-hydroxycytidine, this modification might be found in...

  7. YbeA is the m3Psi methyltransferase RlmH that targets nucleotide 1915 in 23S rRNA

    Purta, Elzbieta; Kaminska, Katarzyna H; Kasprzak, Joanna M;

    2008-01-01

    Pseudouridines in the stable RNAs of Bacteria are seldom subjected to further modification. There are 11 pseudouridine (Psi) sites in Escherichia coli rRNA, and further modification is found only at Psi1915 in 23S rRNA, where the N-3 position of the base becomes methylated. Here, we report the...... identity of the E. coli methyltransferase that specifically catalyzes methyl group addition to form m(3)Psi1915. Analyses of E. coli rRNAs using MALDI mass spectrometry showed that inactivation of the ybeA gene leads to loss of methylation at nucleotide Psi1915. Methylation is restored by complementing the...... knockout strain with a plasmid-encoded copy of ybeA. Homologs of the ybeA gene, and thus presumably the ensuing methylation at nucleotide m(3)Psi1915, are present in most bacterial lineages but are essentially absent in the Archaea and Eukaryota. Loss of ybeA function in E. coli causes a slight slowing of...

  8. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    reveals increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits......The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea and...... chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...

  9. Recognition determinants for proteins and antibiotics within 23S rRNA

    Douthwalte, S; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup;

    1995-01-01

    Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of...... molecular genetic and biochemical probing techniques, we have concentrated on regions of the rRNA that are connected with specific functions. These are located in different domains within the 23S rRNA and include the ribosomal GTPase-associated center in domain II, which contains the binding sites for r......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...

  10. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    Liu, M; Kirpekar, F; Van Wezel, G P;

    2000-01-01

    Streptomyces species indicates that in vivo TlrB modifies nucleotide G748 within helix 35 of 23S rRNA. Purified recombinant TlrB retains its activity and specificity in vitro and modifies G748 in 23S rRNA as well as in a 74 nucleotide RNA containing helix 35 and surrounding structures. Modification is...

  11. Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

    Dam, M; Douthwaite, S; Tenson, T;

    1996-01-01

    Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247....... This is close to a short open reading frame in the 23 S rRNA that encodes a pentapeptide (E-peptide) whose expression in vivo renders cells resistant to erythromycin. Therefore, a possible mechanism of resistance caused by domain II mutations may be related to an increased expression of the E-peptide. To test...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore...

  12. Sites of interaction of streptogramin A and B antibiotics in the peptidyl transferase loop of 23 S rRNA and the synergism of their inhibitory mechanisms

    Porse, B T; Garrett, R A

    1999-01-01

    nucleotides in the peptidyl transferase loop of 23 S rRNA, including the two mutated nucleotides. An rRNA footprinting study, performed both in vivo and in vitro, on the A and B components complexed to Bacillus megaterium ribosomes, indicated that similar drug-induced effects occur on free ribosomes and...

  13. Domain V of 23S rRNA contains all the structural elements necessary for recognition by the ErmE methyltransferase

    Vester, B; Douthwaite, S

    1994-01-01

    enzyme efficiently modifies 23S rRNA in vitro. Removal of most of the 23S rRNA structure, so that only domain V (nucleotides 2000 to 2624) remains, does not affect the efficiency of modification by the methyltransferase. In addition, modification still occurs after the rRNA tertiary structure has been......The ErmE methyltransferase from the erythromycin-producing actinomycete Saccharopolyspora erythraea dimethylates the N-6 position of adenine 2058 in domain V of 23S rRNA. This modification confers resistance to erythromycin and to other macrolide, lincosamide, and streptogramin B antibiotics. We...

  14. Functional interactions within 23S rRNA involving the peptidyltransferase center.

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S rRNA peptidyltransferase loop. All three base substitutions at position 2032 produce an erythromycin-hypersensitive phenotype. The 2032 substitutions were compared with and combined with a 12-bp deletion muta...

  15. Macrolide-ketolide inhibition of MLS-resistant ribosomes is improved by alternative drug interaction with domain II of 23S rRNA

    Douthwaite, S; Hansen, L H; Mauvais, P

    2000-01-01

    The macrolide antibiotic erythromycin and its 6-O-methyl derivative (clarithromycin) bind to bacterial ribosomes primarily through interactions with nucleotides in domains II and V of 23S rRNA. The domain II interaction occurs between nucleotide A752 and the macrolide 3-cladinose moiety. Removal ...

  16. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    Karminska, K. H.; Purta, E.; Hansen, L .H.; Bujnicki, J. M.; Vester, B.; Long, Katherine

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...

  17. Functional interactions within 23S rRNA involving the peptidyltransferase center

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S r...... chloramphenicol. Introduction of the domain II deletion into these double-mutation constructs gives rise to erythromycin resistance. The results are interpreted as indicating that position 2032 interacts with the peptidyltransferase loop and that there is a functional connection between domains II and V....

  18. UV-induced modifications in the peptidyl transferase loop of 23S rRNA dependent on binding of the streptogramin B antibiotic, pristinamycin IA

    Porse, B T; Kirillov, S V; Awayez, M J;

    1999-01-01

    The naturally occurring streptogramin B antibiotic, pristinamycin IA, which inhibits peptide elongation, can produce two modifications in 23S rRNA when bound to the Escherichia coli 70S ribosome and irradiated at 365 nm. Both drug-induced effects map to highly conserved nucleotides within the...... functionally important peptidyl transferase loop of 23S rRNA at positions m2A2503/psi2504 and G2061/A2062. The modification yields are influenced strongly, and differentially, by P-site-bound tRNA and strongly by some of the peptidyl transferase antibiotics tested, with chloramphenicol producing a shift in the...... latter modification to A2062/C2063. Pristinamycin IA can also produce a modification on binding to deproteinized, mature 23S rRNA, at position U2500/C2501. The same modification occurs on an approximately 37-nt fragment, encompassing positions approximately 2496-2532 of the peptidyl transferase loop that...

  19. Antibiotic interactions at the GTPase-associated centre within Escherichia coli 23S rRNA

    Egebjerg, J; Douthwaite, S; Garrett, R A

    1989-01-01

    A comprehensive range of chemical reagents and ribonucleases was employed to investigate the interaction of the antibiotics thiostrepton and micrococcin with the ribosomal protein L11-23S RNA complex and with the 50S subunit. Both antibiotics block processes associated with the ribosomal A-site b...... important exception, however, occurred at nucleotide A1067 within a terminal loop where thiostrepton protected the N-1 position while micrococcin rendered it more reactive. This difference correlates with the opposite effects of the two antibiotics on GTPase activity....... differ in their effects on GTP hydrolysis, which is inhibited by thiostrepton and stimulated by micrococcin. The interaction sites of both drugs were shown to occur within the nucleotide sequences A1067-A1098 within the protein L11 binding site on 23S RNA. This region of the ribosome structure is......A comprehensive range of chemical reagents and ribonucleases was employed to investigate the interaction of the antibiotics thiostrepton and micrococcin with the ribosomal protein L11-23S RNA complex and with the 50S subunit. Both antibiotics block processes associated with the ribosomal A-site but...

  20. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    Kaminska, Katarzyna H; Purta, Elzbieta; Hansen, Lykke H; Bujnicki, Janusz M; Vester, Birte; Long, Katherine S

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...... a 4Fe-4S cluster, a SAM molecule coordinated to the iron-sulfur cluster (SAM1) and a SAM molecule that is the putative methyl group donor (SAM2). All mutations at predicted functional sites affect Cfr activity significantly as assayed by antibiotic susceptibility testing and primer extension...

  1. Fragmentation of 23S rRNA in Strains of Proteus and Providencia Results from Intervening Sequences in the rrn (rRNA) Genes

    Miller, Wayne L.; Pabbaraju, Kanti; Sanderson, Kenneth E.

    2000-01-01

    Intervening sequences (IVSs) were originally identified in the rrl genes for 23S rRNA (rrl genes, for large ribosomal subunit, part of rrn operon encoding rRNA) of Salmonella enterica serovars Typhimurium LT2 and Arizonae. These sequences are transcribed but later removed during RNase III processing of the rRNA, resulting in fragmentation of the 23S species; IVSs are uncommon, but have been reported in at least 10 bacterial genera. Through PCR amplification of IVS-containing regions of the rr...

  2. Intervening Sequences in rrl Genes and Fragmentation of 23S rRNA in Genera of the Family Enterobacteriaceae

    Pronk, Loes M; Sanderson, Kenneth E.

    2001-01-01

    Intervening sequences (IVSs) in the rrl genes for 23S rRNA are transcribed but later removed by RNase III without religation during RNA processing, leading to fragmented rRNA. We examined about 240 strains of the family Enterobacteriaceae for presence of IVSs using PCR. No IVSs were detected in strains belonging to Escherichia, Shigella, Enterobacter, Erwinia, Ewingella, Hafnia, Kluyvera, Morganella, Pantoea, or Serratia. Previously unreported IVSs were detected in Klebsiella oxytoca, Citroba...

  3. Absolute Quantification of Enterococcal 23S rRNA Gene Using Digital PCR.

    Wang, Dan; Yamahara, Kevan M; Cao, Yiping; Boehm, Alexandria B

    2016-04-01

    We evaluated the ability of chip-based digital PCR (dPCR) to quantify enterococci, the fecal indicator recommended by the United States Environmental Protection Agency (USEPA) for water-quality monitoring. dPCR uses Poisson statistics to estimate the number of DNA fragments in a sample with a specific sequence. Underestimation may occur when a gene is redundantly encoded in the genome and multiple copies of that gene are on one DNA fragment. When genomic DNA (gDNA) was extracted using two commercial DNA extraction kits, we confirmed that dPCR could discern individual copies of the redundant 23s rRNA gene in the enterococcal genome. dPCR quantification was accurate when compared to the nominal concentration inferred from fluorometer measurements (linear regression slope = 0.98, intercept = 0.03, R(2) = 0.99, and p value humic acid caused a similar level of inhibition in both dPCR and qPCR, but calcium inhibited dPCR to a lesser degree than qPCR. Inhibition of dPCR was partially relieved when the number of thermal cycles was increased. Based on these results, we conclude that dPCR is a viable option for enumerating enterococci in ambient water. PMID:26903207

  4. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    Rosendahl, G; Douthwaite, S

    1993-01-01

    23 S rRNA. Within the ribosome, L11 also interacts with this rRNA region, although the protection effects are subtly different and extend to nucleotide 1098. The pentameric r-protein complex L10.(L12)4 binds to an adjacent site on the rRNA, protecting riboses at positions 1043, 1046 to 1049, 1053 to...... by L10.(L12)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  5. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio

    2010-04-01

    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae. PMID:19656941

  6. Discrimination of bacillus anthracis and closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microarray.

    Bavykin, S. G.; Mikhailovich, V. M.; Zakharyev, V. M.; Lysov, Y. P.; Kelly, J. J.; Alferov, O. S.; Jackman, J.; Stahl, D. A.; Mirzabekov, A. D.; Gavin, I. M.; Kukhtin, A. V.; Chandler, D. (Biochip Technology Center); (Engelhardt Inst. of Molecular Biology); (Northwestern Univ.); (Georgetown Univ.)

    2008-01-30

    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 min. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead reflect

  7. Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿

    wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

    2008-01-01

    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative s...

  8. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    Ostergaard, P; Phan, H; Johansen, L B;

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

  9. Purification, crystallization and preliminary X-ray diffraction analysis of the 23S rRNA methyltransferase RlmJ from Escherichia coli

    The 23S rRNA methyltransferase RlmJ from E. coli has been cloned, expressed, purified and crystallized. X-ray diffraction data to 1.85 Å resolution have been collected from the apo RlmJ crystals. Methyltransferase RlmJ uses the cofactor S-adenosylmethionine to methylate the exocyclic nitrogen N6 of nucleotide A2030 in 23S rRNA during ribosome assembly in Escherichia coli. RlmJ with a C-terminal hexahistidine tag was overexpressed in E. coli and purified as a monomer using Ni2+-affinity and size-exclusion chromatography. The recombinant RlmJ was crystallized using the sitting-drop vapour-diffusion method and a full data set was collected to 1.85 Å resolution from a single apo crystal. The crystals belonged to space group P21, with unit-cell parameters a = 46.9, b = 77.8, c = 82.5 Å, β = 104°. Data analysis suggested two molecules per asymmetric unit and a Matthews coefficient of 2.20 Å3 Da−1

  10. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  11. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics.

    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G

    2005-09-01

    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  12. Analysis of the function of E. coli 23S rRNA helix-loop 69 by mutagenesis

    Maiväli Ülo

    2005-07-01

    Full Text Available Abstract Background The ribosome is a two-subunit enzyme known to exhibit structural dynamism during protein synthesis. The intersubunit bridges have been proposed to play important roles in decoding, translocation, and the peptidyl transferase reaction; yet the physical nature of their contributions is ill understood. An intriguing intersubunit bridge, B2a, which contains 23S rRNA helix 69 as a major component, has been implicated by proximity in a number of catalytically important regions. In addition to contacting the small ribosomal subunit, helix 69 contacts both the A and P site tRNAs and several translation factors. Results We scanned the loop of helix 69 by mutagenesis and analyzed the mutant ribosomes using a plasmid-borne IPTG-inducible expression system. We assayed the effects of 23S rRNA mutations on cell growth, contribution of mutant ribosomes to cellular polysome pools and the ability of mutant ribosomes to function in cell-free translation. Mutations A1912G, and A1919G have very strong growth phenotypes, are inactive during in vitro protein synthesis, and under-represented in the polysomes. Mutation Ψ1917C has a very strong growth phenotype and leads to a general depletion of the cellular polysome pool. Mutation A1916G, having a modest growth phenotype, is apparently defective in the assembly of the 70S ribosome. Conclusion Mutations A1912G, A1919G, and Ψ1917C of 23S rRNA strongly inhibit translation. Mutation A1916G causes a defect in the 50S subunit or 70S formation. Mutations Ψ1911C, A1913G, C1914A, Ψ1915C, and A1918G lack clear phenotypes.

  13. New mutation points in 23S rRNA gene associated with Helicobacter Pylori resistance to clarithromycin in northeast China

    Qing Hao; Yan Li; Zhi-Jie Zhang; Yong Liu; Hong Gao

    2004-01-01

    AIM: To investigate the resistance rate of Helicobacter pylori (Hpylori) to clarithromycin, metronidazole, amoxicillin and tetracycline to guide clinical practice, and to study the mechanism of H pyloriresistant to clarithromycin.METHODS: Thirty H pyloristrains were isolated from the mucosa of peptic ulcer, gastric tumor and chronic gastritis patients, then the minimal inhibitory concentration (MIC) to clarithromycin, metronidazole, amoxicillin and tetracycline was evaluated by E-test method. The sequence analysis of PCR fragments was conducted in 23S rRNA gene of H pylori resistant to clarithromycin to get the resistance mechanism of the bacteria.RESULTS: Among 30 H pyloristrains, 7 cases were resistant to clarithromycin, 12 to metronidazole, 2 to tetracycline and no strain was found to be resistant to amoxicillin. The resistance rates were 23.3%, 40%, 6.7% and 0%,respectively. Three new mutation points were found to be related to the clarithromycin resistance in H pyloriisolates,which were G2224A, C2245T and T2289C.CONCLUSION: In northeast China, H pylorishows high resistance to metronidazole, while sensitive to amoxicillin.The mechanism of resistance to clarithromycin may be related to the mutation of G2224A, C2245T and T2289C in the 23S rRNA gene.

  14. 116S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads

    Sima eTokajian

    2016-02-01

    Full Text Available Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 to 849 bp, while their G+C content was 42.2 mol% to 57.9 mol%. Five distinct ITS types were identified: ITSnone (without tRNA genes, ITSAla(TGC, ITSAla (TGC+Ile (GAT, ITSIle (GAT+Ala (TGC and ITS Ile (GAT+Pseudo. All of the identified tRNAAla (TGC molecules consisted of 73 bases, and all of the tRNAIle (GAT molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2.

  15. Oxazolidinone resistance mutations in 23S rRNA of Escherichia coli reveal the central region of domain V as the primary site of drug action

    Xiong, L; Kloss, P; Douthwaite, S; Andersen, N M; Swaney, S; Shinabarger, D L; Mankin, A S

    2000-01-01

    resistance mutations were clustered in the vicinity of the central loop of domain V of 23S rRNA, suggesting that this rRNA region plays a major role in the interaction of the drug with the ribosome. Although the central loop of domain V is an essential integral component of the ribosomal peptidyl transferase......, we selected Escherichia coli oxazolidinone-resistant mutants, which contained a randomly mutagenized plasmid-borne rRNA operon. The same mutation, G2032 to A, was identified in the 23S rRNA genes of several independent resistant isolates. Engineering of this mutation by site-directed mutagenesis in...... the wild-type rRNA operon produced an oxazolidinone resistance phenotype, establishing that the G2032A substitution was the determinant of resistance. Engineered U and C substitutions at G2032, as well as a G2447-to-U mutation, also conferred resistance to oxazolidinone. All the characterized...

  16. Prevalence of A2143G mutation of H. pylori-23S rRNA in Chinese subjects with and without clarithromycin use history

    Ma Junling; Feng Guoshuang; Gu Liankun; Zhou Jing; Zhang Baozhen; Li Qiang; Shen Lin; Zhang Lian; Shen Jing; Liu Zhuoqi; You Wei-Cheng; Deng Dajun

    2008-01-01

    Abstract Background A2143G mutation of 23S rRNA gene of H. pylori results in clarithromycin (CLR) resistance. To investigate the prevalence of the CLR resistance-related A2143G mutation of the H. pylori-specific 23S rRNA gene in Chinese subjects with and without CLR use history, 307 subjects received the treatment with amoxicillin and omeprazole (OA) and 310 subjects received a placebo in 1995, and 153 subjects received a triple therapy with OA and CLR (OAC) in 2000. DNA was extracted from fa...

  17. The unusual 23S rRNA gene of Coxiella burnetii: two self-splicing group I introns flank a 34-base-pair exon, and one element lacks the canonical omegaG.

    Raghavan, Rahul; Miller, Scott R; Hicks, Linda D; Minnick, Michael F

    2007-09-01

    We describe the presence and characteristics of two self-splicing group I introns in the sole 23S rRNA gene of Coxiella burnetii. The two group I introns, Cbu.L1917 and Cbu.L1951, are inserted at sites 1917 and 1951 (Escherichia coli numbering), respectively, in the 23S rRNA gene of C. burnetii. Both introns were found to be self-splicing in vivo and in vitro even though the terminal nucleotide of Cbu.L1917 is adenine and not the canonical conserved guanine, termed OmegaG, found in Cbu.L1951 and all other group I introns described to date. Predicted secondary structures for both introns were constructed and revealed that Cbu.L1917 and Cbu.L1951 were group IB2 and group IA3 introns, respectively. We analyzed strains belonging to eight genomic groups of C. burnetii to determine sequence variation and the presence or absence of the elements and found both introns to be highly conserved (>/=99%) among them. Although phylogenetic analysis did not identify the specific identities of donors, it indicates that the introns were likely acquired independently; Cbu.L1917 was acquired from other bacteria like Thermotoga subterranea and Cbu.L1951 from lower eukaryotes like Acanthamoeba castellanii. We also confirmed the fragmented nature of mature 23S rRNA in C. burnetii due to the presence of an intervening sequence. The presence of three selfish elements in C. burnetii's 23S rRNA gene is very unusual for an obligate intracellular bacterium and suggests a recent shift to its current lifestyle from a previous niche with greater opportunities for lateral gene transfer. PMID:17644584

  18. Acquired macrolide resistance in the human intestinal strain Lactobacillus rhamnosus E41 associated with a transition mutation in 23S rRNA genes

    Flórez García, Ana Belén; Ladero Losada, Víctor Manuel; Álvarez Martín, Pablo; Ammor, Mohammed Salim; Álvarez González, Miguel Ángel; Mayo Pérez, Baltasar

    2007-01-01

    Restriction fragment length polymorphism and DNA sequencing of polymerase chain reaction (PCR) products showed that a Lactobacillus rhamnosus strain of human origin resistant to macrolides, from which no resistance determinants have been detected by specific PCR and microarray screening, contained a heterozygous A → G transition mutation at position 2058 (Escherichia coli numbering) of its 23S rRNA genes.

  19. Prevalence of A2143G mutation of H. pylori-23S rRNA in Chinese subjects with and without clarithromycin use history

    Ma Junling

    2008-05-01

    Full Text Available Abstract Background A2143G mutation of 23S rRNA gene of H. pylori results in clarithromycin (CLR resistance. To investigate the prevalence of the CLR resistance-related A2143G mutation of the H. pylori-specific 23S rRNA gene in Chinese subjects with and without CLR use history, 307 subjects received the treatment with amoxicillin and omeprazole (OA and 310 subjects received a placebo in 1995, and 153 subjects received a triple therapy with OA and CLR (OAC in 2000. DNA was extracted from fasting gastric juice at the end of the intervention trial in 2003. H. pylori infection was determined by H. pylori-specific 23S rRNA PCR, ELISA, and13C-urea breath test assays. Mutations of the 23S rRNA gene were detected by RFLP assays. Results The presence of 23S rRNA due to H. pylori infection in the OA group remained lower than that in the placebo group 7.3 yrs after OA-therapy [51.1% (157/307 vs. 83.9% (260/310, p = 0.0000]. In the OAC group, the 23S rRNA detection rate was 26.8% (41/153 three yrs after OAC-treatment. The A2143G mutation rate among the 23S rRNA-positive subjects in the OAC group [31.7% (13/41] was significantly higher than that in the OA group [10.2% (16/157] and the placebo group [13.8% (36/260]. The frequency of the AAGGG → CTTCA (2222–2226 and AACC → GAAG (2081–2084 sequence alterations in the OAC group was also significantly higher than those in the OA group and the placebo group. Conclusion Primary prevalence of the A2143G mutation was 10~14% among Chinese population without history of CLR therapy. Administration of CLR to eliminate H. pylori infection increased the prevalence of the A2143G mutation in Chinese subjects (32% significantly.

  20. 奇异变形杆菌分离株23S rRNA序列分析%Sequence analysis of 23S rRNA genes of Proteus mirabilis

    王慧; 朱瑞良; 朱明华; 谭燕玲; 孙振红; 魏凯; 盛鹏程; 王新建

    2011-01-01

    通过PCR反应扩增7株鸡奇异变形杆菌和1株兔奇异变形杆菌的23SrRNA基因片段(1 045bp),经克隆测序,用DNAStar分析软件将所获得的序列与GenBank中收录的奇异变形杆菌、普通变形杆菌以及其他相近属的23S rRNA基因序列进行同源性比较,并由此构建奇异变形杆菌系统进化发生树.结果表示,本实验室保存的7株鸡奇异变形杆菌核苷酸序列与GenBank中收录的奇异变形杆菌核苷酸序列同源性为99.4%~99.8%,与兔奇异变形杆菌核苷酸序列同源性为98.8%~99.3%,与普通变形杆茵的核苷酸序列同源性为95.4%~96.2%,而与其他相近属同源性只有92.9%~93.4%.结果表明,23S rRNA基因序列分析可以作为鉴定奇异变形杆茵的一种快速、简便的方法.%To assess the evolution of Proteus mirabilis by 23S rRNA genes,To establish the sequence analysis of 23S rRNA of Proteus mirabilis was analyzed. The fragments (1 045 bp) of 23S rRNA genes of seven chicken Proteus mirabilis strains and one rabbit Proteus mirabilis strain were amplified by PCR and were sequenced. The sequences obtained in this paper were compared with the Proteus mirabilis 23S rRNA sequence reported in GenBank and other similar generas by the software of DNAStar analyses. The phylogenetic tree of Proteus mirabilis strains was established. Results showed the homologies between seven chicken Proteus mirabilis strains and the reported one strain in GenBank were 99.4%-99.8% ,and were 98.8%-99.3% identical to the rabbit Proteus mirabilis strains,were 95.4 %-96.2% identical to Proteus vulgaris, were 92. 9%-93.4 % identical to other similar generas. The result shown that 23S rRNA sequence analyses may be a reliable and rapid way for identification of Proteus mirabilis.

  1. Identification to the species level of Lactobacillus isolated in probiotic prospecting studies of human, animal or food origin by 16S-23S rRNA restriction profiling

    Neumann Elisabeth; Teixeira Santuza MR; Horta Maria F; Mota Rodrigo M; Moreira João; Nicoli Jacques R.; Nunes Álvaro C

    2005-01-01

    Abstract Background The accurate identification of Lactobacillus and other co-isolated bacteria during microbial ecological studies of ecosystems such as the human or animal intestinal tracts and food products is a hard task by phenotypic methods requiring additional tests such as protein and/or lipids profiling. Results Bacteria isolated in different probiotic prospecting studies, using de Man, Rogosa and Sharpe medium (MRS), were typed at species level by PCR amplification of 16S-23S rRNA i...

  2. Use of 16S-23S rRNA Intergenic Spacer Region PCR and Repetitive Extragenic Palindromic PCR Analyses of Escherichia coli Isolates To Identify Nonpoint Fecal Sources

    Seurinck, Sylvie; Verstraete, Willy; Siciliano, Steven D.

    2003-01-01

    Despite efforts to minimize fecal input into waterways, this kind of pollution continues to be a problem due to an inability to reliably identify nonpoint sources. Our objective was to find candidate source-specific Escherichia coli fingerprints as potential genotypic markers for raw sewage, horses, dogs, gulls, and cows. We evaluated 16S-23S rRNA intergenic spacer region (ISR)-PCR and repetitive extragenic palindromic (rep)-PCR analyses of E. coli isolates as tools to identify nonpoint fecal...

  3. First Report of the 23S rRNA Gene A2058G Point Mutation Associated With Macrolide Resistance in Treponema pallidum From Syphilis Patients in Cuba.

    Noda, Angel A; Matos, Nelvis; Blanco, Orestes; Rodríguez, Islay; Stamm, Lola Virginia

    2016-05-01

    This study aimed to assess the presence of macrolide-resistant Treponema pallidum subtypes in Havana, Cuba. Samples from 41 syphilis patients were tested for T. pallidum 23S rRNA gene mutations. Twenty-five patients (61%) harbored T. pallidum with the A2058G mutation, which was present in all 8 subtypes that were identified. The A2059G mutation was not detected. PMID:27100771

  4. A molecular biological study on identification of common septicemia bacteria using 16s-23s rRNA gene spacer regions

    傅君芬; 虞和永; 尚世强; 洪文澜; 陆淼泉; 李建平

    2002-01-01

    In the search for a rapid and reliable method for identification of bacteria in blood and cerebrospinal fluid , we developed a unified set of primers and used them under polymerase chain reaction(PCR) to amplify the spacer regions between the 16s and 23s genes in the prokaryotic rRNA genetic loci . Spacer regions within these loci showed a significant level of length and sequence polymorphism across most of the species lines. A generic pair of priming sequences was selected from highly conserved sequences in the 16s and 23s genes occurring adjacent to these polymorphic regions. This single set of primers and reaction conditions were used for the amplification of the 16s-23s spacer regions for 61 strains of standard bacteria and corresponding clinical isolates belonging to 20 genera and 27 species, including Listeria, Staphylococcus and Salmonella species, et al. When the spacer amplification products were resolved by electrophoresis, the resulting patterns could be used to distinguish most of the bacteria species within the test group, and the amplification products of the clinical isolates clustered at the standard species level. Some species presenting similar pattern were further analyzed by HinfI or AluI digestion or DNA clone and sequences analysis in order to establish the specific 16s-23s rRNA gene spacer regions map. Analysis of 42 blood specimens from septicemic neonates and 6 CSF specimens from suspected purulent meningitis patients by bacterial culture and PCR-RFLP(Restriction Fregament Length Polymorphism) showed that 15 specimens of blood culture were positive(35.7%) in the 42 septicemic neonates; 27 specimens were positive(64.2%) by PCR, and that the positive rate by PCR was significantly higher than that by blood culture(P<0.01). Among the 6 CSF specimens, one specimen found positive by blood culture was also positive by PCR, two found negative by blood culture showed positive by PCR; all three were S.epidermidis according to the DNA map. One C

  5. Cleavage of the sarcin–ricin loop of 23S rRNA differentially affects EF-G and EF-Tu binding

    García-Ortega, Lucía; Álvarez-García, Elisa; Gavilanes, José G.; Martínez-del-Pozo, Álvaro; Joseph, Simpson

    2010-01-01

    Ribotoxins are potent inhibitors of protein biosynthesis and inactivate ribosomes from a variety of organisms. The ribotoxin α-sarcin cleaves the large 23S ribosomal RNA (rRNA) at the universally conserved sarcin–ricin loop (SRL) leading to complete inactivation of the ribosome and cellular death. The SRL interacts with translation factors that hydrolyze GTP, and it is important for their binding to the ribosome, but its precise role is not yet understood. We studied the effect of α-sarcin on...

  6. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    Bavykin, Sergei G.; Mirzabekov, Andrei D.

    2007-10-30

    The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  7. VapC20 of Mycobacterium tuberculosis cleaves the Sarcin-Ricin loop of 23S rRNA

    Winther, Kristoffer Skovbo; Brodersen, Ditlev E.; Brown, Alistair K.; Gerdes, Kenn

    2013-01-01

    The highly persistent and often lethal human pathogen, Mycobacterium tuberculosis contains at least 88 toxin–antitoxin genes. More than half of these encode VapC PIN domain endoribonucleases that inhibit cell growth by unknown mechanisms. Here we show that VapC20 of M. tuberculosis inhibits translation by cleavage of the Sarcin–Ricin loop (SRL) of 23S ribosomal RNA at the same position where Sarcin and other eukaryotic ribotoxins cleave. Toxin-inhibited cells can be rescued by the expression ...

  8. The donor substrate site within the peptidyl transferase loop of 23 S rRNA and its putative interactions with the CCA-end of N-blocked aminoacyl-tRNA(Phe)

    Porse, B T; Thi-Ngoc, H P; Garrett, R A

    1996-01-01

    An RNA region associated with the donor substrate site, located at the base of the peptidyl transferase loop of 23 S rRNA, was subjected to a comprehensive single-site mutational study. Growth phenotypes of Escherichia coli cells were characterized on induction of synthesis of the mutated rRNAs and...... the mutated ribosomes were tested, selectively, for their capacity to generate peptide bonds under the conditions of the "fragment" assay. Most of the mutants exhibited dominant or recessive lethal growth phenotypes and, in general, defective growth correlated with low activities in peptide bond...... approach was employed to test for Watson-Crick base-pairing interactions between the -CCA end of the P-site bound tRNA(Phe) and this region of the peptidyl-transferase loop. Single nucleotide substitutions were introduced into the -CCA end of tRNA(Phe) and the ability of the 3'-terminal pentanucleotide...

  9. VapC20 of Mycobacterium tuberculosis Cleaves the Sarcin Ricin Loop of 23S rRNA

    Winther, Kristoffer Skovbo; Brodersen, Ditlev E.; Brown, Alistair K;

    2013-01-01

    exhibited by M. tuberculosis. VapC20 cleavage is inhibited by mutations in the SRL that flank the cleavage site but not by changes elsewhere in the loop. Disruption of the SRL stem abolishes cleavage; however, further mutations that restore the SRL stem structure restore cleavage, revealing that the...... translation by cleavage of the Sarcin–Ricin loop (SRL) of 23S ribosomal RNA at the same position where Sarcin and other eukaryotic ribotoxins cleave. Toxin-inhibited cells can be rescued by the expression of the antitoxin, thereby raising the possibility that vapC20 contributes to the extreme persistence...... structure rather than the exact sequence of the SRL is important for this activity...

  10. The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

    Hori, H; Sawada, M.; Osawa, S; Murao, K; Ishikura, H

    1981-01-01

    The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

  11. Erythromycin binding is reduced in ribosomes with conformational alterations in the 23 S rRNA peptidyl transferase loop

    Douthwaite, S; Aagaard, C

    1993-01-01

    induced by mutations in the peptidyl transferase loop, and to determine how these changes affect drug interaction. Mutations at positions 2057 (G-->A) and 2058 (A-->G, or -->U), all of which confer drug resistance, induce a more open conformation in the peptidyl transferase loop. Erythromycin still...... protects against chemical modification in the mutant peptidyl transferase loops, but the affinity of the drug interaction is reduced 20-fold in the 2057A mutant, 10(3)-fold in the 2058U mutant and 10(4)-fold in the 2058G mutant. Single mutations at position 2032 in the adjacent hairpin loop, which have...... previously been shown to alter drug tolerances, gave no detectable effects on the structure of the peptidyl transferase loop or on erythromycin binding. Dual mutations at positions 2032 and 2058, however, induce a marked change in the rRNA conformation with opening of the phylogenetically conserved base...

  12. VapC20 of Mycobacterium tuberculosis cleaves the sarcin-ricin loop of 23S rRNA.

    Winther, Kristoffer S; Brodersen, Ditlev E; Brown, Alistair K; Gerdes, Kenn

    2013-01-01

    The highly persistent and often lethal human pathogen, Mycobacterium tuberculosis contains at least 88 toxin-antitoxin genes. More than half of these encode VapC PIN domain endoribonucleases that inhibit cell growth by unknown mechanisms. Here we show that VapC20 of M. tuberculosis inhibits translation by cleavage of the Sarcin-Ricin loop (SRL) of 23S ribosomal RNA at the same position where Sarcin and other eukaryotic ribotoxins cleave. Toxin-inhibited cells can be rescued by the expression of the antitoxin, thereby raising the possibility that vapC20 contributes to the extreme persistence exhibited by M. tuberculosis. VapC20 cleavage is inhibited by mutations in the SRL that flank the cleavage site but not by changes elsewhere in the loop. Disruption of the SRL stem abolishes cleavage; however, further mutations that restore the SRL stem structure restore cleavage, revealing that the structure rather than the exact sequence of the SRL is important for this activity. PMID:24225902

  13. Cyanobacterial ecotypes in different optical microenvironments of a 68 C hot spring mat community revealed by 16S-23S rRNA internal transcribed spacer region variation

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea;

    2003-01-01

    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynth......We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic...... distinct populations over the vertical interval. We were unable to identify patterns in genetic variation in Synechococcus 16S rRNA sequences that correlate with different vertically distributed populations. However, patterns of variation at the internal transcribed spacer locus separating 16S and 23S r...

  14. Identification to the species level of Lactobacillus isolated in probiotic prospecting studies of human, animal or food origin by 16S-23S rRNA restriction profiling

    Neumann Elisabeth

    2005-03-01

    Full Text Available Abstract Background The accurate identification of Lactobacillus and other co-isolated bacteria during microbial ecological studies of ecosystems such as the human or animal intestinal tracts and food products is a hard task by phenotypic methods requiring additional tests such as protein and/or lipids profiling. Results Bacteria isolated in different probiotic prospecting studies, using de Man, Rogosa and Sharpe medium (MRS, were typed at species level by PCR amplification of 16S-23S rRNA intergenic spacers using universal primers that anneal within 16S and 23S genes, followed by restriction digestion analyses of PCR products. The set of enzymes chosen differentiates most species of Lactobacillus genus and also co-isolated bacteria such as Enterococcus, Streptococcus, Weissella, Staphylococcus, and Escherichia species. The in silico predictions of restriction patterns generated by the Lactobacillus shorter spacers digested with 11 restriction enzymes with 6 bp specificities allowed us to distinguish almost all isolates at the species level but not at the subspecies one. Simultaneous theoretical digestions of the three spacers (long, medium and short with the same set of enzymes provided more complex patterns and allowed us to distinguish the species without purifying and cloning of PCR products. Conclusion Lactobacillus isolates and several other strains of bacteria co-isolated on MRS medium from gastrointestinal ecosystem and fermented food products could be identified using DNA fingerprints generated by restriction endonucleases. The methodology based on amplified ribosomal DNA restriction analysis (ARDRA is easier, faster and more accurate than the current methodologies based on fermentation profiles, used in most laboratories for the purpose of identification of these bacteria in different prospecting studies.

  15. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. PMID:26800847

  16. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    The peptidyl transfer site has been localized at the centre of domain V of 23S-like ribosomal RNA (rRNA) primarily on the basis of a chloramphenicol binding site. The implicated region constitutes an unstructured circle in the current secondary structural model which contains several universally....... In addition, a G2502----A transition caused a decreased growth rate, probably due to a partial selection against mutant ribosome incorporation into polysomes, while an A2503----C transversion produced a decreased growth rate and conferred resistance to chloramphenicol. All of the mutant RNAs were...

  17. New bioinformatic tools for analysis of nucleotide modifications in eukaryotic rRNA

    Piekna-Przybylska, Dorota; Decatur, Wayne A.; Fournier, Maurille J.

    2007-01-01

    This report presents a valuable new bioinformatics package for research on rRNA nucleotide modifications in the ribosome, especially those created by small nucleolar RNA:protein complexes (snoRNPs). The interactive service, which is not available elsewhere, enables a user to visualize the positions of pseudouridines, 2′-O-methylations, and base methylations in three-dimensional space in the ribosome and also in linear and secondary structure formats of ribosomal RNA. Our tools provide additio...

  18. Relationships between 16S-23S rRNA gene internal transcribed spacer DNA and genomic DNA similarities in the taxonomy of phototrophic bacteria

    Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.

  19. Identification and phyletic evolution analysis of Proteus mirabilis strains by PCR and restriction fragment length polymorphism of 16S-23S rRNA gene intergenic spacer region%16S-23S rRNA基因间隔序列PCR及RFLP对奇异变形杆菌分离株的鉴别与系统发育分析

    崔国林; 朱瑞良; 左雪梅; 钟世勋; 杨世发; 梁漫飞; 孙婧; 刘静静

    2013-01-01

    根据临床常见致病菌16S-23S rRNA基因间隔序列(ISR)两端的16S及23S rRNA保守序列设计PCR扩增的通用引物,对9株奇异变形杆菌和6株相近菌株应用通用引物PCR扩增16S-23S rRNA ISR序列.通过PCR长度多态性比较、RFLP分析以及部分序列测序比较,分析鉴别奇异变形杆菌.结果显示,PCR长度多态性可以将奇异变形杆菌同其余菌种进行区分;RFLP分析可以将所有试验菌种进行区分;部分序列测序可以对奇异变形杆菌进行分型.由此表明,16S 23S rRNA ISR序列PCR及RFLP分析可以简单、快速、准确的鉴定奇异变形杆菌.%To establish a new method to identify Proteus mirabilis strains, according to the conserved sequences of 16S and 23S which located on both ends of the clinical common pathogenic bacteria 16S-23S rRNA gene intergenic spacer region (ISR),a pair of universal primers was designed. Nine Proteus mirabilis strains and six similar bacteria strains were amplified by PCR and identified by the PCR length polymorphism comparison,restriction fragment length polymorphism (RFLP) analysis and partial sequences sequencing. The result showed that Proteus mirabilis strains could be discriminated from other similar bacteria strains by PCR length polymorphism comparison,all of test organism could be discriminated by RFLP and Proteus mirabilis strains could be typed by partial sequences sequencing. The result indicated that the identification method based on the 16S-23S rRNA ISR, using PCR and PCR-RFLP,is very suitable for the rapid low-cost identification and discrimination of Proteus mirabilis strains from other phylogenetically related bacteria strains.

  20. Long PCR-RFLP of 16S-ITS-23S rRNA genes: a high-resolution molecular tool for bacterial genotyping

    Zeng, Yonghui; Koblížek, Michal; Li, Y. X.; Liu, Y. P.; Feng, F. Y.; Ji, J. D.; Jian, J. C.; Wu, Z. H.

    2013-01-01

    Roč. 114, č. 2 (2013), s. 433-447. ISSN 1364-5072 R&D Projects: GA MŠk(CZ) ED2.1.00/03.0110 Institutional support: RVO:61388971 Keywords : 16S-ITS-23S * bacterial genome * computer simulation Subject RIV: EE - Microbiology, Virology Impact factor: 2.386, year: 2013

  1. Mutations in 23S rRNA at the Peptidyl Transferase Center and Their Relationship to Linezolid Binding and Cross-Resistance

    Long, Katherine; Munck, Christian

    2010-01-01

    linezolid. Smaller decreases were observed with the A2503G, U2504G, and G2505A mutations at nucleotides proximal to linezolid, showing that the degree of resistance conferred is not simply inversely proportional to the nucleotide-drug distance. The double mutations G2032A-C2499A, G2032A-U2504G, C2055A-U2504...

  2. 山羊奇异变形杆菌分离鉴定及其16S-23S rRNA ISR序列RFLP分析%Isolation and Identification of Proteus mirabilis from Goat and the Analysis of Its 16S-23S rRNA ISR Sequence by RFLP

    崔国林; 钟世勋; 杨世发; 左雪梅; 朱瑞良

    2013-01-01

    2012年初,山东菏泽某羊场的羊群发病,从发病羊器官分离到2株病原细菌.对病原细菌进行鉴定,并对其与已知同种异源菌株相似性差异进行分析.从患病山羊内脏器官分离细菌,经形态特征、培养特性、生化试验、血清学试验及致病性试验进行鉴定;再通过设计通用引物扩增16S-23S rRNA ISR (intergenie spacer region)序列,将PCR产物经HinfⅠ单酶切获得3条可视条带,同时对扩增条带中的主带测序并进行系统发育分析.结果表明,分离菌株为奇异变形杆菌;分离菌株同本实验室保存的兔源与鸡源奇异变形杆菌PCR-RFLP结果一致;分离菌株PCR产物同GenBank收录的HI4320株奇异变形杆菌及本实验室保存的兔源与鸡源奇异变形杆菌进行序列比较,分离羊源菌株与兔源菌株相似性为94.8%、与鸡源菌株相似性为96.0%~98.2%,与人源HI4320株相似性为96.9%.研究证实发病羊致病病原为奇异变形杆菌,其与鸡源、兔源和人源奇异变形杆菌的亲缘关系较近.%At the beginning of 2012,a disease occurred in a goat farm in Heze City and two strains of pathogen were isolated from the infected goats.In order to identify the infected bacteria and analyze the homology between isolated strains and heterologous strains,bacteria were isolated from infected goats internal organs and were identified by morphologic characteristics,cultural characteristic,biochemistry test,serologic test and pathogenicity test; A pair of universal primers was designed to amplify 16S-23S rRNA ISR (intergenic spacer region) gene.and three visible straps were observed when PCR products were cut by Hinf Ⅰ,at the same time the main strap of PCR straps was sequenced and analyzed by phyletic evolution.The results showed that isolated strains were Proteus mirabilis ; the result of PCR-RFLP of isolated strains and Proteus mirabilis from rabbit and chicken was the same; The homology was 94.8% between

  3. Peptidyl transferase antibiotics perturb the relative positioning of the 3'-terminal adenosine of P/P'-site-bound tRNA and 23S rRNA in the ribosome

    Kirillov, S V; Porse, B T; Garrett, R A

    1999-01-01

    A range of antibiotic inhibitors that act within the peptidyl transferase center of the ribosome were examined for their capacity to perturb the relative positioning of the 3' end of P/P'-site-bound tRNA and the Escherichia coli ribosome. The 3'-terminal adenosines of deacylated tRNA and N......-ribosome complexes. It is concluded that the antibiotics perturb the relative positioning of the 3' end of the P/P'-site-bound tRNA and the peptidyl transferase loop region of 23S rRNA....

  4. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  5. Evaluation of a fluorescence-labelled oligonucleotide tide probe targeting 23S rRNA for in situ detection of Salmonella serovars in paraffin-embedded tissue sections and their rapid identification in bacterial smears

    Nordentoft, Steen; Christensen, H.; Wegener, Henrik Caspar

    1997-01-01

    A method for the detection of Salmonella based on fluorescence in situ hybridization (FISH) has been developed and applied for the direct detection of Salmonella in pure cultures and in formalin-fixed, paraffin-embedded tissue sections. On the basis of the 23S rRNA gene sequences representing all...... with the probe. The probe did not hybridize to serovars from subspecies IIIa (S. arizonae) or to S. bongori. No cross-reaction to 64 other strains of the family Enterobacteriaceae or 18 other bacterial strains outside this family was observed. The probe was tested with sections of formalin-fixed......, paraffin-embedded tissue from experimentally infected mice or from animals with a history of clinical salmonellosis. In these tissue sections the probe hybridized specifically to Salmonella serovars, allowing for the detection of single bacterial cells. The development of a fluorescence-labelled specific...

  6. Multicentre surveillance of prevalence of the 23S rRNA A2058G and A2059G point mutations and molecular subtypes of Treponema pallidum in Taiwan, 2009-2013.

    Wu, B-R; Yang, C-J; Tsai, M-S; Lee, K-Y; Lee, N-Y; Huang, W-C; Wu, H; Lee, C-H; Chen, T-C; Ko, W-C; Lin, H-H; Lu, P-L; Chen, Y-H; Liu, W-C; Yang, S-P; Wu, P-Y; Su, Y-C; Hung, C-C; Chang, S-Y

    2014-08-01

    Resistance mutations A2058G and A2059G, within the 23S rRNA gene of Treponema pallidum, have been reported to cause treatment failures in patients receiving azithromycin for syphilis. Genotyping of T. pallidum strains sequentially isolated from patients with recurrent syphilis is rarely performed. From September 2009 to August 2013, we collected 658 clinical specimens from 375 patients who presented with syphilis for genotyping to examine the number of 60-bp repeats in the acidic repeat protein (arp) gene, T. pallidum repeat (tpr) polymorphism, and tp0548 gene, and to detect A2058G and A2059G point mutations by restriction fragment length polymorphism. Treponemal DNA was identified in 45.2% (n = 298) of the specimens that were collected from 216 (57.6%) patients; 268 (40.7%) specimens tested positive for the 23S rRNA gene, and were examined for macrolide resistance. Two isolates (0.7%) harboured the A2058G mutation, and no A2059G mutation was identified. A total of 14 strains of T. pallidum were identified, with 14f/f (57.5%) and 14b/c (10.0%) being the two predominant strains. Forty patients who presented with recurrent episodes of syphilis had T. pallidum DNA identified from the initial and subsequent episodes, with five cases showing strain discrepancies. One patient had two strains identified from different clinical specimens collected in the same episode. Our findings show that 14f/f is the most common T. pallidum strain in Taiwan, where the prevalence of T. pallidum strains that show A2058G or A2059G mutation remains low. Different genotypes of T. pallidum can be identified in patients with recurrent episodes of syphilis. PMID:24438059

  7. High frequency of the 23S rRNA A2058G mutation of Treponema pallidum in Shanghai is associated with a current strategy for the treatment of syphilis.

    Lu, Haikong; Li, Kang; Gong, Weimin; Yan, Limeng; Gu, Xin; Chai, Ze; Guan, Zhifang; Zhou, Pingyu

    2015-02-01

    The preferred drugs for the treatment of syphilis, benzathine and procaine penicillin, have not been available in Shanghai for many years, and currently, the incidence of syphilis is increasing. Alternative antibiotics for patients with syphilis during the benzathine and procaine penicillin shortage include macrolides. The failure of macrolide treatment in syphilis patients has been reported in Shanghai, but the reason for this treatment failure remains unclear. We used polymerase chain reaction technology to detect a 23S rRNA A2058G mutation in Treponema pallidum in 109 specimens from syphilis patients. The use of azithromycin/erythromycin in the syphilis patients and the physicians' prescription habits were also assessed based on two questionnaires regarding the use of macrolides. A total of 104 specimens (95.4%) were positive for the A2058G mutation in both copies of the 23S rRNA gene, indicating macrolide resistance. A questionnaire provided to 122 dermatologists showed that during the penicillin shortage, they prescribed erythromycin and azithromycin for 8.24±13.95% and 3.21±6.37% of their patients, respectively, and in the case of penicillin allergy, erythromycin and azithromycin were prescribed 15.24±22.89% and 7.23±16.60% of the time, respectively. A second questionnaire provided to the syphilis patients showed that 150 (33.7%), 106 (23.8%) and 34 (7.6%) individuals had used azithromycin, erythromycin or both, respectively, although the majority did not use the drugs for syphilis treatment. Our findings suggest that macrolide resistance in Treponema pallidum is widespread in Shanghai. More than half of the syphilis patients had a history of macrolide use for other treatment purposes, which may have led to the high prevalence of macrolide resistance. Physicians in China are advised to not use azithromycin for early syphilis. PMID:26038763

  8. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O139 outbreak based on the intergenomic heterogeneity of the 16S-23S rRNA intergenic spacer regions

    Atreyi Ghatak; Anasuya Majumdar; Ranajit K Ghosh

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O139 outbreak. ISR classes ‘a’ and ‘g’ were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O139 serogroup and post-O139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  9. Evaluation of a fluorescence-labelled oligonucleotide tide probe targeting 23S rRNA for in situ detection of Salmonella serovars in paraffin-embedded tissue sections and their rapid identification in bacterial smears

    Nordentoft, Steen; Christensen, H.; Wegener, Henrik Caspar

    1997-01-01

    A method for the detection of Salmonella based on fluorescence in situ hybridization (FISH) has been developed and applied for the direct detection of Salmonella in pure cultures and in formalin-fixed, paraffin-embedded tissue sections. On the basis of the 23S rRNA gene sequences representing all...... oligonucleotide probe makes the FISH technique a promising tool for the rapid identification of S. enterica in bacterial smears, as well as for the detection of S. enterica in histological tissue sections....... of the S. enterica subspecies and S. bongori, an 18-mer oligonucleotide probe was selected. The specificity of the probe was tested by in situ hybridization to bacterial cell smears of pur cultures. Forty-nine of 55 tested Salmonella serovars belonging to subspecies I, II, IIIb, IV, and VI hybridized...... with the probe. The probe did not hybridize to serovars from subspecies IIIa (S. arizonae) or to S. bongori. No cross-reaction to 64 other strains of the family Enterobacteriaceae or 18 other bacterial strains outside this family was observed. The probe was tested with sections of formalin...

  10. Detection of the A2058G and A2059G 23S rRNA Gene Point Mutations Associated with Azithromycin Resistance in Treponema pallidum by Use of a TaqMan Real-Time Multiplex PCR Assay

    Chi, Kai-Hua; Pillay, Allan; Nachamkin, Eli; Su, John R.; Ballard, Ronald C.

    2013-01-01

    Macrolide treatment failure in syphilis patients is associated with a single point mutation (either A2058G or A2059G) in both copies of the 23S rRNA gene in Treponema pallidum strains. The conventional method for the detection of both point mutations uses nested PCR combined with restriction enzyme digestions, which is laborious and time-consuming. We initially developed a TaqMan-based real-time duplex PCR assay for detection of the A2058G mutation, and upon discovery of the A2059G mutation, we modified the assay into a triplex format to simultaneously detect both mutations. The point mutations detected by the real-time triplex PCR were confirmed by pyrosequencing. A total of 129 specimens PCR positive for T. pallidum that were obtained from an azithromycin resistance surveillance study conducted in the United States were analyzed. Sixty-six (51.2%) of the 129 samples with the A2058G mutation were identified by both real-time PCR assays. Of the remaining 63 samples that were identified as having a macrolide-susceptible genotype by the duplex PCR assay, 17 (27%) were found to contain the A2059G mutation by the triplex PCR. The proportions of macrolide-susceptible versus -resistant genotypes harboring either the A2058G or the A2059G mutation among the T. pallidum strains were 35.6, 51.2, and 13.2%, respectively. None of the T. pallidum strains examined had both point mutations. The TaqMan-based real-time triplex PCR assay offers an alternative to conventional nested PCR and restriction fragment length polymorphism analyses for the rapid detection of both point mutations associated with macrolide resistance in T. pallidum. PMID:23284026

  11. Comparison of multiple genes and 16S-23S rRNA intergenic space region for their capacity in high resolution melt curve analysis to differentiate Mycoplasma gallisepticum vaccine strain ts-11 from field strains.

    Ghorashi, Seyed A; Bradbury, Janet M; Ferguson-Noel, Naola M; Noormohammadi, Amir H

    2013-12-27

    Mycoplasma gallisepticum (MG) is an important avian pathogen causing significant economic losses in the global poultry industry. In an attempt to compare and evaluate existing genotyping methods for differentiation of MG strains/isolates, high resolution melt (HRM) curve analysis was applied to 5 different PCR methods targeting vlhA, pvpA, gapA, mgc2 genes and 16S-23S rRNA intergenic space region (IGSR). To assess the discriminatory power of PCR-HRM of examined genes and IGSR, MG strains ts-11, F, 6/85 and S6, and, initially, 8 field isolates were tested. All MG strains/isolates were differentiated using PCR-HRM curve analysis and genotype confidence percentage (GCP) values of vlhA and pvpA genes, while only 0, 3 and 4 out of 12 MG strains/isolates were differentiated using gapA, mgc2 genes and IGSR, respectively. The HRM curve analysis of vlhA and pvpA genes was found to be highly correlated with the genetic diversity of the targeted genes confirmed by sequence analysis of amplicons generated from MG strains. The potential of the vlhA and pvpA genes was also demonstrated for genotyping of 12 additional MG strains from Europe and the USA. Results from this study provide a direct comparison between genes previously used in sequencing-based genotyping methods for MG strain identification and highlight the usefulness of vlhA and pvpA HRM curve analyses as rapid and reliable tools specially for diagnosis and differentiation of MG strains used here. PMID:24238667

  12. The aminoglycoside resistance methyltransferase Sgm impedes RsmF methylation at an adjacent rRNA nucleotide in the ribosomal A site

    Cubrilo, Sonja; Babić, Fedora; Douthwaite, Stephen;

    2009-01-01

    methylated nucleotides including m(4)Cm1402 and m(5)C1407. Modification at m(5)C1407 by the methyltransferase RsmF is impeded as Sgm gains access to its adjacent G1405 target on the 30S ribosomal subunit. An Sgm mutant (G135A), which is impaired in S-adenosylmethionine binding and confers lower resistance......Ribosome-targeting antibiotics block protein synthesis by binding at functionally important regions of the bacterial rRNA. Resistance is often conferred by addition of a methyl group at the antibiotic binding site within an rRNA region that is already highly modified with several nucleotide...... methylations. In bacterial rRNA, each methylation requires its own specific methyltransferase enzyme, and this raises the question as to how an extra methyltransferase conferring antibiotic resistance can be accommodated and how it can gain access to its nucleotide target within a short and functionally...

  13. Methanosarcina acetivorans 16S rRNA and transcription factor nucleotide fluctuation with implications in exobiology and pathology

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Marchese, P.; Hiciano, O.; Yao, H.; Lieberman, D.; Cheung, T.

    2008-08-01

    Cultures of the methane-producing archaea Methanosarcina, have recently been isolated from Alaskan sediments. It has been proposed that methanogens are strong candidates for exobiological life in extreme conditions. The spatial environmental gradients, such as those associated with the polygons on Mars' surface, could have been produced by past methanogenesis activity. The 16S rRNA gene has been used routinely to classify phenotypes. Using the fractal dimension of nucleotide fluctuation, a comparative study of the 16S rRNA nucleotide fluctuation in Methanosarcina acetivorans C2A, Deinococcus radiodurans, and E. coli was conducted. The results suggest that Methanosarcina acetivorans has the lowest fractal dimension, consistent with its ancestral position in evolution. Variation in fluctuation complexity was also detected in the transcription factors. The transcription factor B (TFB) was found to have a higher fractal dimension as compared to transcription factor E (TFE), consistent with the fact that a single TFB in Methanosarcina acetivorans can code three different TATA box proteins. The average nucleotide pair-wise free energy of the DNA repair genes was found to be highest for Methanosarcina acetivorans, suggesting a relatively weak bonding, which is consistent with its low prevalence in pathology. Multitasking capacity comparison of type-I and type-II topoisomerases has been shown to correlate with fractal dimension using the methicillin-resistant strain MRSA 252. The analysis suggests that gene adaptation in a changing chemical environment can be measured in terms of bioinformatics. Given that the radiation resistant Deinococcus radiodurans is a strong candidate for an extraterrestrial origin and that the cold temperature Psychrobacter cryohalolentis K5 can function in Siberian permafrost, the fractal dimension comparison in this study suggests that a chemical resistant methanogen could exist in extremely cold conditions (such as that which existed on early

  14. Fragmentations of the large-subunit rRNA in the family Rhizobiaceae.

    Selenska-Pobell, S; Evguenieva-Hackenberg, E

    1995-01-01

    A 130-nucleotide-long rRNA species corresponding to the 5' end of the 23S rRNA gene was found in 96 strains belonging to different Rhizobium, Bradyrhizobium, and Agrobacterium species. Additional fragmentation in the central region of the large-subunit rRNA occurred in all agrobacteria, except Agrobacterium vitis, and in most Rhizobium leguminosarum and Rhizobium etli strains but did not occur in any of the other rhizobia and bradyrhizobia studied.

  15. Diversity of the marine picocyanobacteria Prochlorococcus and Synechococcus assessed by terminal restriction fragment length polymorphisms of 16S-23S rRNA internal transcribed spacer sequences Diversidad de las picocianobacterias marinas Prochlorococcus y Synechococcus por medio de polimorfismos de longitud de fragmentos de restricción terminal en secuencias del espaciador transcrito interno del ARNr 16S - 23S

    PARIS LAVIN

    2008-12-01

    Full Text Available In order to assess the appropriateness of the use of internal transcribed spacer (ITS sequences for the study of population genetics of marine cyanobacteria, we amplified and cloned the 16S rRNA gene plus the 16S-23S ITS regions of six strains of Prochlorococcus and Synechococcus. We analyzed them by denaturing gradient gel electrophoresis (DGGE and terminal restriction fragment length polymorphisms (T-RFLP. When using the standard application of these techniques, we obtained more than one band or terminal restriction fragment (T-RF per strain or cloned sequence. Reports in literature have suggested that these anomalies can result from the formation of secondary structures. Secondary structures of the ITS sequences of Prochlorococcus and Synechococcus strains were computationally modelled at the different temperatures that were used during the polymerase chain reaction (PCR. Modelling results predicted the existence of hairpin loops that would still be present at the extensión temperature; it is likely that these loops produced incomplete and single stranded PCR products. We modified the standard T-RFLP procedure by adding the labelled ITS primer in the last two cycles of the PCR reaction; this resulted, in most cases, in only one T-RF per ribotype. Application of this technique to a natural picoplankton community in marine waters off northern Chile, showed that it was possible to identify the presence, and determine the relative abundance, of several phylogenetic lineages within the genera Prochlorococcus and Synechococcus inhabiting the euphotic zone. Phylogenetic analysis of ITS sequences obtained by cloning and sequencing DNA from the same sample confirmed the presence of the different genotypes. With the proposed modification, T-RFLP profiles should therefore be suitable for studying the diversity of natural populations of cyanobacteria, and should become an important tool to study the factors influencing the genetic structure and

  16. Cooperative assembly of proteins in the ribosomal GTPase centre demonstrated by their interactions with mutant 23S rRNAs

    Rosendahl, G; Douthwaite, S

    1995-01-01

    within a hairpin loop (1068-1072), where the protein probably makes nucleotide contacts. Some of these mutations also interfere with binding of the r-protein complex L10.(L12)4 to an adjacent site on the rRNA. When added together to rRNA, proteins L10.(L12)4 and L11 bind cooperatively to overcome the......The ribosomal protein L11 binds to the region of 23S rRNA associated with the GTPase-dependent steps of protein synthesis. Nucleotides 1054-1107 within this region of the Escherichia coli 23S rRNA gene were mutagenized with bisulphite. Twenty point mutations (G-->A and C-->T transitions) and...... numerous multiple mutations were generated. Expression of mutant 23S rRNAs in vivo shows that all the mutations detectably alter the phenotype, with effects ranging from a slight growth rate reduction to lack of viability. Temperature sensitivity is conferred by 1071G-->A and 1092C-->U substitutions. These...

  17. A single methyltransferase YefA (RlmCD) catalyses both m5U747 and m5U1939 modifications in Bacillus subtilis 23S rRNA

    Desmolaize, Benoit; Fabret, Céline; Brégeon, Damien;

    2011-01-01

    , YefA that is a COG2265 member. A recombinant version of YefA functions in an E. coli m(5)U-null mutant adding the same two rRNA methylations. The findings suggest that during evolution, COG2265 enzymes have undergone a series of changes in target specificity and that YefA is closer to an archetypical...

  18. Update on Pneumocystis carinii f. sp. hominis typing based on nucleotide sequence variations in internal transcribed spacer regions of rRNA genes

    Lee, C H; Helweg-Larsen, J; Tang, X; Jin, S; Li, B; Bartlett, M S; Lu, Jingquan; Lundgren, B; Lundgren, J D; Olsson, M; Lucas, Sandra; Roux, P; Cargnel, A; Atzori, C; Matos, O; Smith, J W

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the...... previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are...... named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study....

  19. Development of polymerase chain reaction primer sets for diagnosis of Lyme disease and for species-specific identification of Lyme disease isolates by 16S rRNA signature nucleotide analysis.

    1992-01-01

    We have determined and compared partial 16S rRNA sequences from 23 Lyme disease spirochete isolates and aligned these with 8 sequences previously presented. The 16S rRNA signature nucleotide compositions were defined for each isolate and compared with the genomic species signature nucleotide sets previously established. To identify positions truly indicative of species classification which could serve as targets for polymerase chain reaction species-specific identification primers, 16S rRNA-b...

  20. Single Nucleotide Polymorphism of SSU rRNA Gene among ‎Plasmodium Knowlesi Isolates of Sabah

    Fread Anderios; Daw Khin Saw Naing; Zaw Lin

    2012-01-01

    ackground: ‎The advent of PCR (Polymerase Chain Reaction) assays helped in correctly identifying ‎Plasmodium knowlesi, which was previously misdiagnosed by microscopy as Plasmodium ‎malarie in Sabah, Malaysia. The PCR-based diagnosis of P. knowlesi in Sabah is currently using a ‎set of oligonucleotide primers namely Pmk8 and Pmk9 that target one of the parasite’s small ‎subunit rRNA (SSU rRNA) genes. PCR also helped in discovering a variant form of P. malariae ‎which has a deletion of 19 bp ...

  1. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. PMID:22510214

  2. Targeting single-nucleotide polymorphisms in the 16S rRNA gene to detect and differentiate Legionella pneumophila and non-Legionella pneumophila species.

    Zhan, Xiao-Yong; Hu, Chao-Hui; Zhu, Qing-Yi

    2016-08-01

    A PCR-based method targeting single-nucleotide polymorphisms (SNPs) in the 16S rRNA gene was developed for differential identification of Legionella pneumophila and non-Legionella pneumophila. Based on the bioinformatics analysis for 176 Legionella 16S rRNA gene fragments of 56 different Legionella species, a set of SNPs, A(628)C(629) was found to be highly specific to L. pneumophila strains. A multiplex assay was designed that was able to distinguish sites with limited sequence heterogeneity between L. pneumophila and non-L. pneumophila in the targeted 16S rRNA gene. The assay amplified a 261-bp amplicon for Legionella spp. and a set of 203- and 97-bp amplicons only specific to L. pneumophila species. Among 49 ATCC strains and 284 Legionella isolates from environmental water and clinical samples, 100 % of L. pneumophila and non-L. pneumophila strains were correctly identified and differentiated by this assay. The assay presents a more rapid, sensitive and alternative method to the currently available PCR-sequencing detection and differentiation method. PMID:27112927

  3. Application of the Sequences Analysis of the 16S rRNA Gene and ITS of 16S-23S rRNA to the Systematic Study of the Genus Arthrospira and Spirulina%16S rRNA基因与16S-23S rRNA转录单元内间隔区序列分析及其在节旋藻和螺旋藻分类鉴定中的应用

    茅云翔; 杨官品; 张宝红; 张学成

    2001-01-01

    测定了节旋藻属3个品系和螺旋藻属1个品系的全长16S rRNA基因和16S-23S rRNA转录单元内间隔区序列(ITS),分析了已知的节旋藻、螺旋藻和相关品系的相应序列的同源性,构建了系统发生树,并评价了这两段DNA序列在节旋藻、螺旋藻种属分类和种质鉴定中的意义.结果表明:(1)16S rRNA基因序列和ITS序列均可用于节旋藻属和螺旋藻属的属间分类,以两序列为基础的系统学分析结果一致;(2)ITS序列变异程度高于16S rDNA序列,适用于节旋藻和螺旋藻属内品系或种质鉴定;(3)节旋藻属可明确界定,16S rRNA基因序列相似性大于98%,ITS序列相似性大于88%;(4)螺旋藻属某些品系间16S rDNA序列和ITS序列相似性较低,与不同属间的序列相似性程度为同一水平.

  4. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    Aagaard, C; Douthwaite, S

    1994-01-01

    A putative base-pairing interaction that determines the folding of the central region of 23S rRNA has been investigated by mutagenesis. Each of the possible base substitutions has been made at the phylogenetically covariant positions adenine-1262 (A1262) and U2017 in Escherichia coli 23S rRNA. Ev...

  5. Crystal structure of the Escherichia coli 23S rRNA:m5C methyltransferase RlmI (YccW) reveals evolutionary links between RNA modification enzymes

    Sunita, S; Tkaczuk, Karolina L; Purta, Elzbieta;

    2008-01-01

    Methylation is the most common RNA modification in the three domains of life. Transfer of the methyl group from S-adenosyl-l-methionine (AdoMet) to specific atoms of RNA nucleotides is catalyzed by methyltransferase (MTase) enzymes. The rRNA MTase RlmI (rRNA large subunit methyltransferase gene I......; previously known as YccW) specifically modifies Escherichia coli 23S rRNA at nucleotide C1962 to form 5-methylcytosine. Here, we report the crystal structure of RlmI refined at 2 A to a final R-factor of 0.194 (R(free)=0.242). The RlmI molecule comprises three domains: the N-terminal PUA domain; the central...

  6. Negative in vitro selection identifies the rRNA recognition motif for ErmE methyltransferase

    Nielsen, A K; Douthwaite, S; Vester, B

    1999-01-01

    the adjacent single-stranded region around A2058. An RNA transcript of 72 nt that displays this motif functions as an efficient substrate for the ErmE methyltransferase. Pools of degenerate RNAs were formed by doping 34-nt positions that extend over and beyond the putative Erm recognition motif within...... contained substitutions at single sites, and these are confined to 12 nucleotide positions. These nucleotides, corresponding to A2051-A2060, C2611, and A2614 in 23S rRNA, presumably comprise the RNA recognition motif for ErmE methyltransferase. The structure formed by these nucleotides is highly conserved...

  7. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan

    Martínez, Allyson K.; GORDON, EMILY; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M.; Benedik, Michael J.; Yanofsky, Charles; Mankin, Alexander S.; Vazquez-Laslop, Nora; Sachs, Matthew S.; Cruz-Vera, Luis R.

    2013-01-01

    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome’s ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the con...

  8. Phylogenetic relationships of Salmonella based on rRNA sequences

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

  9. Renibacterium salmoninarum isolates from different sources possess two highly conserved copies of the rRNA operon .

    Grayson, T H; Alexander, S M; Cooper, L F; Gilpin, M L

    2000-07-01

    The nucleotide sequences of the rRNA genes and the 5' flanking region were determined for R. salmoninarum ATCC 33209T from overlapping products generated by PCR amplification from the genomic DNA. Comparison of the sequences with rRNA genes from a variety of bacteria demonstrated the close relatedness between R. salmoninarum and the high G+C group of the actinobacteria, in particular, Arthrobacter species. A regulatory element within the 5' leader of the rRNA operon was identical to an element, CL2, described for mycobacteria. PCR, DNA sequence analysis, and DNA hybridisation were performed to examine variation between isolates from diverse sources which represented the four 16S-23S rRNA intergenic spacer sequevars previously described for R. salmoninarum. Two 23S-5S rRNA intergenic spacer sequevars of identical length were found. DNA hybridisation using probes complementary to 23S rDNA and 16S rDNA identified two rRNA operons which were identical or nearly identical amongst 40 isolates sourced from a variety of countries. PMID:11016696

  10. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A

    2013-01-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show – using proteomic analysis and dual fluorescence reporter in vivo assays – that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requi...

  11. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repeti...

  12. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

    2013-11-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  13. Modified nucleotides m(2)G966/m(5)C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon.

    Prokhorova, Irina V; Osterman, Ilya A; Burakovsky, Dmitry E; Serebryakova, Marina V; Galyamina, Maria A; Pobeguts, Olga V; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G; Govorun, Vadim M; Bogdanov, Alexey A; Sergiev, Petr V; Dontsova, Olga A

    2013-01-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show--using proteomic analysis and dual fluorescence reporter in vivo assays--that m(2)G966 and m(5)C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m(2)G966 and m(5)C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon. PMID:24241179

  14. Complementary Roles of Yeast Rad4p and Rad34p in Nucleotide Excision Repair of Active and Inactive rRNA Gene Chromatin▿

    Tremblay, Maxime; Teng, Yumin; Paquette, Michel; Waters, Raymond; Conconi, Antonio

    2008-01-01

    Nucleotide excision repair (NER) removes a plethora of DNA lesions. It is performed by a large multisubunit protein complex that finds and repairs damaged DNA in different chromatin contexts and nuclear domains. The nucleolus is the most transcriptionally active domain, and in yeast, transcription-coupled NER occurs in RNA polymerase I-transcribed genes (rDNA). Here we have analyzed the roles of two members of the xeroderma pigmentosum group C family of proteins, Rad4p and Rad34p, during NER ...

  15. Isolation and Characterization of Lactococcus garvieae from Diseased Rainbow Trout (Oncorhynchus mykiss, Walbaum Cultured in Northern Iran Based on the Nucleotide Sequences of the 16s rRNA Gene

    Milad ADEL

    2014-08-01

    Full Text Available This study was done to determine the molecular and biochemical identification of some causative agents of lactococcosis in farmed rainbow trout in Mazandaran provenience (northern Iran. A total of 200 moribund rainbow trout, suspected of lactococcosis from 10 rainbow trout farms in Mazandaran province, were collected during spring 2012 to winter 2012. Sampling was done from the kidney, spleen, liver and brain and cultured aseptically onto brain heart infusion (BHI agar plates and incubated at 25 °C for 24 - 48 h. Results of bacteriological cultures of these organs showed 19 % Lactococcus garvieae (38 fish, 9 % Streptococcus spp., (18 fish, 17 % Yersinia spp. (36 fish, and 55 % of fish were culture negative. The PCR assay was developed based on the 16s rRNA gene of L. garvieae for the rapid and specific detection and identification of this pathogen from different sources. Two pairs of primers were designed based on the nucleotide sequences of the 16s rRNA gene of L. garvieae. After PCR assay on isolated bacterial colonies, DNAs extracted from 38 L. garvieae gave the expected 1107 bp PCR fragment of 16S rDNA sequences, which is specific for L. garvieae. The results of this study suggest the use of molecular methods along with current biochemical methods are effective diagnostic tools in the identification of L. garvieae. The combination of these methods for diagnosis of other bacterial disease is recommended.

  16. Specificity shifts in the rRNA and tRNA nucleotide targets of archaeal and bacterial m5U methyltransferases

    Auxilien, Sylvie; Rasmussen, Anette; Rose, Simon;

    2011-01-01

    Methyltransferase enzymes that use S-adenosylmethionine as a cofactor to catalyze 5-methyl uridine (m(5)U) formation in tRNAs and rRNAs are widespread in Bacteria and Eukaryota, but are restricted to the Thermococcales and Nanoarchaeota groups amongst the Archaea. The RNA m(5)U methyltransferases...... appear to have arisen in Bacteria and were then dispersed by horizontal transfer of an rlmD-type gene to the Archaea and Eukaryota. The bacterium Escherichia coli has three gene paralogs and these encode the methyltransferases TrmA that targets m(5)U54 in tRNAs, RlmC (formerly RumB) that modifies m(5)U......, however, neither of the two P. abyssi enzymes displays RlmD-like activity in vitro. PAB0719 acts in a TrmA-like manner to catalyze m(5)U54 methylation in P. abyssi tRNAs, and here we show that PAB0760 possesses RlmC-like activity and specifically methylates the nucleotide equivalent to U747 in P. abyssi...

  17. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan.

    Martínez, Allyson K; Gordon, Emily; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M; Benedik, Michael J; Yanofsky, Charles; Mankin, Alexander S; Vazquez-Laslop, Nora; Sachs, Matthew S; Cruz-Vera, Luis R

    2014-01-01

    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome's ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the concentration dependence of L-Trp-mediated tna operon induction, whereas the TnaC I19L change suppresses this phenotype, restoring the sensitivity of the translating A2058U mutant ribosome to free L-Trp. These findings suggest that interactions between TnaC residue I19 and 23S rRNA nucleotide A2058 contribute to the creation of a regulatory L-Trp binding site within the translating ribosome. PMID:24137004

  18. Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli 23S ribosomal RNA

    Douthwaite, S

    1992-01-01

    Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli ribosomes has been compared by chemical footprinting. The protection afforded by both drugs is limited to the peptidyl transferase loop of 23S rRNA. Under conditions of stoichiometric binding at 1 mM drug concentration...... in vitro, both drugs strongly protect 23S rRNA bases A2058 and A2451 from dimethyl sulphate and G2505 from kethoxal modification; G2061 is also weakly protected from kethoxal. The modification patterns differ in that A2059 is additionally protected by clindamycin but not by lincomycin. The affinity...... of the two drugs for the ribosome, estimated by footprinting, is approximately the same, giving Kdiss values of 5 microM for lincomycin and 8 microM for clindamycin. The results show that in vitro the drugs are equally potent in blocking their ribosomal target site. Their inhibitory effects on...

  19. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    Triman, K; Becker, E; Dammel, C;

    1989-01-01

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alle...

  20. Mutations in 23S rRNA Confer Resistance against Azithromycin in Pseudomonas aeruginosa

    Marvig, Rasmus Lykke; Søndergaard, Mette S. R.; Pedersen, Søren Damkiær;

    2012-01-01

    The emergence of antibiotic-resistant Pseudomonas aeruginosa is an important concern in the treatment of long-term airway infections in cystic fibrosis patients. In this study, we report the occurrence of azithromycin resistance among clinical P. aeruginosa DK2 isolates. We demonstrate that...

  1. Amplification and direct sequence analysis of the 23S rRNA gene from thermophilic bacteria

    Ibrahim, Ashraf; Hofman-Bang, H. Jacob Peider; Ahring, Birgitte Kiær

    2001-01-01

    We present a simplified and fast method to obtain high-quality sequences directly from PCRs without the traditional gel purification. We also report on an improved method to obtain sequence-quality PCR products from microorganisms that are difficult to lyse with no need for DNA extraction. The...

  2. Identification of the methyltransferase targeting C2499 in Deinococcus radiodurans 23S ribosomal RNA

    Nielsen, Julie Mundus; Flyvbjerg, Karen Freund; Kirpekar, Finn

    2016-01-01

    The bacterium Deinococcus radiodurans-like all other organisms-introduces nucleotide modifications into its ribosomal RNA. We have previously found that the bacterium contains a Carbon-5 methylation on cytidine 2499 of its 23S ribosomal RNA, which is so far the only modified version of cytidine 2...

  3. Primary and secondary structures of Tetrahymena and aphid 5.8S rRNAs: structural features of 5.8S rRNA which interacts with the 28S rRNA containing the hidden break.

    Fujiwara, H.; H. Ishikawa

    1982-01-01

    The Tetrahymena 5.8S rRNA is 154 nucleotides long, the shortest so far reported except for the split 5.8S rRNAs of Diptera (m5.8S plus 2S rRNA). In this molecule several nucleotides are deleted in the helix e (GC-rich stem) region. Upon constructing the secondary structure in accordance with "burp-gun" model, the Tetrahymena 5.8S rRNA forms a wide-open "muzzle" of the terminal regions due to both extra nucleotides and several unpaired bases. The aphid 5.8S rRNA consists of 161 nucleotides and...

  4. Nucleotide Metabolism

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  5. EmtA, a rRNA methyltransferase conferring high-level evernimicin resistance

    Mann, P. A.; Xiong, L.; Mankin, A. S.; Chau, A. S.; Najarian, D. J.; Mendrick, C. A.; Cramer, C. A.; Aarestrup, Frank Møller; Hare, R. S.; Black, T. A.; McNicholas, P. M.

    2001-01-01

    unique to the 23S rRNA extracted from resistant ribosomes. The pause corresponded to methylation of residue G2470 (Escherichia coli numbering). RNA footprinting revealed that G2470 is located within the evernimicin-binding site on the ribosome, thus providing an explanation for the reduced binding of the...

  6. rRNA fragmentation induced by a yeast killer toxin.

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  7. Rapid Identification and Differentiation of the Soft Rot Erwinias by 16S-23S Intergenic Transcribed Spacer-PCR and Restriction Fragment Length Polymorphism Analyses

    Toth, I. K.; Avrova, A. O.; Hyman, L. J.

    2001-01-01

    Current identification methods for the soft rot erwinias are both imprecise and time-consuming. We have used the 16S-23S rRNA intergenic transcribed spacer (ITS) to aid in their identification. Analysis by ITS-PCR and ITS-restriction fragment length polymorphism was found to be a simple, precise, and rapid method compared to current molecular and phenotypic techniques. The ITS was amplified from Erwinia and other genera using universal PCR primers. After PCR, the banding patterns generated al...

  8. Mutations in the 16S rRNA Genes of Helicobacter pylori Mediate Resistance to Tetracycline

    Trieber, Catharine A.; Taylor, Diane E.

    2002-01-01

    Low-cost and rescue treatments for Helicobacter pylori infections involve combinations of several drugs including tetracycline. Resistance to tetracycline has recently emerged in H. pylori. The 16S rRNA gene sequences of two tetracycline-resistant clinical isolates (MIC = 64 μg/ml) were determined and compared to the consensus H. pylori 16S rRNA sequence. One isolate had four nucleotide substitutions, and the other had four substitutions and two deletions. Natural transformation with the 16S ...

  9. 16S rRNA Mutation Associated with Tetracycline Resistance in a Gram-Positive Bacterium

    Ross, Jeremy I.; Eady, E Anne; Cove, Jonathan H.; Cunliffe, William J.

    1998-01-01

    A genetic basis for tetracycline resistance in cutaneous propionibacteria was suggested by comparing the nucleotide sequences of the 16S rRNA genes from 16 susceptible and 21 resistant clinical isolates and 6 laboratory-selected tetracycline-resistant mutants of a susceptible strain. Fifteen clinical isolates resistant to tetracycline were found to have cytosine instead of guanine at a position cognate with Escherichia coli 16S rRNA base 1058 in a region important for peptide chain terminatio...

  10. Primary and secondary structure of 5.8S rRNA from the silkgland of Bombyx mori.

    Fujiwara, H.; Kawata, Y.; H. Ishikawa

    1982-01-01

    Nucleotide sequence of 5.8S rRNA of the silkworm, Bombyx mori has been determined by gel sequencing methods. The 5.8S rRNA was the longest so far reported, with the 5'-terminal sequence several nucleotides longer than those of the other organisms. Upon constructing the secondary structure in accordance with the "burp gun" model (12), the Bombyx 5.8S rRNA formed a wide-open "muzzle" due to several unpaired bases at the ends. The overall structure also appeared less stable with less G . C pairs...

  11. Purification, crystallization and preliminary X-ray crystallographic analysis of 23S RNA m2G2445 methyltransferase RlmL from Escherichia coli

    RlmL, a 23S rRNA m2G2445 methyltransferase from Escherichia coli, was expressed, purified and crystallized, and crystals diffracted to 2.2 Å. The RlmL (YcbY) protein in Escherichia coli is an rRNA methyltransferase that is specific for m2G2445 modification of 23S RNA. The rlmL gene was cloned into the expression vector pET28a and expressed in the host E. coli strain BL21 (DE3). Recombinant protein with a six-histidine tag was purified by Ni2+-affinity chromatography followed by gel filtration. Crystals were grown using the hanging-drop vapour-diffusion method and a detergent was used as an additive to improve diffraction quality. The final crystals diffracted to 2.2 Å resolution. The crystals belonged to space group P21, with unit-cell parameters a = 73.6, b = 140.8, c = 102.9 Å, β = 102.3°. The crystal has a most probable solvent content of 62.8% with two molecules in the asymmetric unit

  12. Higher-order structure in the 3'-terminal domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus

    Garrett, R A; Christensen, A; Douthwaite, S

    1984-01-01

    ribonuclease from Naja naja oxiana, and the relatively unstructured and accessible sequences were detected with the single-strand-specific ribonucleases A, T1 and T2. The data enabled the three secondary structural models, proposed for the E. coli 23 S RNAs, to be examined critically and it was concluded that......An experimental approach was used to determine, and compare, the higher-order structure within domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus. This domain, which encompasses approximately 300 nucleotides at the 3' end of the RNAs, consists of two large...... ribosomes of flowering plants. The structure of domain VI within the eubacterial RNAs was probed with chemical reagents in order to establish the degree of stacking and/or accessibility of each adenosine, cytidine and guanosine residue; the double-helical segments were localized with the cobra venom...

  13. The use of 16S and 16S-23S rDNA to easily detect and differentiate common Gram-negative orchard epiphytes.

    Jeng, R S; Svircev, A M; Myers, A L; Beliaeva, L; Hunter, D M; Hubbes, M

    2001-02-01

    The identification of Gram-negative pathogenic and non-pathogenic bacteria commonly isolated from an orchard phylloplane may result in a time consuming and tedious process for the plant pathologist. The paper provides a simple "one-step" protocol that uses the polymerase chain reaction (PCR) to amplify intergenic spacer regions between 16S and 23S genes and a portion of 16S gene in the prokaryotic rRNA genetic loci. Amplified 16S rDNA, and restriction fragment length polymorphisms (RFLP) following EcoRI digestion produced band patterns that readily distinguished between the plant pathogen Erwinia amylovora (causal agent of fire blight in pear and apple) and the orchard epiphyte Pantoea agglomerans (formerly E. herbicola). The amplified DNA patterns of 16S-23S spacer regions may be used to differentiate E. amylovora at the intraspecies level. Isolates of E. amylovora obtained from raspberries exhibited two major fragments while those obtained from apples showed three distinct amplified DNA bands. In addition, the size of the 16S-23S spacer region differs between Pseudomonas syringae and Pseudomonas fluorescens. The RFLP pattern generated by HaeIII digestion may be used to provide a rapid and accurate identification of these two common orchard epiphytes. PMID:11166101

  14. Interaction of the tylosin-resistance methyltransferase RlmA II at its rRNA target differs from the orthologue RlmA I

    Douthwaite, Stephen; Jakobsen, Lene; Yoshizawa, Satoko;

    2008-01-01

    footprint contacts with nucleotides in stem-loops 33, 34 and 35, and does not interact elsewhere in the rRNA. Binding of RlmA(II) to the rRNA is dependent on the cofactor S-adenosylmethionine (or S-adenosylhomocysteine). RlmA(II) interacts with the same rRNA region as the orthologous enzyme RlmA(I) that...

  15. Mutations in conserved helix 69 of 23S rRNA of Thermus thermophilus that affect capreomycin resistance but not posttranscriptional modifications

    Monshupanee, Tanakarn; Gregory, Steven T; Douthwaite, Stephen; Chungjatupornchai, Wipa; Dahlberg, Albert E

    2008-01-01

    Translocation during the elongation phase of protein synthesis involves the relative movement of the 30S and 50S ribosomal subunits. This movement is the target of tuberactinomycin antibiotics. Here, we describe the isolation and characterization of mutants of Thermus thermophilus selected for...

  16. Length polymorphisms for intergenic spacer regions of 16S-23S rDNA in members of the new hydrogen-producing bacteria

    2007-01-01

    A method based on PCR amplification of the 16S rRNA gene (rDNA) -23S rDNA intergenic spacer regions (ISR) was developed for the identification of species within the novel group hydrogen-producing anaerobes. The sizes of the PCR products varied from 1264 to 398 bp. Strain of isolate Rennanqilyf 3 was characterized as having products of 1262, 398, 638, 437 and 436 bp. The isolate Rennanqilyf 1 had product of 1264 bp. The isolate Rennanqilyf 13 had products of 1261, 579 and 485 bp. Of the 3 species of the novel group hydrogenproducing anaerobes examined, no one was indistinguishable. Two environmental isolates were identified as hydrogen-producing bacteria, which were new species in present taxon. Rennanqilyf 3 could not be associated With any Clostridium sp. Studied. Rennanqilyf 1 could be classified into Clostridium genus. The combination between 16S rDNA equencing and length polymorphisms of IRS in 16S-23S rDNA is a better method for determining species of the hydrogen-producing bacteria.

  17. A nested array of rRNA targeted probes for the detection and identification of enterococci by reverse hybridization.

    Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W

    2000-12-01

    Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants. PMID:11249027

  18. Altered features in the secondary structure of Vicia faba 5.8s rRNA.

    Nazar, R N; Wildeman, A G

    1981-01-01

    We have re-examined the nucleotide sequence of Vicia faba (broad bean) 5.8S rRNA using partial chemical degradation and a new approach to high temperature (65-80 degrees C) sequencing gels. The results indicate that the secondary structure was not completely disrupted in previous studies (Tanaka, Y., Dyer, T.A. and Brownlee, G.G. (1980) Nucleic Acid Res. 8, 1259-1272) and explain ambiguities between the nucleotide sequence and T1 ribonuclease digests. Despite this revision, estimates in the s...

  19. (e, 3e) differential cross section of He (21s) and He (23s)

    The angular distribution of the five-fold differential cross section for the electron impact double ionization of He (21s) and He (23s) has been studied. The kinematical conditions for maxima/minima in the angular distribution for the two cases have been compared. The two-step process for the double ionization is found to contribute very little in the triplet case. (author)

  20. Piperidine nucleosides and nucleotides

    Kovačková, Soňa; Dračínský, Martin; Rosenberg, Ivan; Rejman, Dominik

    Lyon : Université de Lyon, 2010, s. 315-316. [International Roundtable on Nucleosides, Nucleotides and Nucleic Acids. IRT 2010. Lyon (FR), 29.08.2010-03.09.2010] Institutional research plan: CEZ:AV0Z40550506 Keywords : phosphonate analogs * piperidine nucleosides * piperidine nucleotides Subject RIV: CC - Organic Chemistry http://irt2010.univ-lyon1.fr

  1. 16s-23S rDNA: polymorphisms and their use for detection and identification of Xylella fastidiosa strains 16S-23S rDNA: polimorfismos e sua aplicação na detecção e identificação de linhagens de Xylella fastidiosa

    Juliana Camargo Martinati

    2007-03-01

    Full Text Available Strains of Xylella fastidiosa from several hosts (coffee, citrus, grape, almond, oleander, peach, plum, etc. were characterized by analyzing the content of the nucleotide sequences of 16S-23S rDNA (coding for a small subunit ribosomal RNA spacer region (ITS. Current methods for sequencing the ITS region yields partial sequences that do not contribute with significant information. According to this fact, new primers have been designed in order to obtain a complete sequence and facilitate the sequencing. The complete 16S-23S sequences from 08 strains were amplified through PCR using the primers designed in our lab. The 16S-23S sequences obtained were compared with 52 others sequences entries in GenBank database. The results revealed a higher level of variation than that found in 16S gene sequences, with similarity values ranging from 0.79-1.00. The dendogram based on similarity data revealed 5 main groups. This spacer sequence contains two genes for tRNA (tRNAala and tRNAile. The sequence analysis of the tRNA content showed a conserved region with a few differences in the nucleotide composition.Linhagens de Xylella fastidiosa de diferentes hospedeiros (café, uva, amêndoa, ameixa, etc. foram caracterizados analisando as sequências de nucleotídeos do espaço intergênico 16S-23S (ITS. Os métodos atuais para o sequenciamento da região ITS produzem fragmentos parciais das sequências que não contribuem com informações significantes. Em vista disso, novos primers foram desenhados a fim de obter uma sequência completa e facilitar o sequenciamento. A sequencia completa da região ITS de 08 linhagens de X. Fastidiosa foram amplificadas via PCR, sequenciadas e comparadas com outras 52 sequencias depositadas no GenBank. Os resultados revelaram um alto nível de variação sendo maior que os níveis encontrados quando se utiliza o gene 16S para este tipo de análise, com valores variando entre 0.79 a 1.00. O dendograma baseado em dados de

  2. Lifetime of the metastable 23S1 state in stored Li+ ions

    A laser-induced fluorescence technique combined with the observation of spontaneous magnetic dipole photons from the highly metastable 23S1 state of Li+ was used to measure the radiative lifetime of this state. The ions are created by electron impact on a lithium atomic beam and are subsequently stored for periods of many seconds in an RF-quadrupole ion trap. A tunable dye laser excites the 23S--23P, transition at 5485A, and the intercombination electric dipole transition 23P1--1 1S0 at 202A is observed. This process depletes the metastable population in a time tau/sub d/ 3S1/ and provides a measure of the total number of metastables. Comparison with the rate of 210A spontaneously emitted photons yields a measured value for the 23S1 radiative lifetime of tau/sub rad/ = 58.6 +- 12.9 sec, where the quoted error represents 95% confidence levels. The theoretical lifetime is tau/sub theory/ = 49.0 sec. The measured value includes data taken with both 6Li+ and 7Li+ isotopes and was corrected for the slightly different detector efficiencies at 202A and 210A. A careful study of nonradiative quenching of the metastable state was necessary to understand observed differences between tau/sub rad/ and tau/sub 3S1/, the total metastable lifetime. Spatial density profiles of the ions within the trap, useful for determining the ion temperature, were obtained by scanning the laser beam horizontally across the ion trap while storing 23P1--1S0 photon counts as a function of the laser beam's position. Agreement with a simple equilibrium model, including space charge effects, is satisfactory. A study of the optical pumping process is necessary to understand the laser-ion interaction, and observational and theoretical data are presented. 47 references

  3. Main: Nucleotide Analysis [KOME

    Full Text Available Nucleotide Analysis GenBank blastx search ... result Result of blastx search ... against GenBank amino a ... cid sequence kome_genbank_blastx_search _result.zip kome_genbank_blastx_search _result ...

  4. Main: Nucleotide Analysis [KOME

    Full Text Available Nucleotide Analysis GenBank blastn search ... result Result of blastn search ... against GenBank nucleot ... ide sequence kome_genbank_blastn_search _result.zip kome_genbank_blastn_search _result ...

  5. Main: Nucleotide Analysis [KOME

    Full Text Available Nucleotide Analysis PLACE search result Result of signal search against PLACE : cis-acting regul ... atory DNA elements Database ... kome_place_search_result.zip kome_place_search_res ...

  6. Main: Nucleotide Analysis [KOME

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against japonica genome... sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  7. Main: Nucleotide Analysis [KOME

    Full Text Available Nucleotide Analysis Indica genome blast search result Result of blastn search against Indica genome... sequence (top hit only) kome_indica_genome_blast_search_result.zip kome_indica_genome_blast_search_result ...

  8. Nucleotide diversity in gorillas.

    Yu, Ning; Jensen-Seaman, Michael I.; Chemnick, Leona; Ryder, Oliver; Li, Wen-Hsiung

    2004-01-01

    Comparison of the levels of nucleotide diversity in humans and apes may provide valuable information for inferring the demographic history of these species, the effect of social structure on genetic diversity, patterns of past migration, and signatures of past selection events. Previous DNA sequence data from both the mitochondrial and the nuclear genomes suggested a much higher level of nucleotide diversity in the African apes than in humans. Noting that the nuclear DNA data from the apes we...

  9. Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

    Dron, M; Rahire, M; Rochaix, J D

    1982-01-01

    The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stre...

  10. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  11. Precise determination of the magnetic moment of helium in its 23S1 metastable state

    The electronic magnetic moment of helium was measured by the atomic beam magnetic resonance method using separated oscillating fields. Actually, the magnetic moment of helium relative to that of rubidium was measured. The result was combined with the ratio g/sub J/(Rb)/g/sub J/(H) to get R = g/sub J/(He, 23S1)/g/sub J/(H,2S/sub 1/2/) = 1 - (23.19 +- 0.1) x 10-6. The motivation for this Zeeman measurement was to provide as sensitive a test of the theory of atomic magnetism for a multielectron atom as possible. In particular, the experiment provides a test of the relativistic corrections to the Zeeman effect. The experiment also tests the additivity of the radiative corrections to the magnetic moments of the two electrons. Another motivation concerns the determination of the fine structure constant α from measurements of the 23P fine structure intervals of 4He; namely, the understanding of the 23S states contributes to the knowledge of the theoretical expressions for the 23P intervals. For the chosen magnetic field of 9.5 kG, the helium resonance frequency was 26.8 GHz, the rubidium frequency, 26.4 GHz. The linewidth associated with the microwave double loop was 25 KHz. Thus it was necessary to pick the resonance line centers to only 1 part in 10 to achieve a 0.1 ppM accuracy. This result is in excellent agreement with the latest theoretical value, R = 1 - 23.21 x 10-6; and with earlier, less precise atomic beam measurements; and with the latest, comparably accurate optical pumping value. Many possible sources of error were investigated. The quoted error is based on analysis of residual systematic effects

  12. Piperidine nucleosides and nucleotides

    Kovačková, Soňa; Pačes, Ondřej; Dračínský, Martin; Rosenberg, Ivan; Rejman, Dominik

    Manchester : University of Manchester, 2009. s. 50-50. [Nucleic Acids at the Chemistry - Biology Interface. 07.09.2009-08.09.2009, Manchester] R&D Projects: GA MZd NR9138; GA MŠk 2B06065 Institutional research plan: CEZ:AV0Z40550506 Keywords : phosphonate * piperidine nucleosides * nucleotides Subject RIV: CC - Organic Chemistry

  13. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    Recht, M I; Douthwaite, S; Dahlquist, K D;

    1999-01-01

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  14. Designing PCR Primers from 16S-23S rDNA Intergenic Spacer Region for the Identification of Pasteurella multocida%以 16S-23S rDNA 间区序列为目的基因设计 PCR 引物鉴定多杀巴斯德氏菌

    周浩; 刘寅; 陈一军; 郑泽军; 黄熙泰

    2008-01-01

    多杀巴斯德氏菌是养殖动物(鸡,猪,牛等)的重要致病菌.本研究以16S-23S rDNA间区序列为目的基因设计PCR引物鉴定多杀巴斯德氏菌.通过对多杀巴斯德氏菌ITS-IA(含有tDNA-Ile和tDNA-Ala的16S-23S rDNA间区序列)的测序和与GenBank中序列的BLAST,设计筛选了一对特异引物PS-F/PS-R.对引物的特异性和有效性,用PCR方法进行了验证.结果表明:所有的多杀巴斯德氏菌标准菌株和分离菌株都能被检出,而全部39株非多杀巴斯德氏菌都没有扩增出特异性条带.其检测灵敏度能达到102CFU/mL.研究结果表明,发展了的PCR鉴定方法是省时的和可靠的,整个过程只需要20 h,而传统的鉴定方法需要至少5 d的时间.%Pasteurella multocida is an important pathogen that infects many kinds of animals. In present study, a polymerase chain reaction (PCR) assay using primers derived from the 16S-23S rRNA intergenic spacer (ITS) of P. multocida was developed. One pairs of specific PCR primers were designed by sequencing the ITS-IA (ITS containing tDNA-Ile and tDNA-Ala) of P. multocida and BLAST of GenBank. The specificity and efficiency of the PCR methods were tested against a panel of numerous strains from 39 different bacterial strains. All of the P. multocida strains generated positive signal, and no cross-reaction was observed with non-P, multocida strains in the PCR detection. Sensitivity of the detection is 102 CFU/mL cultures. The newly developed PCR array procedures take only 20 hours for each time, whereas the conventional methods required at least five days. This study demonstrated that the PCR detection for P. multocida is time-saved and reliable.

  15. Interaction potentials and energy transfer cross sections for collisions of metastable helium and neon I: He (23S) + Ne

    Differential cross sections have been measured for He(23S) + Ne at kinetic energies between 28 and 370 meV. For energies above 90 meV the elastic cross sections show Stueckelberg oscillations from curve crossings, which lead to the energy exchange process: He(23S) + Ne → He(11S) + Ne(2p54s,3d,4p). Differential cross sections for this inelastic process could be measured above 200 meV. A fit to the data gives the potentials for He(23S) + Ne and, less accurately, for He + Nesup(*). These results offer a simple explanation, why the exothermic pumping process of the infrared lines of the HeNe laser has a threshold of about 80 meV and a small cross section. (orig.)

  16. Expanded versions of the 16S and 23S ribosomal RNA mutation databases (16SMDBexp and 23SMDBexp)

    Triman, K L; Peister, A; R. A. Goel

    1998-01-01

    Expanded versions of the Ribosomal RNA Mutation Databases provide lists of mutated positions in 16S and 16S-like ribosomal RNA (16SMDBexp) and 23S and 23S-like ribosomal RNA (23SMDBexp) and the identity of each alteration. Alterations from organisms other than Escherichia coli are reported at positions according to the E.coli numbering system. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation, (ii) whether a mutant pheno...

  17. Piperidine nucleosides and nucleotides

    Kovačková, Soňa; Pačes, Ondřej; Dračínský, Martin; Rosenberg, Ivan; Rejman, Dominik

    -, č. 52 (2008), s. 587-587. ISSN 0261-3166. [Joint Symposium of the International Roundtable on Nucleosides, Nucleotides and Nucleic Acids /18./ and the International Symposium on Nucleic Acid Chemistry /35./. Kyoto, 08.09.2008-12.09.2008] R&D Projects: GA MŠk(CZ) LC06077; GA MŠk 2B06065; GA MŠk LC512 Grant ostatní: GA MZd(CZ) NR9138 Institutional research plan: CEZ:AV0Z40550506 Keywords : piperidine * nucleosidation * phosphonate Subject RIV: CC - Organic Chemistry

  18. Single Nucleotide Polymorphism

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg;

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification and...... briefly describe the methods that are preferred for SNP typing in forensic genetics. In addition, we will illustrate how SNPs can be used as investigative leads in the police investigation by discussing the use of ancestry informative markers and forensic DNA phenotyping. Modern DNA sequencing...

  19. Template polymerization of nucleotide analogues

    Orgel, L. E.

    1991-01-01

    Recent work on the template-directed reactions of the natural D-nucleotides has made it clear that l-nucleotides and nucleotide-like derivatives of other sugars would strongly inhibit the formation of long oligonucleotides. Consequently, attention is focusing on molecules simpler than nucleotides that might have acted as monomers of an information transfer system. We have begun a general exploration of the template directed reactions of diverse peptide analogues. I will present work by Dr. Taifeng Wu on oxidative oligomerization of phosphorothioates and of Dr. Mary Tohidi on the cyclic polymerization of nucleoside and related cyclic pyrophosphates.

  20. Downregulation of rRNA Transcription Triggers Cell Differentiation

    Yuki Hayashi; Takao Kuroda; Hiroyuki Kishimoto; Changshan Wang; Atsushi Iwama; Keiji Kimura

    2014-01-01

    Responding to various stimuli is indispensable for the maintenance of homeostasis. The downregulation of ribosomal RNA (rRNA) transcription is one of the mechanisms involved in the response to stimuli by various cellular processes, such as cell cycle arrest and apoptosis. Cell differentiation is caused by intra- and extracellular stimuli and is associated with the downregulation of rRNA transcription as well as reduced cell growth. The downregulation of rRNA transcription during differentiati...

  1. Interconversion of active and inactive 30 S ribosomal subunits is accompanied by a conformational change in the decoding region of 16 S rRNA

    Moazed, D; Van Stolk, B J; Douthwaite, S;

    1986-01-01

    Zamir, Elson and their co-workers have shown that 30 S ribosomal subunits are reversibly inactivated by depletion of monovalent or divalent cations. We have re-investigated the conformation of 16 S rRNA in the active and inactive forms of the 30 S subunit, using a strategy that is designed......' regions of 16 S rRNA. The inactive form also shows significantly decreased reactivity at positions 1533 to 1538 (the Shine-Dalgarno region), in agreement with earlier findings. The principal changes in reactivity involve the universally conserved nucleotides G926, C1395, A1398 and G1401. The three purines...

  2. The arabidopsis cyclic nucleotide interactome

    Donaldson, Lara

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  3. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Nathan D. Olson

    2015-03-01

    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  4. The complete nucleotide sequence of a 16S ribosomal RNA gene from a blue-green alga, Anacystis nidulans.

    Tomioka, N; Sugiura, M

    1983-01-01

    The complete nucleotide sequence of a 16S ribosomal RNA gene from a blue-green alga, Anacystis nidulans, has been determined. Its coding region is estimated to be 1,487 base pairs long, which is nearly identical to those reported for chloroplast 16S rRNA genes and is about 4% shorter than that of the Escherichia coli gene. The 16S rRNA sequence of A. nidulans has 83% homology with that of tobacco chloroplast and 74% homology with that of E. coli. Possible stem and loop structures of A. nidulans 16S rRNA sequences resemble more closely those of chloroplast 16S rRNAs than those of E. coli 16S rRNA. These observations support the endosymbiotic theory of chloroplast origin. PMID:6412038

  5. Downregulation of rRNA transcription triggers cell differentiation.

    Yuki Hayashi

    Full Text Available Responding to various stimuli is indispensable for the maintenance of homeostasis. The downregulation of ribosomal RNA (rRNA transcription is one of the mechanisms involved in the response to stimuli by various cellular processes, such as cell cycle arrest and apoptosis. Cell differentiation is caused by intra- and extracellular stimuli and is associated with the downregulation of rRNA transcription as well as reduced cell growth. The downregulation of rRNA transcription during differentiation is considered to contribute to reduced cell growth. However, the downregulation of rRNA transcription can induce various cellular processes; therefore, it may positively regulate cell differentiation. To test this possibility, we specifically downregulated rRNA transcription using actinomycin D or a siRNA for Pol I-specific transcription factor IA (TIF-IA in HL-60 and THP-1 cells, both of which have differentiation potential. The inhibition of rRNA transcription induced cell differentiation in both cell lines, which was demonstrated by the expression of the common differentiation marker CD11b. Furthermore, TIF-IA knockdown in an ex vivo culture of mouse hematopoietic stem cells increased the percentage of myeloid cells and reduced the percentage of immature cells. We also evaluated whether differentiation was induced via the inhibition of cell cycle progression because rRNA transcription is tightly coupled to cell growth. We found that cell cycle arrest without affecting rRNA transcription did not induce differentiation. To the best of our knowledge, our results demonstrate the first time that the downregulation of rRNA levels could be a trigger for the induction of differentiation in mammalian cells. Furthermore, this phenomenon was not simply a reflection of cell cycle arrest. Our results provide a novel insight into the relationship between rRNA transcription and cell differentiation.

  6. High-throughput nucleotide sequence analysis of diverse bacterial communities in leachates of decomposing pig carcasses

    Seung Hak Yang; Joung Soo Lim; Modabber Ahmed Khan; Bong Soo Kim; Dong Yoon Choi; Eun Young Lee; Hee Kwon Ahn

    2015-01-01

    The leachate generated by the decomposition of animal carcass has been implicated as an environmental contaminant surrounding the burial site. High-throughput nucleotide sequencing was conducted to investigate the bacterial communities in leachates from the decomposition of pig carcasses. We acquired 51,230 reads from six different samples (1, 2, 3, 4, 6 and 14 week-old carcasses) and found that sequences representing the phylum Firmicutes predominated. The diversity of bacterial 16S rRNA gen...

  7. The Identification of Discriminating Patterns from 16S rRNA Gene to Generate Signature for Bacillus Genus.

    More, Ravi P; Purohit, Hemant J

    2016-08-01

    The 16S ribosomal RNA (16S rRNA) gene has been widely used for the taxonomic classification of bacteria. A molecular signature is a set of nucleotide patterns, which constitute a regular expression that is specific to each particular taxon. Our main goal was to identify discriminating nucleotide patterns in 16S rRNA gene and then to generate signatures for taxonomic classification. To demonstrate our approach, we used the phylum Firmicutes as a model using representative taxa Bacilli (class), Bacillales (order), Bacillaceae (family), and Bacillus (genus), according to their dominance at each hierarchical taxonomic level. We applied combined composite vector and multiple sequence alignment approaches to generate gene-specific signatures. Further, we mapped all the patterns into the different hypervariable regions of 16S rRNA gene and confirmed the most appropriate distinguishing region as V3-V4 for targeted taxa. We also examined the evolution in discriminating patterns of signatures across taxonomic levels. We assessed the comparative classification accuracy of signatures with other methods (i.e., RDP Classifier, KNN, and SINA). Results revealed that the signatures for taxa Bacilli, Bacillales, Bacillaceae, and Bacillus could correctly classify isolate sequences with sensitivity of 0.99, 0.97, 0.94, and 0.89, respectively, and specificity close to 0.99. We developed signature-based software DNA Barcode Identification (DNA BarID) for taxonomic classification that is available at website http://www.neeri.res.in/DNA_BarID.htm . This pattern-based study provides a deeper understanding of taxon-specific discriminating patterns in 16S rRNA gene with respect to taxonomic classification. PMID:27104769

  8. Calculation and comparative analysis of the ir spectra of homobrassinolide and (22s,23s)-homobrassinolide

    Normal vibrational frequencies and absolute IR band intensities of the biologically active steroid phytohormones homobrassinolide and (22S,23S)-homobrassinolide were calculated in the framework of an original approach that combined classical analysis of normal modes using molecular mechanics with quantum-chemical estimation of the absolute intensities. IR absorption bands were interpreted based on a comparison of the experimental and theoretical absorption spectra. The impact of structural differences in the side chains of these molecules on the formation of their IR spectra in the region 1500-950 cm -1 was estimated. (authors)

  9. Calculation and Comparative Analysis of the IR Spectra of Homobrassinolide and (22S,23S)-Homobrassinolide

    Andrianov, V. M.; Korolevich, M. V.

    2015-09-01

    Normal vibrational frequencies and absolute IR band intensities of the biologically active steroid phytohormones homobrassinolide and (22S,23S)-homobrassinolide were calculated in the framework of an original approach that combined classical analysis of normal modes using molecular mechanics with quantum-chemical estimation of the absolute intensities. IR absorption bands were interpreted based on a comparison of the experimental and theoretical absorption spectra. The impact of structural differences in the side chains of these molecules on the formation of their IR spectra in the region 1500-950 cm -1 was estimated.

  10. Simulation of the structures and calculation of IR Spectra of (22 s,23 s)-Homobrassinolide conformers

    Andrianov, V. M.; Korolevich, M. V.

    2012-07-01

    Frequencies and intensities of normal vibrations of (22 S,23 S)-homobrassinolide, a biologically active representative of steroidal phytohormones, were calculated within the framework of an original approach that combined a classical analysis of normal vibrations by a molecular mechanics method with a quantum-chemical estimation of absolute intensities. Two molecular structures with different side-chain conformations were considered. The molecular IR absorption bands in the range 1500-900 cm-1 were interpreted for the first time and the influence of the side-chain conformation on the IR spectrum was analyzed based on a comparison of the experimental and calculated spectra.

  11. Simulation of the structures and calculation of IR Spectra of (22S,23S)-Homobrassinolide conformers

    Frequencies and intensities of normal vibrations of (22S,23S)-homobrassinolide, a biologically active representative of steroidal phytohormones, were calculated within the framework of an original approach that combined a classical analysis of normal vibrations by a molecular mechanics method with a quantum-chemical estimation of absolute intensities. Two molecular structures with different side-chain conformations were considered. The molecular IR absorption bands in the range 1500-900 cm-1 were interpreted for the first time and the influence of the side-chain conformation on the IR spectrum was analyzed based on a comparison of the experimental and calculated spectra. (authors)

  12. Measurement of the positronium 13S1-23S1 interval by continuous-wave two-photon excitation

    Fee, M.; Mills, A.; Chu, S.; Shaw, E; Danzmann, K.; Chichester, R.; Zuckerman, D.

    1993-01-01

    Using continuous-wave excitation to eliminate the problems inherent with pulsed laser measurements of nonlinear transitions, we have measured the 13S1-23S1 interval in positronium (Ps) to be 1 233 607 216.4±3.2 MHz. The quoted 2.6 ppb (parts per 109) uncertainty is primarily due to the determination of the Ps resonance relative to the Te2 reference line, with a 1.5 ppb contribution from a recent calibration of the Te2 line relative to the hydrogen 1S-2S transition. The uncertainty corresponds...

  13. Multi-site-specific 16S rRNA methyltransferase RsmF from Thermus thermophilus

    Demirci, Hasan; Larsen, Line H G; Hansen, Trine;

    2010-01-01

    Cells devote a significant effort toward the production of multiple modified nucleotides in rRNAs, which fine tune the ribosome function. Here, we report that two methyltransferases, RsmB and RsmF, are responsible for all four 5-methylcytidine (m(5)C) modifications in 16S rRNA of Thermus...... thermophilus. Like Escherichia coli RsmB, T. thermophilus RsmB produces m(5)C967. In contrast to E. coli RsmF, which introduces a single m(5)C1407 modification, T. thermophilus RsmF modifies three positions, generating m(5)C1400 and m(5)C1404 in addition to m(5)C1407. These three residues are clustered near...

  14. AtPPR2, an Arabidopsis pentatricopeptide repeat protein, binds to plastid 23S rRNA and plays an important role in the first mitotic division during gametogenesis and in cell proliferation during embryogenesis

    Lu, Yuqing; Li, Cong; Wang, Hai; Chen, Hao; Berg, Howard; Xia, Yiji

    2011-01-01

    Pentatricopeptide repeat (PPR) proteins are mainly involved in regulating post-transcriptional processes in mitochondria and plastids, including chloroplasts. Mutations in the Arabidopsis PPR2 gene have previously been found to cause defects in seed development and reduced transmission through male and female gametophytes. However, the exact function of AtPPR2 has not been defined. We found that a loss-of-function mutation of AtPPR2 leads to arrest of the first mitotic division during both ma...

  15. Structure of the bifunctional methyltransferase YcbY (RlmKL) that adds the m7G2069 and m2G2445 modifications in Escherichia coli 23S rRNA

    Wang, Kai-Tuo; Desmolaize, Benoit; Nan, Jie;

    2012-01-01

    fusions from two separate proteins found in Gram-positives. The crystal structures described here show that both the N- and C-terminal halves of E. coli YcbY have a methyltransferase active site and their folding patterns respectively resemble the Streptococcus mutans proteins Smu472 and Smu776. Mass...

  16. The nucleotide sequences of 5S rRNAs from a sea-cucumber, a starfish and a sea-urchin.

    Ohama, T; Hori, H; Osawa, S

    1983-01-01

    The nucleotide sequences of 5S rRNA from three echinoderms, a sea-cucumber Stichopus oshimae, a starfish Asterina pectinifera and a sea-urchin Hemicentrotus pulcherrimus have been determined. These 5S rRNAs are all 120 nucleotides long. The echinoderm sequences are more related to the sequences of proterostomes animals such as mollusc, annelids and some others (87% identity on average) than to those of vertebrates (82% identity on average).

  17. Phylogenetic relationships of Salmonella based on rRNA sequences

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    To establish the phylogenetic relationships between the subspecies of Salmonella enterica (official name Salmonella choleraesuis), Salmonella bongori and related members of Enterobacteriaceae, sequence comparison of rRNA was performed by maximum-likelihood analysis. The two Salmonella species were...

  18. The 11S → 23S and 11S → 13P excitation of helium by electron impact

    The R-matrix method calculations of Berrington et al (J. Phys. B.; 8: 1459 (1975)) and Fon et al (J. Phys. B.; 11: 325 (1978)) are extended to the calculation of the integrated and differential cross sections for electron excitation of the ground-state helium atom to the 23S and 23P states in the energy ranges (21.4 <= E <= 30 eV) and (80 <= E <= 200 eV). For intermediate energies (30 <= E <= 80 eV) pseudo-resonances arise which make accurate cross sections difficult to calculate and this region is therefore not considered. The calculations are compared with recent theoretical calculations and experimental measurements. (author)

  19. Hydrogen bonding and packing density are factors most strongly connected to limiting sites of high flexibility in the 16S rRNA in the 30S ribosome

    Ghosh Sujit K

    2009-07-01

    Full Text Available Abstract Background Conformational flexibility in structured RNA frequently is critical to function. The 30S ribosomal subunit exists in different conformations in different functional states due to changes in the central part of the 16S rRNA. We are interested in evaluating the factors that might be responsible for restricting flexibility to specific parts of the 16S rRNA using biochemical data obtained from the 30S subunit in solution. This problem was approached taking advantage of the observation that there must be a high degree of conformational flexibility at sites where UV photocrosslinking occurs and a lack of flexibility inhibits photoreactivity at many other sites that are otherwise suitable for reaction. Results We used 30S x-ray structures to quantify the properties of the nucleotide pairs at UV- and UVA-s4U-induced photocrosslinking sites in 16S rRNA and compared these to the properties of many hundreds of additional sites that have suitable geometry but do not undergo photocrosslinking. Five factors that might affect RNA flexibility were investigated – RNA interactions with ribosomal proteins, interactions with Mg2+ ions, the presence of long-range A minor motif interactions, hydrogen bonding and the count of neighboring heavy atoms around the center of each nucleobase to estimate the neighbor packing density. The two factors that are very different in the unreactive inflexible pairs compared to the reactive ones are the average number of hydrogen bonds and the average value for the number of neighboring atoms. In both cases, these factors are greater for the unreactive nucleotide pairs at a statistically very significant level. Conclusion The greater extent of hydrogen bonding and neighbor atom density in the unreactive nucleotide pairs is consistent with reduced flexibility at a majority of the unreactive sites. The reactive photocrosslinking sites are clustered in the 30S subunit and this indicates nonuniform patterns of

  20. Polarized 3He ion source for the Van de Graaff based on the 23S1 state of helium

    We have reached an important stage in the construction of a source of polarized 3He ions since the end of June, 1981, when a grant was received for its construction. The production of an intense beam of metastables in the 23S1 state has been achieved, as well as Stern-Gerlach separation. We have set up a method of recirculating gas in the metastable production step, which permits the operation of the polarized ion source in the same way as an ordinary ion source. The design of the adiabatic transition according to the method of Abragam and Winter was prepared. We are now studying ionization methods. The fact that the ionization potential is very low allows us to envisage nontraditional methods for this type of ion source. These methods permit high ionization efficiency. The objective set out at the beginning, a source of polarized 3He ions producing 100 nA-Particle with a polarization of 80 percent will be surpassed easily by our source

  1. Applications of adenine nucleotide measurements in oceanography

    Holm-Hansen, O.; Hodson, R.; Azam, F.

    1975-01-01

    The methodology involved in nucleotide measurements is outlined, along with data to support the premise that ATP concentrations in microbial cells can be extrapolated to biomass parameters. ATP concentrations in microorganisms and nucleotide analyses are studied.

  2. Nucleotides in neuroregeneration and neuroprotection.

    Miras-Portugal, M Teresa; Gomez-Villafuertes, Rosa; Gualix, Javier; Diaz-Hernandez, Juan Ignacio; Artalejo, Antonio R; Ortega, Felipe; Delicado, Esmerilda G; Perez-Sen, Raquel

    2016-05-01

    Brain injury generates the release of a multitude of factors including extracellular nucleotides, which exhibit bi-functional properties and contribute to both detrimental actions in the acute phase and also protective and reparative actions in the later recovery phase to allow neuroregeneration. A promising strategy toward restoration of neuronal function is based on activation of endogenous adult neural stem/progenitor cells. The implication of purinergic signaling in stem cell biology, including regulation of proliferation, differentiation, and cell death has become evident in the last decade. In this regard, current strategies of acute transplantation of ependymal stem/progenitor cells after spinal cord injury restore altered expression of P2X4 and P2X7 receptors and improve functional locomotor recovery. The expression of both receptors is transcriptionally regulated by Sp1 factor, which plays a key role in the startup of the transcription machinery to induce regeneration-associated genes expression. Finally, general signaling pathways triggered by nucleotide receptors in neuronal populations converge on several intracellular kinases, such as PI3K/Akt, GSK3 and ERK1,2, as well as the Nrf-2/heme oxigenase-1 axis, which specifically link them to neuroprotection. In this regard, regulation of dual specificity protein phosphatases can become novel mechanism of actions for nucleotide receptors that associate them to cell homeostasis regulation. This article is part of the Special Issue entitled 'Purines in Neurodegeneration and Neuroregeneration'. PMID:26359530

  3. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  4. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S.; McBee, Megan E.; Dedon, Peter C.

    2014-01-01

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and...

  5. A single mutation in the 15S rRNA gene confers nonsense suppressor activity and interacts with mRF1 the release factor in yeast mitochondria

    Ali Gargouri

    2015-08-01

    Full Text Available We have determined the nucleotide sequence of the mim3-1 mitochondrial ribosomal suppressor, acting on ochre mitochondrial mutations and one frameshift mutation in Saccharomyces cerevisiae. The 15s rRNA suppressor gene contains a G633 to C transversion. Yeast mitochondrial G633 corresponds to G517 of the E.coli 15S rRNA, which is occupied by an invariant G in all known small rRNA sequences. Interestingly, this mutation has occurred at the same position as the known MSU1 mitochondrial suppressor which changes G633 to A. The suppressor mutation lies in a highly conserved region of the rRNA, known in E.coli as the 530-loop, interacting with the S4, S5 and S12 ribosomal proteins. We also show an interesting interaction between the mitochondrial mim3-1 and the nuclear nam3-1 suppressors, both of which have the same action spectrum on mitochondrial mutations: nam3-1 abolishes the suppressor effect when present with mim3-1 in the same haploid cell. We discuss these results in the light of the nature of Nam3, identified by [1] as the yeast mitochondrial translation release factor. A hypothetical mechanism of suppression by "ribosome shifting" is also discussed in view of the nature of mutations suppressed and not suppressed.

  6. Frequency and spectrum of mitochondrial 12S rRNA variants in 440 Han Chinese hearing impaired pediatric subjects from two otology clinics

    Zhou Jianjin

    2011-01-01

    Full Text Available Abstract Background Aminoglycoside ototoxicity is one of the common health problems. Mitochondrial 12S rRNA mutations are one of the important causes of aminoglycoside ototoxicity. However, the incidences of 12S rRNA mutations associated with aminoglycoside ototoxicity are less known. Methods A total of 440 Chinese pediatric hearing-impaired subjects were recruited from two otology clinics in the Ningbo and Wenzhou cities of Zhejiang Province, China. These subjects underwent clinical, genetic evaluation and molecular analysis of mitochondrial 12S rRNA. Resultant mtDNA variants were evaluated by structural and phylogenetic analysis. Results The study samples consisted of 227 males and 213 females. The age of all participants ranged from 1 years old to 18 years, with the median age of 9 years. Ninety-eight subjects (58 males and 40 females had a history of exposure to aminoglycosides, accounting for 22.3% cases of hearing loss in this cohort. Molecular analysis of 12S rRNA gene identified 41 (39 known and 2 novel variants. The incidences of the known deafness-associated 1555A > G, 1494C > T and 1095T > C mutations were 7.5%, 0.45% and 0.91% in this entire hearing-impaired subjects, respectively, and 21.4%, 2% and 2% among 98 subjects with aminoglycoside ototoxicity, respectively. The structural and phylogenetic evaluations showed that a novel 747A > G variant and known 839A > G, 1027A > G, 1310C > T and 1413T > C variants conferred increased sensitivity to aminoglycosides or nonsyndromic deafness as they were absent in 449 Chinese controls and localized at highly conserved nucleotides of this rRNA. However, other variants were polymorphisms. Of 44 subjects carrying one of definite or putative deafness-related 12S rRNA variants, only one subject carrying the 1413T > C variant harbored the 235DelC/299DelAT mutations in the GJB2 gene, while none of mutations in GJB2 gene was detected in other 43 subjects. Conclusions Mutations in mitochondrial 12S rRNA

  7. Detection of Borrelia-specific 16S rRNA sequence in total RNA extracted from Ixodes ricinus ticks

    Ž. Radulović

    2010-08-01

    Full Text Available A reverse transcriptase - polymerase chain reaction based assay for Borrelia species detection in ticks was developed. The method was based on amplification of 552 nucleotide bases long sequence of 16S rRNA, targeted by Borrelia specific primers. In the present study, total RNA extracted from Ixodes ricinus ticks was used as template. The results showed higher sensitivity for Borrelia detection as compared to standard dark-field microscopy. Method specificity was confirmed by cloning and sequencing of obtained 552 base pairs long amplicons. Phylogenetic analysis of obtained sequences showed that they belong to B. lusitaniae and B. afzelii genospecies. RT-PCR based method presented in this paper could be very useful as a screening test for detecting pathogen presence, especially when in investigations is required extraction of total RNA from ticks.

  8. Phylogenetic positions of two marine ciliates, Metanophrys similis and Pseudocohnilembus hargisi (Protozoa, Ciliophora, Scuticociliatia), inferred from complete small subunit rRNA gene sequences

    2006-01-01

    The small subunit rRNA (SSrRNA) gene was sequenced for two marine scuticociliates Metanophrys similis and Pseudocohnilembus hargisi. The results show that this gene comprises 1763 and 1753 nucleotides in the two marine ciliates respectively.Metanophrys similis is phylogenetically closely related to the clade containing Mesanophrys carcini and Anophyroides haemophila, which branches basally to other species within the order Philasterida. Pseudocohnilembus hargisi groups with its congener, P. marinus, with strong bootstrap support. Paranophrys magna groups with the clade including Cohnilembus and Uronema, representing a sister clade to that containing the two Pseudocohnilembus species.

  9. A phylogenetic comparison of the 16S rRNA sequence of the fish pathogen, Renibacterium salmoninarum, to gram-positive bacteria.

    Gutenberger, S K; Giovannoni, S J; Field, K G; Fryer, J L; Rohovec, J S

    1991-01-15

    The 16S rRNA of Renibacterium salmoninarum, the causative agent of bacterial kidney disease in salmonids, was sequenced by reverse transcriptase to produce a nearly complete sequence (97%) of 1475 nucleotides. Phylogenetic comparisons to seventeen genera and signature sequence analysis indicated that R. salmoninarum was a member of the high G + C Gram-positive eubacterial subdivision although the reported G + C value is only 53%. A phylogenetic tree details the relationship of R. salmoninarum to ten actinomycetes from diverse environments. PMID:1709893

  10. Nucleotide excision repair in humans.

    Spivak, Graciela

    2015-12-01

    The demonstration of DNA damage excision and repair replication by Setlow, Howard-Flanders, Hanawalt and their colleagues in the early 1960s, constituted the discovery of the ubiquitous pathway of nucleotide excision repair (NER). The serial steps in NER are similar in organisms from unicellular bacteria to complex mammals and plants, and involve recognition of lesions, adducts or structures that disrupt the DNA double helix, removal of a short oligonucleotide containing the offending lesion, synthesis of a repair patch copying the opposite undamaged strand, and ligation, to restore the DNA to its original form. The transcription-coupled repair (TCR) subpathway of NER, discovered nearly two decades later, is dedicated to the removal of lesions from the template DNA strands of actively transcribed genes. In this review I will outline the essential factors and complexes involved in NER in humans, and will comment on additional factors and metabolic processes that affect the efficiency of this important process. PMID:26388429

  11. Identification of Clinically Relevant Nonhemolytic Streptococci on the Basis of Sequence Analysis of 16S-23S Intergenic Spacer Region and Partial gdh Gene▿

    Nielsen, Xiaohui Chen; Justesen, Ulrik Stenz; Dargis, Rimtas; Kemp, Michael; Christensen, Jens Jørgen

    2009-01-01

    Nonhemolytic streptococci (NHS) cause serious infections, such as endocarditis and septicemia. Many conventional phenotypic methods are insufficient for the identification of bacteria in this group to the species level. Genetic analysis has revealed that single-gene analysis is insufficient for the identification of all species in this group of bacteria. The aim of the present study was to establish a method based on sequence analysis of the 16S-23S intergenic spacer (ITS) region and the part...

  12. Nucleotide sequence preservation of human mitochondrial DNA

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  13. Sublingual nucleotides and immune response to exercise

    Ostojic Sergej M

    2012-07-01

    Full Text Available Abstract Evidence exists regarding the potential role of exogenous nucleotides as regulators of the immune function in physically active humans, yet the potential use of nucleotides has been hindered by their low bioavailability after oral administration. We conducted a double-blind, placebo-controlled, randomized trial to assess the effect of sublingual nucleotides (50 mg/day on salivary and serum immunity indicators as compared to placebo, both administered to healthy males aged 20 to 25 years for 14 days. Sublingual administration of nucleotides for 14 days increased serum immunoglobulin A, natural killer cells count and cytotoxic activity, and offset the post-exercise drop of salivary immunoglobulins and lactoferrin (P  0.05. It seems that sublingual administration of nucleotides for two weeks considerably affected immune function in healthy males.

  14. 'View From A Bridge': A New Perspective on Eukaryotic rRNA Base Modification.

    Sharma, Sunny; Lafontaine, Denis L J

    2015-10-01

    Eukaryotic rRNA are modified frequently, although the diversity of modifications is low: in yeast rRNA, there are only 12 different types out of a possible natural repertoire exceeding 112. All nine rRNA base methyltransferases (MTases) and one acetyltransferase have recently been identified in budding yeast, and several instances of crosstalk between rRNA, tRNA, and mRNA modifications are emerging. Although the machinery has largely been identified, the functions of most rRNA modifications remain to be established. Remarkably, a eukaryote-specific bridge, comprising a single ribosomal protein (RP) from the large subunit (LSU), contacts four rRNA base modifications across the ribosomal subunit interface, potentially probing for their presence. We hypothesize in this article that long-range allosteric communication involving rRNA modifications is taking place between the two subunits during translation or, perhaps, the late stages of ribosome assembly. PMID:26410597

  15. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  16. Analysis of RAPD and mitochondrial 16S rRNA gene sequences from Trichiurus lepturus and Eupleurogrammus muticus in the Yellow Sea

    MENG Zining; ZHUANG Zhimeng; JIN Xianshi; TANG Qisheng; SU Yongquan

    2004-01-01

    Random amplified polymorphic DNA (RAPD) technique is applied to 12 individuals from each species of the hairtail fishes Trichiurus lepturus and Eupleurogrammus muticus in the Yellow Sea. The percentage of polymorphic sites, degree of genetic polymorphism and genetic distance are compared and the phylogenetic tree is constructed by Neighbor-joining method. The partial mitochondrial 16S rRNA gene is amplified by polymerase chain reaction (PCR) and the PCR products are directly sequenced after being purified. These sequences, together with the homologous sequences of another Trichiuridae species Lepidopus caudatus obtained from GenBank, are used to analyze nucleotide difference and to construct a UPGMA phylogenetic tree by means of biological informatics. Analysis shows: (1) the RAPD technique is a highly sensitive method for investigating genetic diversity in T. lepturus, and E. muticus. T. lepturus exhibits a lower polymorphism and genetic diversity than E. muticus; (2) according to the analysis of the partial mitochondrial 16S rRNA gene sequences, a very low intraspecific variation and considerably high divergence among species were found, which reveals a dual nature of conservatism and variability in mitochondrial 16S rRNA gene; (3) five primers generate the species-specific RAPD sites and these sites can be served as the molecular markers for species identification and (4) it can be proved at DNA variation level that T. lepturus and E. muticus are of two species respectively pertaining to different genera, which supports the Nelson taxonomic conclusion.

  17. Nucleotide Salvage Deficiencies, DNA Damage and Neurodegeneration

    Michael Fasullo

    2015-04-01

    Full Text Available Nucleotide balance is critically important not only in replicating cells but also in quiescent cells. This is especially true in the nervous system, where there is a high demand for adenosine triphosphate (ATP produced from mitochondria. Mitochondria are particularly prone to oxidative stress-associated DNA damage because nucleotide imbalance can lead to mitochondrial depletion due to low replication fidelity. Failure to maintain nucleotide balance due to genetic defects can result in infantile death; however there is great variability in clinical presentation for particular diseases. This review compares genetic diseases that result from defects in specific nucleotide salvage enzymes and a signaling kinase that activates nucleotide salvage after DNA damage exposure. These diseases include Lesch-Nyhan syndrome, mitochondrial depletion syndromes, and ataxia telangiectasia. Although treatment options are available to palliate symptoms of these diseases, there is no cure. The conclusions drawn from this review include the critical role of guanine nucleotides in preventing neurodegeneration, the limitations of animals as disease models, and the need to further understand nucleotide imbalances in treatment regimens. Such knowledge will hopefully guide future studies into clinical therapies for genetic diseases.

  18. Phylogenetic and genetic diversity analysis in Leptospira species based on the sequence homology pattern of 16S rRNA gene

    Pasupuleti Sreenivasa Rao

    2013-08-01

    Full Text Available Leptospirosis is a bacterial zoonosis, caused by pathogenic spirochete which belongs to the genus Leptospira. It exists in diverse ecological habitats and affects almost all the mammals including humans. Several online databases like NCBI etc will provide the complete genomic sequence data of various Leptospira species. However, the Phylogenetic and genetic diversity Analysis in Leptospira species based on 16S rRNA gene has not studied in detail. Therefore the present study was conducted. Sequences of various species related to genus Leptospira obtained from the NCBI database etc and aligned (CLUSTAL_X. Two Phylogenetic trees were constructed (MEGA-5 in which the first one is related to various serovars of L. interrogans and the other is related to various species of Leptospira. The Phylogenetic trees revealed the relationship and genetic diversity of various serovars of L. interrogans and the other Leptospira species, with their nearest phylogenetic relatives. In the first tree, two major clades were observed which were named as A and B, whereas in the second tree, three major clades were observed and named as A, B and C respectively. Aquifex pyrophilus strain has been used for out grouping in both the trees. The genetic distance between the species in the phylogenetic tree is presented by a bar which represents 0.5 nucleotide substitutions per alignment position in the 16S rRNA gene sequence among the various serovars of L. interrogans while 0.05 nucleotide substitutions in case of various species related to the genus Leptospira. Thus, the findings from the above study confirm that the genus Leptospira exhibits genetic diversity in the 16S rRNA gene. [Int J Res Med Sci 2013; 1(4.000: 369-377

  19. Effects of nucleotides and nucleosides on coagulation

    Bune, Laurids; Thaning, Pia; Johansson, Pär I;

    2010-01-01

    Nucleotides, including ADP, ATP and uridine triphosphate (UTP), are discharged profusely in the circulation during many pathological conditions including sepsis. Sepsis can cause hypotension and systemic activation of the coagulation and fibrinolytic systems in humans, which may cause disseminate...

  20. Nucleotide excision repair in the test tube.

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)

    1995-01-01

    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  1. Determination of the differential cross section for electron excitation of the 23S1 state of helium near threshold via metastable time-of-flight spectra

    The differential cross section for the inelastic process He(11S0) + e- → He(23S1) + e- just above threshold. For a given detector angle and metastable atom speed there corresponds only one value of cos theta, where theta is the electron scattering angle. Since the excitation cross section for unpolarized beams is symmetric in theta, there is a one-to-one relation between atom times of flight and electron scattering angles. Since the kinematics of the problem are understood, the differential cross section can be extracted from the time-of-flight spectrum by using a computer analysis that incorporates factors such as the finite angular resolutions, the finite energy resolution of the electron gun, and the Maxwellian distribution of velocities in the ground state atomic beam. The angular range and resolution available in both conventional electron scattering experiments and in the present time-of-flight experiment show that there is considerable anisotropy in the electron distribution at energies just a few millivolts above the 19.82 eV, 23S1 threshold. Recent theoretical calculations predict that interference should be apparent, in agreement with what we observe. The total cross section for production of the 23S1 state by electron impact shows a peak near 20.4 eV that has been previously interpreted as a p-wave resonance. It is found that the cross section is most ''p-like'' at about 20.2 eV, but evidence for still more partial waves seems to appear even at this relatively low energy

  2. In vitro incorporation of LNA nucleotides.

    Veedu, Rakesh N; Vester, Birte; Wengel, Jesper

    2007-01-01

    An LNA modified nucleoside triphosphate 1 was synthesized in order to investigate its potential to act as substrate for DNA strand synthesis by polymerases. Primer extension assays for the incorporation experiments revealed that Phusion High Fidelity DNA polymerase is an efficient enzyme for incorporation of the LNA nucleotide and for extending strand to full length. It was also observed that pfu DNA polymerase could incorporate the LNA nucleotide but it failed to extend the strand to a full length product. PMID:18058567

  3. Nucleotide Capacitance Calculation for DNA Sequencing

    Lu, Jun-Qiang; Zhang, X.-G.

    2008-01-01

    Using a first-principles linear response theory, the capacitance of the DNA nucleotides, adenine, cytosine, guanine, and thymine, are calculated. The difference in the capacitance between the nucleotides is studied with respect to conformational distortion. The result suggests that although an alternate current capacitance measurement of a single-stranded DNA chain threaded through a nanogap electrode may not be sufficient to be used as a standalone method for rapid DNA sequencing, the capaci...

  4. Analysis of Sequence Conservation at Nucleotide Resolution

    Asthana, Saurabh; Roytberg, Mikhail; Stamatoyannopoulos, John; Sunyaev, Shamil R.

    2007-01-01

    One of the major goals of comparative genomics is to understand the evolutionary history of each nucleotide in the human genome sequence, and the degree to which it is under selective pressure. Ascertainment of selective constraint at nucleotide resolution is particularly important for predicting the functional significance of human genetic variation and for analyzing the sequence substructure of cis-regulatory sequences and other functional elements. Current methods for analysis of sequence ...

  5. Attachment sites of primary binding proteins L1, L2 and L23 on 23 S ribosomal RNA of Escherichia coli

    Egebjerg, Jan; Christiansen, Jan; Garrett, Roger Antony

    1991-01-01

    The attachment sites of the primary binding proteins L1, L2 and L23 on 23 S ribosomal RNA of Escherichia coli were examined by a chemical and ribonuclease footprinting method using several probes with different specificities. The results show that the sites are confined to localized RNA regions...... within the large ribonuclease-protected ribonucleoprotein fragments that were characterized earlier. They are as follows: 1. (1) L1 recognizes a tertiary structural motif in domain V centred on two interacting internal loops; the main protein interaction sites occur at the internal loop/helix junctions.2...

  6. Applicability of the 16S-23S rDNA internal spacer for PCR detection of the phytostimulatory PGPR inoculant Azospirillum lipoferum CRT1 in field soil

    Baudoin, Ezékiel; Couillerot, O.; Spaepen, S.; Moenne-Loccoz, Y.; Nazaret, S.

    2010-01-01

    Aims: To assess the applicability of the 16S-23S rDNA internal spacer regions (ISR) as targets for PCR detection of Azospirillum ssp. and the phytostimulatory plant growth-promoting rhizobacteria seed inoculant Azospirillum lipoferum CRT1 in soil. Methods and Results: Primer sets were designed after sequence analysis of the ISR of A. lipoferum CRT1 and Azospirillum brasilense Sp245. The primers fAZO/rAZO targeting the Azospirillum genus successfully yielded PCR amplicons (400-550 bp) from Azo...

  7. High throughput 16S rRNA gene amplicon sequencing

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup;

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r...... belonging to the phylum Chloroflexi. Based on knowledge about their ecophysiology, other control measures were introduced and the bulking problem was reduced after 2 months. Besides changes in the filament abundance and composition also other changes in the microbial community were observed that likely...... correlated with the bacterial species composition in 25 Danish full-scale WWTPs with nutrient removal. Examples of properties were SVI, filament index, floc size, floc strength, content of cations and amount of extracellular polymeric substances. Multivariate statistics provided several important insights...

  8. Evaluation of the 16S and 12S rRNA genes as universal markers for the identification of commercial fish species in South Africa.

    Cawthorn, Donna-Mareè; Steinman, Harris Andrew; Witthuhn, R Corli

    2012-01-01

    The development of DNA-based methods for the identification of fish species is important for fisheries research and control, as well as for the detection of unintentional or fraudulent species substitutions in the marketplace. The aim of this study was to generate a comprehensive reference database of DNA sequences from the mitochondrial 16S and 12S ribosomal RNA (rRNA) genes for 53 commercial fish species in South Africa and to evaluate the applicability of these genetic markers for the identification of fish at the species level. The DNA extracted from all target species was readily amplified using universal primers targeting both rRNA gene regions. Sequences from the 16S and 12S rRNA genes were submitted to GenBank for the first time for 34% and 53% of the fish species, respectively. Cumulative analysis of the 16S rRNA gene sequences revealed mean conspecific, congeneric and confamilial Kimura two parameter (K2P) distances of 0.03%, 0.70% and 5.10% and the corresponding values at the 12S level were 0.03%, 1.00% and 5.57%. K2P neighbour-joining trees based on both sequence datasets generally clustered species in accordance with their taxonomic classifications. The nucleotide variation in both the 16S and 12S sequences was suitable for identifying the large majority of the examined fish specimens to at least the level of genus, but was found to be less useful for the explicit differentiation of certain congeneric fish species. It is recommended that one or more faster-evolving DNA regions be analysed to confirm the identities of closely-related fish species in South Africa. PMID:21963445

  9. Regulation of mammalian nucleotide metabolism and biosynthesis.

    Lane, Andrew N; Fan, Teresa W-M

    2015-02-27

    Nucleotides are required for a wide variety of biological processes and are constantly synthesized de novo in all cells. When cells proliferate, increased nucleotide synthesis is necessary for DNA replication and for RNA production to support protein synthesis at different stages of the cell cycle, during which these events are regulated at multiple levels. Therefore the synthesis of the precursor nucleotides is also strongly regulated at multiple levels. Nucleotide synthesis is an energy intensive process that uses multiple metabolic pathways across different cell compartments and several sources of carbon and nitrogen. The processes are regulated at the transcription level by a set of master transcription factors but also at the enzyme level by allosteric regulation and feedback inhibition. Here we review the cellular demands of nucleotide biosynthesis, their metabolic pathways and mechanisms of regulation during the cell cycle. The use of stable isotope tracers for delineating the biosynthetic routes of the multiple intersecting pathways and how these are quantitatively controlled under different conditions is also highlighted. Moreover, the importance of nucleotide synthesis for cell viability is discussed and how this may lead to potential new approaches to drug development in diseases such as cancer. PMID:25628363

  10. Louse (Insecta : Phthiraptera) mitochondrial 12S rRNA secondary structure is highly variable

    Page, R.D.M.; Cruickshank, R.; Johnson, K P

    2002-01-01

    Lice are ectoparasitic insects hosted by birds and mammals. Mitochondrial 12S rRNA sequences obtained from lice show considerable length variation and are very difficult to align. We show that the louse 12S rRNA domain III secondary structure displays considerable variation compared to other insects, in both the shape and number of stems and loops. Phylogenetic trees constructed from tree edit distances between louse 12S rRNA structures do not closely resemble trees constructed from sequence ...

  11. Measurement of metastable He*(23S1) density in dielectric barrier discharges with two different configurations operating at around atmospheric pressure

    We have measured the density of metastable He atoms in the lowest triplet state (23S1) with a diode-laser absorption spectroscopic technique in atmospheric pressure plasmas produced by dielectric barrier discharge schemes. Two different types of electrode configuration are employed: one is a conventional parallel-plate system and the other is a microdischarge integrated system with stacked metal-mesh electrodes covered by insulating films. We have analyzed the pressure-broadened spectral line corresponding to the 23S1→23PJ (J=0-2) transition to derive the broadening coefficient and to calibrate absolute densities. The measured density ranges from 1011 to 1012 cm-3, but the values in the mesh-type system are larger than those in the parallel-plate system by about one order of magnitude. The density, however, depends strongly on the gas flow rate, showing the influence of quenching by the Penning-ionization process with impurities. Those behaviors are consistent with the variation of the electron density estimated by millimeter-wave transmittance measurement

  12. Proofreading of misincorporated nucleotides in DNA transcription.

    Voliotis, Margaritis; Cohen, Netta; Molina-París, Carmen; Liverpool, Tanniemola B

    2012-06-01

    The accuracy of DNA transcription is crucial for the proper functioning of the cell. Although RNA polymerases demonstrate selectivity for correct nucleotides, additional active mechanisms of transcriptional error correction are required to achieve observed levels of fidelity. Recent experimental findings have shed light on a particular mechanism of transcriptional error correction involving: (i) diffusive translocation of the RNA polymerase along the DNA (backtracking) and (ii) irreversible RNA cleavage. This mechanism achieves preferential cleavage of misincorporated nucleotides by biasing the local rates of translocation. Here, we study how misincorporated nucleotides affect backtracking dynamics and how this effect determines the level of transcriptional fidelity. We consider backtracking as a diffusive process in a periodic, one-dimensional energy landscape, which at a coarse-grained level gives rise to a hopping process between neighboring local minima. We propose a model for how misincorporated nucleotides deform this energy landscape and hence affect the hopping rates. In particular, we show that this model can be used to derive both the theoretical limit on the fidelity (i.e. the minimum fraction of misincorporated nucleotides) and the actual fidelity relative to this optimum, achieved for specific combinations of the cleavage and polymerization rates. Finally, we study how external factors influencing backtracking dynamics affect transcriptional fidelity. We show that biologically relevant loads, similar to those exerted by nucleosomes or other transcriptional barriers, increase error correction. PMID:22643861

  13. Design and synthesis of ATP-based nucleotide analogues and profiling of nucleotide-binding proteins

    Wolters, Justina. C.; Roelfes, Johannes; Poolman, Bert

    2011-01-01

    Two nucleotide-based probes were designed and synthesized in order to enrich samples for specific classes of proteins by affinity-based protein profiling. We focused on the profiling of adenine nucleotide-binding proteins. Two properties were considered in the design of the probes: the bait needs to

  14. Eukaryotic rRNA Modification by Yeast 5-Methylcytosine-Methyltransferases and Human Proliferation-Associated Antigen p120.

    Gabrielle Bourgeois

    Full Text Available Modified nucleotide 5-methylcytosine (m5C is frequently present in various eukaryotic RNAs, including tRNAs, rRNAs and in other non-coding RNAs, as well as in mRNAs. RNA:m5C-methyltranferases (MTases Nop2 from S. cerevisiae and human proliferation-associated nucleolar antigen p120 are both members of a protein family called Nop2/NSUN/NOL1. Protein p120 is well-known as a tumor marker which is over-expressed in various cancer tissues. Using a combination of RNA bisulfite sequencing and HPLC-MS/MS analysis, we demonstrated here that p120 displays an RNA:m5C- MTase activity, which restores m5C formation at position 2870 in domain V of 25S rRNA in a nop2Δ yeast strain. We also confirm that yeast proteins Nop2p and Rcm1p catalyze the formation of m5C in domains V and IV, respectively. In addition, we do not find any evidence of m5C residues in yeast 18S rRNA. We also performed functional complementation of Nop2-deficient yeasts by human p120 and studied the importance of different sequence and structural domains of Nop2 and p120 for yeast growth and m5C-MTase activity. Chimeric protein formed by Nop2 and p120 fragments revealed the importance of Nop2 N-terminal domain for correct protein localization and its cellular function. We also validated that the presence of Nop2, rather than the m5C modification in rRNA itself, is required for pre-rRNA processing. Our results corroborate that Nop2 belongs to the large family of pre-ribosomal proteins and possesses two related functions in pre-rRNA processing: as an essential factor for cleavages and m5C:RNA:modification. These results support the notion of quality control during ribosome synthesis by such modification enzymes.

  15. Novel mutation in 16S rRNA associated with streptomycin dependence in Mycobacterium tuberculosis.

    Honoré, N; Marchal, G.; Cole, S T

    1995-01-01

    Molecular characterization of a streptomycin-dependent mutant of Mycobacterium tuberculosis revealed the presence of a novel mutation in the rrs gene encoding 16S rRNA. Insertion of an additional cytosine in the 530 loop of 16S rRNA, a region known to be involved in streptomycin susceptibility and resistance, was associated with streptomycin dependence.

  16. The effect of secondary compounds on the rumen microbial population structure measured by 16S rRNA and 18S rRNA

    Full text: Plant secondary compounds in the forages have an important role in determining forage quality. A method for evaluating their effects on microbial population structure was carried out using the in vitro gas syringe system followed by extraction of RNA and gel separation of 16S rRNA and 18S rRNA. Quantification of 16S rRNA and 18S rRNA bands indicated the prokaryote and eukaryote populations, respectively. Five types of plant materials, i.e. Nothopanax scutellarium (Mangkokan) leaves, Morinda citrifolia (Mengkudu) fruit, Sapindus rarak (lerak) fruit and two types of Sesbania sesban leaves (hgh saponin and low saponin) were tested and Pennisetum purpureum (rumput gajah, Indonesian name) was used as a control roughage. Presence of saponin in these plant materials was determined qualitatively by thin layer chromatography. Eukaryote population was found to be significantly affected by the above plant materials. Both types of S. sesban leaves caused total elimination of eukaryotes. S. rarak reduced both eukaryote and prokaryote populations. The observed inhibition of eukaryote population might be due to the presence of saponin in these plant materials. In another experiment, a methanol extract of S. rarak which contained saponin was included and its effect on in vitro fermentation of P. purpureum was evaluated. The results showed that at higher levels of inclusion of S. rarak methanol extract, eukaroytes were totally eliminated. Comparison was made between microbial mass calculated based on difference between apparent undigested residue and true undigested residue and microbial mass calculations based on 16S rRNA and 18S rRNA. Microbial mass calculated by difference method was much higher than the microbial mass calculated on the basis of 16S rRNA and 18S rRNA. The quantification of RNA can be a useful and rapid technique for an accurate assessment of the effect of new forage materials on the microbial population structure. Other parameters from in vitro

  17. Pyrrolidine analogues of nucleosides and nucleotides

    Rejman, Dominik; Pohl, Radek; Kovačková, Soňa; Kočalka, Petr; Švenková, Alžběta; Šanderová, Hana; Krásný, Libor; Rosenberg, Ivan

    -, č. 52 (2008), s. 577-578. ISSN 0261-3166. [Joint Symposium of the International Roundtable on Nucleosides, Nucleotides and Nucleic Acids /18./ and the International Symposium on Nucleic Acid Chemistry /35./. Kyoto, 08.09.2008-12.09.2008] R&D Projects: GA MŠk(CZ) LC06077; GA MŠk 2B06065; GA MZd NR9138 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50200510; CEZ:AV0Z50520514 Keywords : pyrrolidine * nucleoside * nucleotide Subject RIV: CC - Organic Chemistry

  18. Subnuclear partitioning of rRNA genes between the nucleolus and nucleoplasm reflects alternative epiallelic states

    Pontvianne, Frederic; Blevins, Todd; Chandrasekhara, Chinmayi; Mozgová, Iva; Hassel, Christiane; Pontes, Olga M.F.; Tucker, Sarah; Mokroš, Petr; Muchová, Veronika; Fajkus, Jiří; Pikaard, Craig S.

    2013-01-01

    Eukaryotes can have thousands of 45S ribosomal RNA (rRNA) genes, many of which are silenced during development. Using fluorescence-activated sorting techniques, we show that active rRNA genes in Arabidopsis thaliana are present within sorted nucleoli, whereas silenced rRNA genes are excluded. DNA methyltransferase (met1), histone deacetylase (hda6), or chromatin assembly (caf1) mutants that disrupt silencing abrogate this nucleoplasmic–nucleolar partitioning. Bisulfite sequencing data indicate that active nucleolar rRNA genes are nearly completely demethylated at promoter CGs, whereas silenced genes are nearly fully methylated. Collectively, the data reveal that rRNA genes occupy distinct but changeable nuclear territories according to their epigenetic state. PMID:23873938

  19. Parity nonconservation effect with laser-induced 2^3S_1 - 2^1S_0 transition in heavy heliumlike ions

    Shabaev, V M; Kozhuharov, C; Plunien, G; Stöhlker, Th

    2010-01-01

    The parity nonconservation (PNC) effect on the laser-induced 2^3S_1 - 2^1S_0 transition in heavy heliumlike ions is considered. A simple analytical formula for the PNC correction to the cross section is derived for the case, when the opposite-parity 2^1S_0 and 2^3P_0 states are almost degenerate and, therefore, the PNC effect is strongly enhanced. Numerical results are presented for heliumlike gadolinium and thorium, which seem most promising candidates for such kind of experiments. In both Gd and Th cases the photon energy required will be anticipated with a high-energy laser built at GSI. Alternatively, it can be gained with ultraviolet lasers utilizing relativistic Doppler tuning at FAIR facilities in Darmstadt.

  20. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    Cangelosi, G A; Brabant, W H

    1997-07-01

    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA probes to measure steady-state cellular pre-16S rRNA pools during growth state transitions in Escherichia coli. Pre-16S rRNA became undetectable when cells entered the stationary phase on rich medium and was replenished upon restoration of favorable growth conditions. These fluctuations were of much greater magnitude than concurrent fluctuations in the mature 16S rRNA pool. The extent of pre-16S rRNA depletion depended upon the circumstances limiting growth. It was significantly more pronounced in carbon-energy-starved cells than in nitrogen-starved cells or in cells treated with energy uncouplers. In the presence of the transcriptional inhibitor rifampin, rates of pre-16S rRNA depletion in carbon-energy-starved cells and nitrogen-starved cells were similar, suggesting that the difference between these conditions resides primarily at the level of pre-rRNA synthesis. Chloramphenicol, which inhibits the final steps in rRNA maturation, halted pre-16S rRNA depletion under all conditions. The data show that E. coli cells continue to process pre-rRNA after growth and rrn operon transcription cease, leading to drainage of the pre-rRNA pool. This supports the feasibility of using pre-rRNA-targeted probes to monitor bacterial growth in natural systems, with the caveat that patterns of pre-rRNA depletion vary with the conditions limiting growth. PMID:9226253

  1. Sequencing of 16S rRNA Gene: A Rapid Tool for Identification of Bacillus anthracis

    Sacchi, Claudio T.; Whitney, Anne M.; Mayer, Leonard W.; Morey, Roger; Steigerwalt, Arnold; Boras, Ariana; Weyant, Robin S.; Popovic, Tanja

    2002-01-01

    In a bioterrorism event, a tool is needed to rapidly differentiate Bacillus anthracis from other closely related spore-forming Bacillus species. During the recent outbreak of bioterrorism-associated anthrax, we sequenced the 16S rRNA generom these species to evaluate the potential of 16S rRNA gene sequencing as a diagnostic tool. We found eight distinct 16S types among all 107 16S rRNA gene seqs fuences that differed from each other at 1 to 8 positions (0.06% to 0.5%). All 86 B. anthracis had...

  2. The phylogeny of Aerococcus and Pediococcus as determined by 16S rRNA sequence analysis: description of Tetragenococcus gen. nov.

    Collins, M D; Williams, A M; Wallbanks, S

    1990-08-01

    The phylogenetic interrelationships of the genera Pediococcus and Aerococcus were investigated using reverse transcriptase sequencing of 16S rRNA. The genus Pediococcus was found to be phylogenetically heterogeneous. The four species P. acidilactici, P. damnosus, P. parvulus and P. pentosaceus formed a phylogenetically distinct group. Within this pediococcal cluster, P. acidilactici was closely related to P. pentosaceus whereas P. damnosus showed a specific relationship with P. parvulus. The species P. dextrinicus, although showing significant sequence relatedness with these pediococcal species, was peripheral to the genus. Pediococcus halophilus exhibited low sequence homology with all of the species examined and formed a distinct line of descent. Pediococcus halophilus exhibited a closer affinity with enterococci and carnobacteria than with the other lactic acid bacteria. Pediococcus urinae-equi was phylogenetically very closely related to Aerococcus viridans. The 16S rRNA sequences of the type strains of these species differed by only two nucleotides (99.9% sequence homology) and clearly demonstrate that P. urinae-equi is a member of the genus Aerococcus. PMID:2227360

  3. Molecular analysis of 18S rRNA gene of Cryptosporidium parasites from patients living in Iran, Malawi, Nigeria and Vietnam.

    Ghaffari, Salman; Kalantari, Narges

    2012-01-01

    Cryptosporidium species are one of the most common causes of gastrointestinal infection in humans around the world. This study has aimed to investigate the hyper variable region of the 18S rRNA gene in Cryptosporidium for exact parasite identification. DNA was extracted from 26 fecal samples from which initially Cryptosporidium oocysts were identified by Ziehl-Neelsen acid-fast , Auramine phenol and ELISA techniques. Nested PCR, targeting the most polymorphic region of the 18S rRNA gene and genotyping was performed by restriction endonuclease digestion of the PCR product followed by nucleotide sequencing and phylogenic analysis. Among 26 isolates analyzed, three species of Cryptosporidium were identified; 38.5% of the isolates were C. hominis while 53.8% of the isolates were C. parvum and 7.7% of the isolates were C. meleagridis, which the last two species have the potentially zoonotic transmission. The only 11T subtype of C. hominis was demonstrated. These strains clustered distinctly into either human or animal origin regardless of the geographical origin, age, or immunity status of the patients. In summary, this work is the first report of C. meleagridis infecting human in Iran. Moreover, it suggested that multi-locus study of Cryptosporidium species in developing countries would be necessary to determine the extent of transmission of cryptosporidiosis in the populations. PMID:24551771

  4. The complete nucleotide sequence of the mitochondrial genome of the cabbage butterfly, Artogeia melete (Lepidoptera: Pieridae)

    Guiyun Hong; Shaotong Jiang; Miao Yu; Ying Yang; Feng Li; Fangsen Xue; Zhaojun Wei

    2009-01-01

    The complete mitochondrial genome (mitogenome) of Artogeia melete was determined as being composed of 15,140 bp, including 13 protein-coding genes (PCGs), 2rRNA genes, 22 tRNA genes, and one control region.The gene order of A. melete mitogenome is typical of Lepidoptera and differs from the insect ancestral type in the location of trnM. The A. melete mitogenome has a total of 119 bp of intergenic spacer sequences spread over 10 regions, ranging in sizes between 1 and 48 bp.The nucleotide composition of the A. melete mitogenome is also biased toward A + T nucleotides (79.77%),which is higher than that of Ochrogaster lunifer (77.84%), but lower than nine other lepidopterans sequenced. The PCGs have typical mitochondrial start codons, except for cox1, which contains the unusual CGA. The cox1, cox2, nad2, and had5 genes of the A.melete mitogenome have incomplete stop codons (T).The A. melete A + T-rich region contains some conserved structures that are similar to those found in other lepidopteran mitogenomes, including a structure combining the motif 'ATAGA', a 19-bp poly(T) stretch,a microsatellite (AT)n element, and a 9-bp poly(A)upstream trnM. The A. melete mitogenome contains a duplicated 36-bp repeat element, which consists of a 26-bp core sequence flanked by 10-bp perfectly inverted repeats.

  5. Comparative 16S rRNA signatures and multilocus sequence analysis for the genus Salinicola and description of Salinicola acroporae sp. nov., isolated from coral Acropora digitifera.

    Lepcha, Rinchen T; Poddar, Abhijit; Schumann, Peter; Das, Subrata K

    2015-07-01

    A novel Gram-negative, aerobic, motile marine bacterium, strain S4-41(T), was isolated from mucus of the coral Acropora digitifera from the Andaman Sea. Heterotrophic growth was observed in 0-25 % NaCl, at 15-45 °C and pH 4.5-9. In phylogenetic trees, strain S4-41(T) was grouped within the genus Salinicola but formed a separate branch distant from a cluster composed of Salinicola salarius M27(T) and Salinicola socius SMB35(T). DNA-DNA relatedness between strain S4-41(T) and these reference strains were well below 70 %. Q-9 was the sole respiratory quinone. The DNA G+C content was determined to be 63.6 mol%. Based on a polyphasic analysis, strain S4-41(T) is concluded to represent a novel species in the genus Salinicola for which the name Salinicola acroporae sp. nov. is proposed. The type strain is S4-41(T) (=JCM 30412(T) = LMG 28587(T)). Comparative 16S rRNA analysis of the genera Salinicola, Kushneria, Chromohalobacter and Cobetia revealed the presence of genus specific sequence signatures. Multilocus sequence analysis based on concatenated sequences of rRNAs (16S and 23S) and four protein coding housekeeping genes (atpA, gyrB, secA, rpoD) was found to be unnecessary for phylogenetic studies of the genus Salinicola. PMID:25944083

  6. Pyrrolidine nucleotides conformationally constrained via hydrogen bonding

    Pohl, Radek; Poštová Slavětínská, Lenka; Rejman, Dominik

    Praha : Institute of Organic Chemistry and Biochemistry AS CR, v. v. i, 2014 - (Hocek, M.), s. 352-353 ISBN 978-80-86241-50-0. - (Collection Symposium Series. 14). [Symposium on Chemistry of Nucleic Acid Components /16./. Český Krumlov (CZ), 08.06.2014-13.06.2014] R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : pyrrolidine nucleotides * PMEA * hydrogen bond Subject RIV: CC - Organic Chemistry

  7. Pyrrolidine nucleotide analogs with a tunable conformation

    Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek

    2014-01-01

    Roč. 10, Aug 22 (2014), s. 1967-1980. ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014 http://www.beilstein-journals.org/bjoc/single/articleFullText.htm?publicId=1860-5397-10-205

  8. Mitochondrial Adenine Nucleotide Transport and Cardioprotection

    Das, Samarjit; Steenbergen, Charles

    2011-01-01

    Mitochondria are highly metabolically active cell organelles that not only act as the powerhouse of the cell by supplying energy through ATP production, but also play a destructive role by initiating cell death pathways. Growing evidence recognizes that mitochondrial dysfunction is one of the major causes of cardiovascular disease. Under de-energized conditions, slowing of adenine nucleotide transport in and out of the mitochondria significantly attenuates myocardial ischemia-reperfusion inju...

  9. Nucleotide Manipulatives to Illustrate the Central Dogma

    Sonja B. Yung

    2015-08-01

    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  10. Nucleotide Manipulatives to Illustrate the Central Dogma†

    Sonja B. Yung; Todd P. Primm

    2015-01-01

    The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  11. Investigation of molluscan phylogeny on the basis of 18S rRNA sequences.

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1996-12-01

    The 18S rRNA sequences of 12 molluscs, representing the extant classes Gastropoda, Bivalvia, Polyplacophora, Scaphopoda, and Caudofoveata, were determined and compared with selected known 18S rRNA sequences of Metazoa, including other Mollusca. These data do not provide support for a close relationship between Platyhelminthes (Turbellaria) and Mollusca, but rather suggest that the latter group belongs to a clade of eutrochozoan coelomates. The 18S rRNA data fail to recover molluscan, bivalve, or gastropod monophyly. However, the branching pattern of the eutrochozoan phyla and classes is unstable, probably due to the explosive Cambrian radiation during which these groups arose. Similarly, the 18S rRNA data do not provide a reliable signal for the molluscan interclass relationships. Nevertheless, we obtained strong preliminary support for phylogenetic inferences at more restricted taxonomic levels, such as the monophyly of Polyplacophora, Caenogastropoda, Euthyneura, Heterodonta, and Arcoida. PMID:8952075

  12. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria

    Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.

    2015-01-01

    Roč. 15, APR 2015 (2015). ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EE - Microbiology , Virology Impact factor: 2.729, year: 2014

  13. Inhibition of Escherichia coli precursor-16S rRNA processing by mouse intestinal contents

    Licht, Tine Rask; Tolker-Nielsen, Tim; Holmstrøm, Kim; Krogfelt, Karen A.; Molin, Søren

    1999-01-01

    . We have applied fluorescence in situ hybridization of pre-16S rRNA to Escherichia coli cells growing in vitro in extracts from two different compartments of the mouse intestine: the caecal mucus layer, where E. coli grew rapidly, and the contents of the caecum, which supported much slower bacterial......The correlation between ribosome content and growth rate found in many bacterial species has proved useful for estimating the growth activity of individual cells by quantitative in situ rRNA hybridization. However, in dynamic environments, the stability of mature ribosomal RNA causes problems in...... using cellular rRNA contents for direct monitoring of bacterial growth activity in situ. In a recent paper, Cangelosi and Brabant suggested monitoring the content of precursors in rRNA synthesis (pre-rRNAs) as an alternative approach. These are rapidly broken down after the cessation of bacterial growth...

  14. Visualization of cyclic nucleotide dynamics in neurons

    Kirill eGorshkov

    2014-12-01

    Full Text Available The second messengers cAMP and cGMP transduce many neuromodulatory signals from hormones and neurotransmitters into specific functional outputs. Their production, degradation and signaling are spatiotemporally regulated to achieve high specificity in signal transduction. The development of genetically encodable fluorescent biosensors has provided researchers with useful tools to study these versatile second messengers and their downstream effectors with unparalleled spatial and temporal resolution in cultured cells and living animals. In this review, we introduce the general design of these fluorescent biosensors and describe several of them in more detail. Then we discuss a few examples of using cyclic nucleotide fluorescent biosensors to study regulation of neuronal function and finish with a discussion of advances in the field. Although there has been significant progress made in understanding how the specific signaling of cyclic nucleotide second messengers is achieved, the mechanistic details in complex cell types like neurons are only just beginning to surface. Current and future fluorescent protein reporters will be essential to elucidate the role of cyclic nucleotide signaling dynamics in the functions of individual neurons and their networks.

  15. Multiphasic interactions between nucleotides and target proteins

    Nissen, Per

    2016-01-01

    The nucleotides guanosine tetraphosphate (ppGpp) and guanosine pentaphosphate (pppGpp) bind to target proteins to promote bacterial survival (Corrigan et al. 2016). Thus, the binding of the nucleotides to RsgA, a GTPase, inhibits the hydrolysis of GTP. The dose response, taken to be curvilinear with respect to the logarithm of the inhibitor concentration, is instead much better (P<0.001 when the 6 experiments are combined) represented as multiphasic, with high to exceedingly high absolute r values for the straight lines, and with transitions in the form of non-contiguities (jumps). Profiles for the binding of radiolabeled nucleotides to HprT and Gmk, GTP synthesis enzymes, were, similarly, taken to be curvilinear with respect to the logarithm of the protein concentration. However, the profiles are again much better represented as multiphasic than as curvilinear (the P values range from 0.047 to <0.001 for each of the 8 experiments for binding of ppGpp and pppGpp to HprT). The binding of GTP to HprT and ...

  16. A Sensitive Cyclic Nucleotide Phosphodiesterase Assay for Transient Enzyme Kinetics

    Lookeren Campagne, Michiel M. van; Haastert, Peter J.M. van

    1983-01-01

    A new assay for cyclic nucleotide phosphodiesterase has been developed by using reverse-phase column chromatography for the separation of product and substrate of the enzymatic reaction. The polar 5'-nucleotides are not retarded by the column, while the more lipophilic cyclic nucleotides bind to the

  17. Development of a Broad-Range 23S rDNA Real-Time PCR Assay for the Detection and Quantification of Pathogenic Bacteria in Human Whole Blood and Plasma Specimens

    Paolo Gaibani; Mara Mariconti; Gloria Bua; Sonia Bonora; Davide Sassera; Maria Paola Landini; Patrizia Mulatto; Stefano Novati; Claudio Bandi; Vittorio Sambri

    2013-01-01

    Molecular methods are important tools in the diagnosis of bloodstream bacterial infections, in particular in patients treated with antimicrobial therapy, due to their quick turn-around time. Here we describe a new broad-range real-time PCR targeting the 23S rDNA gene and capable to detect as low as 10 plasmid copies per reaction of targeted bacterial 23S rDNA gene. Two commercially available DNA extraction kits were evaluated to assess their efficiency for the extraction of plasma and whole b...

  18. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  19. Nucleotide Excision Repair in Caenorhabditis elegans

    Hannes Lans; Wim Vermeulen

    2011-01-01

    Nucleotide excision repair (NER) plays an essential role in many organisms across life domains to preserve and faithfully transmit DNA to the next generation. In humans, NER is essential to prevent DNA damage-induced mutation accumulation and cell death leading to cancer and aging. NER is a versatile DNA repair pathway that repairs many types of DNA damage which distort the DNA helix, such as those induced by solar UV light. A detailed molecular model of the NER pathway has emerged from in vi...

  20. Nucleotide sequence of Klebsiella pneumoniae lac genes.

    Buvinger, W E; Riley, M

    1985-01-01

    The nucleotide sequences of the Klebsiella pneumoniae lacI and lacZ genes and part of the lacY gene were determined, and these genes were located and oriented relative to one another. The K. pneumoniae lac operon is divergent in that the lacI and lacZ genes are oriented head to head, and complementary strands are transcribed. Besides base substitutions, the lacZ genes of K. pneumoniae and Escherichia coli have suffered short distance shifts of reading frame caused by additions or deletions or...

  1. Histone displacement during nucleotide excision repair

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.

    2012-01-01

    Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called......, thus allowing repair proteins to efficiently access DNA. On the other hand, after completion of the repair, the chromatin must be returned to its previous undamaged state. Chromatin remodeling can refer to three separate but interconnected processes, histone post-translational modifications, insertion...

  2. Classifying Coding DNA with Nucleotide Statistics

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  3. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  4. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    William Orsi

    Full Text Available The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC, nitrate, sulfide, and dissolved inorganic carbon (DIC. These correlations are supported by terminal restriction length polymorphism (TRFLP analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  5. Molecular phylogeny of Pneumocystis based on 5.8S rRNA gene and the internal transcribed spacers of rRNA gene sequences

    2008-01-01

    To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis.

  6. Exploring microbial diversity and taxonomy using SSU rRNA hypervariable tag sequencing.

    Susan M Huse

    2008-11-01

    Full Text Available Massively parallel pyrosequencing of hypervariable regions from small subunit ribosomal RNA (SSU rRNA genes can sample a microbial community two or three orders of magnitude more deeply per dollar and per hour than capillary sequencing of full-length SSU rRNA. As with full-length rRNA surveys, each sequence read is a tag surrogate for a single microbe. However, rather than assigning taxonomy by creating gene trees de novo that include all experimental sequences and certain reference taxa, we compare the hypervariable region tags to an extensive database of rRNA sequences and assign taxonomy based on the best match in a Global Alignment for Sequence Taxonomy (GAST process. The resulting taxonomic census provides information on both composition and diversity of the microbial community. To determine the effectiveness of using only hypervariable region tags for assessing microbial community membership, we compared the taxonomy assigned to the V3 and V6 hypervariable regions with the taxonomy assigned to full-length SSU rRNA sequences isolated from both the human gut and a deep-sea hydrothermal vent. The hypervariable region tags and full-length rRNA sequences provided equivalent taxonomy and measures of relative abundance of microbial communities, even for tags up to 15% divergent from their nearest reference match. The greater sampling depth per dollar afforded by massively parallel pyrosequencing reveals many more members of the "rare biosphere" than does capillary sequencing of the full-length gene. In addition, tag sequencing eliminates cloning bias and the sequences are short enough to be completely sequenced in a single read, maximizing the number of organisms sampled in a run while minimizing chimera formation. This technique allows the cost-effective exploration of changes in microbial community structure, including the rare biosphere, over space and time and can be applied immediately to initiatives, such as the Human Microbiome Project.

  7. Strength and Regulation of Seven rRNA Promoters in Escherichia coli.

    Michihisa Maeda

    Full Text Available The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed.

  8. A yeast transcription system for the 5S rRNA gene.

    Keulen, H.; Thomas, D. Y.

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA gen...

  9. Oligonucleotide Fingerprinting of rRNA Genes for Analysis of Fungal Community Composition

    Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

    2002-01-01

    Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones d...

  10. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    Cangelosi, G A; Brabant, W H

    1997-01-01

    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA prob...

  11. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  12. TaxMan: a server to trim rRNA reference databases and inspect taxonomic coverage

    Brandt, B. W.; Bonder, M. J.; Huse, S.M.; Zaura, E.

    2012-01-01

    Amplicon sequencing of the hypervariable regions of the small subunit ribosomal RNA gene is a widely accepted method for identifying the members of complex bacterial communities. Several rRNA gene sequence reference databases can be used to assign taxonomic names to the sequencing reads using BLAST, USEARCH, GAST or the RDP classifier. Next-generation sequencing methods produce ample reads, but they are short, currently ∼100-450 nt (depending on the technology), as compared to the full rRNA g...

  13. Structure of the Hsp110:Hsc70 Nucleotide Exchange Machine

    Schuermann, Jonathan P.; Jiang, Jianwen; Cuellar, Jorge; Llorca, Oscar; Wang, Liping; Gimenez, Luis E.; Jin, Suping; Taylor, Alexander B.; Demeler, Borries; Morano, Kevin A.; Hart, P. John; Valpuesta, Jose M.; Lafer, Eileen M.; Sousa, Rui

    2008-01-01

    Hsp70s mediate protein folding, translocation, and macromolecular complex remodeling reactions. Their activities are regulated by proteins that exchange ADP for ATP from the nucleotide-binding domain (NBD) of the Hsp70. These nucleotide exchange factors (NEFs) include the Hsp110s, which are themselves members of the Hsp70 family. We report the structure of an Hsp110:Hsc70 nucleotide exchange complex. The complex is characterized by extensive protein:protein interactions and symmetric bridging...

  14. Regulation of nucleotide excision repair through ubiquitination

    Jia Li; Audesh Bhat; Wei Xiao

    2011-01-01

    Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

  15. Signal transduction by guanine nucleotide binding proteins.

    Spiegel, A M

    1987-01-01

    High affinity binding of guanine nucleotides and the ability to hydrolyze bound GTP to GDP are characteristics of an extended family of intracellular proteins. Subsets of this family include cytosolic initiation and elongation factors involved in protein synthesis, and cytoskeletal proteins such as tubulin (Hughes, S.M. (1983) FEBS Lett. 164, 1-8). A distinct subset of guanine nucleotide binding proteins is membrane-associated; members of this subset include the ras gene products (Ellis, R.W. et al. (1981) Nature 292, 506-511) and the heterotrimeric G-proteins (also termed N-proteins) (Gilman, A.G. (1984) Cell 36, 577-579). Substantial evidence indicates that G-proteins act as signal transducers by coupling receptors (R) to effectors (E). A similar function has been suggested but not proven for the ras gene products. Known G-proteins include Gs and Gi, the G-proteins associated with stimulation and inhibition, respectively, of adenylate cyclase; transducin (TD), the G-protein coupling rhodopsin to cGMP phosphodiesterase in rod photoreceptors (Bitensky, M.W. et al. (1981) Curr. Top. Membr. Transp. 15, 237-271; Stryer, L. (1986) Annu. Rev. Neurosci. 9, 87-119), and Go, a G-protein of unknown function that is highly abundant in brain (Sternweis, P.C. and Robishaw, J.D. (1984) J. Biol. Chem. 259, 13806-13813; Neer, E.J. et al. (1984) J. Biol. Chem. 259, 14222-14229). G-proteins also participate in other signal transduction pathways, notably that involving phosphoinositide breakdown. In this review, I highlight recent progress in our understanding of the structure, function, and diversity of G-proteins. PMID:2435586

  16. In Vivo Effect of NusB and NusG on rRNA Transcription Antitermination

    Torres, Martha; Balada, Joan-Miquel; Zellars, Malcolm; Squires, Craig; Squires, Catherine L.

    2004-01-01

    Similarities between lambda and rRNA transcription antitermination have led to suggestions that they involve the same Nus factors. However, direct in vivo confirmation that rRNA antitermination requires all of the lambda Nus factors is lacking. We have therefore analyzed the in vivo role of NusB and NusG in rRNA transcription antitermination and have established that both are essential for it. We used a plasmid test system in which reporter gene mRNA was measured to monitor rRNA antiterminato...

  17. Caracterização de rizóbios indicados para produção de inoculantes por meio de sequenciamento parcial do 16S rRNA Characterization of rhizobia indicated for inoculant production using 16S rRNA partial sequencing

    Bethânia Figueiredo Barbosa de Toledo

    2009-04-01

    Full Text Available O objetivo deste trabalho foi confrontar as sequências parciais do gene 16S rRNA de estirpes padrão de rizóbios com as de estirpes recomendadas para a produção de inoculantes no Brasil, com vistas à verificação da confiabilidade do sequenciamento parcial desse gene para a identificação rápida de estirpes. Foram realizados sequenciamentos através de reação em cadeia da polimerase (PCR com iniciadores relativos à região codificadora do gene 16S rRNA entre as bactérias estudadas. Os resultados foram analisados pela consulta de similaridade de nucleotídeos aos do "Basic Local Alignment Search Tool" (Blastn e por meio da interpretação de árvores filogenéticas geradas usando ferramentas de bioinformática. A classificação taxonômica das estirpes Semia recomendadas para inoculação de leguminosas com base em propriedades morfológicas e especificidade hospedeira não foi confirmada em todas as estirpes. A maioria das estirpes estudadas, consultadas no Blastn, é consistente com a classificação proposta pela construção de árvores filogenéticas das sequências destas estirpes, com base na similaridade pelo sequenciamento parcial do gene considerado.The aim of this work was to compare the partial sequences of 16S rRNA gene of rhizobia strain patterns already classified with strains recommended for the production of inoculants in Brazil, in order to verify the reliability of partial sequencing of the gene for the purpose of rapid identification of strains. Polymerase Chain Reaction (PCR sequencing using primers on the coding region of the 16S rRNA gene among the bacteria studied was conducted. The results were analyzed by consulting the nucleotides' similarity based on Basic Local Alignment Search Tool (Blastn and by interpreting the phylogenetic trees generated by bioinformatic tools. The taxonomic classification of Semia strains recommended for legume inoculation based on morphological properties and host specificity was

  18. Methyltransferase Erm(37) Slips on rRNA to Confer Atypical Resistance in Mycobacterium tuberculosis

    Madsen, Ch. T.; Jakobsen, L.; Buriánková, Karolína; Doucet-Populaire, F.; Perdonet, J. L.; Douthwaite, S.

    2005-01-01

    Roč. 280, č. 47 (2005), s. 38942-38947. ISSN 0021-9258 R&D Projects: GA ČR GA310/03/0292 Institutional research plan: CEZ:AV0Z50200510 Keywords : methyltransferase erm * mycobacterium tuberculosis * rRNA Subject RIV: EE - Microbiology, Virology Impact factor: 5.854, year: 2005

  19. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten; Dalgaard, Jacob; Lykke-Andersen, Jens; Phan, Hoa T.N.; Trevisanato, Siro; Østergaard, Laust; Larsen, Niels; Leffers, Henrik

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows is a...

  20. An alternative strategy for bacterial ribosome synthesis: Bacillus subtilis rRNA transcription regulation

    Krásný, Libor; Gourse, Richard. L.

    2004-01-01

    Roč. 23, č. 22 (2004), s. 4473-4483. ISSN 0261-4189 Grant ostatní: National Institutes of Health(US) RO1 GM37048 Institutional research plan: CEZ:AV0Z5052915 Keywords : B. subtilis , GTP concentrations, rRNA transcription Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 10.492, year: 2004

  1. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    van Wezel, G P; Krab, I M; Douthwaite, S; Bibb, M J; Vijgenboom, E; Bosch, L

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, correspondi...

  2. Supramolecular hydrogel of kanamycin selectively sequesters 16S rRNA

    Yang, Zhimou; Kuang, Yi; Li, Xinming; Zhou, Ning; Zhang, Ye; Xu, Bing

    2012-01-01

    As the first example of hydrogelator derived from aminoglycoside antibiotics, the hydrogel of kanamycin indicates that the hydrogel of aminoglycosides preserve the specific interaction with their macromolecular targets (e.g., 16S rRNA), thus illustrating a simple approach to explore and identify possible biological targets of supramolecular nanofibers/hydrogels.

  3. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Linder Markus

    2006-03-01

    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  4. Prebiotic nucleotide synthesis demonstration of a geologically plausible pathway

    Schwartz, A.W.; Veen, van der M.; Bisseling, T.; Chittenden, G.J.

    1975-01-01

    Mineral phosphate (apatite) is activated for the synthesis of nucleotides when dilute solutions containing nucleoside and ammonium oxalate are evaporated in its presence. A natural, igneous fluorapatite was found to be even more effective in nucleotide synthesis than the more soluble hydroxylapatite

  5. Nucleotide sequence of cloned rat serum albumin messenger RNA.

    Sargent, T D; Yang, M; Bonner, J.

    1981-01-01

    The nucleotide sequences of the recombinant DNA inserts of three bacterial plasmid clones containing nearly all of the rat serum albumin mRNA have been determined. A statistical analysis of the nucleotide sequence reveals a pattern of repeated internal homology that confirms the "intragenic triplication" model of albumin evolution.

  6. Oral microbiome profiles: 16S rRNA pyrosequencing and microarray assay comparison.

    Jiyoung Ahn

    Full Text Available OBJECTIVES: The human oral microbiome is potentially related to diverse health conditions and high-throughput technology provides the possibility of surveying microbial community structure at high resolution. We compared two oral microbiome survey methods: broad-based microbiome identification by 16S rRNA gene sequencing and targeted characterization of microbes by custom DNA microarray. METHODS: Oral wash samples were collected from 20 individuals at Memorial Sloan-Kettering Cancer Center. 16S rRNA gene survey was performed by 454 pyrosequencing of the V3-V5 region (450 bp. Targeted identification by DNA microarray was carried out with the Human Oral Microbe Identification Microarray (HOMIM. Correlations and relative abundance were compared at phylum and genus level, between 16S rRNA sequence read ratio and HOMIM hybridization intensity. RESULTS: The major phyla, Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, and Fusobacteria were identified with high correlation by the two methods (r = 0.70∼0.86. 16S rRNA gene pyrosequencing identified 77 genera and HOMIM identified 49, with 37 genera detected by both methods; more than 98% of classified bacteria were assigned in these 37 genera. Concordance by the two assays (presence/absence and correlations were high for common genera (Streptococcus, Veillonella, Leptotrichia, Prevotella, and Haemophilus; Correlation = 0.70-0.84. CONCLUSION: Microbiome community profiles assessed by 16S rRNA pyrosequencing and HOMIM were highly correlated at the phylum level and, when comparing the more commonly detected taxa, also at the genus level. Both methods are currently suitable for high-throughput epidemiologic investigations relating identified and more common oral microbial taxa to disease risk; yet, pyrosequencing may provide a broader spectrum of taxa identification, a distinct sequence-read record, and greater detection sensitivity.

  7. Magnetic and electrical properties of Fe{sub 0.9}Ag{sub 0.1}In{sub 2.3}S{sub 4.4} single crystals

    Bodnar, I. V., E-mail: chemzav@bsuir.by [Belarusian State University of Information and Radio Electronics (Belarus); Trukhanov, S. V. [National Academy of Sciences of Belarus, Scientific and Practical Materials Research Center (Belarus); Barugu, T. H. [Belarusian State University of Information and Radio Electronics (Belarus)

    2015-10-15

    The magnetic and electrical properties of the Fe{sub 0.9}Ag{sub 0.1}In{sub 2.3}S{sub 4.4} single crystal are studied in the temperature range 4–300 K and in magnetic fields of 0–14 T. It is established that the sample under study is paramagnetic. In the ground state, short-range-order correlations typical of a spin glass with a freezing temperature of 10 K are detected. The magnetic ordering temperature is 15 K. The sample is a semiconductor with a resistivity of 3.5 kΩ cm at room temperature. For the Fe{sub 0.9}Ag{sub 0.1}In{sub 2.3}S{sub 4.4} single crystal, a mechanism for the formation of magnetic and electrical states is suggested.

  8. Nucleolin is required for DNA methylation state and the expression of rRNA gene variants in Arabidopsis thaliana.

    Frédéric Pontvianne

    2010-11-01

    Full Text Available In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1. Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre-rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis.

  9. Nucleotide Excision Repair in Caenorhabditis elegans

    Hannes Lans

    2011-01-01

    Full Text Available Nucleotide excision repair (NER plays an essential role in many organisms across life domains to preserve and faithfully transmit DNA to the next generation. In humans, NER is essential to prevent DNA damage-induced mutation accumulation and cell death leading to cancer and aging. NER is a versatile DNA repair pathway that repairs many types of DNA damage which distort the DNA helix, such as those induced by solar UV light. A detailed molecular model of the NER pathway has emerged from in vitro and live cell experiments, particularly using model systems such as bacteria, yeast, and mammalian cell cultures. In recent years, the versatility of the nematode C. elegans to study DNA damage response (DDR mechanisms including NER has become increasingly clear. In particular, C. elegans seems to be a convenient tool to study NER during the UV response in vivo, to analyze this process in the context of a developing and multicellular organism, and to perform genetic screening. Here, we will discuss current knowledge gained from the use of C. elegans to study NER and the response to UV-induced DNA damage.

  10. Software for tag single nucleotide polymorphism selection

    Stram Daniel O

    2005-06-01

    Full Text Available Abstract This paper reviews the theoretical basis for single nucleotide polymorphism (SNP tagging and considers the use of current software made freely available for this task. A distinction between haplotype block-based and non-block-based approaches yields two classes of procedures. Analysis of two different sets of SNP genotype data from the HapMap is used to judge the practical aspects of using each of the programs considered, as well as to make some general observations about the performance of the programs in finding optimal sets of tagging SNPs. Pairwise R2 methods, while the simplest of those considered, do tend to pick more tagging SNPs than are strictly needed to predict unmeasured (non-tagging SNPs, since a combination of two or more tagging SNPs can form a prediction of SNPs that have no direct (pairwise surrogate. Block-based methods that exploit the linkage disequilibrium structure within haplotype blocks exploit this sort of redundancy, but run a risk of over-fitting if used without some care. A compromise approach which eliminates the need first to analyse block structure, but which still exploits simple relationships between SNPs, appears promising.

  11. Nucleotide Phosphohydrolase in Purified Vaccinia Virus

    Munyon, William; Paoletti, Enzo; Ospina, Julio; Grace, James T.

    1968-01-01

    Purified infectious vaccinia virus has been shown to contain an enzyme or enzymes that remove the terminal phosphate group from adenosine triphosphate (ATP), guanosine triphosphate (GTP), uridine triphosphate (UTP), and cytidine triphosphate (CTP). The Km for ATP of this enzyme is 5.5 × 10−4m, and the relative rates of the reaction with ATP, GTP, UTP, and CTP are 1.00, 0.34, 0.15, and 0.29, respectively. The virus enzyme does not react with any of the diphosphates. The rate of the reaction is proportional to the amount of virus added and is linear for 130 min. The virus nucleotide phosphohydrolase activity is greatly stimulated by Mg++ and very slightly stimulated by Ca++. The small residual activity observed in the absence of divalent cations is completely inhibited by ethylenediaminetetraacetic acid. Neither Na+ nor K+ ions, nor any mixture of these, was found to stimulate the reaction significantly, and ouabain, at 10−4m, inhibited the reaction by only 27%. The response of the vaccinia enzyme to mono- and divalent cations and to ouabain indicates that the vaccinia enzyme has different properties from those associated with microsomes and mitochondria. PMID:4986904

  12. High-throughput nucleotide sequence analysis of diverse bacterial communities in leachates of decomposing pig carcasses

    Seung Hak Yang

    2015-09-01

    Full Text Available The leachate generated by the decomposition of animal carcass has been implicated as an environmental contaminant surrounding the burial site. High-throughput nucleotide sequencing was conducted to investigate the bacterial communities in leachates from the decomposition of pig carcasses. We acquired 51,230 reads from six different samples (1, 2, 3, 4, 6 and 14 week-old carcasses and found that sequences representing the phylum Firmicutes predominated. The diversity of bacterial 16S rRNA gene sequences in the leachate was the highest at 6 weeks, in contrast to those at 2 and 14 weeks. The relative abundance of Firmicutes was reduced, while the proportion of Bacteroidetes and Proteobacteria increased from 3–6 weeks. The representation of phyla was restored after 14 weeks. However, the community structures between the samples taken at 1–2 and 14 weeks differed at the bacterial classification level. The trend in pH was similar to the changes seen in bacterial communities, indicating that the pH of the leachate could be related to the shift in the microbial community. The results indicate that the composition of bacterial communities in leachates of decomposing pig carcasses shifted continuously during the study period and might be influenced by the burial site.

  13. Cardiac Na+ Current Regulation by Pyridine Nucleotides

    Liu, Man; Sanyal, Shamarendra; Gao, Ge; Gurung, Iman S.; Zhu, Xiaodong; Gaconnet, Georgia; Kerchner, Laurie J.; Shang, Lijuan L.; Huang, Christopher L-H.; Grace, Andrew; London, Barry; Dudley, Samuel C.

    2009-01-01

    Rationale Mutations in glycerol-3-phosphate dehydrogenase 1-like (GPD1-L) protein reduce cardiac Na+ current (INa) and cause Brugada Syndrome (BrS). GPD1-L has >80% amino acid homology with glycerol-3-phosphate dehydrogenase, which is involved in nicotinamide adenine dinucleotide (NAD)-dependent energy metabolism. Objective Therefore, we tested whether NAD(H) could regulate human cardiac sodium channels (Nav1.5). Methods and Results HEK293 cells stably expressing Nav1.5 and rat neonatal cardiomyocytes were used. The influence of NADH/NAD+ on arrhythmic risk was evaluated in wild-type or SCN5A+/− mouse heart. A280V GPD1-L caused a 2.48 ± 0.17-fold increase in intracellular NADH level (P<0.001). NADH application or co-transfection with A280V GPD1-L resulted in decreased INa (0.48 ± 0.09 or 0.19 ±0.04 of control group, respectively; P<0.01), which was reversed by NAD+, chelerythrine, or superoxide dismutase (SOD). NAD+ antagonism of the Na+ channel downregulation by A280V GPD1-L or NADH was prevented by a protein kinase A (PKA) inhibitor, PKAI6–22. The effects of NADH and NAD+ were mimicked by a phorbol ester and forskolin, respectively. Increasing intracellular NADH was associated with an increased risk of ventricular tachycardia (VT) in wild-type mouse hearts. Extracellular application of NAD+ to SCN5A+/− mouse hearts ameliorated the risk of VT. Conclusions Our results show that Nav1.5 is regulated by pyridine nucleotides, suggesting a link between metabolism and INa. This effect required protein kinase C (PKC) activation and was mediated by oxidative stress. NAD+ could prevent this effect by activating PKA. Mutations of GPD1-L may downregulate Nav1.5 by altering the oxidized to reduced NAD(H) balance. PMID:19745168

  14. Empirical Bayes analysis of single nucleotide polymorphisms

    Ickstadt Katja

    2008-03-01

    Full Text Available Abstract Background An important goal of whole-genome studies concerned with single nucleotide polymorphisms (SNPs is the identification of SNPs associated with a covariate of interest such as the case-control status or the type of cancer. Since these studies often comprise the genotypes of hundreds of thousands of SNPs, methods are required that can cope with the corresponding multiple testing problem. For the analysis of gene expression data, approaches such as the empirical Bayes analysis of microarrays have been developed particularly for the detection of genes associated with the response. However, the empirical Bayes analysis of microarrays has only been suggested for binary responses when considering expression values, i.e. continuous predictors. Results In this paper, we propose a modification of this empirical Bayes analysis that can be used to analyze high-dimensional categorical SNP data. This approach along with a generalized version of the original empirical Bayes method are available in the R package siggenes version 1.10.0 and later that can be downloaded from http://www.bioconductor.org. Conclusion As applications to two subsets of the HapMap data show, the empirical Bayes analysis of microarrays cannot only be used to analyze continuous gene expression data, but also be applied to categorical SNP data, where the response is not restricted to be binary. In association studies in which typically several ten to a few hundred SNPs are considered, our approach can furthermore be employed to test interactions of SNPs. Moreover, the posterior probabilities resulting from the empirical Bayes analysis of (prespecified interactions/genotypes can also be used to quantify the importance of these interactions.

  15. 多浆旱生植物霸王18SrRNA基因的克隆及序列分析%Cloning and sequence analysis of 18S rRNA gene fragment from succulent xerophyte Zygophyllum xanthoxylum

    胡静; 谢俊仁; 王锁民

    2012-01-01

    In order to reveal the relationship between succulent xerophyte Zygophyllum xanthoxylum and other plants and to provide evidences for the biologically evolution, total DNA was extracted from leaves of Z. xanthoxylurn seedlings, and the 18S rRNA gene was cloned by PCR using general primers and cloned into pGEM-T vector. The positive clone identified by PCR was sequenced. The sequencing result revealed that the 18S rRNA gene fragment from Z. xanthoxylum contains 1808 bp. Homology comparison with other plants 18S rRNA gene sequences in the GenBank showed that it shared over 96% nucleotide sequence homology, so it is concluded that 18S rRNA is very conservative gene in plants. However, Homology matrix and Blast showed that Z. xanthoxylurn shared high similarity (98%) with the identified 18S rRNA in Galearia fili formis , Cnidoscolus aconiti folius and Hevea brasiliensis. Phylogenetic tree analysis indicated that Z. xanthoxylum and Panax notoginseng were most consanguineously grouped.%为探讨多浆旱生植物霸王(Zygophyllum xanthoxylum)的生物进化历程及与其他植物的亲缘关系,本研究以霸王叶基因组DNA为模板,使用通用引物扩增其18SrRNA基因片段,并克隆到pGEM—T载体,阳性克隆经鉴定后进行测序。核苷酸序列分析结果表明,该片段长1808bp,所得序列与GenBank中注册的18SrRNA基因序列的同源性均在96%以上。可见,高等植物18SrRNA的基因非常保守。同源性分析与Blast比较结果表明,霸王与小盘木(Galearia filiformis)、驱虫苋(Cnidoscolus aconitifolius)及橡胶树(Herera brasiliensis)同源性最高。系统进化树分析表明,霸王与三七(Panax notoginseng)的亲缘关系最近。

  16. 罗氏沼虾18S rRNA基因生物素标记探针的制备及应用%Preparation and application of the biotin-labeled probe of 18S rRNA gene in Macrobrachium rosenbergii

    高风英; 叶星; 白俊杰; 吴锐全; 劳海华; 简清; 罗建仁

    2005-01-01

    Probes are essential for study of gene expression and regulation. In this study, a method was established to prepare the biotin-labeled probe for 18S rRNA gene of freshwater prawn, Macrobrachium rosenbergii. And the labeled method was used to produce a lysozyme gene probe, then applied in analysis of lysozyme gene expression. Primers were designed according to the nucleotide sequences of 18S rRNA of Decalxxta in order to isolate the 18S rRNA gene sequences of M. rosenbergii. Total genomic DNA was isolated from hepatopancreas of the freshwater prawn. A specific DNA fragment with desired size was amplified by PCR using the total DNA as templates. The DNA fragment was inserted into pGEM-T Easy vector and sequenced. The result of BLAST and alignment analysis confirmed that the DNA fragment isolated was the 18S rRNA gene of M. rosenbergii, which was 418 nt in length.Biotin-labeled probe of the 18S rRNA was then produced by PCR using the recombinant plasmid as templates. The biotin-21-dTTP and the non-labeled dNTP were added to the PCR reaction system. Ratio of the biotin-21-dTTP and the non-labeled dTFP was 3 to 1.The yield of the labeled probe is 300 ng·μL-1. The detection limit of the probe is 60 pg. A biotin-labeled probe of lysozyme gene was prepared by the same label method, and the yield of the lysozyme gene probe is 500 ng·μL-1. These biotin-labeled probes were applied in Northern dot blotting analysis of tissue distribution of lysoyzme mRNA of M. rosenbergii. Signals were scanned and quantified by Analysis System of Biology Image. The signal intensity ratio of the lysozyme to 18S rRNA represents the relative expression level of lysozyme mRNA. The results showed that the lysozyme mRNA existed in all the tissues checked, including eye,muscle, gill, hepatopancreas, haemocytes and intestine. But lysoyzme mRNA levels varied among different tissues. The highest level was found in the intestine, and the second was in the hepatopancreas and the lowest was in the

  17. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment.

    Kwasniewska, Jolanta; Jaskowiak, Joanna

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  18. A renaissance for the pioneering 16S rRNA gene

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  19. Rapid identification of Renibacterium salmoninarum using an oligonucleotide probe complementary to 16S rRNA.

    Mattsson, J G; Gersdorf, H; Jansson, E; Hongslo, T; Göbel, U B; Johansson, K E

    1993-02-01

    Bacterial kidney disease in salmonid fish is caused by the slow-growing Gram-positive rod, Renibacterium salmoninarum. The partial sequence of 16S rRNA from R. salmoninarum was determined and compared with published bacterial 16S rRNA sequences. From this sequence information, a 30-bases-long oligonucleotide was designed and used as a specific probe for identification of R. salmoninarum in filter hybridization experiments. Strong specific hybridization signals were observed for all strains of R. salmoninarum tested. Furthermore, no cross-hybridization could be seen against 22 other bacterial species, among them other salmonid fish pathogens. The detection limit for the probe in direct filter hybridization by the dot-blot technique was 2.5 x 10(4) bacteria. It was also possible to detect R. salmoninarum in clinical samples by direct filter hybridization. PMID:8455640

  20. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  1. Detection of Renibacterium salmoninarum in tissue samples by sequence capture and fluorescent PCR based on the 16S rRNA gene.

    Königsson, Malin Heldtander; Ballagi, Andras; Jansson, Eva; Johansson, Karl-Erik

    2005-02-25

    The 16S rRNA genes from eight isolates of Renibacterium salmoninarum with different origins and dates of isolation were sequenced to evaluate the possibility to construct a diagnostic PCR system with target sites within this gene. The sequences were found to be identical but for one single position in one of the isolates, and two regions with an adequate number of nucleotide differences as compared to closely related species were identified. Species-specific fluorescent PCR primers complementary to these regions were constructed as well as oligonucleotides for DNA preparation by sequence capture. A mimic molecule was constructed to be used as an internal control. The PCR was specific and allowed the detection of DNA equivalent to 1-10 R. salmoninarum genomes per reaction. The DNA preparation with sequence capture and analysis by PCR with a mimic was found to be a reliable method for analysis of kidneys from fish with BKD. The amount of PCR inhibiting substances present in the tissue was reduced, and the relevant DNA was concentrated in the capture step. Furthermore, the use of the mimic molecule in the system assured that false negative results could be identified. PMID:15708821

  2. Phylogeny of the malarial genus Plasmodium, derived from rRNA gene sequences.

    Escalante, A A; Ayala, F. J.

    1994-01-01

    Malaria is among mankind's worst scourges, affecting many millions of people, particularly in the tropics. Human malaria is caused by several species of Plasmodium, a parasitic protozoan. We analyze the small subunit rRNA gene sequences of 11 Plasmodium species, including three parasitic to humans, to infer their evolutionary relationships. Plasmodium falciparum, the most virulent of the human species, is closely related to Plasmodium reichenowi, which is parasitic to chimpanzee. The estimate...

  3. Direct ribosome isolation from soil to extract bacterial rRNA for community analysis.

    Felske, A; B. Engelen; Nübel, U; Backhaus, H

    1996-01-01

    A simple method that combines an adapted ribosome isolation method and a common RNA extraction step has been developed for selective recovery of intact rRNA from natural microbial communities in soil. After mechanical cell lysis, ribosomes are separated by centrifugation steps, avoiding massive humic acid contamination and RNA degradation. The protocol accommodates the complex composition of soils by blocking adsorbing surfaces and humic acids with polyvinylpyrrolidone and bovine serum albumi...

  4. rRNA genes from the lower chordate Herdmania momus: structural similarity with higher eukaryotes.

    Degnan, B M; Yan, J.; Hawkins, C J; Lavin, M F

    1990-01-01

    Ascidians, primitive chordates that have retained features of the likely progenitors to all vertebrates, are a useful model to study the evolutionary relationship of chordates to other animals. We have selected the well characterized ribosomal RNA (rRNA) genes to investigate this relationship, and we describe here the cloning and characterization of an entire ribosomal DNA (rDNA) tandem repeat unit from a lower chordate, the ascidian Herdmania momus. rDNA copy number and considerable sequence...

  5. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    Haltiner, M M; Smale, S T; Tjian, R

    1986-01-01

    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this...

  6. 18S rRNA suggests that Entoprocta are protostomes, unrelated to Ectoprocta

    Mackey, L.Y.; Winnepenninckx, B.; Wachter, R.; Backeljau, T.; Emschermann, P.; Garey, J.R.

    1996-01-01

    The Ento- and Ectoprocta are sometimes placed together in the Bryozoa, which have variously been regarded as proto- or deuterostomes. However, Entoprocta have also been allied to the pseudocoelomates, while Ectoprocta are often united with the Brachiopoda and Phoronida in the (super)phylum Lophophorata. Hence, the phylogenetic relationships of these taxa are still much debated. We determined complete 18S rRNA sequences of two entoprocts, an ectoproct, an inarticulate brachiopod, a phoronid, t...

  7. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    Mohammad Bagher Javadi Nobandegani; Halimi Mohd Saud; Wong Mui Yun

    2015-01-01

    Phosphate solubilizing bacteria (PSB) can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang) oil palm field (University Putra Malaysia). Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta sub...

  8. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    Anna eKiryk

    2013-11-01

    Full Text Available Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer´s disease (AD and may play a role in dementia. Moreover aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3 and dentate gyrus. Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that thirty-six transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the dentate gyrus a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving

  9. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  10. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness.

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan

    2016-06-01

    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general. PMID:26119842

  11. rRNA Binding Sites and the Molecular Mechanism of Action of the Tetracyclines.

    Chukwudi, Chinwe U

    2016-08-01

    The tetracycline antibiotics are known to be effective in the treatment of both infectious and noninfectious disease conditions. The 16S rRNA binding mechanism currently held for the antibacterial action of the tetracyclines does not explain their activity against viruses, protozoa that lack mitochondria, and noninfectious conditions. Also, the mechanism by which the tetracyclines selectively inhibit microbial protein synthesis against host eukaryotic protein synthesis despite conservation of ribosome structure and functions is still questionable. Many studies have investigated the binding of the tetracyclines to the 16S rRNA using the small ribosomal subunit of different bacterial species, but there seems to be no agreement between various reports on the exact binding site on the 16S rRNA. The wide range of activity of the tetracyclines against a broad spectrum of bacterial pathogens, viruses, protozoa, and helminths, as well as noninfectious conditions, indicates a more generalized effect on RNA. In the light of recent evidence that the tetracyclines bind to various synthetic double-stranded RNAs (dsRNAs) of random base sequences, suggesting that the double-stranded structures may play a more important role in the binding of the tetracyclines to RNA than the specific base pairs, as earlier speculated, it is imperative to consider possible alternative binding modes or sites that could help explain the mechanisms of action of the tetracyclines against various pathogens and disease conditions. PMID:27246781

  12. Characterization of Hydrocortisone Biometabolites and 18S rRNA Gene in Chlamydomonas reinhardtii Cultures

    Seyed Bagher Mosavi-Azam

    2008-10-01

    Full Text Available A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1. This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25ºC for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17b-Dihydroxyandrost-4-en-3-one (2, 11b-hydroxyandrost-4-en-3,17-dione (3, 11b,17a,20b,21-tetrahydroxypregn-4-en-3-one (4 and prednisolone (5 were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  13. Molecular systematics of Volvocales (Chlorophyceae, Chlorophyta) based on exhaustive 18S rRNA phylogenetic analyses.

    Nakada, Takashi; Misawa, Kazuharu; Nozaki, Hisayoshi

    2008-07-01

    The taxonomy of Volvocales (Chlorophyceae, Chlorophyta) was traditionally based solely on morphological characteristics. However, because recent molecular phylogeny largely contradicts the traditional subordinal and familial classifications, no classification system has yet been established that describes the subdivision of Volvocales in a manner consistent with the phylogenetic relationships. Towards development of a natural classification system at and above the generic level, identification and sorting of hundreds of sequences based on subjective phylogenetic definitions is a significant step. We constructed an 18S rRNA gene phylogeny based on 449 volvocalean sequences collected using exhaustive BLAST searches of the GenBank database. Many chimeric sequences, which can cause fallacious phylogenetic trees, were detected and excluded during data collection. The results revealed 21 strongly supported primary clades within phylogenetically redefined Volvocales. Phylogenetic classification following PhyloCode was proposed based on the presented 18S rRNA gene phylogeny along with the results of previous combined 18S and 26S rRNA and chloroplast multigene analyses. PMID:18430591

  14. Details of gastropod phylogeny inferred from 18S rRNA sequences.

    Winnepenninckx, B; Steiner, G; Backeljau, T; De Wachter, R

    1998-02-01

    Some generally accepted viewpoints on the phylogenetic relationships within the molluscan class Gastropoda are reassessed by comparing complete 18S rRNA sequences. Phylogenetic analyses were performed using the neighbor-joining and maximum parsimony methods. The previously suggested basal position of Archaeogastropoda, including Neritimorpha and Vetigastropoda, in the gastropod clade is confirmed. The present study also provides new molecular evidence for the monophyly of both Caenogastropoda and Euthyneura (Pulmonata and Opisthobranchia), making Prosobranchia paraphyletic. The relationships within Caenogastropoda and Euthyneura data turn out to be very unstable on the basis of the present 18S rRNA sequences. The present 18S rRNA data question, but are insufficient to decide on, muricacean (Neogastropoda), neotaenioglossan, pulmonate, or stylommatophoran monophyly. The analyses also focus on two systellommatophoran families, namely, Veronicellidae and Onchidiidae. It is suggested that Systellommatophora are not a monophyletic unit but, due to the lack of stability in the euthyneuran clade, their affinity to either Opisthobranchia or Pulmonata could not be determined. PMID:9479694

  15. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  16. Nucleotide Sequence - KOME | LSDB Archive [Life Science Database Archive metadata

    Full Text Available [ Credits ] BLAST Search Image Search Home About Archive Update History Contact us ...rtio About This Database Database Description Download License Update History of This Database Site Policy | Contact Us Nucleotide Sequence - KOME | LSDB Archive ...

  17. Nucleotide Metabolism and its Control in Lactic Acid Bacteria

    Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal;

    2005-01-01

    Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including the...... interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods for...... manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

  18. Association study of nonsynonymous single nucleotide polymorphisms in schizophrenia

    Carrera, Noa; Arrojo, Manuel; Sanjuán, Julio;

    2012-01-01

    Genome-wide association studies using several hundred thousand anonymous markers present limited statistical power. Alternatively, association studies restricted to common nonsynonymous single nucleotide polymorphisms (nsSNPs) have the advantage of strongly reducing the multiple testing problem...

  19. Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome

    Carlos; W; Nossa; William; E; Oberdorf; Jφrn; A; Aas; Bruce; J; Paster; Todd; Z; DeSantis; Eoin; L; Brodie; Daniel; Malamud; Michael; A; Poles

    2010-01-01

    AIM:To design and validate broad-range 16S rRNA primers for use in high throughput sequencing to classify bacteria isolated from the human foregut microbiome.METHODS:A foregut microbiome dataset was constructed using 16S rRNA gene sequences obtained from oral,esophageal,and gastric microbiomes produced by Sanger sequencing in previous studies represented by 219 bacterial species.Candidate primers evaluated were from the European rRNA database.To assess the effect of sequence length on accuracy of classifica...

  20. Tissue-specific accelerated aging in nucleotide excision repair deficiency

    Laura J. Niedernhofer

    2008-01-01

    Nucleotide excision repair (NER) is a multi-step DNA repair mechanism that removes helix-distorting modified nucleotides from the genome. NER is divided into two subpathways depending on the location of DNA damage in the genome and how it is first detected. Global genome NER identifies and repairs DNA lesions throughout the genome. This subpathway of NER primarily protects against the accumulation of mutations in the genome. Transcription-coupled (TC) NER rapidly repairs lesions in the transc...

  1. Nucleotide sequence and genome organization of carnation mottle virus RNA.

    Guilley, H; Carrington, J C; Balàzs, E; Jonard, G; Richards, K; Morris, T J

    1985-01-01

    The complete nucleotide sequence of carnation mottle genomic RNA (4003 nucleotides) is presented. The sequence was determined for cloned cDNA copies of viral RNA containing over 99% of the sequence and was completed by direct sequence analysis of RNA and cDNA transcripts. The sequence contains two long open reading frames which together can account for observed translation products. One translation product would arise by suppression of an amber termination codon and the sequence raises the po...

  2. Quantitative Analysis of Guanine Nucleotide Exchange Factors (GEFs) as Enzymes

    Randazzo, Paul A.; Jian, Xiaoying; Chen, Pei-Wen; Zhai, Peng; Soubias, Olivier; Northup, John K.

    2014-01-01

    The proteins that possess guanine nucleotide exchange factor (GEF) activity, which include about ~800 G protein coupled receptors (GPCRs), 1 15 Arf GEFs, 2 81 Rho GEFs, 3 8 Ras GEFs, 4 and others for other families of GTPases, 5 catalyze the exchange of GTP for GDP on all regulatory guanine nucleotide binding proteins. Despite their importance as catalysts, relatively few exchange factors (we are aware of only eight for ras superfamily members) have been rigorously characterized kinetically. ...

  3. Thermodynamics of RNA duplexes modified with unlocked nucleic acid nucleotides

    Pasternak, Anna; Wengel, Jesper

    2010-01-01

    Thermodynamics provides insights into the influence of modified nucleotide residues on stability of nucleic acids and is crucial for designing duplexes with given properties. In this article, we introduce detailed thermodynamic analysis of RNA duplexes modified with unlocked nucleic acid (UNA) nucleotide residues. We investigate UNA single substitutions as well as model mismatch and dangling end effects. UNA residues placed in a central position makes RNA duplex structure less favourable by 4...

  4. An efficient rRNA removal method for RNA sequencing in GC-rich bacteria

    Peano Clelia

    2013-01-01

    Full Text Available Abstract Background Next generation sequencing (NGS technologies have revolutionized gene expression studies and functional genomics analysis. However, further improvement of RNA sequencing protocols is still desirable, in order to reduce NGS costs and to increase its accuracy. In bacteria, a major problem in RNA sequencing is the abundance of ribosomal RNA (rRNA, which accounts for 95-98% of total RNA and can therefore hinder sufficient coverage of mRNA, the main focus of transcriptomic studies. Thus, efficient removal of rRNA is necessary to achieve optimal coverage, good detection sensitivity and reliable results. An additional challenge is presented by microorganisms with GC-rich genomes, in which rRNA removal is less efficient. Results In this work, we tested two commercial kits for rRNA removal, either alone or in combination, on Burkholderia thailandensis. This bacterium, chosen as representative of the important Burkholderia genus, which includes both pathogenic and environmental bacteria, has a rather large (6.72 Mb and GC-rich (67.7% genome. Each enriched mRNA sample was sequenced through paired-end Illumina GAIIx run in duplicate, yielding between 10 and 40 million reads. We show that combined treatment with both kits allows an mRNA enrichment of more than 238-fold, enabling the sequencing of almost all (more than 90% B. thailandensis transcripts from less than 10 million reads, without introducing any bias in mRNA relative abundance, thus preserving differential expression profile. Conclusions The mRNA enrichment protocol presented in this work leads to an increase in detection sensitivity up to 770% compared to total RNA; such increased sensitivity allows for a corresponding reduction in the number of sequencing reads necessary for the complete analysis of whole transcriptome expression profiling. Thus we can conclude that the MICROBExpress/Ovation combined rRNA removal method could be suitable for RNA sequencing of whole

  5. An introduction to recurrent nucleotide interactions in RNA.

    Sweeney, Blake A; Roy, Poorna; Leontis, Neocles B

    2015-01-01

    RNA secondary structure diagrams familiar to molecular biologists summarize at a glance the folding of RNA chains to form Watson–Crick paired double helices. However, they can be misleading: First of all, they imply that the nucleotides in loops and linker segments, which can amount to 35% to 50% of a structured RNA, do not significantly interact with other nucleotides. Secondly, they give the impression that RNA molecules are loosely organized in three-dimensional (3D) space. In fact, structured RNAs are compactly folded as a result of numerous long-range, sequence-specific interactions, many of which involve loop or linker nucleotides. Here, we provide an introduction for students and researchers of RNA on the types, prevalence, and sequence variations of inter-nucleotide interactions that structure and stabilize RNA 3D motifs and architectures, using Escherichia coli (E. coli) 16S ribosomal RNA as a concrete example. The picture that emerges is that almost all nucleotides in structured RNA molecules, including those in nominally single-stranded loop or linker regions, form specific interactions that stabilize functional structures or mediate interactions with other molecules. The small number of noninteracting, ‘looped-out’ nucleotides make it possible for the RNA chain to form sharp turns. Base-pairing is the most specific interaction in RNA as it involves edge-to-edge hydrogen bonding (H-bonding) of the bases. Non-Watson–Crick base pairs are a significant fraction (30% or more) of base pairs in structured RNAs. PMID:25664365

  6. Nucleotide-sugar transporters: structure, function and roles in vivo

    Handford M.

    2006-01-01

    Full Text Available The glycosylation of glycoconjugates and the biosynthesis of polysaccharides depend on nucleotide-sugars which are the substrates for glycosyltransferases. A large proportion of these enzymes are located within the lumen of the Golgi apparatus as well as the endoplasmic reticulum, while many of the nucleotide-sugars are synthesized in the cytosol. Thus, nucleotide-sugars are translocated from the cytosol to the lumen of the Golgi apparatus and endoplasmic reticulum by multiple spanning domain proteins known as nucleotide-sugar transporters (NSTs. These proteins were first identified biochemically and some of them were cloned by complementation of mutants. Genome and expressed sequence tag sequencing allowed the identification of a number of sequences that may encode for NSTs in different organisms. The functional characterization of some of these genes has shown that some of them can be highly specific in their substrate specificity while others can utilize up to three different nucleotide-sugars containing the same nucleotide. Mutations in genes encoding for NSTs can lead to changes in development in Drosophila melanogaster or Caenorhabditis elegans, as well as alterations in the infectivity of Leishmania donovani. In humans, the mutation of a GDP-fucose transporter is responsible for an impaired immune response as well as retarded growth. These results suggest that, even though there appear to be a fair number of genes encoding for NSTs, they are not functionally redundant and seem to play specific roles in glycosylation.

  7. Extension of model potential methods to treat charge transfer in open shell systems. Application to the Si3+/He, He2+/He (21S) and He2+/He (23S) systems

    Charge transfer reactions in ion-atom collisions are investigated theoretically for systems involving open-shell configurations. Both model potential and ab-initio methods are used to treat the adiabatic states of the collision complex. A quantum mechanical treatment of the collision dynamics is used. Electron capture cross sections for two representative systems (He2+ in collision with either 21S or 23S metastable He and for Si3+ with ground state He) are calculated in the eV-keV energy range. (author)

  8. Caracterização da região espaçadora 16-23S rDNA para diferenciação de estirpes de rizóbios utilizadas na produção de inoculantes comerciais no Brasil Characterization of the spacer region 16-23S rDNA for differentiation of strains of rhizobia used in the production of commercial inoculants in Brazil

    Andréia Mara Rotta Oliveira

    2012-08-01

    Full Text Available A identificação de estirpes de rizóbio tem sido feita pela especificidade por hospedeiros e ensaios microbiológicos tradicionais. Por constituírem um grupo filogeneticamente heterogêneo, diferentes técnicas moleculares têm sido empregadas para auxiliar na caracterização genética e na identificação de estirpes eficientes e competitivas para a produção de inoculantes. Este trabalho teve por objetivos caracterizar a região espaçadora 16S-23S rDNA das estirpes de rizóbios utilizadas nos inoculantes comercializados no Brasil para espécies leguminosas, utilizando a técnica da PCR em combinação com a de RFLP, e avaliar a possibilidade do uso desse marcador molecular como método auxiliar para identificação das estipes. A amplificação da região espaçadora 16-23 S rDNA das estirpes de rizóbios gerou fragmentos com tamanhos que variaram entre 700pb e 1350pb. Os produtos resultantes da amplificação foram submetidos à digestão com as endonucleases. Mps I, Dde I e Hae III. Os resultados obtidos neste estudo indicam a possibilidade do uso da técnica de PCR-RFLP da região espaçadora 16S-23S rDNA como marcador molecular para a diferenciar as estirpes de rizóbios, em complemento às técnicas microbiológicas tradicionais. Contudo, este marcador não é suficientemente discriminatório para ser usado na identificação das estirpes recomendadas para a produção de inoculantes comerciais.The identification of strains of rhizobia has been made by host specificity and regular microbiological tests. By forming a phylogenetically heterogeneous group, different molecular techniques have been employed to assist in the genetic characterization and identification of efficient and competitive strains for production of inoculants. This study aimed to characterize the spacer region 16S-23S rDNA of the strains of rhizobia used in commercial inoculants in Brazil for legume species, using PCR combined with RFLP, and assess the possibility

  9. Identification of 8-methyladenosine as the modification catalyzed by the radical SAM methyltransferase Cfr that confers antibiotic resistance in bacteria

    Giessing, Anders; Jensen, Søren Skov; Rasmussen, Anette;

    2009-01-01

    The Cfr methyltransferase confers combined resistance to five different classes of antibiotics that bind to the peptidyl transferase center of bacterial ribosomes. The Cfr-mediated modification has previously been shown to occur on nucleotide A2503 of 23S rRNA and has a mass corresponding to an a...

  10. Species identification and profiling of complex microbial communities using shotgun Illumina sequencing of 16S rRNA amplicon sequences.

    Ong, SH; Kukkillaya, VU; Wilm, A; Lay, C; Ho, EX; Low, L; Hibberd, ML; Nagarajan, N.

    2013-01-01

    The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequenc...

  11. Transcriptional down-regulation and rRNA cleavage in Dictyostelium discoideum mitochondria during Legionella pneumophila infection.

    Chenyu Zhang

    Full Text Available Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial

  12. Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide

    Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; Shock, David D.; Kim, Taejin; Schlick, Tamar; Wilson, Samuel H.

    2015-01-01

    Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2'-deoxyguanosine, which is found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate Escherichia coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerases discriminate between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities, nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine and 8-oxo-dGTP(syn) uses its Hoogsteen edge to base pair with adenine. Here we use time-lapse crystallography to follow 8-oxo-dGTP insertion opposite adenine or cytosine with human pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen-bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxo-dGTP uses charge modulation during insertion that can lead to a blocked DNA repair intermediate.

  13. Penning and associative ionisations of argon atoms by collisions with metastable helium atoms He(21S) and He(23S) of thermal energies 0.03-0.40eV

    This work, devoted to the 21S and 23S metastable states of the helium atom, is mainly experimental. It centres on observation of the non-bound states Ar+ and bound states HeAr+ created during collisions of these metastable atoms with argon atoms in the ground state. The Penning and associative ionisation cross-sections corresponding to these two processes were obtained as a function of the relative speed of approach of the He*+Ar particles in the thermal region 1200-4500m/s (0.3-0.40eV). The experimental time of flight method used in this experiment is original in its application to the measurement of reaction products such as Ar+ and HeAr+ ions. The results obtained testify to the efficiency of this method since the variations in the Penning ionisation cross-section sigmasub(IP)(v) and associative ionisation cross-section sigmasub(IA)(v) against speed have not been observed in other laboratories. They are given here for the couples He(23S)+Ar and He(21S) + Ar. The theoretical interpretation attempted for the cross-sections sigmasub(IP)(v) and sigmasub(IA)(v) is based on a very recent model due to the American school of Miller and the Japanese school of Nakamura. This model, common to all interpretations, can lead to different results according to whether quantum effects are taken into account

  14. The spatio-temporal distribution of He (23S1) metastable atoms in a MHz-driven helium plasma jet is influenced by the oxygen/nitrogen ratio of the surrounding atmosphere

    Winter, J.; Santos Sousa, J.; Sadeghi, N.; Schmidt-Bleker, A.; Reuter, S.; Puech, V.

    2015-04-01

    The density of helium He (23S1) metastable atoms is measured in a 1.6 mm diameter MHz-driven atmospheric pressure helium plasma jet by laser absorption spectroscopy with spatial and temporal resolution. The surrounding atmosphere of the jet is varied from pure oxygen to pure nitrogen with a gas shielding device. The highest metastable density of 1.3 × 1013 cm-3 is obtained in the center of the jet close to the nozzle exit at normal atmospheric air conditions. Within 0.3 mm in the radial direction and 2 mm in the axial direction, the He metastable density drops below the detection limit. The obtained He metastable lifetime is almost independent of the shielding gas composition. By analyzing the diffusion of shielding gas species into the effluent it is concluded that their density is too low to explain the observed He metastable lifetime. Instead, impurities from the feed gas, especially water molecules, are more likely to be responsible. However, a drastic change in metastable He density is observed when decreasing the amount of oxygen in the shielding gas. The lower the oxygen amount, the lower the metastable He density. For pure nitrogen, no He metastables are detected at all. By exchanging nitrogen with argon, a similar behavior is observed. Thus, it is concluded that it is the absence of ambient oxygen rather than the elevated presence of nitrogen, which is responsible for the observed decrease in the He (23S1) density.

  15. Molecular epidemiology of Plasmodium species prevalent in Yemen based on 18 s rRNA

    A Azazy Ahmed

    2010-11-01

    Full Text Available Abstract Background Malaria is an endemic disease in Yemen and is responsible for 4.9 deaths per 100,000 population per year and 43,000 disability adjusted life years lost. Although malaria in Yemen is caused mainly by Plasmodium falciparum and Plasmodium vivax, there are no sequence data available on the two species. This study was conducted to investigate the distribution of the Plasmodium species based on the molecular detection and to study the molecular phylogeny of these parasites. Methods Blood samples from 511 febrile patients were collected and a partial region of the 18 s ribosomal RNA (18 s rRNA gene was amplified using nested PCR. From the 86 positive blood samples, 13 Plasmodium falciparum and 4 Plasmodium vivax were selected and underwent cloning and, subsequently, sequencing and the sequences were subjected to phylogenetic analysis using the neighbor-joining and maximum parsimony methods. Results Malaria was detected by PCR in 86 samples (16.8%. The majority of the single infections were caused by P. falciparum (80.3%, followed by P. vivax (5.8%. Mixed infection rates of P. falciparum + P. vivax and P. falciparum + P. malariae were 11.6% and 2.3%, respectively. All P. falciparum isolates were grouped with the strain 3D7, while P. vivax isolates were grouped with the strain Salvador1. Phylogenetic trees based on 18 s rRNA placed the P. falciparum isolates into three sub-clusters and P. vivax into one cluster. Sequence alignment analysis showed 5-14.8% SNP in the partial sequences of the 18 s rRNA of P. falciparum. Conclusions Although P. falciparum is predominant, P. vivax, P. malariae and mixed infections are more prevalent than has been revealed by microscopy. This overlooked distribution should be considered by malaria control strategy makers. The genetic polymorphisms warrant further investigation.

  16. The role of human ribosomal proteins in the maturation of rRNA and ribosome production

    Robledo, Sara; Rachel A Idol; Crimmins, Dan L.; Ladenson, Jack H.; Mason, Philip J.; Bessler, Monica

    2008-01-01

    Production of ribosomes is a fundamental process that occurs in all dividing cells. It is a complex process consisting of the coordinated synthesis and assembly of four ribosomal RNAs (rRNA) with about 80 ribosomal proteins (r-proteins) involving more than 150 nonribosomal proteins and other factors. Diamond Blackfan anemia (DBA) is an inherited red cell aplasia caused by mutations in one of several r-proteins. How defects in r-proteins, essential for proliferation in all cells, lead to a hum...

  17. Structures of nucleolus and transcription sites of rRNA genes in rat liver cells

    2000-01-01

    We observed the ultrastructure of nucleolus in rat liver cells by conventional electronmicroscopy, and employed cytochemistry NAMA-Ur DNA specific stain method to analyze the distributionand position of nucleolar DNA in situ. The results showed that nucleolar DNA of rat livercells comes from nucleolus-associated chromatin, and continuously extends in the dense fibrillarcomponent (DFC) of nucleolus, localizes at the periphery of fibrillar center (FC) and in DFC. Furthermore,by employing anti-DNA/RNA hybrid antibodies, we directly and selectively labeled transcriptionsites of rRNA genes and testified that localization of transcription sites not only to DFC butalso to the periphery of FC.

  18. Evolution of green plants as deduced from 5S rRNA sequences

    Hori, Hiroshi; Lim, Byung-Lak; OSAWA, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land pl...

  19. Phosphorus-33-labeled nucleotide 5'-triphosphates: Applications in DNA analysis

    Synthesis of [γ-33P] adenosine 5'-triphosphate and [α-33P]2'-deoxyadenosine 5'-triphosphate was accomplished in a way similar to the preparation of 32P-labeled nucleotides. These nucleotides were then used in a variety of molecular biological applications. The techniques of DNA sequencing and nucleic acid hybridization were used to evaluate potential applications for 33P labeled nucleotides. The 33P nucleotides were compared with the 32P and 35S nucleotide equivalents for the ability to serve as substrates for various enzymes used to label DNA, T4-bacteriophage polynucleotide kinase, E. coli DNA polymerase, and T7 DNA polymerase. The products of there reactions were either separated by polyacrylamide gel electrophoresis (DNA sequencing) or used as hybridization probes on a nylon membrane. The isotopically labeled DNA was detected by autoradiography on X-ray film. The film was evaluated for relative sensitivity of the film versus time for each isotope and the sharpness or resolution of the exposed bands on the film

  20. Dynamics of Charge Transfer in Ordered and Chaotic Nucleotide Sequences

    Fialko, N S

    2013-01-01

    Charge transfer is considered in systems composed of a donor, an acceptor and bridge sites of (AT) nucleotide pairs. For a bridge consisting of 180 (AT) pairs, three cases are dealt with: a uniform case, when all the nucleotides in each strand are identical; an ordered case, when nucleotides in each DNA strand are arranged in an orderly fashion; a chaotic case, when (AT) and (TA) pairs are arranged randomly. It is shown that in all the cases a charge transfer from a donor to an acceptor can take place. All other factors being equal, the transfer is the most efficient in the uniform case, the ordered and chaotic cases are less and the least efficient, accordingly. The results obtained are in agreement with experimental data on long-range charge transfer in DNA.

  1. GENE 16S RRNA SEQUENCE PHYLOGENETIC ANALYSIS OF LYSINE PRODUCERS STRAINS

    G. S. Andriiash

    2014-12-01

    Full Text Available The phylogenetic relationships of strainsproducers of essential amino acids of aspartate family Brevibacterium sp. UCM Ac-674 (Brevibacterium sp. 90, Brevibacterium sp. IMV Ac-5004 (Brevibacterium sp. 90H, Brevibacterium sp. UCM Ac-675 (Brevibacterium sp. E531, mutant strain Brevibacterium sp. IMV B-7447 from the «Collections strains and lines of plants for food and agricultural biotechnology SO “Institute for Food Biotechnology and Genomics” of National Academy of Sciences of Ukraine were investigated. The affiliation strain Brevibacterium sp. IMV B-7447 to the genus Brevibacterium within the sequences of the genes based on 16S rRNA was confirmed. The dendogram of phylogenetic relationships of studied strains and related strains Brevibacterium from database GenBank was constructed. It was shown that by the criterion of homology gene sequences based on 16S rRNA the investigated strains-producers belong to three phylogenetic groups. It was established that the mutant strain Brevibacterium sp. ІMV B-7447 has no analogues in the database GenBank.

  2. Analysis of Guanine Nucleotide Binding and Exchange Kinetics of the Escherichia coli GTPase Era

    Sullivan, S M; Mishra, R.; Neubig, R. R.; Maddock, J. R.

    2000-01-01

    Era is an essential Escherichia coli guanine nucleotide binding protein that appears to play a number of cellular roles. Although the kinetics of Era guanine nucleotide binding and hydrolysis have been described, guanine nucleotide exchange rates have never been reported. Here we describe a kinetic analysis of guanine nucleotide binding, exchange, and hydrolysis by Era using the fluorescent mant (N-methyl-3′-O-anthraniloyl) guanine nucleotide analogs. The equilibrium binding constants (KD) fo...

  3. Fluorescence chemosensors with pyrene and their interaction with nucleotide phosphate

    李华平; 汪鹏飞; 吴世康

    1999-01-01

    A group of fluorescence chemosensor with pyrene, compounds (Ⅰ), (Ⅱ) and (Ⅲ), were synthesized The fluorescence spectra and the lifetime of these compounds were carefully measured. The fluorescence quenching spec tra of pyrenyl butyric acid, compounds (Ⅰ), (Ⅱ) and (Ⅲ) by different nucleotide phosphates, AMP ADP, ATP dTTP, were also recorded and studied. The quenching and the stability constants were calculated by Stern-Volmer equa tion and eq. (2), respectively. The mechanism of interaction between fluorescence chemosensor and nucleotide phos phate was didscussed based on the comparison of the results obtained with the CPK model of free molecules of these com pounds in the ground state.

  4. Exogenous Nucleotides Antagonize the Developmental Toxicity of Ethanol In Vitro

    Jie Zhao; Jia-Xi Zhao; Ya-Jun Xu

    2013-01-01

    The objective of this study was to assess whether nucleotides supplementation in vitro could suppress ethanol-induced developmental toxicity in mouse. The models of whole embryo culture (WEC) and midbrain (MB) cell micromass culture were used in this study. In WEC system, exposure to 4.0 mg/mL ethanol for 48 h yielded various developmental malformations of the mice embryos. Nucleotides supplementation (0.16, 0.80, 4.00, 20.00, and 100.00 mg/L) improved the growth parameters to some extent, an...

  5. Activated Ras interacts with the Ral guanine nucleotide dissociation stimulator.

    Hofer, F.; Fields, S; Schneider, C; Martin, G S

    1994-01-01

    The yeast two-hybrid system was used to identify proteins that interact with Ras. The H-Ras protein was found to interact with a guanine nucleotide dissociation stimulator (GDS) that has been previously shown to regulate guanine nucleotide exchange on another member of the Ras protein family, Ral. The interaction is mediated by the C-terminal, noncatalytic segment of the RalGDS and can be detected both in vivo, using the two-hybrid system, and in vitro, with purified recombinant proteins. The...

  6. Biocuration of functional annotation at the European nucleotide archive.

    Gibson, Richard; Alako, Blaise; Amid, Clara; Cerdeño-Tárraga, Ana; Cleland, Iain; Goodgame, Neil; Ten Hoopen, Petra; Jayathilaka, Suran; Kay, Simon; Leinonen, Rasko; Liu, Xin; Pallreddy, Swapna; Pakseresht, Nima; Rajan, Jeena; Rosselló, Marc; Silvester, Nicole; Smirnov, Dmitriy; Toribio, Ana Luisa; Vaughan, Daniel; Zalunin, Vadim; Cochrane, Guy

    2016-01-01

    The European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena) is a repository for the submission, maintenance and presentation of nucleotide sequence data and related sample and experimental information. In this article we report on ENA in 2015 regarding general activity, notable published data sets and major achievements. This is followed by a focus on sustainable biocuration of functional annotation, an area which has particularly felt the pressure of sequencing growth. The importance of functional annotation, how it can be submitted and the shifting role of the biocurator in the context of increasing volumes of data are all discussed. PMID:26615190

  7. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    Long, Katherine S.; Vester, Birte

    2012-01-01

    linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design...

  8. Analysis of the Precursor rRNA Fractions of Rapidly Growing Mycobacteria: Quantification by Methods That Include the Use of a Promoter (rrnA P1) as a Novel Standard†

    Menéndez, María del Carmen; Rebollo, María José; Núñez, María del Carmen; Cox, Robert A.; García, María Jesús

    2005-01-01

    Mycobacterial species are able to control rRNA production through variations in the number and strength of promoters controlling their rrn operons. Mycobacterium chelonae and M. fortuitum are members of the rapidly growing mycobacterial group. They carry a total of five promoters each, encoded, respectively, by one and two rrn operons per genome. Quantification of precursor rrn transcriptional products (pre-rrn) has allowed detection of different promoter usage during cell growth. Bacteria growing in several culture media with different nutrient contents were compared. Balanced to stationary phases were analyzed. Most promoters were found to be used at different levels depending on the stage of bacterial growth and the nutrient content of the culture medium. Some biological implications are discussed. Sequences of the several promoters showed motifs that could be correlated to their particular level of usage. A product corresponding to the first rrnA promoter in both species, namely, rrnA P1, was found to contribute at a low and near-constant level to pre-rRNA synthesis, regardless of the culture medium used and the stage of growth analyzed. This product was used as a standard to quantitate rRNA gene expression by real-time PCR when M. fortuitum infected macrophages. It was shown that this bacterium actively synthesizes rRNA during the course of infection and that one of its rrn operons is preferentially used under such conditions. PMID:15629925

  9. Changes in rRNA levels during stress invalidates results from mRNA blotting: Fluorescence in situ rRNA hybridization permits renormalization for estimation of cellular mRNA levels

    Hansen, M.C.; Nielsen, A.K.; Molin, Søren; Hammer, Karin; Kilstrup, Mogens

    2001-01-01

    experiments, in which mRNA levels routinely are normalized to a fixed amount of extracted total RNA. The cellular levels of specific mRNA species were estimated using a renormalization with the total RNA content per cell. By a combination of fluorescence in situ rRNA hybridization, which estimates the...... relative level of rRNA per cell, and slot blotting to rRNA probes, which estimates the level of rRNA per extracted total RNA, the amount of RNA per cell was calculated in a series of heat shock experiments with the gram-positive bacterium Lactococcus lactis. It was found that the level of rRNA per cell......Regulation of gene expression can be analyzed by a number of different techniques. Some techniques monitor the level of specific mRNA directly, and others monitor indirectly by determining the level of enzymes encoded by the mRNA. Each method has its own inherent way of normalization. When results...

  10. Evolutionary origin of Plasmodium and other Apicomplexa based on rRNA genes.

    Escalante, A.A.; Ayala, F J

    1995-01-01

    We have explored the evolutionary history of the Apicomplexa and two related protistan phyla, Dinozoa and Ciliophora, by comparing the nucleotide sequences of small subunit ribosomal RNA genes. We conclude that the Plasmodium lineage, to which the malarial parasites belong, diverged from other apicomplexan lineages (piroplasmids and coccidians) several hundred million years ago, perhaps even before the Cambrian. The Plasmodium radiation, which gave rise to several species parasitic to humans,...

  11. Fine and hyperfine structure spectra of the ultra-violet 23S → 53P transition in 4He and 3He with a frequency doubled CW ring laser, detected via associative ionization

    High resolution laser spectroscopy coupled to a sensitive method of detection via mass analysis of He+2 ions produced in He(53P) + He(11S) collisions, is used to obtain the fine and hyperfine spectra of the ultra-violet He 23S → 53P transition. A cw tunable UV radiation around 294.5 nm is generated by intracavity frequency doubling a Rhodamine 6G single mode ring dye laser using an ADA crystal. Both spectra enable fine and hyperfine structures to be determined within a few MHz. The magnetic dipole coupling constant A of the 53P term of 3He is found to be -4326 +- 9 MHz (-0.1443 +- 0.0003 cm-1). (orig.)

  12. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-01-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  13. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes.

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-06-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  14. Metagenomic 16s rRNA investigation of microbial communities in the Black Sea estuaries in South-West of Ukraine.

    Bobrova, Oleksandra; Kristoffersen, Jon Bent; Oulas, Anastasis; Ivanytsia, Volodymyr

    2016-01-01

    The Black Sea estuaries represent interfaces of the sea and river environments. Microorganisms that inhabit estuarine water play an integral role in all biochemical processes that occur there and form unique ecosystems. There are many estuaries located in the Southern-Western part of Ukraine and some of them are already separated from the sea. The aim of this research was to determine the composition of microbial communities in the Khadzhibey, Dniester and Sukhyi estuaries by metagenomic 16S rDNA analysis. This study is the first complex analysis of estuarine microbiota based on isolation of total DNA from a biome that was further subjected to sequencing. DNA was extracted from water samples and sequenced on the Illumina Miseq platform using primers to the V4 variable region of the 16S rRNA gene. Computer analysis of the obtained raw sequences was done with QIIME (Quantitative Insights Into Microbial Ecology) software. As the outcome, 57970 nucleotide sequences were retrieved. Bioinformatic analysis of bacterial community in the studied samples demonstrated a high taxonomic diversity of Prokaryotes at above genus level. It was shown that majority of 16S rDNA bacterial sequences detected in the estuarine samples belonged to phyla Cyanobacteria, Proteobacteria, Bacteroidetes, Actinobacteria, Verrucomicrobia, Planctomycetes. The Khadhzibey estuary was dominated by the Proteobacteria phylum, while Dniester and Sukhyi estuaries were characterized by dominance of Cyanobacteria. The differences in bacterial populations between the Khadzhibey, Dniester and Sukhyi estuaries were demonstrated through the Beta-diversity analysis. It showed that the Khadzhibey estuary's microbial community significantly varies from the Sukhyi and Dniester estuaries. The majority of identified bacterial species is known as typical inhabitants of marine environments, however, for 2.5% of microbial population members in the studied estuaries no relatives were determined. PMID:26929931

  15. The nucleotide sequences of two leghemoglobin genes from soybean

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O; Paludan, K; Marcker, K A

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  16. A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

    Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

    2016-01-01

    The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

  17. Nucleotide excision repair I: from E.coli to yeast.

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

  18. DNA Nucleotides Detection via capacitance properties of Graphene

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

    2016-05-01

    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  19. Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

    Golan, O; Issan, Y; Isak, A;

    2011-01-01

    protective effect is not mediated via those receptors. We found that a wide variety of triphosphate and diphosphate nucleotides (TTP, ITP, deoxyGTP, and GDP), provided significant cardioprotective effect. GMP, guanosine, and ribose phosphate provided no cardioprotective effect. Moreover, we observed that tri...

  20. NMR study of conformationally restricted acylic phosphonate nucleotides

    Poštová Slavětínská, Lenka; Pohl, Radek; Rejman, Dominik

    Hersonissos : -, 2013. s. 609-609. [EUROMAR 2013. A European Magnetic Resonance Meeting. 30.06.2013-05.07.2013, Hersonissos] R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : acyclic phosphonate nucleotides * conformation * pyrrolidine ring * NMR spectra * PSEUROT program * pD dependence * molecular modeling Subject RIV: CB - Analytical Chemistry, Separation

  1. Nucleotide diversity and linkage disequilibrium in balsam poplar (Populus balsamifera).

    Olson, Matthew S; Robertson, Amanda L; Takebayashi, Naoki; Silim, Salim; Schroeder, William R; Tiffin, Peter

    2010-04-01

    *Current perceptions that poplars have high levels of nucleotide variation, large effective population sizes, and rapid decay of linkage disequilibrium are based primarily on studies from one poplar species, Populus tremula. *We analysed 590 gene fragments (average length 565 bp) from each of 15 individuals from different populations from throughout the range of Populus balsamifera. *Nucleotide diversity (theta(total) = 0.0028, pi = 0.0027) was low compared with other trees and model agricultural systems. Patterns of nucleotide diversity and site frequency spectra were consistent with purifying selection on replacement and intron sites. When averaged across all loci we found no evidence for decay of linkage disequilibrium across 750 bp, consistent with the low estimates of the scaled recombination parameter, rho = 0.0092. *Compared with P. tremula, a well studied congener with a similar distribution, P. balsamifera has low diversity and low effective recombination, both of which indicate a lower effective population size in P. balsamifera. Patterns of diversity and linkage indicate that there is considerable variation in population genomic patterns among poplar species and unlike P. tremula, association mapping techniques in balsam poplar should consider sampling single nucleotide polymorphisms (SNPs) at well-spaced intervals. PMID:20122131

  2. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin;

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from the...

  3. Nucleotide excision repair by dual incisions in plants.

    Canturk, Fazile; Karaman, Muhammet; Selby, Christopher P; Kemp, Michael G; Kulaksiz-Erkmen, Gulnihal; Hu, Jinchuan; Li, Wentao; Lindsey-Boltz, Laura A; Sancar, Aziz

    2016-04-26

    Plants use light for photosynthesis and for various signaling purposes. The UV wavelengths in sunlight also introduce DNA damage in the form of cyclobutane pyrimidine dimers (CPDs) and pyrimidine (6-4) pyrimidone photoproducts [(6-4)PPs] that must be repaired for the survival of the plant. Genome sequencing has revealed the presence of genes for both CPD and (6-4)PP photolyases, as well as genes for nucleotide excision repair in plants, such as Arabidopsis and rice. Plant photolyases have been purified, characterized, and have been shown to play an important role in plant survival. In contrast, even though nucleotide excision repair gene homologs have been found in plants, the mechanism of nucleotide excision repair has not been investigated. Here we used the in vivo excision repair assay developed in our laboratory to demonstrate that Arabidopsis removes CPDs and (6-4)PPs by a dual-incision mechanism that is essentially identical to the mechanism of dual incisions in humans and other eukaryotes, in which oligonucleotides with a mean length of 26-27 nucleotides are removed by incising ∼20 phosphodiester bonds 5' and 5 phosphodiester bonds 3' to the photoproduct. PMID:27071131

  4. Cyclization of nucleotide analogues as an obstacle to polymerization

    Hill, A. R. Jr; Nord, L. D.; Orgel, L. E.; Robins, R. K.

    1988-01-01

    Cyclization of activated nucleotide analogues by intramolecular phosphodiester-bond formation is likely to compete very effectively with template-directed condensation except in the cases of ribo- and arabinonucleotides. This could have excluded derivatives of most sugars from growing polyribonucleotide chains and thus reduced chain-termination in prebiotic polynucleotide synthesis.

  5. Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

    Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.

    2012-01-01

    Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

  6. Novel modified nucleobases, nucleosides and nucleotides: biological activity and applications

    Hocek, Michal

    Louvain-La Neuve : -, 2007. PL4. [ Organic Chemistry , Present and Future. 10.04.2007-13.04.2007, Louvain-La-Neuve] R&D Projects: GA MŠk 1M0508; GA MŠk LC512 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleobases * nucleosides * nucleotides Subject RIV: CC - Organic Chemistry

  7. Spatiotemporal regulation of Rap guanine nucleotide exchange factors

    Consonni, S.V.

    2014-01-01

    Guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) orchestrate the activity of small G-proteins. In response to extracellular stimuli, GEFs and GAPs activate signaling cascades regulated by G-proteins by controlling their regulation in time and in space. Generally, GEFs

  8. THE NUCLEOTIDE RECEPTORS ON MOUSE C2C12 MYOTUBES

    HENNING, RH; NELEMANS, A; VANDENAKKER, J; DENHERTOG, A

    1992-01-01

    1 The response of C2C12 mouse myotubes to stimulation with adenosine triphosphate (ATP) and other nucleotides was studied by measuring changes in membrane potential. 2 A transient hyperpolarization followed by a slowly declining depolarization of the cells was observed in the presence of ATP (10-mu-

  9. Guanosine nucleotide precursor for flavinogenesis of Eremothecium Ashbyii.

    Mitsuda, H; Nakajima, K

    1975-01-01

    The purine precursor in the riboflavin biosynthetic pathway in Eremothecium ashbyii was examined using a guanine analogue, 8-azaguanine, with non-growing cell systems. 1. Riboflavin formation in the culture filtrate was determined at 0, 5, 10 and 20 hr after start of the incubation of the non-growing cells in the presence of xanthine or 8-azaguanine (1 mM, respectively). At 20 hr of incubation, the addition of xanthine stimulated riboflavin formation by 36% and the addition of 8-azaguanine inhibited the formation by 57%. 2. Acid soluble nucleotide pools in the cells were followed at 0, 5, 10 and 20 hr of the incubation period in the presence of xanthine or 8-azaguanine by means of anion exchange column chromatography. The result showed that the GTP pool changed markedly despite the fact that the adenosine nucleotide pool was almost constant irrespective of the presence or absence of these purines till 10 hr of incubation. But, the decrease of the former was overcome in part by the addition of flavinogenic xanthine. Furthermore, the total amounts of GTP and guanosine accumulated in cells in the presence of 8-azaguanine reached the maximum already at 5 hr, attaining a level twice as much as the GTP contents of the control. 3. The role of guanosine nucleotide pool in riboflavin formation was further examined using 8-azaguanine. In this experiment the drug was added to the suspension of non-growing cells at 3 hr or 6 hr after the incubation was started and the reaction was continued till the 12th hr. A more clear-cut correlationship between riboflavin formation and guanosine nucleotide pool was oberved by this experiment. The guanosine nucleotide pool (consisting of GMP, GDP and GTP) increased simultaneously with the inhibition of riboflavin formation. Of the guanosine nucleotides pools, the GMP pool increased 2.7 times above normal upon the addition of 8-azaguanine during the incubation for 6 hr and 5.3 fold for 9 hr. While, the GTP pool increased 1.9 fold above

  10. Global regulation of nucleotide biosynthetic genes by c-Myc.

    Yen-Chun Liu

    Full Text Available BACKGROUND: The c-Myc transcription factor is a master regulator and integrates cell proliferation, cell growth and metabolism through activating thousands of target genes. Our identification of direct c-Myc target genes by chromatin immunoprecipitation (ChIP coupled with pair-end ditag sequencing analysis (ChIP-PET revealed that nucleotide metabolic genes are enriched among c-Myc targets, but the role of Myc in regulating nucleotide metabolic genes has not been comprehensively delineated. METHODOLOGY/PRINCIPAL FINDINGS: Here, we report that the majority of genes in human purine and pyrimidine biosynthesis pathway were induced and directly bound by c-Myc in the P493-6 human Burkitt's lymphoma model cell line. The majority of these genes were also responsive to the ligand-activated Myc-estrogen receptor fusion protein, Myc-ER, in a Myc null rat fibroblast cell line, HO.15 MYC-ER. Furthermore, these targets are also responsive to Myc activation in transgenic mouse livers in vivo. To determine the functional significance of c-Myc regulation of nucleotide metabolism, we sought to determine the effect of loss of function of direct Myc targets inosine monophosphate dehydrogenases (IMPDH1 and IMPDH2 on c-Myc-induced cell growth and proliferation. In this regard, we used a specific IMPDH inhibitor mycophenolic acid (MPA and found that MPA dramatically inhibits c-Myc-induced P493-6 cell proliferation through S-phase arrest and apoptosis. CONCLUSIONS/SIGNIFICANCE: Taken together, these results demonstrate the direct induction of nucleotide metabolic genes by c-Myc in multiple systems. Our finding of an S-phase arrest in cells with diminished IMPDH activity suggests that nucleotide pool balance is essential for c-Myc's orchestration of DNA replication, such that uncoupling of these two processes create DNA replication stress and apoptosis.

  11. 16S rRNA gene sequencing as a tool to study microbial populations in foods and process environments

    Buschhardt, Tasja; Hansen, Tina Beck; Bahl, Martin Iain; Asser Hansen, Martin; Abu Al-Soud, Waleed; Aabo, Søren

    and their role in food safety. During method optimization, we have identified several factors which distort the characterization of microbial populations, including DNA extraction methods, DNA polymerases, and most importantly the analyzed fragment of the 16S rRNA gene. Methods: This study...... culture methods as cross reference. Results: Taxonomic assignments and abundances of sequences in the total community and in the Enterobacteriaceae subpopulation were affected by the 16S rRNA gene variable region, DNA extraction methods, and polymerases chosen. However, community compositions were very......Introduction: Methodological constraints during culturing and biochemical testing have left the true microbiological diversity of foods and process environments unexplored. Culture-independent molecular methods, such as 16S rRNA gene sequencing, may provide deeper insight into microbial communities...

  12. 16S rRNA amplicon sequencing dataset for conventionalized and conventionally raised zebrafish larvae.

    Davis, Daniel J; Bryda, Elizabeth C; Gillespie, Catherine H; Ericsson, Aaron C

    2016-09-01

    Data presented here contains metagenomic analysis regarding the sequential conventionalization of germ-free zebrafish embryos. Zebrafish embryos that underwent a germ-free sterilization process immediately after fertilization were promptly exposed to and raised to larval stage in conventional fish water. At 6 days postfertilization (dpf), these "conventionalized" larvae were compared to zebrafish larvae that were raised in conventional fish water never undergoing the initial sterilization process. Bacterial 16S rRNA amplicon sequencing was performed on DNA isolated from homogenates of the larvae revealing distinct microbiota variations between the two groups. The dataset described here is also related to the research article entitled "Microbial modulation of behavior and stress responses in zebrafish larvae" (Davis et al., 2016) [1]. PMID:27508247

  13. A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel

    Long, Katherine S; Porse, Bo T

    2003-01-01

    The antibiotic chloramphenicol produces modifications in 23S rRNA when bound to ribosomes from the bacterium Escherichia coli and the archaeon Halobacterium halobium and irradiated with 365 nm light. The modifications map to nucleotides m(5)U747 and C2611/C2612, in domains II and V, respectively......, of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site on...

  14. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    Junko Obata

    Full Text Available While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating.

  15. Phylogenetic relationships of Arthrospira strains inferred from 16S rRNA gene and cpcBA-IGS sequences

    Chi-Yong Ahn

    2012-06-01

    Full Text Available Arthrospira platensis and Arthrospira maxima are species of cyanobacteria used in health foods, animal feed, food additives, and fine chemicals. This study conducted a comparison of the 16S rRNA gene and cpcBA-intergenic spacer (cpcBA-IGS sequences in Arthrospira strains from culture collections around the world. A cluster analysis divided the 10 Arthrospira strains into two main genotypic clusters, designated I and II, where Group I contained A. platensis SAG 86.79, UTEX 2340, A. maxima KCTC AG30054, and SAG 49.88, while Group II contained A. platensis PCC 9108, NIES 39, NIES 46, and SAG 257.80. However, although A. platensis PCC 9223 belonged to Group II-2 based on its cpcBA-IGS sequence, this strain also belonged to Group I based on its 16S rRNA gene sequence. Phylogenetic analyses based on the 16S rRNA gene and cpcBA-IGS sequences showed no division between A. platensis and A. maxima, plus the 16S rRNA gene and cpcBAIGS sequence clusters did not indicate any well-defined geographical distribution, instead overlapping in a rather interesting way. Therefore, the current study supports some previous conclusions based on 16S rRNA gene and cpcBA-IGS sequences, which found that Arthrospira taxa are monophyletic. However, when compared with 16S rRNA sequences, cpcBA-IGS sequences may be better suited to resolve close relationships and intraspecies variability.

  16. High-throughput profiling of nucleotides and nucleotide sugars to evaluate their impact on antibody N-glycosylation.

    Villiger, Thomas K; Steinhoff, Robert F; Ivarsson, Marija; Solacroup, Thomas; Stettler, Matthieu; Broly, Hervé; Krismer, Jasmin; Pabst, Martin; Zenobi, Renato; Morbidelli, Massimo; Soos, Miroslav

    2016-07-10

    Recent advances in miniaturized cell culture systems have facilitated the screening of media additives on productivity and protein quality attributes of mammalian cell cultures. However, intracellular components are not routinely measured due to the limited throughput of available analytical techniques. In this work, time profiling of intracellular nucleotides and nucleotide sugars of CHO-S cell fed-batch processes in a micro-scale bioreactor system was carried out using a recently developed high-throughput method based on matrix-assisted laser desorption/ionization (MALDI) time-of-flight mass spectrometry (TOF-MS). Supplementation of various media additives significantly altered the intracellular nucleotides and nucleotide sugars that are inextricably linked to the process of glycosylation. The results revealed that UDP-Gal synthesis appeared to be particularly limiting whereas the impact of elevated UDP-GlcNAc and GDP-Fuc levels on the final glycosylation patterns was only marginally important. In contrast, manganese and asparagine supplementation altered the glycan profiles without affecting intracellular components. The combination of miniaturized cell cultures and high-throughput analytical techniques serves therefore as a useful tool for future quality driven media optimization studies. PMID:27131894

  17. Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus

    Verma Mansi; Lal Devi; Lal Rup

    2011-01-01

    Abstract Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplemen...

  18. SSU rRNA reveals a sequential increase in shell complexity among the euglyphid testate amoebae (Rhizaria: Euglyphida)

    Lara, Enrique; Heger, Thierry J; Mitchell, Edward A D; Meisterfeld, Ralf; Ekelund, Flemming

    2007-01-01

    The existing data on the molecular phylogeny of filose testate amoebae from order Euglyphida has revealed contradictions between traditional morphological classification and SSU rRNA phylogeny and, moreover, the position of several important genera remained unknown. We therefore carried out a study...... aiming to fill several important gaps and better understand the relationships among the main euglyphid testate amoebae and the evolutionary steps that led to the present diversity at a higher level. We obtained new SSU rRNA sequences from five genera and seven species. This new phylogeny obtained shows...

  19. The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis

    Cole, J. R.; Chai, B.; Farris, R. J.; Wang, Q; Kulam, S. A.; McGarrell, D. M.; Garrity, G M; Tiedje, J M

    2004-01-01

    The Ribosomal Database Project (RDP-II) provides the research community with aligned and annotated rRNA gene sequences, along with analysis services and a phylogenetically consistent taxonomic framework for these data. Updated monthly, these services are made available through the RDP-II website (http://rdp.cme.msu.edu/). RDP-II release 9.21 (August 2004) contains 101 632 bacterial small subunit rRNA gene sequences in aligned and annotated format. High-throughput tools for initial taxonomic p...

  20. Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up- and downshift

    Jydegaard-Axelsen, A.M.; Aaes-Jorgensen, A.; Koch, A.G.; Stoumann Jensen, J.; Knochel, S.

    2005-01-01

    Cell morphology, rRNA content, and growth were examined for Listeria monocytogenes LO28 and EGD, respectively, grown in brain-heart infusion (BHI) and on slices of sausage at 10degreesC in 100% CO2, 100% N-2, and air. In CO2, filamentous cells were formed by both strains on sausage slices and by L...... unchanged. On sausage slices, the number of colony forming units also increased rapidly for both strains in response to CO2 downshift. Large variations in rRNA content of individual cells were observed in the tested scenarios. The results demonstrate the risk of underestimating the number of infectious...

  1. Assessing the Fecal Microbiota: An Optimized Ion Torrent 16S rRNA Gene-Based Analysis Protocol

    Foroni, Elena; Duranti, Sabrina; Turroni, Francesca; Lugli, Gabriele Andrea; Sanchez, Borja; Martín, Rebeca; Gueimonde, Miguel; van Sinderen, Douwe; Margolles, Abelardo; Ventura, Marco

    2013-01-01

    Assessing the distribution of 16S rRNA gene sequences within a biological sample represents the current state-of-the-art for determination of human gut microbiota composition. Advances in dissecting the microbial biodiversity of this ecosystem have very much been dependent on the development of novel high-throughput DNA sequencing technologies, like the Ion Torrent. However, the precise representation of this bacterial community may be affected by the protocols used for DNA extraction as well as by the PCR primers employed in the amplification reaction. Here, we describe an optimized protocol for 16S rRNA gene-based profiling of the fecal microbiota. PMID:23869230

  2. Molecular genetic monitoring of bacterial communities in manzala lake, egypt, based on 16S rRNA gene analysis

    El Saied, H.E.

    2007-01-01

    A first molecular genetic study on the diversity of bacterial communities at Manzala Lake, Egypt, was determined by culture-independent 16S rRNA gene analysis. Bulk DNAs were extracted from water and sediment at two different sampling sites namely; Bashtir and Genka, in the lake. The 16S rRNA gene was positively amplified by polymerase chain reaction (PCR) from bulk DNA of each sample, cloned and sequenced. The sequence analysis of one hundred clones from each clone library obtained number of...

  3. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

    Manal Helal

    Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

  4. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.

    2011-01-01

    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stab...

  5. Automated identification of medically important bacteria by 16S rRNA gene sequencing using a novel comprehensive database, 16SpathDB

    Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

    2011-01-01

    Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiol...

  6. Estimation of 16S rRNA gene copy number in several probiotic Lactobacillus strains isolated from the gastrointestinal tract of chicken

    Lee, Chin Mei; Sieo, Chin Chin; Abdullah, Norhani; Ho, Yin Wan

    2008-01-01

    The copy numbers of 16S rRNA genes in 12 probiotic Lactobacillus strains of poultry origin were analyzed. Genomic DNA of the strains was digested with restriction endonucleases that do not cut within the 16S rRNA gene of the strains. This was followed by Southern hybridization with a biotinylated probe complementary to the 16S rRNA gene. The copy number of the 16S rRNA gene within a Lactobacillus species was found to be conserved. From the hybridization results, Lactobacillus salivarius I 24 ...

  7. Nucleotide diversity in the mitochondrial and nuclear compartments of Chlamydomonas reinhardtii: investigating the origins of genome architecture

    Lee Robert W

    2008-05-01

    Full Text Available Abstract Background The magnitude of intronic and intergenic DNA can vary substantially both within and among evolutionary lineages; however, the forces responsible for this disparity in genome compactness are conjectural. One explanation, termed the mutational-burden hypothesis, posits that genome compactness is primarily driven by two nonadaptive processes: mutation and random genetic drift – the effects of which can be discerned by measuring the nucleotide diversity at silent sites (πsilent, defined as noncoding sites and the synonymous sites of protein-coding regions. The mutational-burden hypothesis holds that πsilent is negatively correlated to genome compactness. We used the model organism Chlamydomonas reinhardtii, which has a streamlined, coding-dense mitochondrial genome and an noncompact, intron-rich nuclear genome, to investigate the mutational-burden hypothesis. For measuring πsilent we sequenced the complete mitochondrial genome and portions of 7 nuclear genes from 7 geographical isolates of C. reinhardtii. Results We found significantly more nucleotide diversity in the nuclear compartment of C. reinhardtii than in the mitochondrial compartment: net values of πsilent for the nuclear and mitochondrial genomes were 32 × 10-3 and 8.5 × 10-3, respectively; and when insertions and deletions (indels are factored in, these values become 49 × 10-3 for the nuclear DNA and 11 × 10-3 for the mitochondrial DNA (mtDNA. Furthermore, our investigations of C. reinhardtii revealed 4 previously undiscovered mitochondrial introns, one of which contains a fragment of the large-subunit (LSU rRNA gene and another of which is found in a region of the LSU-rRNA gene not previously reported (for any taxon to contain introns. Conclusion At first glance our results are in opposition to the mutational-burden hypothesis: πsilent was approximately 4 times greater in the nuclear compartment of C. reinhardtii relative to the mitochondrial compartment

  8. Modification of survival of gamma irradiated mice by adenosine nucleotides

    The administration prior to irradiation of adenosine triphosphate (ATP) or other adenosine nucleotides, singly or in combination, increased the radioresistance of mice. Post-irradiation treatment with the adenosine nucleotides had no effect on the survival of the irradiated mice. Dose reduction factors of 2.32 could be obtained by pretreatment of mice with the following combination of protective agents: S-2(4-aminobutylamino)ethyl phosphorothioic aced (WR 2822), cysteamine (MEA) and ATP. Since cyclic AMP levels were unchanged in the spleen or gut by administration of cysteamine and other protectors it is unlikely that the increase in protection was due to changes in cyclic AMP levels. The calcium salt of ATP provided a higher level of protection than the ATP alone, indicating that the protective mechanism of ATP is probably not related to anoxia. (orig.)

  9. Genome-wide patterns of nucleotide polymorphism in domesticated rice

    Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D;

    2007-01-01

    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... plausible explanations for patterns of variation in domesticated rice varieties. If selective sweeps are indeed the explanation for the observed nucleotide data of domesticated rice, it suggests that strong selection can leave its imprint on genome-wide polymorphism patterns, contrary to expectations that...

  10. Nucleotide analogs based on pentaerythritol — An hypothesis

    Schwartz, Alan W.

    1993-06-01

    The synthesis of ribose and ribose-based nucleotides under reasonable prebiotic conditions has not been achieved. Glycerol has been suggested as a structural unit that might have preceded ribose in the evolutionary emergence of RNA. Template-directed oligomerizations of nucleotide analogs based on glycerol, however, have been only partially successful. Recent studies on the effect of ultraviolet irradiation of formaldehyde solutions have shown that the reduced sugar pentaerythritol is formed with great specificity. I argue that pentaerythritol is potentially capable of being converted by simple chemistry into a series of nucleoside analogs related to barbituric acid. These analogs may be able to take part in nucleic acid-like interactions and could therefore be of potential interest as a new class of candidates as RNA precursors.

  11. Identification of cyclic nucleotide gated channels using regular expressions

    Zelman, Alice K.

    2013-09-03

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

  12. The nucleotide exchange factors of Hsp70 molecular chaperone

    Andreas eBracher

    2015-04-01

    Full Text Available Molecular chaperones of the Hsp70 family form an important hub in the cellular protein folding networks in bacteria and eukaryotes, connecting translation with the downstream machineries of protein folding and degradation. The Hsp70 folding cycle is driven by two types of cochaperones: J-domain proteins stimulate ATP hydrolysis by Hsp70, while nucleotide exchange factors (NEFs promote replacement of Hsp70-bound ADP with ATP. Bacteria and organelles of bacterial origin have only one known NEF type for Hsp70, GrpE. In contrast, a large diversity of Hsp70 NEFs has been discovered in the eukaryotic cell. These NEFs belong to the Hsp110/Grp170, HspBP1/Sil1 and BAG domain protein families. In this short review we compare the structures and molecular mechanisms of nucleotide exchange factors for Hsp70 and discuss how these cochaperones contribute to protein folding and quality control in the cell.

  13. The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment

    Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: htinsley@montevallo.edu [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)

    2014-02-26

    For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.

  14. Spontaneous formation and base pairing of plausible prebiotic nucleotides in water.

    Cafferty, Brian J; Fialho, David M; Khanam, Jaheda; Krishnamurthy, Ramanarayanan; Hud, Nicholas V

    2016-01-01

    The RNA World hypothesis presupposes that abiotic reactions originally produced nucleotides, the monomers of RNA and universal constituents of metabolism. However, compatible prebiotic reactions for the synthesis of complementary (that is, base pairing) nucleotides and mechanisms for their mutual selection within a complex chemical environment have not been reported. Here we show that two plausible prebiotic heterocycles, melamine and barbituric acid, form glycosidic linkages with ribose and ribose-5-phosphate in water to produce nucleosides and nucleotides in good yields. Even without purification, these nucleotides base pair in aqueous solution to create linear supramolecular assemblies containing thousands of ordered nucleotides. Nucleotide anomerization and supramolecular assemblies favour the biologically relevant β-anomer form of these ribonucleotides, revealing abiotic mechanisms by which nucleotide structure and configuration could have been originally favoured. These findings indicate that nucleotide formation and selection may have been robust processes on the prebiotic Earth, if other nucleobases preceded those of extant life. PMID:27108699

  15. Spontaneous formation and base pairing of plausible prebiotic nucleotides in water

    Cafferty, Brian J.; Fialho, David M.; Khanam, Jaheda; Krishnamurthy, Ramanarayanan; Hud, Nicholas V.

    2016-01-01

    The RNA World hypothesis presupposes that abiotic reactions originally produced nucleotides, the monomers of RNA and universal constituents of metabolism. However, compatible prebiotic reactions for the synthesis of complementary (that is, base pairing) nucleotides and mechanisms for their mutual selection within a complex chemical environment have not been reported. Here we show that two plausible prebiotic heterocycles, melamine and barbituric acid, form glycosidic linkages with ribose and ribose-5-phosphate in water to produce nucleosides and nucleotides in good yields. Even without purification, these nucleotides base pair in aqueous solution to create linear supramolecular assemblies containing thousands of ordered nucleotides. Nucleotide anomerization and supramolecular assemblies favour the biologically relevant β-anomer form of these ribonucleotides, revealing abiotic mechanisms by which nucleotide structure and configuration could have been originally favoured. These findings indicate that nucleotide formation and selection may have been robust processes on the prebiotic Earth, if other nucleobases preceded those of extant life. PMID:27108699

  16. Molecular genetic characterization of two pedigrees with mitochondrial 12S rRNA C1494T mutation and aminoglycoside-induced hearing loss%两个线粒体12S rRNA C1494T突变及药物性耳聋家系的分子遗传学研究

    李海峰; 陈智斌; 邢光前

    2011-01-01

    the two families. Sequence analysis of the complete mitochondrial genomes in two probands revealed the distinct sets of mtDNA polymorphism (52 other nucleotide changes), in addition to the identical 12S rRNA C1494T mutation. None of these 52 variants, however, were shown to be pathogenic. The whole mitochondrial genome of proband from each of the two families was established that they belong to mitochondrial haplogroups D4 and D5a respectively. No mutations were identified in either TRMU gene or MTO1 gene. Conclusion:C 1494T mutation in the mitochondrial 12S rRNA gene is the main molecular mechanism responsible for the hearing loss in the two pedigrees, and the use of aminoglycnside antibiotics may enhance the phenotypic manifestation of deafnessassociated mitochondrial mutation. Mitochondrial haplogroups and nuclear genes (TRMU and MT01), however, seems not play a role in the phenotypic expression of C 1494T mutation in these two families.

  17. iCLIP: Protein–RNA interactions at nucleotide resolution

    Huppertz I; Attig J; D'Ambrogio A.; Eastonb L; Sibley CR; Sugimoto Y; Tajnik M; K\\xf6nig J; Ule J

    2014-01-01

    RNA-binding proteins (RBPs) are key players in the post-transcriptional regulation of gene expression. Precise knowledge about their binding sites is therefore critical to unravel their molecular function and to understand their role in development and disease. Individual-nucleotide resolution UV crosslinking and immunoprecipitation (iCLIP) identifies protein-RNA crosslink sites on a genome-wide scale. The high resolution and specificity of this method are achieved by an intramolecular cDNA c...

  18. Synthesis of sugar-nucleotide analogs as potential glycosyltransferase inhibitors

    Kóšiová, Ivana; Koiš, P.; Rosenberg, Ivan

    2007-01-01

    Roč. 101, č. 11 (2007), s. 949-950. ISSN 0009-2770. [Pokroky v organické, bioorganické a farmaceutické chemii /42./. 16.11.2007-18.11.2007, Liblice] R&D Projects: GA ČR GA202/05/0628 Grant ostatní: SSTAA(SK) APVV-51-046505 Institutional research plan: CEZ:AV0Z40550506 Keywords : glycosylation * glycosyltransferase * nucleotide analogs * nucleoside phosphonates Subject RIV: CC - Organic Chemistry

  19. Conformation of pyrrolidine ring in pyrrolidine nucleotide analogues

    Pohl, Radek; Buděšínský, Miloš; Rejman, Dominik; Kočalka, Petr; Rosenberg, Ivan

    Praha : Institute of Organic Chemistry and Biochemistry ASCR, 2008 - (Hocek, M.), s. 435-436 ISBN 978-80-86241-29-6. - (Collection Symposium Series. 10). [Symposium on Chemistry of Nucleic Acid Components /14./. Český Krumlov (CZ), 08.06.2008-13.06.2008] R&D Projects: GA MŠk 2B06065 Institutional research plan: CEZ:AV0Z40550506 Keywords : NMR spectroscopy * conformation analysis * nucleotides Subject RIV: CC - Organic Chemistry

  20. Isolation and nucleotide sequence of the gene encoding human rhodopsin.

    Nathans, J; Hogness, D S

    1984-01-01

    We have isolated and completely sequenced the gene encoding human rhodopsin. The coding region of the human rhodopsin gene is interrupted by four introns, which are located at positions analogous to those found in the previously characterized bovine rhodopsin gene. The amino acid sequence of human rhodopsin, deduced from the nucleotide sequence of its gene, is 348 residues long and is 93.4% homologous to that of bovine rhodopsin. Interestingly, those portions of the polypeptide chain predicte...

  1. Single nucleotide polymorphisms of complement component 5 and periodontitis

    L. Chai; Zee, KY; Song, YQ; Leung, WK

    2010-01-01

    BACKGROUND AND OBJECTIVE: Polymorphisms of host defence genes might increase one's risks for periodontitis. This study investigated whether tagging single nucleotide polymorphisms (SNPs) of the gene encoding complement component 5 (C5) are associated with periodontitis in a Hong Kong Chinese population. MATERIAL AND METHODS: Eleven tagging SNPs of 229 patients with at least moderate periodontitis and 207 control subjects without periodontitis were genotyped using an i-plexGOLD MassARRAY mass-...

  2. Utilizing Single Nucleotide Polymorphism Analysis in Determining Parentage of Cattle

    Elbert, Nicole M.

    2013-01-01

    Parentage identification within cattle herds is an important aspect of record keeping. It is essential for accurate registration within a purebred association and decision making for production purposes, such as replacement heifer and sire selection. Methods used to identify parentage have evolved from utilizing blood protein antigens, restriction fragment length polymorphism (RFLP) and microsatellites to the current technology of analyzing DNA profiles for differing single nucleotide polymor...

  3. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  4. Haplotype Information and Linkage Disequilibrium Mapping for Single Nucleotide Polymorphisms

    Lu, Xin; Niu, Tianhua; Liu, Jun

    2003-01-01

    Single nucleotide polymorphisms in the human genome have become an increasingly popular topic in that their analyses promise to be a key step toward personalized medicine. We investigate two related questions, how much the haplotype information contributes to linkage disequilibrium (LD) mapping and whether an in silico haplotype construction preceding the LD analysis can help. For disease gene mapping, using both simulated and real data sets on cystic fibrosis and the Alzheimer disease, we re...

  5. Haplotype Information and Linkage Disequilibrium Mapping for Single Nucleotide Polymorphisms

    Lu, Xin; Niu, Tianhua; Liu, Jun S.

    2003-01-01

    Single nucleotide polymorphisms in the human genome have become an increasingly popular topic in that their analyses promise to be a key step toward personalized medicine. We investigate two related questions, how much the haplotype information contributes to linkage disequilibrium (LD) mapping and whether an in silico haplotype construction preceding the LD analysis can help. For disease gene mapping, using both simulated and real data sets on cystic fibrosis and the Alzheimer disease,...

  6. Expression of Vesicular Nucleotide Transporter in Rat Odontoblasts

    Ikeda, Erina; Goto, Tetsuya; Gunjigake, Kaori; Kuroishi, Kayoko; Ueda, Masae; Kataoka, Shinji; Toyono, Takashi; Nakatomi, Mitsushiro; Seta, Yuji; Kitamura, Chiaki; NISHIHARA, Tatsuji; Kawamoto, Tatsuo

    2016-01-01

    Several theories have been proposed regarding pain transmission mechanisms in tooth. However, the exact signaling mechanism from odontoblasts to pulp nerves remains to be clarified. Recently, ATP-associated pain transmission has been reported, but it is unclear whether ATP is involved in tooth pain transmission. In the present study, we focused on the vesicular nucleotide transporter (VNUT), a transporter of ATP into vesicles, and examined whether VNUT was involved in ATP release from odontob...

  7. MGMT expression: insights into its regulation. 2. Single nucleotide polymorphisms

    Iatsyshyna A. P.; Pidpala O. V.; Lukash L. L.

    2013-01-01

    High intra- and interindividual variations in the expression levels of the human O6-methylguanine-DNA methyltransferase (MGMT) gene have been observed. This DNA repair enzyme can be a cause of resistance of cancer cells to alkylating chemotherapy. It has been studied the association of single nucleotide polymorphisms (SNPs) of MGMT with the risk for different types of cancer, progression-free survival in patients with cancer treated with alkylating chemotherapy, as well as an effect of SNPs o...

  8. A Simple Strategy for Glycosyltransferase-Catalyzed Aminosugar Nucleotide Synthesis

    Zhang, Jianjun; Singh, Shanteri; Hughes, Ryan R.; Zhou, Maoquan; Sunkara, Manjula; Morris, Andrew J.; Thorson, Jon S.

    2014-01-01

    A set of 2-chloro-4-nitrophenyl glucosamino/xylosaminosides were synthesized and assessed as potential substrates in the context of glycosyltransferase-catalyzed formation of the corresponding UDP/TDP-α-D-glucosamino-/xylosaminosugars and single vessel transglycosylation reactions with a model acceptor. This study highlights a robust platform for aminosugar nucleotide synthesis and reveals OleD Loki as a proficient catalyst for U/TDP-aminosugar synthesis and utilization.

  9. Single nucleotide polymorphisms predict symptom severity of autism spectrum disorder

    Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H

    2012-01-01

    Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs) can predict symptom severity of autism spectrum disorder (ASD). We divided 118 ASD children into a mild/moderate autism group (n = 65) and a severe a...

  10. SSE: a nucleotide and amino acid sequence analysis platform

    Simmonds Peter

    2012-01-01

    Abstract Background There is an increasing need to develop bioinformatic tools to organise and analyse the rapidly growing amount of nucleotide and amino acid sequence data in organisms ranging from viruses to eukaryotes. Finding A simple sequence editor (SSE) was developed to create an integrated environment where sequences can be aligned, annotated, classified and directly analysed by a number of built-in bioinformatic programs. SSE incorporates a sequence editor for the creation of sequenc...

  11. Analysis of Single Nucleotide Polymorphism Panels for Bovine DNA Identification

    Blanchard, Kimberly A.

    2013-01-01

    Single nucleotide polymorphisms (SNPs) are single base-pair variations that exist between individuals. There are approximately a million or more SNPs located throughout the genome of each individual animal. Therefore, by taking advantage of these unique polymorphisms, SNPs can be used to resolve questions of unknown parentage in the livestock industry. Currently a panel of 88 SNPs, obtained from a panel of 121 SNPs originally created by USDA-MARC, is commercially available from Fluidigm®. The...

  12. Scambio, a novel guanine nucleotide exchange factor for Rho

    Groffen John; Senadheera Dinithi; Haataja Leena; Hemmeryckx Bianca; Curtis Christina; Heisterkamp Nora

    2004-01-01

    Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is lo...

  13. Spatiotemporal regulation of Rap guanine nucleotide exchange factors

    Consonni, S.V.

    2014-01-01

    Guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) orchestrate the activity of small G-proteins. In response to extracellular stimuli, GEFs and GAPs activate signaling cascades regulated by G-proteins by controlling their regulation in time and in space. Generally, GEFs function as activators of G-proteins by promoting their GTP-bound state while GAPs serve as inhibitors by increasing the rate of GTP hydrolysis. Our understanding of the mechanisms of regulation o...

  14. Monovar: single-nucleotide variant detection in single cells.

    Zafar, Hamim; Wang, Yong; Nakhleh, Luay; Navin, Nicholas; Chen, Ken

    2016-06-01

    Current variant callers are not suitable for single-cell DNA sequencing, as they do not account for allelic dropout, false-positive errors and coverage nonuniformity. We developed Monovar (https://bitbucket.org/hamimzafar/monovar), a statistical method for detecting and genotyping single-nucleotide variants in single-cell data. Monovar exhibited superior performance over standard algorithms on benchmarks and in identifying driver mutations and delineating clonal substructure in three different human tumor data sets. PMID:27088313

  15. The effect of mitochondrial dysfunction on cytosolic nucleotide metabolism

    Madsen, Claus Desler; Lykke, Anne; Rasmussen, Lene Juel

    2010-01-01

    Several enzymes of the metabolic pathways responsible for metabolism of cytosolic ribonucleotides and deoxyribonucleotides are located in mitochondria. Studies described in this paper suggest dysfunction of the mitochondria to affect these metabolic pathways and limit the available levels of...... cytosolic ribonucleotides and deoxyribonucleotides, which in turn can result in aberrant RNA and DNA synthesis. Mitochondrial dysfunction has been linked to genomic instability, and it is possible that the limiting effect of mitochondrial dysfunction on the levels of nucleotides and resulting aberrant RNA...

  16. Single-nucleotide polymorphism identification and genotyping in Camelina sativa

    Singh, Ravinder; Bollina, Venkatesh; Higgins, Erin E.; Clarke, Wayne E.; Eynck, Christina; Sidebottom, Christine; Gugel, Richard; Snowdon, Rod; Parkin, Isobel A. P.

    2015-01-01

    Camelina sativa, a largely relict crop, has recently returned to interest due to its potential as an industrial oilseed. Molecular markers are key tools that will allow C. sativa to benefit from modern breeding approaches. Two complementary methodologies, capture of 3′ cDNA tags and genomic reduced-representation libraries, both of which exploited second generation sequencing platforms, were used to develop a low density (768) Illumina GoldenGate single nucleotide polymorphism (SNP) array. Th...

  17. Genome-wide patterns of nucleotide polymorphism in domesticated rice.

    Ana L Caicedo

    2007-09-01

    Full Text Available Domesticated Asian rice (Oryza sativa is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models to explain contemporary patterns of polymorphisms in rice, including a (i selectively neutral population bottleneck model, (ii bottleneck plus migration model, (iii multiple selective sweeps model, and (iv bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been the dominant demographic model for domesticated species, cannot explain the derived nucleotide polymorphism site frequency spectrum in rice. Instead, a bottleneck model that incorporates selective sweeps, or a more complex demographic model that includes subdivision and gene flow, are more plausible explanations for patterns of variation in domesticated rice varieties. If selective sweeps are indeed the explanation for the observed nucleotide data of domesticated rice, it suggests that strong selection can leave its imprint on genome-wide polymorphism patterns, contrary to expectations that selection results only in a local signature of variation.

  18. Nucleotide Sequencing and Identification of Some Wild Mushrooms

    Sudip Kumar Das

    2013-01-01

    Full Text Available The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India was amplified using ITS1 (Internal Transcribed Spacers 1 and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base of Amanita hemibapha [CN (Chota Nagpur 1, % identity 99 (JX844716.1], Amanita sp. [CN 2, % identity 98 (JX844763.1], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1], Termitomyces sp. [CN 4, % identity 90 (JF746992.1], Termitomyces sp. [CN 5, % identity 99 (GU001667.1], T. microcarpus [CN 6, % identity 82 (EF421077.1], Termitomyces sp. [CN 7, % identity 76 (JF746993.1], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

  19. Scambio, a novel guanine nucleotide exchange factor for Rho

    Groffen John

    2004-04-01

    Full Text Available Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is located on human chromosome 14q11.1, encodes a protein of around 181 kDa, and is highly expressed in both heart and skeletal muscle. In contrast to most DH-PH-domain containing proteins, it binds the activated, GTP-bound forms of Rac and Cdc42. However, it fails to associate with V14RhoA. Immunofluorescence studies indicate that Scambio and activated Rac3 colocalize in membrane ruffles at the cell periphery. In accordance with these findings, Scambio does not activate either Rac or Cdc42 but rather, stimulates guanine nucleotide exchange on RhoA and its close relative, RhoC. Conclusion Scambio associates with Rac in its activated conformation and functions as a guanine nucleotide exchange factor for Rho.

  20. Cyclic nucleotide regulation of cardiac sympatho-vagal responsiveness.

    Li, Dan; Paterson, David J

    2016-07-15

    Cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP) are now recognized as important intracellular signalling molecules that modulate cardiac sympatho-vagal balance in the progression of heart disease. Recent studies have identified that a significant component of autonomic dysfunction associated with several cardiovascular pathologies resides at the end organ, and is coupled to impairment of cyclic nucleotide targeted pathways linked to abnormal intracellular calcium handling and cardiac neurotransmission. Emerging evidence also suggests that cyclic nucleotide coupled phosphodiesterases (PDEs) play a key role limiting the hydrolysis of cAMP and cGMP in disease, and as a consequence this influences the action of the nucleotide on its downstream biological target. In this review, we illustrate the action of nitric oxide-CAPON signalling and brain natriuretic peptide on cGMP and cAMP regulation of cardiac sympatho-vagal transmission in hypertension and ischaemic heart disease. Moreover, we address how PDE2A is now emerging as a major target that affects the efficacy of soluble/particulate guanylate cyclase coupling to cGMP in cardiac dysautonomia. PMID:26915722

  1. The secondary structure of large-subunit rRNA divergent domains, a marker for protist evolution

    Lenaers, G; Nielsen, Henrik; Engberg, J;

    1988-01-01

    ), Tetrahymena thermophila (ciliate), Physarum polycephalum and Dictyostelium discoideum (slime moulds), Crithidia fasciculata and Giardia lamblia (parasitic flagellates). The folding for the D3, D7a and D10 divergent domains has been refined and a consensus model for the protist 24-26S rRNA structure is...

  2. Variation in secondary structure of the 16S rRNA molecule in cyanobacteria with implications for phylogenetic analysis

    Řeháková, Klára; Johansen, J. R.; Bowen, M.B.; Martin, M.P.; Sheil, C.A.

    2014-01-01

    Roč. 14, č. 2 (2014), s. 161-178. ISSN 1802-5439 Institutional support: RVO:60077344 Keywords : 16S rRNA secondary structure * cyanobacteria * phylogeny Subject RIV: EE - Microbiology, Virology Impact factor: 1.930, year: 2014

  3. The Cfr rRNA methyltransferase confers resistance to Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A antibiotics

    Long, K. S.; Poehlsgaard, Jacob; Kehrenberg, C.; Schwarz, S.; Vester, B.

    2006-01-01

    A novel multidrug resistance phenotype mediated by the Cfr rRNA methyltransferase is observed in Staphylococcus aureus and Escherichia coli. The cfr gene has previously been identified as a phenicol and lincosamide resistance gene on plasmids isolated from Staphylococcus spp. of animal origin and...

  4. A pseudouridylation switch in rRNA is implicated in ribosome function during the life cycle of Trypanosoma brucei.

    Chikne, Vaibhav; Doniger, Tirza; Rajan, K Shanmugha; Bartok, Osnat; Eliaz, Dror; Cohen-Chalamish, Smadar; Tschudi, Christian; Unger, Ron; Hashem, Yaser; Kadener, Sebastian; Michaeli, Shulamit

    2016-01-01

    The protozoan parasite Trypanosoma brucei, which causes devastating diseases in humans and animals in sub-Saharan Africa, undergoes a complex life cycle between the mammalian host and the blood-feeding tsetse fly vector. However, little is known about how the parasite performs most molecular functions in such different environments. Here, we provide evidence for the intriguing possibility that pseudouridylation of rRNA plays an important role in the capacity of the parasite to transit between the insect midgut and the mammalian bloodstream. Briefly, we mapped pseudouridines (Ψ) on rRNA by Ψ-seq in procyclic form (PCF) and bloodstream form (BSF) trypanosomes. We detected 68 Ψs on rRNA, which are guided by H/ACA small nucleolar RNAs (snoRNA). The small RNome of both life cycle stages was determined by HiSeq and 83 H/ACAs were identified. We observed an elevation of 21 Ψs modifications in BSF as a result of increased levels of the guiding snoRNAs. Overexpression of snoRNAs guiding modification on H69 provided a slight growth advantage to PCF parasites at 30 °C. Interestingly, these modifications are predicted to significantly alter the secondary structure of the large subunit (LSU) rRNA suggesting that hypermodified positions may contribute to the adaption of ribosome function during cycling between the two hosts. PMID:27142987

  5. FiveS rRNA sequences and fatty acid profiles of colourless sulfur-oxidising bacteria

    LokaBharathi, P.A.; Ortiz-conde, B.A; Nair, S.; Chandramohan, D.; Colwell, R.R.

    these at the molecular level, 5S ribosomal ribonucleic acid (5S rRNA) sequences have been determined. Fatty acid profiles showed strain 29 to be related to Pseudomonas vesicularis with an E.D. of 5.965 and similarity index of 0.182. The nearest organism of strain 82...

  6. Comparison of gull-specific assays targeting 16S rRNA gene of Catellicoccus marimammalium and Streptococcus spp.

    Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...

  7. Species identification and profiling of complex microbial communities using shotgun Illumina sequencing of 16S rRNA amplicon sequences.

    Swee Hoe Ong

    Full Text Available The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequencing of the bacterial 16S rRNA gene, optimized to amplify more than 90% of sequences in the Greengenes database and with the ability to distinguish nearly twice as many species-level OTUs compared to existing protocols. Using several in silico and experimental datasets, we demonstrate that despite the presence of multiple variable and conserved regions, the resulting shotgun sequences can be used to accurately quantify the constituents of complex microbial communities. The reconstruction of a significant fraction of the 16S rRNA gene also enabled high precision (>90% in species-level identification thereby opening up potential application of this approach for clinical microbial characterization.

  8. 16S rRNA gene sequencing in routine identification of anaerobic bacteria isolated from blood cultures

    Justesen, Ulrik Stenz; Skov, Marianne Nielsine; Knudsen, Elisa;

    2010-01-01

    A comparison between conventional identification and 16S rRNA gene sequencing of anaerobic bacteria isolated from blood cultures in a routine setting was performed (n = 127). With sequencing, 89% were identified to the species level, versus 52% with conventional identification. The times for...... identification were 1.5 days and 2.8 days, respectively....

  9. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)

    Stenger, B.L.S.; Clark, M.E.; Kváč, Martin; Khan, E.; Giddings, C.W.; Dyer, N.W.; Schultz, J.L.; McEvoy, J.M.

    2015-01-01

    Roč. 32, JUN 2015 (2015), s. 113-123. ISSN 1567-1348 R&D Projects: GA MŠk(CZ) LH11061 Institutional support: RVO:60077344 Keywords : Cryptosporidium * Paralogy * 18S rRNA * 18S rDNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 3.015, year: 2014

  10. Taxonomy of the genus Rhexinema (Ulvophyceae) based on phylogeny of the 18S rRNA and morphology

    Caisová, Lenka

    2009-01-01

    Roč. 48, č. 4 (2009), s. 15-15. ISSN 0031-8884. [International Phycological Congress /9./. 02.08.2009-08.08.2009, Tokyo] Institutional research plan: CEZ:AV0Z60050516 Keywords : Rhexinema * 18S rRNA * morphology Subject RIV: EF - Botanics

  11. A Fluorimetric Readout Reporting the Kinetics of Nucleotide-Induced Human Ribonucleotide Reductase Oligomerization

    Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A.; Aye, Yimon

    2014-01-01

    Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typicall...

  12. Performance-enhancing effects of dietary nucleotides: do mitochondria play a role?

    Sergej M. Ostojic

    2015-09-01

    Full Text Available Nucleotides are group of natural biomonomeric molecules and novel dietary supplements with performance-enhancing attributes. However, their mechanisms of action and target biological structures are poorly understood and identified. This short paper overviews the possible role of mitochondria during the utilization of nucleotides for exercise performance. Mitochondria-related effects of nucleotides have been identified, along with obstacles for dietary nucleotides delivery to the organelle.

  13. Nucleotide sequences specific to Brucella and methods for the detection of Brucella

    McCready, Paula M. (Tracy, CA); Radnedge, Lyndsay (San Mateo, CA); Andersen, Gary L. (Berkeley, CA); Ott, Linda L. (Livermore, CA); Slezak, Thomas R. (Livermore, CA); Kuczmarski, Thomas A. (Livermore, CA)

    2009-02-24

    Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  14. Isolation of Cronobacter spp. (formerly Enterobacter sakazakii from infant food, herbs and environmental samples and the subsequent identification and confirmation of the isolates using biochemical, chromogenic assays, PCR and 16S rRNA sequencing

    Samara Nawal A

    2009-10-01

    Full Text Available Abstract Background Cronobacter spp. (formerly Enterobacter sakazakii, are a group of Gram-negative pathogens that have been implicated as causative agents of meningitis and necrotizing enterocolitis in infants. The pathogens are linked to infant formula; however, they have also been isolated from a wide range of foods and environmental samples. Results In this study, 233 samples of food, infant formula and environment were screened for the presence of Cronobacter spp. in an attempt to find its source. Twenty nine strains were isolated from samples of spices, herbs, infant foods, and dust obtained from household vacuum cleaners. Among the 76 samples of infant food, infant formula, milk powder and non-milk dairy products tested, only one sample of infant food contained Cronobacter spp. (1.4%. The other Cronobacter spp. isolates recovered include two from household vacuum dust, and 26 from 67 samples of herbs and spices. Among the food categories analyzed, herbs and spices harbored the highest number of isolates, indicating plants as a possible reservoir of this pathogen. Initial screening with API 20E test strips yielded 42 presumptive isolates. Further characterization using 3 chromogenic media (α-MUG, DFI and EsPM and 8 sets of PCR primers detecting ITS (internal transcribed spacer sequences, 16S rRNA, zpx, gluA, gluB, OmpA genes followed by nucleotide sequencing of some PCR amplicons did not confirm the identity of all the isolates as none of the methods proved to be free of both false positives or false negatives. The final confirmation step was done by 16S rRNA sequence analysis identifying only 29 of the 42 isolates as Cronobacter spp. Conclusion Our studies showed that Cronobacter spp. are highly diverse and share many phenotypic traits with other Enterobacteriaceae members highlighting the need to use several methods to confirm the identity of this pathogen. None of the biochemical, chromogenic or PCR primers proved to be a reliable

  15. n-Nucleotide circular codes in graph theory.

    Fimmel, Elena; Michel, Christian J; Strüngmann, Lutz

    2016-03-13

    The circular code theory proposes that genes are constituted of two trinucleotide codes: the classical genetic code with 61 trinucleotides for coding the 20 amino acids (except the three stop codons {TAA,TAG,TGA}) and a circular code based on 20 trinucleotides for retrieving, maintaining and synchronizing the reading frame. It relies on two main results: the identification of a maximal C(3) self-complementary trinucleotide circular code X in genes of bacteria, eukaryotes, plasmids and viruses (Michel 2015 J. Theor. Biol. 380, 156-177. (doi:10.1016/j.jtbi.2015.04.009); Arquès & Michel 1996 J. Theor. Biol. 182, 45-58. (doi:10.1006/jtbi.1996.0142)) and the finding of X circular code motifs in tRNAs and rRNAs, in particular in the ribosome decoding centre (Michel 2012 Comput. Biol. Chem. 37, 24-37. (doi:10.1016/j.compbiolchem.2011.10.002); El Soufi & Michel 2014 Comput. Biol. Chem. 52, 9-17. (doi:10.1016/j.compbiolchem.2014.08.001)). The univerally conserved nucleotides A1492 and A1493 and the conserved nucleotide G530 are included in X circular code motifs. Recently, dinucleotide circular codes were also investigated (Michel & Pirillo 2013 ISRN Biomath. 2013, 538631. (doi:10.1155/2013/538631); Fimmel et al. 2015 J. Theor. Biol. 386, 159-165. (doi:10.1016/j.jtbi.2015.08.034)). As the genetic motifs of different lengths are ubiquitous in genes and genomes, we introduce a new approach based on graph theory to study in full generality n-nucleotide circular codes X, i.e. of length 2 (dinucleotide), 3 (trinucleotide), 4 (tetranucleotide), etc. Indeed, we prove that an n-nucleotide code X is circular if and only if the corresponding graph [Formula: see text] is acyclic. Moreover, the maximal length of a path in [Formula: see text] corresponds to the window of nucleotides in a sequence for detecting the correct reading frame. Finally, the graph theory of tournaments is applied to the study of dinucleotide circular codes. It has full equivalence between the combinatorics

  16. The nucleotide sequence and genome organization of Plasmopara halstedii virus

    Göpfert Jens C

    2011-03-01

    Full Text Available Abstract Background Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Methods Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. Results The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2 were established. RNA1 consisted of 2793 nucleotides (nt exclusive its 3' poly(A tract and a single open-reading frame (ORF1 of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR of 18 nt and a 3' untranslated region (3' UTR of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A tract and a second ORF (ORF2 of 1128 nt. ORF2 coded for the single viral coat protein (CP and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb and RNA2 (ca. 1.4 kb were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. Conclusions The results showed the presence of a single and new

  17. De novo Synthesis and Assembly of rRNA into Ribosomal Subunits during Cold Acclimation in Escherichia coli.

    Piersimoni, Lolita; Giangrossi, Mara; Marchi, Paolo; Brandi, Anna; Gualerzi, Claudio O; Pon, Cynthia L

    2016-04-24

    During the cold adaptation that follows a cold stress, bacterial cells undergo many physiological changes and extensive reprogramming of their gene expression pattern. Bulk gene expression is drastically reduced, while a set of cold shock genes is selectively and transiently expressed. The initial stage of cold acclimation is characterized by the establishment of a stoichiometric imbalance of the translation initiation factors (IFs)/ribosomes ratio that contributes to the preferential translation of cold shock transcripts. Whereas de novo synthesis of the IFs following cold stress has been documented, nothing was known concerning the activity of the rrn operons during the cold acclimation period. In this work, we focus on the expression of the rrn operons and the fate of rRNA after temperature downshift. We demonstrate that in Escherichia coli, rRNA synthesis does not stop during the cold acclimation phase, but continues with greater contribution of the P2 compared to the P1 promoter and all seven rrn operons are active, although their expression levels change with respect to pre-stress conditions. Eight hours after the 37°→10°C temperature downshift, the newly transcribed rRNA represents up to 20% of total rRNA and is preferentially found in the polysomes. However, with respect to the de novo synthesis of the IFs, both rRNA transcription and maturation are slowed down drastically by cold stress, thereby accounting in part for the stoichiometric imbalance of the IFs/ribosomes. Overall, our data indicate that new ribosomes, which are possibly suitable to function at low temperature, are slowly assembled during cold acclimation. PMID:26953262

  18. Efficient subtraction of insect rRNA prior to transcriptome analysis of Wolbachia-Drosophila lateral gene transfer

    Kumar Nikhil

    2012-05-01

    Full Text Available Abstract Background Numerous methods exist for enriching bacterial or mammalian mRNA prior to transcriptome experiments. Yet there persists a need for methods to enrich for mRNA in non-mammalian animal systems. For example, insects contain many important and interesting obligate intracellular bacteria, including endosymbionts and vector-borne pathogens. Such obligate intracellular bacteria are difficult to study by traditional methods. Therefore, genomics has greatly increased our understanding of these bacteria. Efficient subtraction methods are needed for removing both bacteria and insect rRNA in these systems to enable transcriptome-based studies. Findings A method is described that efficiently removes >95% of insect rRNA from total RNA samples, as determined by microfluidics and transcriptome sequencing. This subtraction yielded a 6.2-fold increase in mRNA abundance. Such a host rRNA-depletion strategy, in combination with bacterial rRNA depletion, is necessary to analyze transcription of obligate intracellular bacteria. Here, transcripts were identified that arise from a lateral gene transfer of an entire Wolbachia bacterial genome into a Drosophila ananassae chromosome. In this case, an rRNA depletion strategy is preferred over polyA-based enrichment since transcripts arising from bacteria-to-animal lateral gene transfer may not be poly-adenylated. Conclusions This enrichment method yields a significant increase in mRNA abundance when poly-A selection is not suitable. It can be used in combination with bacterial rRNA subtraction to enable experiments to simultaneously measure bacteria and insect mRNA in vector and endosymbiont biology experiments.

  19. Capreomycin susceptibility is increased by TlyA-directed 2'-O-methylation on both ribosomal subunits

    Monshupanee, Tanakarn; Johansen, Shanna K; Dahlberg, Albert E; Douthwaite, Stephen Roger

    2012-01-01

    The binding site of the cyclic peptide antibiotics capreomycin and viomycin is located on the ribosomal subunit interface close to nucleotides C1409 in 16S rRNA and C1920 in 23S rRNA. In Mycobacterium tuberculosis, the 2'-hydroxyls of both nucleotides are methylated by the enzyme TlyA. Loss of...... these methylations through inactivation of TlyA confers resistance to capreomycin and viomycin. We report here that TlyA orthologues occur in diverse bacteria and fall into two distinct groups. One group, now termed TlyA(I) , has shorter N- and C-termini and methylates only C1920; the second group (now...

  20. A Method for Quantification of Nucleotides and Nucleotide Analogues in Thymidine Kinase Assays Utilizing Lanthanum Phosphate Co-Precipitation

    Gammon, ST; Bernstein, M; Schuster, DP; Piwnica-Worms, D

    2007-01-01

    Current methodologies for quantifying radiolabeled nucleoside monophosphates and nucleoside analogues result in high retention of unphosphorylated guanosine nucleosides in the case of lanthanum chloride precipitation or inconsistent retention of nucleotides in the case of DEAE cellulose filter papers. This study describes an innovative method for quantifying TK activity that is compatible with both purine and pyrimidine nucleoside analogues by utilizing lanthanum phosphate co-precipitation at...

  1. Eukaryotic ribosomes that lack a 5.8S RNA

    Vossbrinck, C. R.; Woese, C. R.

    1986-01-01

    The 5.8S ribosomal RNA is believed to be a universal eukaryotic characteristic. It has no (size) counterpart among the prokaryotes, although its sequence is homologous with the first 150 or so nucleotides of the prokaryotic large subunit (23S) ribosomal RNA. An exception to this rule is reported here. The microsporidian Vairimorpha necatrix is a eukaryote that has no 5.8S rRNA. As in the prokaryotes, it has a single large subunit rRNA, whose 5-prime region corresponds to the 5.8S rRNA.

  2. Development of a Multiplex PCR Method for Detection of the Genes Encoding 16S rRNA, Coagulase, Methicillin Resistance and Enterotoxins in Staphylococcus aureus

    A multiplex PCR method was developed for simultaneous detection of the genes encoding methicillin resistance (mecA), staphylococcal enterotoxins A, B and C (sea, seb and sec), coagulase (coa) and 16S rRNA. The primers for amplification of the 16S rRNA gene were specific for Staphylococcus spp., and ...

  3. Comparison of COBAS AMPLICOR Neisseria gonorrhoeae PCR, including confirmation with N. gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    Luijt, D.S.; Bos, P.A.; van Zwet, A.A.; Voorst-Vader, P.C.; Schirm, J.

    2005-01-01

    : A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased

  4. Comparison of COBAS AMPLICOR Neissefia gonorrhoeae PCR, including confirmation with N-gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    Luijt, DS; Bos, PAJ; van Zwet, AA; Vader, PCV; Schirm, J

    2005-01-01

    A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased t

  5. Molecular identification of adulteration in mutton based on mitochondrial 16S rRNA gene.

    Xu, Jia; Zhao, Wei; Zhu, Mengru; Wen, Yuanju; Xie, Tao; He, Xiaoqian; Zhang, Yongfeng; Cao, Suizhong; Niu, Lili; Zhang, Hongping; Zhong, Tao

    2016-01-01

    The aim of this study is to set up a protocol for identification of the adulteration in mutton based on mitochondrial 16S rRNA gene. The multiplex polymerase chain reaction (multi-PCR) assay was carried out to trace the impure DNA in mutton. A universal primer pair yielded an approximate 610 bp fragment in mutton, pork, duck, chicken, horse and cat meats. The amplicons of multi-PCR assay represented the species-specific products, which could be discriminated by the size ranging from 106 bp to 532 bp. Subsequently, the authentication of each fragment was also confirmed by sequencing. Random analyses of adulterants with various meats yielded the identical results to their components, showing the suitability of the multi-PCR assay for tracing of adulterant meats with high-accuracy and precision. This assay was sensitive to detect the species-specific DNA in different proportional mixtures of mutton and duck/pork (9.1%-90.9%). In conclusion, this multi-PCR assay successfully discriminated the double-, triple-, quadruple-, and quintuple-mixtures containing variant counterparts. This method will be particularly useful in the detection of mutton adulteration in processed foods further. PMID:24739005

  6. An updated 18S rRNA phylogeny of tunicates based on mixture and secondary structure models

    Shenkar Noa

    2009-08-01

    Full Text Available Abstract Background Tunicates have been recently revealed to be the closest living relatives of vertebrates. Yet, with more than 2500 described species, details of their evolutionary history are still obscure. From a molecular point of view, tunicate phylogenetic relationships have been mostly studied based on analyses of 18S rRNA sequences, which indicate several major clades at odds with the traditional class-level arrangements. Nonetheless, substantial uncertainty remains about the phylogenetic relationships and taxonomic status of key groups such as the Aplousobranchia, Appendicularia, and Thaliacea. Results Thirty new complete 18S rRNA sequences were acquired from previously unsampled tunicate species, with special focus on groups presenting high evolutionary rate. The updated 18S rRNA dataset has been aligned with respect to the constraint on homology imposed by the rRNA secondary structure. A probabilistic framework of phylogenetic reconstruction was adopted to accommodate the particular evolutionary dynamics of this ribosomal marker. Detailed Bayesian analyses were conducted under the non-parametric CAT mixture model accounting for site-specific heterogeneity of the evolutionary process, and under RNA-specific doublet models accommodating the occurrence of compensatory substitutions in stem regions. Our results support the division of tunicates into three major clades: 1 Phlebobranchia + Thaliacea + Aplousobranchia, 2 Appendicularia, and 3 Stolidobranchia, but the position of Appendicularia could not be firmly resolved. Our study additionally reveals that most Aplousobranchia evolve at extremely high rates involving changes in secondary structure of their 18S rRNA, with the exception of the family Clavelinidae, which appears to be slowly evolving. This extreme rate heterogeneity precluded resolving with certainty the exact phylogenetic placement of Aplousobranchia. Finally, the best fitting secondary-structure and CAT-mixture models

  7. Binding of nucleotides to nucleoside diphosphate kinase: a calorimetric study.

    Cervoni, L; Lascu, I; Xu, Y; Gonin, P; Morr, M; Merouani, M; Janin, J; Giartosio, A

    2001-04-17

    The source of affinity for substrates of human nucleoside diphosphate (NDP) kinases is particularly important in that its knowledge could be used to design more effective antiviral nucleoside drugs (e.g., AZT). We carried out a microcalorimetric study of the binding of enzymes from two organisms to various nucleotides. Isothermal titration calorimetry has been used to characterize the binding in terms of Delta G degrees, Delta H degrees and Delta S degrees. Thermodynamic parameters of the interaction of ADP with the hexameric NDP kinase from Dictyostelium discoideum and with the tetrameric enzyme from Myxococcus xanthus, at 20 degrees C, were similar and, in both cases, binding was enthalpy-driven. The interactions of ADP, 2'deoxyADP, GDP, and IDP with the eukaryotic enzyme differed in enthalpic and entropic terms, whereas the Delta G degrees values obtained were similar due to enthalpy--entropy compensation. The binding of the enzyme to nonphysiological nucleotides, such as AMP--PNP, 3'deoxyADP, and 3'-deoxy-3'-amino-ADP, appears to differ in several respects. Crystallography of the protein bound to 3'-deoxy-3'-amino-ADP showed that the drug was in a distorted position, and was unable to interact correctly with active site side chains. The interaction of pyrimidine nucleoside diphosphates with the hexameric enzyme is characterized by a lower affinity than that with purine nucleotides. Titration showed the stoichiometry of the interaction to be abnormal, with 9--12 binding sites/hexamer. The presence of supplementary binding sites might have physiological implications. PMID:11294625

  8. Study of sperm cell phosphorylating systems using nucleotide photoaffinity probes

    The major thrust of the research presented in this thesis was to identify specific nucleotide binding proteins and phosphoproteins of rat caput and cauda sperm. Also, the differences in these proteins between caput and cauda sperm were investigated as well as determination of the membrane sidedness of the proteins and their location in either the head or tail/mid-piece region. In addition, the effects of small molecular weight modifers such as cGMP, cAMP and Ca2+ on the detection of binding proteins and phosphorylated proteins was studied. The technique used to identify and locate nucleotide binding proteins was photoaffinity labeling using the proven 8-azidopurine nucleotide analogs of cAMP, ATP and GTP in radioactive form. The first study presented involved the use of [32P]8-N 3cAMP which showed that both caput and cauda sperm contained both type I and type II regulatory subunits (R/sub I/ and R/sub II/, respectively) of the cAMP dependent kinases and that the great majority of the regulatory subunits were located in the tail/mid-piece section and not in the sperm head. The second phase of this study involved the use of [γ32P]8-azidoadensosine triphosphate ([γ32P]8-N3ATP) and (γ32P)8-azidoguanosine triphosphate ([γ32P]8-N3GTP) to photolable specific ATP and GTP binding proteins and to phosphorylate specific phosphoproteins. Again, this was done on caput versus cauda sperm and the location of the majority of the photolabeled or phosphorylated proteins was shown to be in the tail/mid-piece fraction. In addition, considerable differences were found in both the phosphorylated and photolabeled proteins of caput versus cauda sperm

  9. Comparative nucleotide diversity across North American and European populus species.

    Ismail, Mohamed; Soolanayakanahally, Raju Y; Ingvarsson, Pär K; Guy, Robert D; Jansson, Stefan; Silim, Salim N; El-Kassaby, Yousry A

    2012-06-01

    Nucleotide polymorphisms in two North American balsam poplars (Populus trichocarpa Torr. & Gray and P. balsamifera L.; section Tacamahaca), and one Eurasian aspen (P. tremula L.; section Populus) were compared using nine loci involved in defense, stress response, photoperiodism, freezing tolerance, and housekeeping. Nucleotide diversity varied among species and was highest for P. tremula (θ(w) = 0.005, π(T) = 0.007) as compared to P. balsamifera (θ(w) = 0.004, π(T) = 0.005) or P. trichocarpa (θ(w) = 0.002, π(T) = 0.003). Across species, the defense and the stress response loci accounted for the majority of the observed level of nucleotide diversity. In general, the studied loci did not deviate from neutral expectation either at the individual locus (non-significant normalized Fay and Wu's H) or at the multi-locus level (non-significant HKA test). Using molecular clock analysis, section Tacamahaca probably shared a common ancestor with section Populus approximately 4.5 million year ago. Divergence between the two closely related balsam poplars was about 0.8 million years ago, a pattern consistent with an isolation-with-migration (IM) model. As expected, P. tremula showed a five-fold higher substitution rate (2 × 10(-8) substitution/site/year) compared to the North American species (0.4 × 10(-8) substitution/site/year), probably reflecting its complex demographic history. Linkage disequilibrium (LD) varied among species with a more rapid decay in the North American species (balsam poplar species likely reflects the recent time of their divergence. PMID:22562720

  10. Bioinformatics comparison of sulfate-reducing metabolism nucleotide sequences

    Tremberger, G.; Dehipawala, Sunil; Nguyen, A.; Cheung, E.; Sullivan, R.; Holden, T.; Lieberman, D.; Cheung, T.

    2015-09-01

    The sulfate-reducing bacteria can be traced back to 3.5 billion years ago. The thermodynamics details of the sulfur cycle have been well documented. A recent sulfate-reducing bacteria report (Robator, Jungbluth, et al , 2015 Jan, Front. Microbiol) with Genbank nucleotide data has been analyzed in terms of the sulfite reductase (dsrAB) via fractal dimension and entropy values. Comparison to oil field sulfate-reducing sequences was included. The AUCG translational mass fractal dimension versus ATCG transcriptional mass fractal dimension for the low temperature dsrB and dsrA sequences reported in Reference Thirteen shows correlation R-sq ~ 0.79 , with a probably of about 3% in simulation. A recent report of using Cystathionine gamma-lyase sequence to produce CdS quantum dot in a biological method, where the sulfur is reduced just like in the H2S production process, was included for comparison. The AUCG mass fractal dimension versus ATCG mass fractal dimension for the Cystathionine gamma-lyase sequences was found to have R-sq of 0.72, similar to the low temperature dissimilatory sulfite reductase dsr group with 3% probability, in contrary to the oil field group having R-sq ~ 0.94, a high probable outcome in the simulation. The other two simulation histograms, namely, fractal dimension versus entropy R-sq outcome values, and di-nucleotide entropy versus mono-nucleotide entropy R-sq outcome values are also discussed in the data analysis focusing on low probability outcomes.

  11. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  12. Usefulness of single nucleotide polymorphism data for estimating population parameters.

    Kuhner, M K; Beerli, P; Yamato, J; Felsenstein, J

    2000-01-01

    Single nucleotide polymorphism (SNP) data can be used for parameter estimation via maximum likelihood methods as long as the way in which the SNPs were determined is known, so that an appropriate likelihood formula can be constructed. We present such likelihoods for several sampling methods. As a test of these approaches, we consider use of SNPs to estimate the parameter Theta = 4N(e)micro (the scaled product of effective population size and per-site mutation rate), which is related to the br...

  13. Metal-based chemosensors for amino acids, peptides, and nucleotides

    Buryak, Andrey

    2007-01-01

    An organometallic 4d transition metal complex [Cp*RhCl2]2, together with commercially available dyes, was used to construct indicator displacement assays (IDAs) for the detection of peptides, amino acids, and nucleotides. The combination of the Cp*Rh complex with the dye azophloxine was found to form a chemosensing ensemble for the sequence-selective detection of histidine- and methionine-containing peptides in water at neutral pH. A strong interaction of the rhodium complex with peptides bea...

  14. Metal-based chemosensors for amino acids, peptides, and nucleotides

    Buryak, Andrey; Severin, Kay

    2008-01-01

    An organometallic 4d transition metal complex [Cp*RhCl2]2, together with commercially available dyes, was used to construct indicator displacement assays (IDAs) for the detection of peptides, amino acids, and nucleotides. The combination of the Cp*Rh complex with the dye azophloxine was found to form a chemosensing ensemble for the sequence-selective detection of histidine- and methionine-containing peptides in water at neutral pH. A strong interaction of the rhodium complex with peptides bea...

  15. Purine nucleotide synthesis in cultured rat embryos undergoing organogenesis

    The authors show that de n ovo synthesis is the sole source of the purine nucleotides required for in vitro rat embryonic growth during organogenesis. The presence of high levels of activity of purine catabolic enzymes in the homologous serum essential for culture prohibits the salvage of purine. While the 3-carbon atom of serine is the major source of one carbon units for purine ring synthesis there is a significant contribution from the 2-ring carbon atom of tryptophan. The paper describes in detail the incorporation of (1-14C)glycine into the acid soluble phase and other processes connected with de novo purine synthesis

  16. Nucleotide sequence of a spinach chloroplast valine tRNA.

    Sprouse, H M; Kashdan, M; Otis, L; Dudock, B

    1981-01-01

    The nucleotide sequence of a spinach chloroplast valine tRNA (sp. chl. tRNA Val) has been determined. This tRNA shows essentially equal homology to prokaryotic valine tRNAs (58-65% homology) and to the mitochondrial valine tRNAs of lower eukaryotes (yeast and N. crassa, 61-62% homology). Sp. chl. tRNA Val shows distinctly lower homology to mouse mitochondrial valine tRNA (53% homology) and to eukaryotic cytoplasmic valine tRNAs (47-53% homology). Sp. chl. tRNA Val, like all other chloroplast ...

  17. 16S rRNA gene survey of microbial communities in Winogradsky columns.

    Ethan A Rundell

    Full Text Available A Winogradsky column is a clear glass or plastic column filled with enriched sediment. Over time, microbial communities in the sediment grow in a stratified ecosystem with an oxic top layer and anoxic sub-surface layers. Winogradsky columns have been used extensively to demonstrate microbial nutrient cycling and metabolic diversity in undergraduate microbiology labs. In this study, we used high-throughput 16s rRNA gene sequencing to investigate the microbial diversity of Winogradsky columns. Specifically, we tested the impact of sediment source, supplemental cellulose source, and depth within the column, on microbial community structure. We found that the Winogradsky columns were highly diverse communities but are dominated by three phyla: Proteobacteria, Bacteroidetes, and Firmicutes. The community is structured by a founding population dependent on the source of sediment used to prepare the columns and is differentiated by depth within the column. Numerous biomarkers were identified distinguishing sample depth, including Cyanobacteria, Alphaproteobacteria, and Betaproteobacteria as biomarkers of the soil-water interface, and Clostridia as a biomarker of the deepest depth. Supplemental cellulose source impacted community structure but less strongly than depth and sediment source. In columns dominated by Firmicutes, the family Peptococcaceae was the most abundant sulfate reducer, while in columns abundant in Proteobacteria, several Deltaproteobacteria families, including Desulfobacteraceae, were found, showing that different taxonomic groups carry out sulfur cycling in different columns. This study brings this historical method for enrichment culture of chemolithotrophs and other soil bacteria into the modern era of microbiology and demonstrates the potential of the Winogradsky column as a model system for investigating the effect of environmental variables on soil microbial communities.

  18. In situ hybridization of phytoplankton using fluorescently labeled rRNA probes.

    Groben, René; Medlin, Linda

    2005-01-01

    Phytoplankton are one of the major components of ecosystem processes and play an important role in many biogeochemical cycles in the marine and freshwater environment. Despite their importance, many microalgae are poorly described and little is known of broad spatial and temporal scale trends in their abundance and distribution. Reasons for this are that microalgae are often small, lack distinct morphological features, and are unculturable, which make analyses difficult. It is now possible by using molecular biological techniques to advance our knowledge of aquatic biodiversity and to understand how biodiversity supports ecosystem structure, dynamics, and resilience. We present in this chapter a brief review of the progress that has been made in analyzing microalgae from populations to the species level. The described methods range from DNA fingerprinting techniques, such as random amplified polymorphic DNA (RAPD), amplified fragment length polymorphisms (AFLPs), and simple sequence repeats (SSRs), to microsatellites, which are used in population studies, to sequence analysis, which help to reconstruct the evolutionary history of organisms and to examine relationships at various taxonomic levels. Special emphasis is given to the application of molecular probes for the identification and characterization of microalgal taxa. The fast and secure identification of phytoplankton, especially of toxic species, is important from an ecological and economical point of view and whole-cell hybridization with specific fluorochrome-labeled probes followed by fluorescence microscopy or flow cytometry offers a fast method for this purpose. In this context, we present a detailed protocol for fluorescence in situ hybridization (FISH) of ribosomal RNA (rRNA) probes that can be applied to many algal cell types and discuss practical considerations of its use. PMID:15865974

  19. Phylogenetic relationships between Sarcocystis species from reindeer and other Sarcocystidae deduced from ssu rRNA gene sequences

    Dahlgren, S.S.; Oliveira, Rodrigo Gouveia; Gjerde, B.

    2008-01-01

    Six Sarcocystis species from reindeer (S. grueneri, S. rangi, S. tarandivulpes, S. hardangeri, S. rangiferi and S. tarandi) have previously been genetically characterised. The aim of this study was to identify possible definitive hosts for S. hardangeri, S. rangiferi and S. tarandi by including the...... six species in phylogenetic analyses of the Sarcocystidae, and also to investigate the phylogenetic relationships between the species from reindeer and those from other hosts. The study also aimed at revealing whether the inclusion of six Sarcocystis species from the same intermediate host would have...... any effect on previously inferred phylogenetic relationships within the Sarcocystidae. The complete small subunit (ssu) rRNA gene sequences of all six Sarcocystis species from reindeer were used in the phylogenetic analyses along with ssu rRNA gene sequences of 85 other members of the Coccidea. Trees...

  20. Distribution of DNA and localization of rRNA transcription in G2 phase nucleolus of Physarum polycephalum

    2001-01-01

    Using electron microscopy, NAMA-Ur DNA selective staining and BrUTP incorporation, the nucleo lus ultrastructure, the distribution of DNA and the rRNA transcription sites in nucleolus of G2 phase Physarum poly cephalum were studied. The nucleolus was found to be different in structure from that of other plant cells. Fibrillar cen tern (FCs) were present in a large amount all over the nucleolus. DNA was distributed both in dense fibrillar components (DFC) and in FC. The DNA in the nucleolus was less condensed than that of the chromosome territory. These changes suggested that the transcription was active within the nucleolus. BrUTP incorporation localized the rRNA transcription in DFC and at the interface of FC and DFC, suggesting that the DNA in FC is in a storage form and only the rDNA in DFC is transcribed.

  1. Phylogeny of the cuttlefishes (Mollusca:Cephalopoda) based on mitochondrial COI and 16S rRNA gene sequence data

    LIN Xiangzhi; ZHENG Xiaodong; XIAO Shu; WANG Rucai

    2004-01-01

    To clarify cuttlefish phylogeny, mitochondrial cytochrome c oxidase subunit I (COI) gene and partial 16S rRNA gene are sequenced for 13 cephalopod species. Phylogenetic trees are constructed, with the neighbor-joining method.Coleoids are divided into two main lineages, Decabrachia and Octobrachia. The monophyly of the order Sepioidea,which includes the families Sepiidae, Sepiolidae and Idiosepiidae, is not supported. From the two families of Sepioidea examined, the Sepiolidae are polyphyletic and are excluded from the order. On the basis of 16S rRNA and amino acid of COI gene sequences data, the two genera (Sepiella and Sepia) from the Sepiidae can be distinguished, but do not have a visible boundary using COI gene sequences. The reason is explained. This suggests that the 16S rDNA of cephalopods is a precious tool to analyze taxonomic relationships at the genus level, and COI gene is fitter at a higher taxonomic level (i.e., family).

  2. Validation of a PCR Assay for Chlamydophila abortus rRNA gene detection in a murine model

    Francielle Gibson da Silva-Zacarias

    2009-11-01

    Full Text Available Chlamydophila abortus (C. abortus is associated with reproductive problems in cattle, sheep, and goats. Diagnosis of C. abortus using embryonated chicken eggs or immortalized cell lines has a very low sensitivity. Polymerase chain reaction (PCR assays have been used to detect C. abortus infection in clinical specimens and organ fragments, such as placenta, fetal organs, vaginal secretions, and semen. The aim of this study was to develop a PCR assay for the amplification of an 856-bp fragment of the rRNA gene of the Chlamydiaceae family. The PCR assay was evaluated using organs from 15 mice experimentally infected with the S26/3 reference strain of C. abortus. The results of the rRNA PCR were compared to the results from another PCR system (Omp2 PCR that has been previously described for the Omp2 (outer major protein gene from the Chlamydiaceae family. From the 15 C. abortus-inoculated mice, 13 (K=0.84, standard error =0.20 tested positive using the rRNA PCR assay and 9 (K=0.55, standard error=0.18 tested positive using the Omp2 PCR assay. The detection limit, measured using inclusion-forming units (IFU, for C. abortus with the rRNA PCR (1.05 IFU was 100-fold lower than for the Omp2 PCR (105 IFU. The higher sensitivity of the rRNA PCR, as compared to the previously described PCR assay, and the specificity of the assay, demonstrated using different pathogenic microorganisms of the bovine reproductive system, suggest that the new PCR assay developed in this study can be used for the molecular diagnosis of C. abortus in abortion and other reproductive failures in bovines, caprines, and ovines.Chlamydophila abortus (C. abortus é frequentemente associada a distúrbios reprodutivos em bovinos, ovinos e caprinos. Para o diagnóstico, os métodos de cultivo em ovo embrionado de galinha e em células de linhagem contínua apresentam baixa sensibilidade. A reação em cadeia da polimerase (PCR tem sido utilizada em placenta, órgãos fetais, secre

  3. Identification of bacteria associated with underground parts of Crocus sativus by 16S rRNA gene targeted metagenomic approach.

    Ambardar, Sheetal; Sangwan, Naseer; Manjula, A; Rajendhran, J; Gunasekaran, P; Lal, Rup; Vakhlu, Jyoti

    2014-10-01

    Saffron (Crocus sativus L), an autumn-flowering perennial sterile plant, reproduces vegetatively by underground corms. Saffron has biannual corm-root cycle that makes it an interesting candidate to study microbial dynamics in its rhizosphere and cormosphere (area under influence of corm). Culture independent 16S rRNA gene metagenomic study of rhizosphere and cormosphere of Saffron during flowering stage revealed presence of 22 genera but none of the genus was common in all the three samples. Bulk soil bacterial community was represented by 13 genera with Acidobacteria being dominant. In rhizosphere, out of eight different genera identified, Pseudomonas was the most dominant genus. Cormosphere bacteria comprised of six different genera, dominated by the genus Pantoea. This study revealed that the bacterial composition of all the three samples is significantly different (P rhizosphere, cormosphere and bulk soil of Saffron, using cultivation independent 16S rRNA gene targeted metagenomic approach. PMID:24989343

  4. Community structure, cellular rRNA content, and activity of sulfate-reducing bacteria in marine Arctic sediments

    Ravenschlag, K.; Sahm, K.; Knoblauch, C.;

    2000-01-01

    The community structure of sulfate-reducing bacteria (SRB) of a marine Arctic sediment (Smeerenburg-fjorden, Svalbard) a-as characterized by both fluorescence in situ hybridization (FISH) and rRNA slot blot hybridization by using group- and genus-specific 16S rRNA-targeted oligonucleotide probes......, The SRB community was dominated by members of the Desulfosarcina-Desulfococcus group. This group accounted for up to 73% of the SRB detected and up to 70% of the SRB rRNA detected. The predominance was shown to be a common feature for different stations along the coast of Svalbard, In a top......-Desulfococcus group. A group of clone sequences (group SVAL1) most closely related to Desulfosarcina variabilis (91.2% sequence similarity) was dominant and was shown to be most abundant in situ, accounting for up to 54.8% of the total SRB detected. A comparison of the two methods used for quantification showed...

  5. rRNA Gene Expression of Abundant and Rare Activated-Sludge Microorganisms and Growth Rate Induced Micropollutant Removal.

    Vuono, David C; Regnery, Julia; Li, Dong; Jones, Zackary L; Holloway, Ryan W; Drewes, Jörg E

    2016-06-21

    The role of abundant and rare taxa in modulating the performance of wastewater-treatment systems is a critical component of making better predictions for enhanced functions such as micropollutant biotransformation. In this study, we compared 16S rRNA genes (rDNA) and rRNA gene expression of taxa in an activated-sludge-treatment plant (sequencing batch membrane bioreactor) at two solids retention times (SRTs): 20 and 5 days. These two SRTs were used to influence the rates of micropollutant biotransformation and nutrient removal. Our results show that rare taxa (micropollutant biotransformation. An analysis of micropollutant-associated degradation genes via metagenomics and direct measurements of a suite of micropollutants and nutrients further corroborates the loss of enhanced functions at 5-day SRT operation. This work advances our knowledge of the underlying ecosystem properties and dynamics of abundant and rare organisms associated with enhanced functions in engineered systems. PMID:27196630

  6. Assay of cyclic nucleotide phosphodiesterase using radiolabeled and fluorescent substrates

    There are four major classes of phosphodiesterase with different specificities for cAMP and cGMP and different allosteric regulators. Type I phosphodiesterase is activated by calmodulin plus Ca/sup 2+/ and has a higher affinity for cGMP than cAMP. Type II phosphodiesterase likewise has a higher affinity for cGMP than cAMP, but the activity toward one substrate is markedly stimulated by low (micromolar) concentrations of the other nucleotide. Type III phosphodiesterase has a higher affinity for cAMP than cGMP; its activity is increased in responsive cells by certain hormones, e.g., insulin, isoproterenol. Type IV phosphodiesterase is the cGMP-specific enzyme, which also has an allosteric binding site for cGMP. An example of this class of enzyme is the one from retinal rod outer segments, which is activated by light via rhodopsin and the guanine nucleotide-binding protein transducin. There appears to be little structural relatedness among these enzymes based on immunologic analysis, consistent with the possibility that divergent forms evolved from an ancestral enzyme. Determination of the amount of a specific form of phosphodiesterase in crude material is often difficult. Modification of assay conditions by judicious choice of substrate and/or inhibitor concentrations may selectively favor (or reduce) the activity of a particular form; in many instances, however, some fractionation of enzymes may be necessary. This is discussed more fully in the final section of this chapter

  7. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Ahamad Salamian

    2008-01-01

    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  8. Single nucleotide polymorphism analysis of European archaeological M. leprae DNA.

    Claire L Watson

    Full Text Available BACKGROUND: Leprosy was common in Europe eight to twelve centuries ago but molecular confirmation of this has been lacking. We have extracted M. leprae ancient DNA (aDNA from medieval bones and single nucleotide polymorphism (SNP typed the DNA, this provides insight into the pattern of leprosy transmission in Europe and may assist in the understanding of M. leprae evolution. METHODS AND FINDINGS: Skeletons have been exhumed from 3 European countries (the United Kingdom, Denmark and Croatia and are dated around the medieval period (476 to 1350 A.D.. we tested for the presence of 3 previously identified single nucleotide polymorphisms (SNPs in 10 aDNA extractions. M. leprae aDNA was extracted from 6 of the 10 bone samples. SNP analysis of these 6 extractions were compared to previously analysed European SNP data using the same PCR assays and were found to be the same. Testing for the presence of SNPs in M. leprae DNA extracted from ancient bone samples is a novel approach to analysing European M. leprae DNA and the findings concur with the previously published data that European M. leprae strains fall in to one group (SNP group 3. CONCLUSIONS: These findings support the suggestion that the M. leprae genome is extremely stable and show that archaeological M. leprae DNA can be analysed to gain detailed information about the genotypic make-up of European leprosy, which may assist in the understanding of leprosy transmission worldwide.

  9. Nucleotide variation in the Toxoplasma gondii micronemal protein 8 gene.

    Li, Z Y; Song, H Q; Wang, C R; Zhu, X Q

    2016-01-01

    Toxoplasma gondii is a successful opportunistic protozoan distributed worldwide, which can infect all vertebrates, leading to serious infection, blindness, and abortion. Micronemal (MIC) proteins are critically important for T. gondii infection, as they participate in various stages of the Toxoplasma life cycle, including invasion and attachment to host cells. MIC8 secretion relies on the concentration of intracellular calcium, and can mediate the invasion of T. gondii by interacting with soluble MIC3. To investigate genetic diversity of the MIC8 gene, 16 T. gondii strains from different hosts and geographical locations, and two reference isolates (ToxoDB: TGME49_245490 and TGVEG_245490) were examined in this study. The results showed that all the examined MIC8 genes are 2055 bp, with an A+T content ranging from 50.2 to 50.6%. Conversely, lower levels of variation were detected within their nucleotide and amino acid sequences. Phylogenetic analyses indicated that three classical genotypes of T. gondii and the ToxoDB#9 genotype did not group exclusively via Bayesian inference, maximum parsimony, neighbor joining, and/or maximum likelihood assays based on the nucleotide and amino acid sequences of the MIC8 gene. In summary, the T. gondii MIC8 gene is not a suitable marker for population genetic studies of this parasite. PMID:27173337

  10. Structure and function of nucleotide sugar transporters: Current progress

    Barbara Hadley

    2014-06-01

    Full Text Available The proteomes of eukaryotes, bacteria and archaea are highly diverse due, in part, to the complex post-translational modification of protein glycosylation. The diversity of glycosylation in eukaryotes is reliant on nucleotide sugar transporters to translocate specific nucleotide sugars that are synthesised in the cytosol and nucleus, into the endoplasmic reticulum and Golgi apparatus where glycosylation reactions occur. Thirty years of research utilising multidisciplinary approaches has contributed to our current understanding of NST function and structure. In this review, the structure and function, with reference to various disease states, of several NSTs including the UDP-galactose, UDP-N-acetylglucosamine, UDP-N-acetylgalactosamine, GDP-fucose, UDP-N-acetylglucosamine/UDP-glucose/GDP-mannose and CMP-sialic acid transporters will be described. Little is known regarding the exact structure of NSTs due to difficulties associated with crystallising membrane proteins. To date, no three-dimensional structure of any NST has been elucidated. What is known is based on computer predictions, mutagenesis experiments, epitope-tagging studies, in-vitro assays and phylogenetic analysis. In this regard the best-characterised NST to date is the CMP-sialic acid transporter (CST. Therefore in this review we will provide the current state-of-play with respect to the structure–function relationship of the (CST. In particular we have summarised work performed by a number groups detailing the affect of various mutations on CST transport activity, efficiency, and substrate specificity.

  11. Evaluation of published single nucleotide polymorphisms associated with acute GVHD.

    Chien, Jason W; Zhang, Xinyi Cindy; Fan, Wenhong; Wang, Hongwei; Zhao, Lue Ping; Martin, Paul J; Storer, Barry E; Boeckh, Michael; Warren, Edus H; Hansen, John A

    2012-05-31

    Candidate genetic associations with acute GVHD (aGVHD) were evaluated with the use of genotyped and imputed single-nucleotide polymorphism data from genome-wide scans of 1298 allogeneic hematopoietic cell transplantation (HCT) donors and recipients. Of 40 previously reported candidate SNPs, 6 were successfully genotyped, and 10 were imputed and passed criteria for analysis. Patient and donor genotypes were assessed for association with grades IIb-IV and III-IV aGVHD, stratified by donor type, in univariate and multivariate allelic, recessive and dominant models. Use of imputed genotypes to replicate previous IL10 associations was validated. Similar to previous publications, the IL6 donor genotype for rs1800795 was associated with a 20%-50% increased risk for grade IIb-IV aGVHD after unrelated HCT in the allelic (adjusted P = .011) and recessive (adjusted P = .0013) models. The donor genotype was associated with a 60% increase in risk for grade III-IV aGVHD after related HCT (adjusted P = .028). Other associations were found for IL2, CTLA4, HPSE, and MTHFR but were inconsistent with original publications. These results illustrate the advantages of using imputed single-nucleotide polymorphism data in genetic analyses and demonstrate the importance of validation in genetic association studies. PMID:22282500

  12. Determination of 16S rRNA Sequences of Enterococci and Application to Species Identification of Nonmotile Enterococcus gallinarum Isolates

    Patel, Robin; Piper, Kerryl E.; Rouse, Mark S; Steckelberg, James M.; Uhl, Jim R.; Kohner, Peggy; Hopkins, Marlene K.; Cockerill, Franklin R.; Kline, Bruce C.

    1998-01-01

    The 16S rRNA sequences of enterococcal species E. faecium, E. faecalis, E. gallinarum, E. casseliflavus/flavescens, E. dispar, E. pseudoavium, E. sulfureus, E. malodoratus, E. raffinosus, E. cecorum, E. hirae, E. saccharolyticus, E. seriolicida, E. mundtii, E. avium, E. durans, E. columbae, and E. solitarius are presented herein. These data were utilized to confirm the species identification of two nonmotile E. gallinarum isolates which had been previously phenotypically identified as E. faec...

  13. Unique 16S rRNA sequences of Eurythenes gryllus (Crustacea: Amphipoda: Lysianassidae) from the Gulf of Mexico abyssal plain

    Elva Escobar-Briones; Eduardo Nájera-Hillman; Fernando Álvarez

    2010-01-01

    Amphipods of the species Eurythenes gryllus were collected at 2 locations on the abyssal plain (~3 400 m) of the Gulf of Mexico in order to test whether or not these scavenger amphipods are isolated in this peripheral sea or show connectivity by their predominant swimming behavior, moving horizontally along the abyssal water masses in the region. Partial sequences of the mitochondrial 16S rRNA gene from 2 individuals of E. gryllus were determined and showed small differences when compared to ...

  14. Molecular characterization of Sarcocystis species from Polish roe deer based on ssu rRNA and cox1 sequence analysis.

    Kolenda, Rafał; Ugorski, Maciej; Bednarski, Michał

    2014-08-01

    Sarcocysts from four Polish roe deer were collected and examined by light microscopy, small subunit ribosomal RNA (ssu rRNA), and the subunit I of cytochrome oxidase (cox1) sequence analysis. This resulted in identification of Sarcocystis gracilis, Sarcocystis oviformis, and Sarcocystis silva. However, we were unable to detect Sarcocystis capreolicanis, the fourth Sarcocystis species found previously in Norwegian roe deer. Polish sarcocysts isolated from various tissues differed in terms of their shape and size and were larger than the respective Norwegian isolates. Analysis of ssu rRNA gene revealed the lack of differences between Sarcocystis isolates belonging to one species and a very low degree of genetic diversity between Polish and Norwegian sarcocysts, ranging from 0.1% for Sarcocystis gracilis and Sarcocystis oviformis to 0.44% for Sarcocystis silva. Contrary to the results of the ssu rRNA analysis, small intraspecies differences in cox1 sequences were found among Polish Sarcocystis gracilis and Sarcocystis silva isolates. The comparison of Polish and Norwegian cox1 sequences representing the same Sarcocystis species revealed similar degree of sequence identity, namely 99.72% for Sarcocystis gracilis, 98.76% for Sarcocystis silva, and 99.85% for Sarcocystis oviformis. Phylogenetic reconstruction and genetic population analyses showed an unexpected high degree of identity between Polish and Norwegian isolates. Moreover, cox1 gene sequences turned out to be more accurate than ssu rRNA when used to reveal phylogenetic relationships among closely related species. The results of our study revealed that the same Sarcocystis species isolated from the same hosts living in different geographic regions show a very high level of genetic similarity. PMID:24948101

  15. Influence of DNA extraction on oral microbial profiles obtained via 16S rRNA gene sequencing

    Diaz, Patricia I.; Abusleme, Loreto; Hong, Bo-Young; Amanda K. Dupuy; Linda D Strausbaugh

    2014-01-01

    Background and objective: The advent of next-generation sequencing has significantly facilitated characterization of the oral microbiome. Despite great efforts in streamlining the processes of sequencing and data curation, upstream steps required for amplicon library generation could still influence 16S rRNA gene-based microbial profiles. Among upstream processes, DNA extraction is a critical step that could represent a great source of bias. Accounting for bias introduced by extraction proced...

  16. Use of 16S rRNA Sequencing for Identification of Actinobacillus ureae Isolated from a Cerebrospinal Fluid Sample

    Whitelaw, A. C.; Shankland, I. M.; Elisha, B. G.

    2002-01-01

    Actinobacillus ureae, previously Pasteurella ureae, has on rare occasions been described as a cause of human infection. Owing to its rarity, it may not be easily identified in clinical microbiology laboratories by standard tests. This report describes a patient with acute bacterial meningitis due to A. ureae. The identity of the isolate was determined by means of DNA sequence analysis of a portion of the 16S rRNA gene.

  17. Analysis of Mixed Sequencing Chromatograms and Its Application in Direct 16S rRNA Gene Sequencing of Polymicrobial Samples▿

    Kommedal, Øyvind; Karlsen, Bjarte; Sæbø, Øystein

    2008-01-01

    Investigation of clinical samples by direct 16S rRNA gene sequencing provides the possibility to detect nonviable bacteria and bacteria with special growth requirements. This approach has been particularly valuable for the diagnosis of patients who have received antibiotics prior to sample collection. In specimens containing more than one bacterium, direct sequencing gives mixed chromatograms that complicate further interpretation. We designed an algorithm able to analyze these ambiguous chro...

  18. Cilantro microbiome before and after nonselective pre-enrichment for Salmonella using 16S rRNA and metagenomic sequencing

    Jarvis, Karen G.; White, James R.; Grim, Christopher J.; Ewing, Laura; Ottesen, Andrea R; Beaubrun, Junia Jean-Gilles; Pettengill, James B; Brown, Eric; Hanes, Darcy E.

    2015-01-01

    Background Salmonella enterica is a common cause of foodborne gastroenteritis in the United States and is associated with outbreaks in fresh produce such as cilantro. Salmonella culture-based detection methods are complex and time consuming, and improvments to increase detection sensitivity will benefit consumers. In this study, we used 16S rRNA sequencing to determine the microbiome of cilantro. We also investigated changes to the microbial community prior to and after a 24-hour nonselective...

  19. Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

    Xiao Li Shi

    Full Text Available The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX, which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

  20. An intramolecular recombination mechanism for the formation of the rRNA gene palindrome of Tetrahymena thermophila.

    Butler, D. K.; Yasuda, L E; Yao, M C

    1995-01-01

    Large palindromic DNAs are found in a wide variety of eukaryotic cells. In Tetrahymena thermophila, a large palindrome is formed from a single rRNA gene (rDNA) during nuclear differentiation. We present evidence that a key step in the formation of the rDNA palindrome of T. thermophila involves homologous intramolecular recombination. Heteroduplex micronuclear rDNA molecules were constructed in vitro and microinjected into developing macronuclei, where they formed palindromes. Analysis of the ...

  1. Analysis of 16S rRNA amplicon sequencing options on the Roche/454 next-generation titanium sequencing platform.

    Hideyuki Tamaki

    Full Text Available BACKGROUND: 16S rRNA gene pyrosequencing approach has revolutionized studies in microbial ecology. While primer selection and short read length can affect the resulting microbial community profile, little is known about the influence of pyrosequencing methods on the sequencing throughput and the outcome of microbial community analyses. The aim of this study is to compare differences in output, ease, and cost among three different amplicon pyrosequencing methods for the Roche/454 Titanium platform METHODOLOGY/PRINCIPAL FINDINGS: The following three pyrosequencing methods for 16S rRNA genes were selected in this study: Method-1 (standard method is the recommended method for bi-directional sequencing using the LIB-A kit; Method-2 is a new option designed in this study for unidirectional sequencing with the LIB-A kit; and Method-3 uses the LIB-L kit for unidirectional sequencing. In our comparison among these three methods using 10 different environmental samples, Method-2 and Method-3 produced 1.5-1.6 times more useable reads than the standard method (Method-1, after quality-based trimming, and did not compromise the outcome of microbial community analyses. Specifically, Method-3 is the most cost-effective unidirectional amplicon sequencing method as it provided the most reads and required the least effort in consumables management. CONCLUSIONS: Our findings clearly demonstrated that alternative pyrosequencing methods for 16S rRNA genes could drastically affect sequencing output (e.g. number of reads before and after trimming but have little effect on the outcomes of microbial community analysis. This finding is important for both researchers and sequencing facilities utilizing 16S rRNA gene pyrosequencing for microbial ecological studies.

  2. Sequence analysis of 16S rRNA from mycoplasmas by direct solid-phase DNA sequencing.

    Pettersson, B; Johansson, K. E.; Uhlén, M

    1994-01-01

    Automated solid-phase DNA sequencing was used for determination of partial 16S ribosomal DNA sequences of mycoplasmas. The sequence information was used to establish phylogenetic relationships of 11 different mycoplasmas whose 16S rRNA sequences had not been determined earlier. A biotinylated fragment corresponding to positions 344 to 939 in the Escherichia coli sequence was generated by PCR. The PCR product was immobilized onto streptavidin-coated paramagnetic beads, and direct sequencing wa...

  3. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes

    Mu Peng; Xiaoxue Zi; Qiuyu Wang

    2015-01-01

    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacte...

  4. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    Martins Cesar

    2010-01-01

    Full Text Available Abstract Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s occurring in 39.6% of the analyzed individuals (both male and female were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement.

  5. The phylogenetic relationship of the family Lutjanidae based on analyses of AFLP and mitochondrial 12S rRNA sequences

    ZHANG Junbin; LIU Xin

    2006-01-01

    Fishes of the family Lutjanidae are commercially important in South China Sea. However,the phylogeny of Lutjanids is still unclear and there are many controversies over it. Herein, studies about the phylogeny of Lutjanids were performed based on Amplified Fragment Length Polymorphism (AFLP) analysis of genome DNA and sequence analysis of mitochondrial 12S rRNA gene, and 10 Lutjanidae species and 1 Lethrinidae species were employed.The topologies of minimum evolution (ME) trees based on the two analyses respectively were congruent except for positions of genera Pristipomoides and Caesio. The optimal substitution model TrN + G for DNA sequences of 12S rRNA genes in Lutjanids was obtained using MODELTEST 3.6 software and maximum likelihood (ML) analysis supports the topology displayed by the ME tree. The test of log-likelihood suggests that the use of molecular clock calibrations to estimate species divergence time appeared valid. Phylogenetic analyses using AFLP data and DNA sequences of mitochondrial 12S rRNA genes indicated the monophyly of Lutjanus genra. However, further studies are required to reveal the phylogenetic relationship among other genera. In addition, the results demonstrated that AFLP genetic marker was suitable for the phylogenetic analysis of Lutjanids.

  6. Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing.

    Shin, Jongoh; Lee, Sooin; Go, Min-Jeong; Lee, Sang Yup; Kim, Sun Chang; Lee, Chul-Ho; Cho, Byung-Kwan

    2016-01-01

    Demands for faster and more accurate methods to analyze microbial communities from natural and clinical samples have been increasing in the medical and healthcare industry. Recent advances in next-generation sequencing technologies have facilitated the elucidation of the microbial community composition with higher accuracy and greater throughput than was previously achievable; however, the short sequencing reads often limit the microbial composition analysis at the species level due to the high similarity of 16S rRNA amplicon sequences. To overcome this limitation, we used the nanopore sequencing platform to sequence full-length 16S rRNA amplicon libraries prepared from the mouse gut microbiota. A comparison of the nanopore and short-read sequencing data showed that there were no significant differences in major taxonomic units (89%) except one phylotype and three taxonomic units. Moreover, both sequencing data were highly similar at all taxonomic resolutions except the species level. At the species level, nanopore sequencing allowed identification of more species than short-read sequencing, facilitating the accurate classification of the bacterial community composition. Therefore, this method of full-length 16S rRNA amplicon sequencing will be useful for rapid, accurate and efficient detection of microbial diversity in various biological and clinical samples. PMID:27411898

  7. TaxCollector: Modifying Current 16S rRNA Databases for the Rapid Classification at Six Taxonomic Levels

    Eric W. Triplett

    2010-07-01

    Full Text Available The high level of conservation of 16S ribosomal RNA gene (16S rRNA in all Prokaryotes makes this gene an ideal tool for the rapid identification and classification of these microorganisms. Databases such as the Ribosomal Database Project II (RDP-II and the Greengenes Project offer access to sets of ribosomal RNA sequence databases useful in identification of microbes in a culture-independent analysis of microbial communities. However, these databases do not contain all of the taxonomic levels attached to the published names of the bacterial and archaeal sequences. TaxCollector is a set of scripts developed in Python language that attaches taxonomic information to all 16S rRNA sequences in the RDP-II and Greengenes databases. These modified databases are referred to as TaxCollector databases, which when used in conjunction with BLAST allow for rapid classification of sequences from any environmental or clinical source at six different taxonomic levels, from domain to species. The TaxCollector database prepared from the RDP-II database is an important component of a new 16S rRNA pipeline called PANGEA. The usefulness of TaxCollector databases is demonstrated with two very different datasets obtained using samples from a clinical setting and an agricultural soil. The six TaxCollector scripts are freely available on http://taxcollector.sourceforge.net and on http://www.microgator.org.

  8. Evolutionary History of the Chaetognaths Inferred from Actin and 18S-28S rRNA Paralogous Genes

    J.P. Casanova

    2006-01-01

    Full Text Available The chaetognaths constitute a small and enigmatic phylum of marine invertebrates whose phylogenetic affinities remain uncertain. Our phylogenetical investigations inferred from partial paralogous 18S-28S rRNA genes suggest that the event resulting in the presence of two classes of rRNA genes would have occurred at approximately 300-400 million years and prior to the radiation of extant chaetognath, whereas the taxon, according to both molecular and paleontological data, would be dated from at least the Early Cambrian. These divergent rRNA genes could be the result of a whole ribosomal cluster duplication or of an allopolyploid event during a crisis period, since, the fossil are lacking posterioly to the post-Carboniferous period (c.a., 300 million years. In addition, actin phylogeny evidenced that the cytoplasmic chaetognath actin clustered with the cytoplasmic insect actins, while the muscular chaetognath actins are placed basal to all muscular vertebrate actins. The present study suggests that the gene conversion mechanisms could be inefficient in this taxon; this could explain the conservation of extremely divergent paralogous sequences in the chaetognath genomes which could be correlated to the difficulties to identify a sister group between chaetognaths and other taxa among metazoans.

  9. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.

    2011-01-01

    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show this structural change depends only on 16S residues within the S4 binding site. SHAPE chemical-probing experiments showed that S4 strongly stabilizes the five-helix junction and helix 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in helix 16 that makes specific contacts with the S4 N-terminal extension, and a right angle motif between helices 3, 4 and 18, require a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of helix 3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  10. Limitations of metazoan 18S rRNA sequence data : implications for reconstructing a phylogeny of the animal kingdom and inferring the reality of the cambrian explosion

    Abouheif, Ehab; Zardoya, Rafael; Meyer, Axel

    1998-01-01

    We document the phylogenetic behavior of the 18S rRNA molecule in 67 taxa from 28 metazoan phyla and assess the effects of among-site rate variation on reconstructing phylogenies of the animal kingdom. This empirical assessment was undertaken to clarify further the limits of resolution of the 18S rRNA gene as a phylogenetic marker and to address the question of whether 18S rRNA phylogenies can be used as a source of evidence to infer the reality of a Cambrian explosion. A notable degree of am...

  11. Quantification of Hyphomicrobium Populations in Activated Sludge from an Industrial Wastewater Treatment System as Determined by 16S rRNA Analysis

    Layton, A C; Karanth, P. N.; Lajoie, C. A.; Meyers, A J; Gregory, I. R.; Stapleton, R. D.; Taylor, D E; Sayler, G. S.

    2000-01-01

    The bacterial community structure of the activated sludge from a 25 million-gal-per-day industrial wastewater treatment plant was investigated using rRNA analysis. 16S ribosomal DNA (rDNA) libraries were created from three sludge samples taken on different dates. Partial rRNA gene sequences were obtained for 46 rDNA clones, and nearly complete 16S rRNA sequences were obtained for 18 clones. Seventeen of these clones were members of the beta subdivision, and their sequences showed high homolog...

  12. Action of ''Bipenst'' preparation and dimethylsulfoxide on the adenyl nucleotide content in liver of irradiated animals

    Action of parenteral administration of a biostimulator ''Bipenst'' and a 10; dimethylsulfoxide solution on the level of adenyl nucleotides in the liver of rats subjected to a single whole-body irradiation (243 R) has been studied. It has been found that the level of adenyl nucleotides in the liver of irradiated animals decreases, and adenyl nucleotide content normalizes under the action of the preparations under study

  13. Neutralizing monoclonal antibody against ras oncogene product p21 which impairs guanine nucleotide exchange.

    Hattori, S; Clanton, D J; Satoh, T.; Nakamura, S.; Kaziro, Y; Kawakita, M; Shih, T Y

    1987-01-01

    The neutralizing monoclonal antibody Y13-259 severely hampers the nucleotide exchange reaction between p21-bound and exogenous guanine nucleotides but does not interfere with the association of GDP to p21. These results suggest that the nucleotide exchange reaction is critical for p21 function. Interestingly, the v-ras p21 has a much faster dissociation rate than the p21 of the c-ras proto-oncogene.

  14. The complete nucleotide sequence of the RNA coding for the primary translation product of foot and mouth disease virus.

    1984-01-01

    The complete nucleotide sequence of the coding region of foot and mouth disease virus RNA (strain A1061) is presented. The sequence extends from the primary initiation site, approximately 1200 nucleotide from the 5' end of the genome, in an open translational reading frame of 6,999 nucleotides to a termination codon 93 nucleotides from the 3' terminal poly (A). Available amino acid sequence data correlates with that predicted from the nucleotide sequence. The amino acid sequence around cleava...

  15. Enzymatic polymerisation involving 2'-amino-LNA nucleotides.

    Johannsen, Marie W; Veedu, Rakesh N; Madsen, Andreas Stahl; Wengel, Jesper

    2012-05-15

    The triphosphate of the thymine derivative of 2'-amino-LNA (2'-amino-LNA-TTP) was synthesised and found to be a good substrate for Phusion® HF DNA polymerase, allowing enzymatic synthesis of modified DNA encoded by an unmodified template. To complement this, 2'-amino-LNA-T phosphoramidites were incorporated into DNA oligonucleotides which were used as templates for enzymatic synthesis of unmodified DNA using either KOD, KOD XL or Phusion polymerases. 2'-Amino-LNA-T in the template and 2'-amino-LNA-TTP as a substrate both decreased reaction rate and yield compared to unmodified DNA, especially for sequences with multiple 2'-amino-LNA-T nucleotides. PMID:22503454

  16. Radicals of DNA and DNA nucleotides generated by ionising radiation

    A first stage of cell processes leading to DNA damage of initiated by radical reactions. In a model system such transformations were generated by ionising radiation which involves production of electron loss and electron gain centers of the substrate and radical formation. Using cryogenic ESR spectroscopy it was found that the DNA nucleotides, which convert to radical anions upon electron capture undergo the separation of unpaired spin and charge due to protonation. Circular and linear dichroism studies enabled to conclude that iron ions(III) induce strong changes in the DNA helical structure indicating their coordination with nitrogen bases. The repair of DNA radicals produced via radiolytic oxidation, i.e. the guanine radical cation and the allyl type radical of thymine, is possible at elevated temperatures due to the involvement of sulphydryl groups. The influence of the thiol charge is then limited

  17. Pinched flow fractionation devices for detection of single nucleotide polymorphisms

    Larsen, A.V.; Poulsen, L.; Birgens, H.;

    2008-01-01

    We demonstrate a new and flexible micro fluidic based method for genotyping single nucleotide polymorphisms ( SNPs). The method relies on size separation of selectively hybridized polystyrene microspheres in a micro fluidic pinched flow fractionation (PFF) device. The micro fluidic PFF devices with......, synthesized using human DNA samples from individuals with point mutations in the HBB gene. Following a stringent wash, the beads were separated in a PFF device and the fluorescent signal from the beads was analyzed. Patients being wildtypes, heterozygotes or mutated respectively for the investigated mutation...... could reliably be diagnosed in the PFF device. This indicates that the PFF technique can be used for accurate and fast genotyping of SNPs Udgivelsesdato: 2008...

  18. Single nucleotide variations: biological impact and theoretical interpretation.

    Katsonis, Panagiotis; Koire, Amanda; Wilson, Stephen Joseph; Hsu, Teng-Kuei; Lua, Rhonald C; Wilkins, Angela Dawn; Lichtarge, Olivier

    2014-12-01

    Genome-wide association studies (GWAS) and whole-exome sequencing (WES) generate massive amounts of genomic variant information, and a major challenge is to identify which variations drive disease or contribute to phenotypic traits. Because the majority of known disease-causing mutations are exonic non-synonymous single nucleotide variations (nsSNVs), most studies focus on whether these nsSNVs affect protein function. Computational studies show that the impact of nsSNVs on protein function reflects sequence homology and structural information and predict the impact through statistical methods, machine learning techniques, or models of protein evolution. Here, we review impact prediction methods and discuss their underlying principles, their advantages and limitations, and how they compare to and complement one another. Finally, we present current applications and future directions for these methods in biological research and medical genetics. PMID:25234433

  19. The adsorption and reaction of adenine nucleotides on montmorillonite

    Ferris, James P.; Hagan, William J., Jr.

    1986-01-01

    The binding of AMP to Zn(2+)-montmorillonite is investigated in the presence of salts and Good's zwitterion buffers, PIPES and MES. The initial concentrations of nucleotide and the percent adsorbtion are used to calculate the adsorption isotherms, and the Langmuir adsorption equation is used for the analysis of data. The adsorption coefficient was found to be three times greater in the presence of 0.2 M PIPES than in its absence. In addition, basal spacings measured by X-ray diffraction were increased by the buffer. These results are interpreted in terms of a model in which the adsorption of AMP is mediated by a Zn(2+) complex of PIPES in different orientations in the interlamellar region of the montmorillonite. Mixed ligand complexes of this type are reminiscent of the complexes observed between metal ions and biological molecules in living systems.

  20. Efficient fidelity control by stepwise nucleotide selection in polymerase elongation

    Yu, Jin

    2014-01-01

    Polymerases select nucleotides before incorporating them for chemical synthesis during gene replication or transcription. How the selection proceeds stepwise efficiently to achieve sufficiently high fidelity and speed is essential for polymerase function. We examined step-by-step selections that have conformational transition rates tuned one at time in the polymerase elongation cycle, with a controlled differentiation free energy at each checkpoint. The elongation is sustained at non-equilibrium steady state with constant free energy input and heat dissipation. It is found that error reduction capability does not improve for selection checkpoints down the reaction path. Hence, it is essential to select early to achieve an efficient fidelity control. In particular, for two consecutive selections that reject the wrong substrate back and inhibit it forward from a same kinetic state, the same error rates are obtained at the same free energy differentiation. The initial screening is indispensible for maintaining t...

  1. The nucleotide sequence of the bacteriophage T5 ltf gene.

    Kaliman, A V; Kulshin, V E; Shlyapnikov, M G; Ksenzenko, V N; Kryukov, V M

    1995-06-01

    The nucleotide sequence of the bacteriophage T5 Bg/II-BamHI fragment (4,835 bp in length) known to carry a gene encoding the LTF protein which forms the phage L-shaped tail fibers was determined. It was shown to contain an open reading frame for 1,396 amino acid residues that corresponds to a protein of 147.8 kDa. The coding region of ltf gene is preceded by a typical Shine-Dalgarno sequence. Downstream from the ltf gene there is a strong transcription terminator. Data bank analysis of the LTF protein sequence reveals 55.1% identity to the hypothetical protein ORF 401 of bacteriophage lambda in a segment of 118 amino acids overlap. PMID:7789514

  2. Fluorogenic Labeling of 5-Formylpyrimidine Nucleotides in DNA and RNA.

    Samanta, Biswajit; Seikowski, Jan; Höbartner, Claudia

    2016-01-26

    5-Formylcytosine (5fC) and 5-formyluracil (5fU) are natural nucleobase modifications that are generated by oxidative modification of 5-methylcytosine and thymine (or 5-methyluracil). Herein, we describe chemoselective labeling of 5-formylpyrimidine nucleotides in DNA and RNA by fluorogenic aldol-type condensation reactions with 2,3,3-trimethylindole derivatives. Mild and specific reaction conditions were developed for 5fU and 5fC to produce hemicyanine-like chromophores with distinct photophysical properties. Residue-specific detection was established by fluorescence readout as well as primer-extension assays. The reactions were optimized on DNA oligonucleotides and were equally suitable for the modification of 5fU- and 5fC-modified RNA. This direct labeling approach of 5-formylpyrimidines is expected to help in elucidating the occurrence, enzymatic transformations, and functional roles of these epigenetic/epitranscriptomic nucleobase modifications in DNA and RNA. PMID:26679556

  3. Computational learning on specificity-determining residue-nucleotide interactions

    Wong, Ka-Chun

    2015-11-02

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  4. A nucleotide-level coarse-grained model of RNA

    Šulc, Petr; Ouldridge, Thomas E; Doye, Jonathan P K; Louis, Ard A

    2014-01-01

    We present a new, nucleotide-level model for RNA, oxRNA, based on the coarse-graining methodology recently developed for the oxDNA model of DNA. The model is designed to reproduce structural, mechanical and thermodynamic properties of RNA, and the coarse-graining level aims to retain the relevant physics for RNA hybridization and the structure of single- and double-stranded RNA. In order to explore its strengths and weaknesses, we test the model in a range of nanotechnological and biological settings. Applications explored include the folding thermodynamics of a pseudoknot, the formation of a kissing loop complex, the structure of a hexagonal RNA nanoring, and the unzipping of a hairpin motif. We argue that the model can be used for efficient simulations of the structure of systems with thousands of base pairs, and for the assembly of systems of up to hundreds of base pairs. The source code implementing the model is released for public use.

  5. Computational identification of candidate nucleotide cyclases in higher plants

    Wong, Aloysius Tze

    2013-09-03

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs are often part of complex multifunctional proteins with different domain organizations and biological functions that are not conserved in higher plants. For this reason, we have developed CNC search strategies based on functionally conserved amino acids in the catalytic center of annotated and/or experimentally confirmed CNCs. Here we detail this method which has led to the identification of >25 novel candidate CNCs in Arabidopsis thaliana, several of which have been experimentally confirmed in vitro and in vivo. We foresee that the application of this method can be used to identify many more members of the growing family of CNCs in higher plants. © Springer Science+Business Media New York 2013.

  6. Nucleotide sequence of Streptomyces griseus initiator tRNA.

    Kuchino, Y; Yamamoto, I.; Nishimura, S.

    1982-01-01

    The primary structure of initiator tRNA from Streptomyces griseus was determined by post-labeling procedures. The nucleotide sequence is pC-G-C-G-G-G-G-U-G-G-A-G-C-A-G-C-U-C-G-G-D-A-G-C-U-C-G-C-U-G-G-G-C-U-C-A-U-A-A-C-C- C-A-G-A-G-G-U-C-G-C-A-G-G-U-psi-C-A-m1A-A-U-C-C-U-G-U-C-C-C-C-G-C-U-A-C-C-A0H. The unique feature of the sequence of this tRNA is that residue 54 is occupied by unmodified U, while ribothymidine is located in that position in most initiator tRNAs from eubacteria.

  7. Current research status, databases and application of single nucleotide polymorphism.

    Javed, R; Mukesh

    2010-07-01

    Single Nucleotide Polymorphisms (SNPs) are the most frequent form of DNA variation in the genome. SNPs are genetic markers which are bi-allelic in nature and grow at a very fast rate. Current genomic databases contain information on several million SNPs. More than 6 million SNPs have been identified and the information is publicly available through the efforts of the SNP Consortium and others data bases. The NCBI plays a major role in facillating the identification and cataloging of SNPs through creation and maintenance of the public SNP database (dbSNP) by the biomedical community worldwide and stimulate many areas of biological research including the identification of the genetic components of disease. In this review article, we are compiling the existing SNP databases, research status and their application. PMID:21717869

  8. Environmental heat stress, hyperammonemia and nucleotide metabolism during intermittent exercise

    Mohr, Magni; Rasmussen, Peter; Drust, Barry;

    2006-01-01

    glycogen, CP, ATP and IMP levels were similar across trials. In conclusion, altered levels of "classical peripheral fatiguing agents" does apparently not explain the reduced capacity for performing repeated sprints following intermittent exercise in the heat, whereas the augmented systemic NH3 response may......Abstract  This study investigated the influence of environmental heat stress on ammonia (NH3) accumulation in relation to nucleotide metabolism and fatigue during intermittent exercise. Eight males performed 40 min of intermittent exercise (15 s at 306±22 W alternating with 15 s of unloaded cycling......) followed by five 15 s all-out sprints. Control trials were conducted in a 20°C environment while heat stress trials were performed at an ambient temperature of 40°C. Muscle biopsies and venous blood samples were obtained at rest, after 40 min of exercise and following the maximal sprints. Following...

  9. Morphine enhances purine nucleotide catabolism in rive and in vitro

    Chang LIU; Jian-kai LIU; Mu-jie KAN; Lin GAO; Hai-ying FU; Hang ZHOU; Min HONG

    2007-01-01

    Aim: To investigate the effect and mechanism of morphine on purine nucleotide catabolism. Methods: The rat model of morphine dependence and withdrawal and rat C6 glioma cells in culture were used. Concentrations of uric acid in the plasma were measured by the uricase-rap method, adenosine deaminase (ADA) and xan- thine oxidase (XO) in the plasma and tissues were measured by the ADA and XO test kit. RT-PCR and RT-PCR-Southern blotting were used to examine the relative amount of ADA and XO gene transcripts in tissues and C6 cells. Results: (i) the concentration of plasma uric acid in the morphine-administered group was signifi-cantly higher (P<0.05) than the control group; (ii) during morphine administration and withdrawal periods, the ADA and XO concentrations in the plasma increased significantly (P<0.05); (iii) the amount of ADA and XO in the parietal lobe, liver, small intestine, and skeletal muscles of the morphine-administered groups increased, while the level of ADA and XO in those tissues of the withdrawal groups decreased; (iv) the transcripts of the ADA and XO genes in the parietal lobe, liver, small intestine, and skeletal muscles were higher in the morphine-administered group. The expression of the ADA and XO genes in those tissues returned to the control level during morphine withdrawal, with the exception of the skeletal muscles; and (v) the upregulation of the expression of the ADA and XO genes induced by morphine treatment could be reversed by naloxone. Conclusion: The effects of morphine on purine nucleotide metabolism might be an important, new biochemical pharmacological mechanism of morphine action.

  10. Structural basis for a six nucleotide genetic alphabet.

    Georgiadis, Millie M; Singh, Isha; Kellett, Whitney F; Hoshika, Shuichi; Benner, Steven A; Richards, Nigel G J

    2015-06-01

    Expanded genetic systems are most likely to work with natural enzymes if the added nucleotides pair with geometries that are similar to those displayed by standard duplex DNA. Here, we present crystal structures of 16-mer duplexes showing this to be the case with two nonstandard nucleobases (Z, 6-amino-5-nitro-2(1H)-pyridone and P, 2-amino-imidazo[1,2-a]-1,3,5-triazin-4(8H)one) that were designed to form a Z:P pair with a standard "edge on" Watson-Crick geometry, but joined by rearranged hydrogen bond donor and acceptor groups. One duplex, with four Z:P pairs, was crystallized with a reverse transcriptase host and adopts primarily a B-form. Another contained six consecutive Z:P pairs; it crystallized without a host in an A-form. In both structures, Z:P pairs fit canonical nucleobase hydrogen-bonding parameters and known DNA helical forms. Unique features include stacking of the nitro group on Z with the adjacent nucleobase ring in the A-form duplex. In both B- and A-duplexes, major groove widths for the Z:P pairs are approximately 1 Å wider than those of comparable G:C pairs, perhaps to accommodate the large nitro group on Z. Otherwise, ZP-rich DNA had many of the same properties as CG-rich DNA, a conclusion supported by circular dichroism studies in solution. The ability of standard duplexes to accommodate multiple and consecutive Z:P pairs is consistent with the ability of natural polymerases to biosynthesize those pairs. This, in turn, implies that the GACTZP synthetic genetic system can explore the entire expanded sequence space that additional nucleotides create, a major step forward in this area of synthetic biology. PMID:25961938

  11. 77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

    2012-10-29

    ... Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request. SUMMARY: The United States....'' SUPPLEMENTARY INFORMATION: I. Abstract Patent applications that contain nucleotide and/or amino acid...

  12. Enzymatic synthesis of radioisotope-labeled nucleotides from the corresponding labeled nitrogen bases

    The authors have developed a procedure that permits the production of nucleotides multiply labeled with various radioisotopes, with a molar radioactivity equal to the molar radioactivity of the original nitrogen bases. The methods of isolation and purification of the enzyme preparations were studied on the enzyme systems converting nitrogen bases to nucleoside triphosphates in the presence of phosphoribosyl pyrophosphate or ribose-5-phosphate. The presence of nucleotide impurities in the enzyme preparation was determined spectrophotometrically. The authors were able to practically avoid nucleotide impurities by salting out the protein fraction of interest with ammonium sulfate. The authors succeeded in reducing the content of nucleotides in the enzyme preparation by a factor of 40

  13. Sulphate reduction and vertical distribution of sulphate-reducing bacteria quantified by rRNA slot-blot hybridization in a coastal marine sediment

    Sahm, K.; MacGregor, BJ; Jørgensen, BB; Stahl, DA

    1999-01-01

    In the past, enumeration of sulphate-reducing bacteria (SRB) by cultivation-based methods generally contradicted measurements of sulphate reduction, suggesting unrealistically high respiration rates per cell. Here, we report evidence that quantification of SRB rRNA by slot-blot hybridization is a...... between 18% and 25% to the prokaryotic rRNA pool. The dominant SRB were related to complete oxidizing genera (Desulphococcus, Desulphosarcina and Desulphobacterium), while Desulpho-bacter could not be detected. The vertical profile and quantity of rRNA from SRB was compared with sulphate reduction rates...... (SRR) measured with (SO42-)-S-35 tracer in whole-core incubations. While SRB abundance was highest near the surface, peaking at around 1.5cm, measured sulphate reduction rates were lowest in this region. A second peak of SRB rRNA was observed at the transition zone from oxidized to reduced sediment...

  14. Transport of rRNA into cytoplasm required for initiation of S phase in root meristem cells in Helianthus annuus L

    Cold treatment (10degC) of root meristems during a period longer than duration of the cell cycle in 20degC causes a blocking of most cells in G1. One of the causes of cell cycle blockade is the decrease of rRNA synthesis and inhibition of rRNA transport into cytoplasm. Transfer of seedlings to 20degC results in increase of rRNA synthesis and its transport to cytoplasm as well as transition of almost all cells from G1 to S during 3 hours. Synchronization of DNA replication, comprising cells within rows of cells, is preceded by similar transport patter of rRNA to cytoplasm. (Author)

  15. A rapid method for sequencing of rRNA gene(s) amplified by polymerase chain reaction using an automated DNA sequencer

    Dwivedi, P.P.; Patel, B.K.C.; Rees, G.N.; Ollivier, Bernard

    1996-01-01

    A method for DNA sequencing of ribosomal RNA (rRNA) genes, amplified by polymerase chain reaction (PCR), using internal primers, designed on the basis of conserved regions of rRNA genes for determining a near complete sequence (99%) of the gene using an automated DNA sequencer (Applied Biosystem Incorporation, USA) is described. The procedure is extremely rapid as cloning of the gene is not required for sequence determination. In addition time consuming steps such as ethanol precipitation and...

  16. Molecular evolution of rDNA in early diverging Metazoa: First comparative analysis and phylogenetic application of complete SSU rRNA secondary structures in Porifera

    Wörheide Gert; Erpenbeck Dirk; Voigt Oliver

    2008-01-01

    Abstract Background The cytoplasmic ribosomal small subunit (SSU, 18S) ribosomal RNA (rRNA) is the most frequently-used gene for molecular phylogenetic studies. However, information regarding its secondary structure is neglected in most phylogenetic analyses. Incorporation of this information is essential in order to apply specific rRNA evolutionary models to overcome the problem of co-evolution of paired sites, which violates the basic assumption of the independent evolution of sites made by...

  17. Update and evaluation of 16SpathDB, an automated comprehensive database for identification of medically important bacteria by 16S rRNA gene sequencing

    Yeung, Shiu-yan; 楊兆恩

    2013-01-01

    Identification of pathogens is one of the important duties of clinical microbiology laboratory. Traditionally, phenotypic tests are used to identify the bacteria. However, due to some limitations of the phenotypic tests, the bacteria may not be identified sometimes and cannot be identified promptly. 16S rRNA gene sequencing is a rapid and accurate method to achieve this target. It is especially useful for identify rare or slow growing bacteria. However, the interpretation of the 16S rRNA gene...

  18. Soil Acidobacterial 16S rRNA Gene Sequences Reveal Subgroup Level Differences between Savanna-Like Cerrado and Atlantic Forest Brazilian Biomes

    Catão, Elisa C. P.; Lopes, Fabyano A. C.; Janaína F. Araújo; Alinne P. de Castro; Barreto, Cristine C.; Mercedes M.C. Bustamante; Betania F. Quirino; Krüger, Ricardo H.

    2014-01-01

    16S rRNA sequences from the phylum Acidobacteria have been commonly reported from soil microbial communities, including those from the Brazilian Savanna (Cerrado) and the Atlantic Forest biomes, two biomes that present contrasting characteristics of soil and vegetation. Using 16S rRNA sequences, the present work aimed to study acidobacterial diversity and distribution in soils of Cerrado savanna and two Atlantic forest sites. PCA and phylogenetic reconstruction showed that the acidobacterial ...

  19. Identificación de Yarrowia lipolytica (Ascomycota: Hemiascomycetes como contaminante en la obtención de amplificados del gen 28S rRNA de moluscos

    Jenny Chirinos

    2011-05-01

    Full Text Available En el presente trabajo se identifica una secuencia de DNA no esperada proveniente de los amplificados del gen 28S rRNA de moluscos terrestres. Las extracciones de DNA se realizaron del tejido del pie de caracoles terrestres por el método del CTAB modificado. Las PCRs fueron llevadas a cabo con primers universales para el gen COI e iniciadores diseñados para moluscos, para el marcador 16S rRNA, 28S rRNA y la región ITS-2. Los tamaños aproximados de las bandas de los amplificados de moluscos fueron de 706 pb para el COI, 330 pb para el 16S rRNA, 900 pb para el ITS-2 y 583 pb para el 28S rRNA; un amplificado del último marcador fue de una longitud inesperada, ~340 pb. Las secuencias de DNA fueron comparadas con la base de datos del GenBank mediante el programa BLASTn y la muestra con la banda de tamaño inesperado resultó en un 100% de identidad y cobertura del 99% con el gen 26S rRNA de la levadura Yarrowia lipolytica. El análisis filogenético con Neighbour-Joining y los valores de divergencia confirmaron la identificación, proporcionando resultados que apoyan la ubicación taxonómica de la especie dentro del clado de los Hemiascomycetes.

  20. Microbial Dark Matter: Unusual intervening sequences in 16S rRNA genes of candidate phyla from the deep subsurface

    Jarett, Jessica; Stepanauskas, Ramunas; Kieft, Thomas; Onstott, Tullis; Woyke, Tanja

    2014-03-17

    The Microbial Dark Matter project has sequenced genomes from over 200 single cells from candidate phyla, greatly expanding our knowledge of the ecology, inferred metabolism, and evolution of these widely distributed, yet poorly understood lineages. The second phase of this project aims to sequence an additional 800 single cells from known as well as potentially novel candidate phyla derived from a variety of environments. In order to identify whole genome amplified single cells, screening based on phylogenetic placement of 16S rRNA gene sequences is being conducted. Briefly, derived 16S rRNA gene sequences are aligned to a custom version of the Greengenes reference database and added to a reference tree in ARB using parsimony. In multiple samples from deep subsurface habitats but not from other habitats, a large number of sequences proved difficult to align and therefore to place in the tree. Based on comparisons to reference sequences and structural alignments using SSU-ALIGN, many of these ?difficult? sequences appear to originate from candidate phyla, and contain intervening sequences (IVSs) within the 16S rRNA genes. These IVSs are short (39 - 79 nt) and do not appear to be self-splicing or to contain open reading frames. IVSs were found in the loop regions of stem-loop structures in several different taxonomic groups. Phylogenetic placement of sequences is strongly affected by IVSs; two out of three groups investigated were classified as different phyla after their removal. Based on data from samples screened in this project, IVSs appear to be more common in microbes occurring in deep subsurface habitats, although the reasons for this remain elusive.

  1. Application of rRNA probes and fluorescence in situ hybridization for rapid detection of the toxic dinoflagellate Alexandrium minutum

    TANG Xianghai; YU Rencheng; ZHOU Mingjiang; YU Zhigang

    2012-01-01

    The dinoflagellate Alexandrium minutum is often associated with harmful algal blooms (HABs).This species consists of many strains that differ in their ability to produce toxins but have similar morphology,making identification difficult.In this study,species-specific rRNA probes were designed for whole-cell fluorescence in situ hybridization (FISH) to distinguish A.minutum from two phylogenetic clades.We acquired the complete SSU to LSU rDNA sequences (GenBank accession numbers JF906989-JF906999) of 11 Alexandrium strains and used these to design rRNA targeted oligonucleotide probes.Three ribotype-specific probes,M-GC-1,M-PC-2,and M-PC-3,were designed.The former is specific for the GC clade (“Global clade”) of A.minutum,the majority of which have been found non-toxic,and the latter two are specific for the PSP (paralytic shellfish poisoning)-producing PC clade (“Pacific clade”).The specificity of these three probes was confirmed by FISH.All cells in observed fields of view were fluorescently labeled when probes and target species were incubated under optimized FISH conditions.However,the accessibility of rRNA molecules in ribosomes varied among the probe binding positions.Thus,there was variation in the distribution of positive signals in labeled cells within nucleolus and cytosol (M-GC-1,M-PC-3),or just nucleolus (M-PC-2).Our results provide a methodological basis for studying the biogeography and population dynamics of A.minutum,and providing an early warning of toxic HABs.

  2. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report

    Lee SH

    2016-04-01

    Full Text Available Sin Hang Lee,1,21Pathology Department, Milford Hospital, Milford, CT, USA; 2Milford Molecular Diagnostics, Milford, CT, USA Abstract: Lyme disease (LD, the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. Keywords: Lyme disease, Borrelia burgdorferi, homeologous 16S rRNA genes, DNA sequencing

  3. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing

    Chia Sing eChan

    2015-03-01

    Full Text Available The Sungai Klah (SK hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-meter-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0 to 9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC. In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3−V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream and geochemical parameters (broad temperature and pH range. It is speculated that symbiotic relationships occur between the members of the community.

  4. Slow formation of stable complexes during coincubation of minimal rRNA and ribosomal protein S4.

    Mayerle, Megan; Bellur, Deepti L; Woodson, Sarah A

    2011-09-23

    Ribosomal protein S4 binds and stabilizes a five-helix junction or five-way junction (5WJ) in the 5' domain of 16S ribosomal RNA (rRNA) and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and 5WJ reorganize their structures. We show that labile S4 complexes rearrange into stable complexes within a few minutes at 42 °C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show that this structural change depends only on 16S residues within the S4 binding site. SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension) chemical probing experiments showed that S4 strongly stabilizes 5WJ and the helix (H) 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in H16 that makes specific contacts with the S4 N-terminal extension, as well as a right-angle motif between H3, H4, and H18, requires a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of H3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  5. Diverse nucleotide compositions and sequence fluctuation in Rubisco protein genes

    Holden, Todd; Dehipawala, S.; Cheung, E.; Bienaime, R.; Ye, J.; Tremberger, G., Jr.; Schneider, P.; Lieberman, D.; Cheung, T.

    2011-10-01

    The Rubisco protein-enzyme is arguably the most abundance protein on Earth. The biology dogma of transcription and translation necessitates the study of the Rubisco genes and Rubisco-like genes in various species. Stronger correlation of fractal dimension of the atomic number fluctuation along a DNA sequence with Shannon entropy has been observed in the studied Rubisco-like gene sequences, suggesting a more diverse evolutionary pressure and constraints in the Rubisco sequences. The strategy of using metal for structural stabilization appears to be an ancient mechanism, with data from the porphobilinogen deaminase gene in Capsaspora owczarzaki and Monosiga brevicollis. Using the chi-square distance probability, our analysis supports the conjecture that the more ancient Rubisco-like sequence in Microcystis aeruginosa would have experienced very different evolutionary pressure and bio-chemical constraint as compared to Bordetella bronchiseptica, the two microbes occupying either end of the correlation graph. Our exploratory study would indicate that high fractal dimension Rubisco sequence would support high carbon dioxide rate via the Michaelis- Menten coefficient; with implication for the control of the whooping cough pathogen Bordetella bronchiseptica, a microbe containing a high fractal dimension Rubisco-like sequence (2.07). Using the internal comparison of chi-square distance probability for 16S rRNA (~ E-22) versus radiation repair Rec-A gene (~ E-05) in high GC content Deinococcus radiodurans, our analysis supports the conjecture that high GC content microbes containing Rubisco-like sequence are likely to include an extra-terrestrial origin, relative to Deinococcus radiodurans. Similar photosynthesis process that could utilize host star radiation would not compete with radiation resistant process from the biology dogma perspective in environments such as Mars and exoplanets.

  6. Development of an Analysis Pipeline Characterizing Multiple Hypervariable Regions of 16S rRNA Using Mock Samples.

    Jennifer J Barb

    Full Text Available There is much speculation on which hypervariable region provides the highest bacterial specificity in 16S rRNA sequencing. The optimum solution to prevent bias and to obtain a comprehensive view of complex bacterial communities would be to sequence the entire 16S rRNA gene; however, this is not possible with second generation standard library design and short-read next-generation sequencing technology.This paper examines a new process using seven hypervariable or V regions of the 16S rRNA (six amplicons: V2, V3, V4, V6-7, V8, and V9 processed simultaneously on the Ion Torrent Personal Genome Machine (Life Technologies, Grand Island, NY. Four mock samples were amplified using the 16S Ion Metagenomics Kit™ (Life Technologies and their sequencing data is subjected to a novel analytical pipeline.Results are presented at family and genus level. The Kullback-Leibler divergence (DKL, a measure of the departure of the computed from the nominal bacterial distribution in the mock samples, was used to infer which region performed best at the family and genus levels. Three different hypervariable regions, V2, V4, and V6-7, produced the lowest divergence compared to the known mock sample. The V9 region gave the highest (worst average DKL while the V4 gave the lowest (best average DKL. In addition to having a high DKL, the V9 region in both the forward and reverse directions performed the worst finding only 17% and 53% of the known family level and 12% and 47% of the genus level bacteria, while results from the forward and reverse V4 region identified all 17 family level bacteria.The results of our analysis have shown that our sequencing methods using 6 hypervariable regions of the 16S rRNA and subsequent analysis is valid. This method also allowed for the assessment of how well each of the variable regions might perform simultaneously. Our findings will provide the basis for future work intended to assess microbial abundance at different time points

  7. Molecular identification of Trichinella spiralis and Trichinella britovi by diagnostic multiprimer large mitochondrial rRNA amplification.

    Borsuk, P; Moskwa, B; Pastusiak, K; Cabaj, W

    2003-11-01

    Trichinella parasites with different epidemiological features still occur in Europe and four species of genus Trichinella have been identified: T. spiralis, T. britovi, T. nativa and T. pseudospiralis. Until now, two of them, T. spiralis and T. britovi, have been identified in Poland. In our studies we selected sequence coding for large mitochondrial rRNA (mt LrDNA) as a genetic marker and developed a sensitive LrDNA multiprimer PCR assay allowing for rapid identification of T. spiralis and T. britovi, parasites present in wild and domestic animals in Poland. PMID:14505042

  8. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)1

    Stenger, Brianna L.S.; Clark, Mark E.; Kváč, Martin; Khan, Eakalak; Giddings, Catherine W.; Dyer, Neil W.; Schultz, Jessie L.; McEvoy, John M.

    2015-01-01

    Cryptosporidium is an apicomplexan parasite that causes the disease cryptosporidiosis in humans, livestock, and other vertebrates. Much of the knowledge on Cryptosporidium diversity is derived from 18S rRNA gene (18S rDNA) phylogenies. Eukaryote genomes generally have multiple 18S rDNA copies that evolve in concert, which is necessary for the accurate inference of phylogenetic relationships. However, 18S rDNA copies in some genomes evolve by a birth-and-death process that can result in sequen...

  9. Energy efficiency trade-offs drive nucleotide usage in transcribed regions

    Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.

    2016-01-01

    Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217

  10. Comparative Nucleotide Sequence Analysis of Polymorphic Variable-Number Tandem-Repeat Loci in Mycobacterium ulcerans

    Ablordey, A; Hilty, M.; Stragier, Pieter; Swings, Jean; Portaels, F.

    2005-01-01

    We analyzed a set of variable-number tandem-repeat (VNTR) loci to assess their nucleotide sequence diversity in isolates of three Mycobacterium ulcerans genotypes. Sequence variants in two loci resulted in intraspecies resolution of Southeast Asian and Asian genotypes in contrast to a homogenous sequence composition among African isolates. Nucleotide sequence polymorphism in repeat units can enhance discrimination of VNTR loci.

  11. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey; Rådstrøm, Peter; Malorny, Burkhard; Rudi, Knut

    2011-01-01

    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technology...

  12. Regulation of Salmonella typhimurium pyr Gene Expression: Effect of Changing Both Purine and Pyrimidine Nucleotide Pools

    Jensen, Kaj Frank

    1989-01-01

    permit manipulation of the intracellular pools of both pyrimidine and purine nucleotides. The results identify the effectory purine compound as being a guanine nucleotide; it is probably GTP, but it may be GDP or GMP. The synthesis of carbamoylphosphate synthase, encoded by pyrA, and particularly...

  13. Molecular evolution of rDNA in early diverging Metazoa: First comparative analysis and phylogenetic application of complete SSU rRNA secondary structures in Porifera

    Wörheide Gert

    2008-02-01

    Full Text Available Abstract Background The cytoplasmic ribosomal small subunit (SSU, 18S ribosomal RNA (rRNA is the most frequently-used gene for molecular phylogenetic studies. However, information regarding its secondary structure is neglected in most phylogenetic analyses. Incorporation of this information is essential in order to apply specific rRNA evolutionary models to overcome the problem of co-evolution of paired sites, which violates the basic assumption of the independent evolution of sites made by most phylogenetic methods. Information about secondary structure also supports the process of aligning rRNA sequences across taxa. Both aspects have been shown to increase the accuracy of phylogenetic reconstructions within various taxa. Here, we explore SSU rRNA secondary structures from the three extant classes of Phylum Porifera (Grant, 1836, a pivotal, but largely unresolved taxon of early branching Metazoa. This is the first phylogenetic study of poriferan SSU rRNA data to date that includes detailed comparative secondary structure information for all three sponge classes. Results We found base compositional and structural differences in SSU rRNA among Demospongiae, Hexactinellida (glass sponges and Calcarea (calcareous sponges. We showed that analyses of primary rRNA sequences, including secondary structure-specific evolutionary models, in combination with reconstruction of the evolution of unusual structural features, reveal a substantial amount of additional information. Of special note was the finding that the gene tree topologies of marine haplosclerid demosponges, which are inconsistent with the current morphology-based classification, are supported by our reconstructed evolution of secondary structure features. Therefore, these features can provide alternative support for sequence-based topologies and give insights into the evolution of the molecule itself. To encourage and facilitate the application of rRNA models in phylogenetics of early

  14. Molecular evolution of rDNA in early diverging Metazoa: First comparative analysis and phylogenetic application of complete SSU rRNA secondary structures in Porifera

    2008-01-01

    Background The cytoplasmic ribosomal small subunit (SSU, 18S) ribosomal RNA (rRNA) is the most frequently-used gene for molecular phylogenetic studies. However, information regarding its secondary structure is neglected in most phylogenetic analyses. Incorporation of this information is essential in order to apply specific rRNA evolutionary models to overcome the problem of co-evolution of paired sites, which violates the basic assumption of the independent evolution of sites made by most phylogenetic methods. Information about secondary structure also supports the process of aligning rRNA sequences across taxa. Both aspects have been shown to increase the accuracy of phylogenetic reconstructions within various taxa. Here, we explore SSU rRNA secondary structures from the three extant classes of Phylum Porifera (Grant, 1836), a pivotal, but largely unresolved taxon of early branching Metazoa. This is the first phylogenetic study of poriferan SSU rRNA data to date that includes detailed comparative secondary structure information for all three sponge classes. Results We found base compositional and structural differences in SSU rRNA among Demospongiae, Hexactinellida (glass sponges) and Calcarea (calcareous sponges). We showed that analyses of primary rRNA sequences, including secondary structure-specific evolutionary models, in combination with reconstruction of the evolution of unusual structural features, reveal a substantial amount of additional information. Of special note was the finding that the gene tree topologies of marine haplosclerid demosponges, which are inconsistent with the current morphology-based classification, are supported by our reconstructed evolution of secondary structure features. Therefore, these features can provide alternative support for sequence-based topologies and give insights into the evolution of the molecule itself. To encourage and facilitate the application of rRNA models in phylogenetics of early metazoans, we present 52 SSU rRNA

  15. Single Nucleotide Polymorphism Clustering in Systemic Autoimmune Diseases

    Charlon, Thomas; Bossini-Castillo, Lara; Carmona, F. David; Di Cara, Alessandro; Wojcik, Jérôme; Voloshynovskiy, Sviatoslav

    2016-01-01

    Systemic Autoimmune Diseases, a group of chronic inflammatory conditions, have variable symptoms and difficult diagnosis. In order to reclassify them based on genetic markers rather than clinical criteria, we performed clustering of Single Nucleotide Polymorphisms. However naive approaches tend to group patients primarily by their geographic origin. To reduce this “ancestry signal”, we developed SNPClust, a method to select large sources of ancestry-independent genetic variations from all variations detected by Principal Component Analysis. Applied to a Systemic Lupus Erythematosus case control dataset, SNPClust successfully reduced the ancestry signal. Results were compared with association studies between the cases and controls without or with reference population stratification correction methods. SNPClust amplified the disease discriminating signal and the ratio of significant associations outside the HLA locus was greater compared to population stratification correction methods. SNPClust will enable the use of ancestry-independent genetic information in the reclassification of Systemic Autoimmune Diseases. SNPClust is available as an R package and demonstrated on the public Human Genome Diversity Project dataset at https://github.com/ThomasChln/snpclust. PMID:27490238

  16. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.

    B Josh Lane

    2008-03-01

    Full Text Available Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein. TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs, Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K, appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  17. Single Nucleotide Polymorphism Clustering in Systemic Autoimmune Diseases.

    Charlon, Thomas; Martínez-Bueno, Manuel; Bossini-Castillo, Lara; Carmona, F David; Di Cara, Alessandro; Wojcik, Jérôme; Voloshynovskiy, Sviatoslav; Martín, Javier; Alarcón-Riquelme, Marta E

    2016-01-01

    Systemic Autoimmune Diseases, a group of chronic inflammatory conditions, have variable symptoms and difficult diagnosis. In order to reclassify them based on genetic markers rather than clinical criteria, we performed clustering of Single Nucleotide Polymorphisms. However naive approaches tend to group patients primarily by their geographic origin. To reduce this "ancestry signal", we developed SNPClust, a method to select large sources of ancestry-independent genetic variations from all variations detected by Principal Component Analysis. Applied to a Systemic Lupus Erythematosus case control dataset, SNPClust successfully reduced the ancestry signal. Results were compared with association studies between the cases and controls without or with reference population stratification correction methods. SNPClust amplified the disease discriminating signal and the ratio of significant associations outside the HLA locus was greater compared to population stratification correction methods. SNPClust will enable the use of ancestry-independent genetic information in the reclassification of Systemic Autoimmune Diseases. SNPClust is available as an R package and demonstrated on the public Human Genome Diversity Project dataset at https://github.com/ThomasChln/snpclust. PMID:27490238

  18. Expression of Vesicular Nucleotide Transporter in Rat Odontoblasts.

    Ikeda, Erina; Goto, Tetsuya; Gunjigake, Kaori; Kuroishi, Kayoko; Ueda, Masae; Kataoka, Shinji; Toyono, Takashi; Nakatomi, Mitsushiro; Seta, Yuji; Kitamura, Chiaki; Nishihara, Tatsuji; Kawamoto, Tatsuo

    2016-02-27

    Several theories have been proposed regarding pain transmission mechanisms in tooth. However, the exact signaling mechanism from odontoblasts to pulp nerves remains to be clarified. Recently, ATP-associated pain transmission has been reported, but it is unclear whether ATP is involved in tooth pain transmission. In the present study, we focused on the vesicular nucleotide transporter (VNUT), a transporter of ATP into vesicles, and examined whether VNUT was involved in ATP release from odontoblasts. We examined the expression of VNUT in rat pulp by RT-PCR and immunostaining. ATP release from cultured odontoblast-like cells with heat stimulation was evaluated using ATP luciferase methods. VNUT was expressed in pulp tissue, and the distribution of VNUT-immunopositive vesicles was confirmed in odontoblasts. In odontoblasts, some VNUT-immunopositive vesicles were colocalized with membrane fusion proteins. Additionally P2X3, an ATP receptor, immunopositive axons were distributed between odontoblasts. The ATP release by thermal stimulation from odontoblast-like cells was inhibited by the addition of siRNA for VNUT. These findings suggest that cytosolic ATP is transported by VNUT and that the ATP in the vesicles is then released from odontoblasts to ATP receptors on axons. ATP vesicle transport in odontoblasts seems to be a key mechanism for signal transduction from odontoblasts to axons in the pulp. PMID:27006518

  19. Single nucleotide polymorphisms in clinics: Fantasy or reality for cancer?

    Srinivasan, Srilakshmi; Clements, Judith A; Batra, Jyotsna

    2016-02-01

    Single nucleotide polymorphisms (SNPs) have been classically used for dissecting various human complex disorders using candidate gene studies. During the last decade, large scale SNP analysis, i.e. genome-wide association studies (GWAS) have provided an agnostic approach to identify possible genetic loci associated with heterogeneous disease such as cancer susceptibility, prognosis of survival or drug response. Further, the advent of new technologies, including microarray-based genotyping as well as high throughput next generation sequencing has opened new avenues for SNPs to be used in clinical practice. It is speculated that the utility of SNPs to understand the mechanisms, biology of variable drug response and ultimately treatment individualization based on the individual's genome composition will be indispensable in the near future. In the current review, we discuss the advantages and disadvantages of the clinical utility of genetic variants in disease risk-prediction, prognosis, clinical outcome and pharmacogenomics. The lessons and challenges for the utility of SNP-based biomarkers are also discussed, including the need for additional functional validation studies. PMID:26398894

  20. Single nucleotide polymorphisms of Kit gene in Chinese indigenous horses.

    Han, Haoyuan; Mao, Chunchun; Chen, Ningbo; Lan, Xianyong; Chen, Hong; Lei, Chuzhao; Dang, Ruihua

    2016-02-01

    Kit gene is a genetic determinant of horse white coat color which has been a highly valued trait in horses for at least 2,000 years. Single nucleotide polymorphisms (SNPs) in Kit are of importance due to their strong associations with melanoblast survival during embryonic development. In this study, a mutation analysis of all 21 Kit exons in 14 Chinese domestic horse breeds revealed six SNPs (g.91214T>G, g.143245T>G, g.164297C>T, g.170189C>T, g.171356C>G, and g.171471G>A), which located in 5'-UTR region, intron 6, exon 15, exon 20, intron 20, and exon 21 of the equine Kit gene, respectively. Subsequently, these six SNPs loci were genotyped in 632 Chinese horses by PCR-RFLP or direct sequencing. The six SNPs together defined 18 haplotypes, demonstrating abundant haplotype diversities in Chinese horses. All the mutant alleles and haplotypes were shared among different breeds. But fewer mutations were detected in horses from China than that from abroad, indicating that Chinese horses belong to a more ancient genetic pool. This study will provide fundamental genetic information for evaluating the genetic diversity of Kit gene in Chinese indigenous horse breeds. PMID:27348891