WorldWideScience

Sample records for 23s rrna methyltransferase

  1. Domain V of 23S rRNA contains all the structural elements necessary for recognition by the ErmE methyltransferase

    Vester, B; Douthwaite, S

    1994-01-01

    enzyme efficiently modifies 23S rRNA in vitro. Removal of most of the 23S rRNA structure, so that only domain V (nucleotides 2000 to 2624) remains, does not affect the efficiency of modification by the methyltransferase. In addition, modification still occurs after the rRNA tertiary structure has been......The ErmE methyltransferase from the erythromycin-producing actinomycete Saccharopolyspora erythraea dimethylates the N-6 position of adenine 2058 in domain V of 23S rRNA. This modification confers resistance to erythromycin and to other macrolide, lincosamide, and streptogramin B antibiotics. We...

  2. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    Karminska, K. H.; Purta, E.; Hansen, L .H.; Bujnicki, J. M.; Vester, B.; Long, Katherine

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...

  3. YccW is the m5C methyltransferase specific for 23S rRNA nucleotide 1962

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M;

    2008-01-01

    . However, YccW does not methylate assembled 50S subunits, and this is somewhat surprising as the published crystal structures show nucleotide C1962 to be fully accessible at the subunit interface. YccW-directed methylation at nucleotide C1962 is conserved in bacteria, and loss of this methylation in E....... coli marginally reduces its growth rate. YccW had previously eluded identification because it displays only limited sequence similarity to the m(5)C methyltransferases RsmB and RsmF and is in fact more similar to known m(5)U (5-methyluridine) RNA methyltransferases. In keeping with the previously...... proposed nomenclature system for bacterial rRNA methyltransferases, yccW is now designated as the rRNA large subunit methyltransferase gene rlmI....

  4. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    Kaminska, Katarzyna H; Purta, Elzbieta; Hansen, Lykke H; Bujnicki, Janusz M; Vester, Birte; Long, Katherine S

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...... a 4Fe-4S cluster, a SAM molecule coordinated to the iron-sulfur cluster (SAM1) and a SAM molecule that is the putative methyl group donor (SAM2). All mutations at predicted functional sites affect Cfr activity significantly as assayed by antibiotic susceptibility testing and primer extension...

  5. YgdE is the 2'-O-ribose methyltransferase RlmM specific for nucleotide C2498 in bacterial 23S rRNA

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M;

    2009-01-01

    The rRNAs of Escherichia coli contain four 2'-O-methylated nucleotides. Similar to other bacterial species and in contrast with Archaea and Eukaryota, the E. coli rRNA modifications are catalysed by specific methyltransferases that find their nucleotide targets without being guided by small...... ribosomes. Nucleotide C2498 is situated within a highly conserved and heavily modified rRNA sequence, and YgdE's activity is influenced by other modification enzymes that target this region. Phylogenetically, YgdE is placed in the cluster of orthologous groups COG2933 together with S...... complementary RNAs. We show here that the ygdE gene encodes the methyltransferase that catalyses 2'-O-methylation at nucleotide C2498 in the peptidyl transferase loop of E. coli 23S rRNA. Analyses of rRNAs using MALDI mass spectrometry showed that inactivation of the ygdE gene leads to loss of methylation at...

  6. The conformation of 23S rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase

    Vester, B; Hansen, L H; Douthwaite, S

    1995-01-01

    it was shown that the A2057 and U2611 mutations alone and in combination alter the reactivity of A2058 and adjacent bases. However, mutagenizing position G-->A2032 in an adjacent loop, which has been implicated to interact with A2058, alters neither the ErmE methylation at A2058 nor the accessibility...... effects of mutations around position A2058 on methylation. Mutagenizing A2058 (to G or U) completely abolishes methylation of 23S rRNA by ErmE. No methylation occurred at other sites in the rRNA, demonstrating the fidelity of ErmE for A2058. Breaking the neighboring G2057-C2611 Watson-Crick base pair by...... introducing either an A2057 or a U2611 mutation, greatly reduces the rate of methylation at A2058. Methylation remains impaired after these mutations have been combined to create a new A2057-U2611 Watson-Crick base interaction. The conformation of this region in 23S rRNA was probed with chemical reagents and...

  7. Purification, crystallization and preliminary X-ray diffraction analysis of the 23S rRNA methyltransferase RlmJ from Escherichia coli

    The 23S rRNA methyltransferase RlmJ from E. coli has been cloned, expressed, purified and crystallized. X-ray diffraction data to 1.85 Å resolution have been collected from the apo RlmJ crystals. Methyltransferase RlmJ uses the cofactor S-adenosylmethionine to methylate the exocyclic nitrogen N6 of nucleotide A2030 in 23S rRNA during ribosome assembly in Escherichia coli. RlmJ with a C-terminal hexahistidine tag was overexpressed in E. coli and purified as a monomer using Ni2+-affinity and size-exclusion chromatography. The recombinant RlmJ was crystallized using the sitting-drop vapour-diffusion method and a full data set was collected to 1.85 Å resolution from a single apo crystal. The crystals belonged to space group P21, with unit-cell parameters a = 46.9, b = 77.8, c = 82.5 Å, β = 104°. Data analysis suggested two molecules per asymmetric unit and a Matthews coefficient of 2.20 Å3 Da−1

  8. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    Liu, M; Kirpekar, F; Van Wezel, G P;

    2000-01-01

    Streptomyces species indicates that in vivo TlrB modifies nucleotide G748 within helix 35 of 23S rRNA. Purified recombinant TlrB retains its activity and specificity in vitro and modifies G748 in 23S rRNA as well as in a 74 nucleotide RNA containing helix 35 and surrounding structures. Modification is...

  9. YbeA is the m3Psi methyltransferase RlmH that targets nucleotide 1915 in 23S rRNA

    Purta, Elzbieta; Kaminska, Katarzyna H; Kasprzak, Joanna M;

    2008-01-01

    Pseudouridines in the stable RNAs of Bacteria are seldom subjected to further modification. There are 11 pseudouridine (Psi) sites in Escherichia coli rRNA, and further modification is found only at Psi1915 in 23S rRNA, where the N-3 position of the base becomes methylated. Here, we report the...... identity of the E. coli methyltransferase that specifically catalyzes methyl group addition to form m(3)Psi1915. Analyses of E. coli rRNAs using MALDI mass spectrometry showed that inactivation of the ybeA gene leads to loss of methylation at nucleotide Psi1915. Methylation is restored by complementing the...... knockout strain with a plasmid-encoded copy of ybeA. Homologs of the ybeA gene, and thus presumably the ensuing methylation at nucleotide m(3)Psi1915, are present in most bacterial lineages but are essentially absent in the Archaea and Eukaryota. Loss of ybeA function in E. coli causes a slight slowing of...

  10. Structure of the bifunctional methyltransferase YcbY (RlmKL) that adds the m7G2069 and m2G2445 modifications in Escherichia coli 23S rRNA

    Wang, Kai-Tuo; Desmolaize, Benoit; Nan, Jie;

    2012-01-01

    fusions from two separate proteins found in Gram-positives. The crystal structures described here show that both the N- and C-terminal halves of E. coli YcbY have a methyltransferase active site and their folding patterns respectively resemble the Streptococcus mutans proteins Smu472 and Smu776. Mass...

  11. A single methyltransferase YefA (RlmCD) catalyses both m5U747 and m5U1939 modifications in Bacillus subtilis 23S rRNA

    Desmolaize, Benoit; Fabret, Céline; Brégeon, Damien;

    2011-01-01

    , YefA that is a COG2265 member. A recombinant version of YefA functions in an E. coli m(5)U-null mutant adding the same two rRNA methylations. The findings suggest that during evolution, COG2265 enzymes have undergone a series of changes in target specificity and that YefA is closer to an archetypical...

  12. Functional interactions within 23S rRNA involving the peptidyltransferase center.

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S rRNA peptidyltransferase loop. All three base substitutions at position 2032 produce an erythromycin-hypersensitive phenotype. The 2032 substitutions were compared with and combined with a 12-bp deletion muta...

  13. Negative in vitro selection identifies the rRNA recognition motif for ErmE methyltransferase

    Nielsen, A K; Douthwaite, S; Vester, B

    1999-01-01

    the adjacent single-stranded region around A2058. An RNA transcript of 72 nt that displays this motif functions as an efficient substrate for the ErmE methyltransferase. Pools of degenerate RNAs were formed by doping 34-nt positions that extend over and beyond the putative Erm recognition motif within...... contained substitutions at single sites, and these are confined to 12 nucleotide positions. These nucleotides, corresponding to A2051-A2060, C2611, and A2614 in 23S rRNA, presumably comprise the RNA recognition motif for ErmE methyltransferase. The structure formed by these nucleotides is highly conserved...

  14. Recognition determinants for proteins and antibiotics within 23S rRNA

    Douthwalte, S; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup;

    1995-01-01

    Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of...... molecular genetic and biochemical probing techniques, we have concentrated on regions of the rRNA that are connected with specific functions. These are located in different domains within the 23S rRNA and include the ribosomal GTPase-associated center in domain II, which contains the binding sites for r......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...

  15. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    reveals increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits......The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea and...... chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...

  16. Crystal structure of the Escherichia coli 23S rRNA:m5C methyltransferase RlmI (YccW) reveals evolutionary links between RNA modification enzymes

    Sunita, S; Tkaczuk, Karolina L; Purta, Elzbieta;

    2008-01-01

    Methylation is the most common RNA modification in the three domains of life. Transfer of the methyl group from S-adenosyl-l-methionine (AdoMet) to specific atoms of RNA nucleotides is catalyzed by methyltransferase (MTase) enzymes. The rRNA MTase RlmI (rRNA large subunit methyltransferase gene I......; previously known as YccW) specifically modifies Escherichia coli 23S rRNA at nucleotide C1962 to form 5-methylcytosine. Here, we report the crystal structure of RlmI refined at 2 A to a final R-factor of 0.194 (R(free)=0.242). The RlmI molecule comprises three domains: the N-terminal PUA domain; the central...

  17. Functional interactions within 23S rRNA involving the peptidyltransferase center

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S r...... chloramphenicol. Introduction of the domain II deletion into these double-mutation constructs gives rise to erythromycin resistance. The results are interpreted as indicating that position 2032 interacts with the peptidyltransferase loop and that there is a functional connection between domains II and V....

  18. Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

    Dam, M; Douthwaite, S; Tenson, T;

    1996-01-01

    Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247....... This is close to a short open reading frame in the 23 S rRNA that encodes a pentapeptide (E-peptide) whose expression in vivo renders cells resistant to erythromycin. Therefore, a possible mechanism of resistance caused by domain II mutations may be related to an increased expression of the E-peptide. To test...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore...

  19. Purification, crystallization and preliminary X-ray crystallographic analysis of 23S RNA m2G2445 methyltransferase RlmL from Escherichia coli

    RlmL, a 23S rRNA m2G2445 methyltransferase from Escherichia coli, was expressed, purified and crystallized, and crystals diffracted to 2.2 Å. The RlmL (YcbY) protein in Escherichia coli is an rRNA methyltransferase that is specific for m2G2445 modification of 23S RNA. The rlmL gene was cloned into the expression vector pET28a and expressed in the host E. coli strain BL21 (DE3). Recombinant protein with a six-histidine tag was purified by Ni2+-affinity chromatography followed by gel filtration. Crystals were grown using the hanging-drop vapour-diffusion method and a detergent was used as an additive to improve diffraction quality. The final crystals diffracted to 2.2 Å resolution. The crystals belonged to space group P21, with unit-cell parameters a = 73.6, b = 140.8, c = 102.9 Å, β = 102.3°. The crystal has a most probable solvent content of 62.8% with two molecules in the asymmetric unit

  20. Fragmentation of 23S rRNA in Strains of Proteus and Providencia Results from Intervening Sequences in the rrn (rRNA) Genes

    Miller, Wayne L.; Pabbaraju, Kanti; Sanderson, Kenneth E.

    2000-01-01

    Intervening sequences (IVSs) were originally identified in the rrl genes for 23S rRNA (rrl genes, for large ribosomal subunit, part of rrn operon encoding rRNA) of Salmonella enterica serovars Typhimurium LT2 and Arizonae. These sequences are transcribed but later removed during RNase III processing of the rRNA, resulting in fragmentation of the 23S species; IVSs are uncommon, but have been reported in at least 10 bacterial genera. Through PCR amplification of IVS-containing regions of the rr...

  1. Intervening Sequences in rrl Genes and Fragmentation of 23S rRNA in Genera of the Family Enterobacteriaceae

    Pronk, Loes M; Sanderson, Kenneth E.

    2001-01-01

    Intervening sequences (IVSs) in the rrl genes for 23S rRNA are transcribed but later removed by RNase III without religation during RNA processing, leading to fragmented rRNA. We examined about 240 strains of the family Enterobacteriaceae for presence of IVSs using PCR. No IVSs were detected in strains belonging to Escherichia, Shigella, Enterobacter, Erwinia, Ewingella, Hafnia, Kluyvera, Morganella, Pantoea, or Serratia. Previously unreported IVSs were detected in Klebsiella oxytoca, Citroba...

  2. Absolute Quantification of Enterococcal 23S rRNA Gene Using Digital PCR.

    Wang, Dan; Yamahara, Kevan M; Cao, Yiping; Boehm, Alexandria B

    2016-04-01

    We evaluated the ability of chip-based digital PCR (dPCR) to quantify enterococci, the fecal indicator recommended by the United States Environmental Protection Agency (USEPA) for water-quality monitoring. dPCR uses Poisson statistics to estimate the number of DNA fragments in a sample with a specific sequence. Underestimation may occur when a gene is redundantly encoded in the genome and multiple copies of that gene are on one DNA fragment. When genomic DNA (gDNA) was extracted using two commercial DNA extraction kits, we confirmed that dPCR could discern individual copies of the redundant 23s rRNA gene in the enterococcal genome. dPCR quantification was accurate when compared to the nominal concentration inferred from fluorometer measurements (linear regression slope = 0.98, intercept = 0.03, R(2) = 0.99, and p value humic acid caused a similar level of inhibition in both dPCR and qPCR, but calcium inhibited dPCR to a lesser degree than qPCR. Inhibition of dPCR was partially relieved when the number of thermal cycles was increased. Based on these results, we conclude that dPCR is a viable option for enumerating enterococci in ambient water. PMID:26903207

  3. Mapping important nucleotides in the peptidyl transferase centre of 23 S rRNA using a random mutagenesis approach

    Porse, B T; Garrett, R A

    1995-01-01

    Random mutations were generated in the lower half of the peptidyl transferase loop in domain V of 23 S rRNA from Escherichia coli using a polymerase chain reaction (PCR) approach, a rapid procedure for identifying mutants and a plasmid-based expression system. The effects of 21 single......-site mutations, at 18 different positions, on cell growth, mutant rRNA incorporation into ribosomes and peptidyl transferase activity of the mutant ribosomes were analysed. The general importance of the whole region for the peptidyl transferase centre was emphasized by the finding that 14 of the mutants were...... sick, or very sick, when ribosomes containing chromosomal-encoded 23 S rRNA were inhibited by erythromycin, and all except one of these exhibited low levels of peptidyl transferase activity in their mutated ribosomes. Two mutations, psi 2580-->C and U2584-->G that both yielded inactive ribosomes were...

  4. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio

    2010-04-01

    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae. PMID:19656941

  5. Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿

    wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

    2008-01-01

    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative s...

  6. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    Ostergaard, P; Phan, H; Johansen, L B;

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

  7. Antibiotic interactions at the GTPase-associated centre within Escherichia coli 23S rRNA

    Egebjerg, J; Douthwaite, S; Garrett, R A

    1989-01-01

    A comprehensive range of chemical reagents and ribonucleases was employed to investigate the interaction of the antibiotics thiostrepton and micrococcin with the ribosomal protein L11-23S RNA complex and with the 50S subunit. Both antibiotics block processes associated with the ribosomal A-site b...... important exception, however, occurred at nucleotide A1067 within a terminal loop where thiostrepton protected the N-1 position while micrococcin rendered it more reactive. This difference correlates with the opposite effects of the two antibiotics on GTPase activity....... differ in their effects on GTP hydrolysis, which is inhibited by thiostrepton and stimulated by micrococcin. The interaction sites of both drugs were shown to occur within the nucleotide sequences A1067-A1098 within the protein L11 binding site on 23S RNA. This region of the ribosome structure is......A comprehensive range of chemical reagents and ribonucleases was employed to investigate the interaction of the antibiotics thiostrepton and micrococcin with the ribosomal protein L11-23S RNA complex and with the 50S subunit. Both antibiotics block processes associated with the ribosomal A-site but...

  8. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics.

    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G

    2005-09-01

    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  9. Analysis of the function of E. coli 23S rRNA helix-loop 69 by mutagenesis

    Maiväli Ülo

    2005-07-01

    Full Text Available Abstract Background The ribosome is a two-subunit enzyme known to exhibit structural dynamism during protein synthesis. The intersubunit bridges have been proposed to play important roles in decoding, translocation, and the peptidyl transferase reaction; yet the physical nature of their contributions is ill understood. An intriguing intersubunit bridge, B2a, which contains 23S rRNA helix 69 as a major component, has been implicated by proximity in a number of catalytically important regions. In addition to contacting the small ribosomal subunit, helix 69 contacts both the A and P site tRNAs and several translation factors. Results We scanned the loop of helix 69 by mutagenesis and analyzed the mutant ribosomes using a plasmid-borne IPTG-inducible expression system. We assayed the effects of 23S rRNA mutations on cell growth, contribution of mutant ribosomes to cellular polysome pools and the ability of mutant ribosomes to function in cell-free translation. Mutations A1912G, and A1919G have very strong growth phenotypes, are inactive during in vitro protein synthesis, and under-represented in the polysomes. Mutation Ψ1917C has a very strong growth phenotype and leads to a general depletion of the cellular polysome pool. Mutation A1916G, having a modest growth phenotype, is apparently defective in the assembly of the 70S ribosome. Conclusion Mutations A1912G, A1919G, and Ψ1917C of 23S rRNA strongly inhibit translation. Mutation A1916G causes a defect in the 50S subunit or 70S formation. Mutations Ψ1911C, A1913G, C1914A, Ψ1915C, and A1918G lack clear phenotypes.

  10. New mutation points in 23S rRNA gene associated with Helicobacter Pylori resistance to clarithromycin in northeast China

    Qing Hao; Yan Li; Zhi-Jie Zhang; Yong Liu; Hong Gao

    2004-01-01

    AIM: To investigate the resistance rate of Helicobacter pylori (Hpylori) to clarithromycin, metronidazole, amoxicillin and tetracycline to guide clinical practice, and to study the mechanism of H pyloriresistant to clarithromycin.METHODS: Thirty H pyloristrains were isolated from the mucosa of peptic ulcer, gastric tumor and chronic gastritis patients, then the minimal inhibitory concentration (MIC) to clarithromycin, metronidazole, amoxicillin and tetracycline was evaluated by E-test method. The sequence analysis of PCR fragments was conducted in 23S rRNA gene of H pylori resistant to clarithromycin to get the resistance mechanism of the bacteria.RESULTS: Among 30 H pyloristrains, 7 cases were resistant to clarithromycin, 12 to metronidazole, 2 to tetracycline and no strain was found to be resistant to amoxicillin. The resistance rates were 23.3%, 40%, 6.7% and 0%,respectively. Three new mutation points were found to be related to the clarithromycin resistance in H pyloriisolates,which were G2224A, C2245T and T2289C.CONCLUSION: In northeast China, H pylorishows high resistance to metronidazole, while sensitive to amoxicillin.The mechanism of resistance to clarithromycin may be related to the mutation of G2224A, C2245T and T2289C in the 23S rRNA gene.

  11. Sites of interaction of streptogramin A and B antibiotics in the peptidyl transferase loop of 23 S rRNA and the synergism of their inhibitory mechanisms

    Porse, B T; Garrett, R A

    1999-01-01

    nucleotides in the peptidyl transferase loop of 23 S rRNA, including the two mutated nucleotides. An rRNA footprinting study, performed both in vivo and in vitro, on the A and B components complexed to Bacillus megaterium ribosomes, indicated that similar drug-induced effects occur on free ribosomes and...

  12. Methyltransferase Erm(37) Slips on rRNA to Confer Atypical Resistance in Mycobacterium tuberculosis

    Madsen, Ch. T.; Jakobsen, L.; Buriánková, Karolína; Doucet-Populaire, F.; Perdonet, J. L.; Douthwaite, S.

    2005-01-01

    Roč. 280, č. 47 (2005), s. 38942-38947. ISSN 0021-9258 R&D Projects: GA ČR GA310/03/0292 Institutional research plan: CEZ:AV0Z50200510 Keywords : methyltransferase erm * mycobacterium tuberculosis * rRNA Subject RIV: EE - Microbiology, Virology Impact factor: 5.854, year: 2005

  13. Identification of 5-hydroxycytidine at position 2501 concludes characterization of modified nucleotides in E. coli 23S rRNA

    Havelund, Jesper Foged; Giessing, Anders Michael Bernth; Hansen, Trine Møller;

    2011-01-01

    modification as 5-hydroxycytidine-a novel modification in RNA. Identification of 5-hydroxycytidine was completed by liquid chromatography under nonoxidizing conditions using a graphitized carbon stationary phase in combination with ion trap tandem mass spectrometry and by comparing the fragmentation behavior...... rRNA-has previously been characterized in the bacterium Escherichia coli. Despite a first report nearly 20 years ago, the chemical nature of the modification at position 2501 has remained elusive, and attempts to isolate it have so far been unsuccessful. We unambiguously identify this last unknown...... of the natural nucleoside with that of a chemically synthesized ditto. Furthermore, we show that 5-hydroxycytidine is also present in the equivalent position of 23S rRNA from the bacterium Deinococcus radiodurans. Given the unstable nature of 5-hydroxycytidine, this modification might be found in...

  14. 116S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads

    Sima eTokajian

    2016-02-01

    Full Text Available Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 to 849 bp, while their G+C content was 42.2 mol% to 57.9 mol%. Five distinct ITS types were identified: ITSnone (without tRNA genes, ITSAla(TGC, ITSAla (TGC+Ile (GAT, ITSIle (GAT+Ala (TGC and ITS Ile (GAT+Pseudo. All of the identified tRNAAla (TGC molecules consisted of 73 bases, and all of the tRNAIle (GAT molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2.

  15. Oxazolidinone resistance mutations in 23S rRNA of Escherichia coli reveal the central region of domain V as the primary site of drug action

    Xiong, L; Kloss, P; Douthwaite, S; Andersen, N M; Swaney, S; Shinabarger, D L; Mankin, A S

    2000-01-01

    resistance mutations were clustered in the vicinity of the central loop of domain V of 23S rRNA, suggesting that this rRNA region plays a major role in the interaction of the drug with the ribosome. Although the central loop of domain V is an essential integral component of the ribosomal peptidyl transferase......, we selected Escherichia coli oxazolidinone-resistant mutants, which contained a randomly mutagenized plasmid-borne rRNA operon. The same mutation, G2032 to A, was identified in the 23S rRNA genes of several independent resistant isolates. Engineering of this mutation by site-directed mutagenesis in...... the wild-type rRNA operon produced an oxazolidinone resistance phenotype, establishing that the G2032A substitution was the determinant of resistance. Engineered U and C substitutions at G2032, as well as a G2447-to-U mutation, also conferred resistance to oxazolidinone. All the characterized...

  16. EmtA, a rRNA methyltransferase conferring high-level evernimicin resistance

    Mann, P. A.; Xiong, L.; Mankin, A. S.; Chau, A. S.; Najarian, D. J.; Mendrick, C. A.; Cramer, C. A.; Aarestrup, Frank Møller; Hare, R. S.; Black, T. A.; McNicholas, P. M.

    2001-01-01

    unique to the 23S rRNA extracted from resistant ribosomes. The pause corresponded to methylation of residue G2470 (Escherichia coli numbering). RNA footprinting revealed that G2470 is located within the evernimicin-binding site on the ribosome, thus providing an explanation for the reduced binding of the...

  17. UV-induced modifications in the peptidyl transferase loop of 23S rRNA dependent on binding of the streptogramin B antibiotic, pristinamycin IA

    Porse, B T; Kirillov, S V; Awayez, M J;

    1999-01-01

    The naturally occurring streptogramin B antibiotic, pristinamycin IA, which inhibits peptide elongation, can produce two modifications in 23S rRNA when bound to the Escherichia coli 70S ribosome and irradiated at 365 nm. Both drug-induced effects map to highly conserved nucleotides within the...... functionally important peptidyl transferase loop of 23S rRNA at positions m2A2503/psi2504 and G2061/A2062. The modification yields are influenced strongly, and differentially, by P-site-bound tRNA and strongly by some of the peptidyl transferase antibiotics tested, with chloramphenicol producing a shift in the...... latter modification to A2062/C2063. Pristinamycin IA can also produce a modification on binding to deproteinized, mature 23S rRNA, at position U2500/C2501. The same modification occurs on an approximately 37-nt fragment, encompassing positions approximately 2496-2532 of the peptidyl transferase loop that...

  18. Prevalence of A2143G mutation of H. pylori-23S rRNA in Chinese subjects with and without clarithromycin use history

    Ma Junling; Feng Guoshuang; Gu Liankun; Zhou Jing; Zhang Baozhen; Li Qiang; Shen Lin; Zhang Lian; Shen Jing; Liu Zhuoqi; You Wei-Cheng; Deng Dajun

    2008-01-01

    Abstract Background A2143G mutation of 23S rRNA gene of H. pylori results in clarithromycin (CLR) resistance. To investigate the prevalence of the CLR resistance-related A2143G mutation of the H. pylori-specific 23S rRNA gene in Chinese subjects with and without CLR use history, 307 subjects received the treatment with amoxicillin and omeprazole (OA) and 310 subjects received a placebo in 1995, and 153 subjects received a triple therapy with OA and CLR (OAC) in 2000. DNA was extracted from fa...

  19. Macrolide-ketolide inhibition of MLS-resistant ribosomes is improved by alternative drug interaction with domain II of 23S rRNA

    Douthwaite, S; Hansen, L H; Mauvais, P

    2000-01-01

    The macrolide antibiotic erythromycin and its 6-O-methyl derivative (clarithromycin) bind to bacterial ribosomes primarily through interactions with nucleotides in domains II and V of 23S rRNA. The domain II interaction occurs between nucleotide A752 and the macrolide 3-cladinose moiety. Removal ...

  20. Acquired macrolide resistance in the human intestinal strain Lactobacillus rhamnosus E41 associated with a transition mutation in 23S rRNA genes

    Flórez García, Ana Belén; Ladero Losada, Víctor Manuel; Álvarez Martín, Pablo; Ammor, Mohammed Salim; Álvarez González, Miguel Ángel; Mayo Pérez, Baltasar

    2007-01-01

    Restriction fragment length polymorphism and DNA sequencing of polymerase chain reaction (PCR) products showed that a Lactobacillus rhamnosus strain of human origin resistant to macrolides, from which no resistance determinants have been detected by specific PCR and microarray screening, contained a heterozygous A → G transition mutation at position 2058 (Escherichia coli numbering) of its 23S rRNA genes.

  1. 23S rRNA nucleotides in the peptidyl transferase center are essential for tryptophanase operon induction.

    Yang, Rui; Cruz-Vera, Luis R; Yanofsky, Charles

    2009-06-01

    Distinct features of the ribosomal peptide exit tunnel are known to be essential for recognition of specific amino acids of a nascent peptidyl-tRNA. Thus, a tryptophan residue at position 12 of the peptidyl-tRNA TnaC-tRNA(Pro) leads to the creation of a free tryptophan binding site within the ribosome at which bound tryptophan inhibits normal ribosome functions. The ribosomal processes that are inhibited are hydrolysis of TnaC-tRNA(Pro) by release factor 2 and peptidyl transfer of TnaC of TnaC-tRNA(Pro) to puromycin. These events are normally performed in the ribosomal peptidyl transferase center. In the present study, changes of 23S rRNA nucleotides in the 2585 region of the peptidyl transferase center, G2583A and U2584C, were observed to reduce maximum induction of tna operon expression by tryptophan in vivo without affecting the concentration of tryptophan necessary to obtain 50% induction. The growth rate of strains with ribosomes with either of these changes was not altered appreciably. In vitro analyses with mutant ribosomes with these changes showed that tryptophan was not as efficient in protecting TnaC-tRNA(Pro) from puromycin action as wild-type ribosomes. However, added tryptophan did prevent sparsomycin action as it normally does with wild-type ribosomes. These findings suggest that these two mutational changes act by reducing the ability of ribosome-bound tryptophan to inhibit peptidyl transferase activity rather than by reducing the ability of the ribosome to bind tryptophan. Thus, the present study identifies specific nucleotides within the ribosomal peptidyl transferase center that appear to be essential for effective tryptophan induction of tna operon expression. PMID:19329641

  2. Prevalence of A2143G mutation of H. pylori-23S rRNA in Chinese subjects with and without clarithromycin use history

    Ma Junling

    2008-05-01

    Full Text Available Abstract Background A2143G mutation of 23S rRNA gene of H. pylori results in clarithromycin (CLR resistance. To investigate the prevalence of the CLR resistance-related A2143G mutation of the H. pylori-specific 23S rRNA gene in Chinese subjects with and without CLR use history, 307 subjects received the treatment with amoxicillin and omeprazole (OA and 310 subjects received a placebo in 1995, and 153 subjects received a triple therapy with OA and CLR (OAC in 2000. DNA was extracted from fasting gastric juice at the end of the intervention trial in 2003. H. pylori infection was determined by H. pylori-specific 23S rRNA PCR, ELISA, and13C-urea breath test assays. Mutations of the 23S rRNA gene were detected by RFLP assays. Results The presence of 23S rRNA due to H. pylori infection in the OA group remained lower than that in the placebo group 7.3 yrs after OA-therapy [51.1% (157/307 vs. 83.9% (260/310, p = 0.0000]. In the OAC group, the 23S rRNA detection rate was 26.8% (41/153 three yrs after OAC-treatment. The A2143G mutation rate among the 23S rRNA-positive subjects in the OAC group [31.7% (13/41] was significantly higher than that in the OA group [10.2% (16/157] and the placebo group [13.8% (36/260]. The frequency of the AAGGG → CTTCA (2222–2226 and AACC → GAAG (2081–2084 sequence alterations in the OAC group was also significantly higher than those in the OA group and the placebo group. Conclusion Primary prevalence of the A2143G mutation was 10~14% among Chinese population without history of CLR therapy. Administration of CLR to eliminate H. pylori infection increased the prevalence of the A2143G mutation in Chinese subjects (32% significantly.

  3. 奇异变形杆菌分离株23S rRNA序列分析%Sequence analysis of 23S rRNA genes of Proteus mirabilis

    王慧; 朱瑞良; 朱明华; 谭燕玲; 孙振红; 魏凯; 盛鹏程; 王新建

    2011-01-01

    通过PCR反应扩增7株鸡奇异变形杆菌和1株兔奇异变形杆菌的23SrRNA基因片段(1 045bp),经克隆测序,用DNAStar分析软件将所获得的序列与GenBank中收录的奇异变形杆菌、普通变形杆菌以及其他相近属的23S rRNA基因序列进行同源性比较,并由此构建奇异变形杆菌系统进化发生树.结果表示,本实验室保存的7株鸡奇异变形杆菌核苷酸序列与GenBank中收录的奇异变形杆菌核苷酸序列同源性为99.4%~99.8%,与兔奇异变形杆菌核苷酸序列同源性为98.8%~99.3%,与普通变形杆茵的核苷酸序列同源性为95.4%~96.2%,而与其他相近属同源性只有92.9%~93.4%.结果表明,23S rRNA基因序列分析可以作为鉴定奇异变形杆茵的一种快速、简便的方法.%To assess the evolution of Proteus mirabilis by 23S rRNA genes,To establish the sequence analysis of 23S rRNA of Proteus mirabilis was analyzed. The fragments (1 045 bp) of 23S rRNA genes of seven chicken Proteus mirabilis strains and one rabbit Proteus mirabilis strain were amplified by PCR and were sequenced. The sequences obtained in this paper were compared with the Proteus mirabilis 23S rRNA sequence reported in GenBank and other similar generas by the software of DNAStar analyses. The phylogenetic tree of Proteus mirabilis strains was established. Results showed the homologies between seven chicken Proteus mirabilis strains and the reported one strain in GenBank were 99.4%-99.8% ,and were 98.8%-99.3% identical to the rabbit Proteus mirabilis strains,were 95.4 %-96.2% identical to Proteus vulgaris, were 92. 9%-93.4 % identical to other similar generas. The result shown that 23S rRNA sequence analyses may be a reliable and rapid way for identification of Proteus mirabilis.

  4. Identification to the species level of Lactobacillus isolated in probiotic prospecting studies of human, animal or food origin by 16S-23S rRNA restriction profiling

    Neumann Elisabeth; Teixeira Santuza MR; Horta Maria F; Mota Rodrigo M; Moreira João; Nicoli Jacques R.; Nunes Álvaro C

    2005-01-01

    Abstract Background The accurate identification of Lactobacillus and other co-isolated bacteria during microbial ecological studies of ecosystems such as the human or animal intestinal tracts and food products is a hard task by phenotypic methods requiring additional tests such as protein and/or lipids profiling. Results Bacteria isolated in different probiotic prospecting studies, using de Man, Rogosa and Sharpe medium (MRS), were typed at species level by PCR amplification of 16S-23S rRNA i...

  5. Use of 16S-23S rRNA Intergenic Spacer Region PCR and Repetitive Extragenic Palindromic PCR Analyses of Escherichia coli Isolates To Identify Nonpoint Fecal Sources

    Seurinck, Sylvie; Verstraete, Willy; Siciliano, Steven D.

    2003-01-01

    Despite efforts to minimize fecal input into waterways, this kind of pollution continues to be a problem due to an inability to reliably identify nonpoint sources. Our objective was to find candidate source-specific Escherichia coli fingerprints as potential genotypic markers for raw sewage, horses, dogs, gulls, and cows. We evaluated 16S-23S rRNA intergenic spacer region (ISR)-PCR and repetitive extragenic palindromic (rep)-PCR analyses of E. coli isolates as tools to identify nonpoint fecal...

  6. First Report of the 23S rRNA Gene A2058G Point Mutation Associated With Macrolide Resistance in Treponema pallidum From Syphilis Patients in Cuba.

    Noda, Angel A; Matos, Nelvis; Blanco, Orestes; Rodríguez, Islay; Stamm, Lola Virginia

    2016-05-01

    This study aimed to assess the presence of macrolide-resistant Treponema pallidum subtypes in Havana, Cuba. Samples from 41 syphilis patients were tested for T. pallidum 23S rRNA gene mutations. Twenty-five patients (61%) harbored T. pallidum with the A2058G mutation, which was present in all 8 subtypes that were identified. The A2059G mutation was not detected. PMID:27100771

  7. Discrimination of bacillus anthracis and closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microarray.

    Bavykin, S. G.; Mikhailovich, V. M.; Zakharyev, V. M.; Lysov, Y. P.; Kelly, J. J.; Alferov, O. S.; Jackman, J.; Stahl, D. A.; Mirzabekov, A. D.; Gavin, I. M.; Kukhtin, A. V.; Chandler, D. (Biochip Technology Center); (Engelhardt Inst. of Molecular Biology); (Northwestern Univ.); (Georgetown Univ.)

    2008-01-30

    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 min. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead reflect

  8. Identification of the methyltransferase targeting C2499 in Deinococcus radiodurans 23S ribosomal RNA

    Nielsen, Julie Mundus; Flyvbjerg, Karen Freund; Kirpekar, Finn

    2016-01-01

    The bacterium Deinococcus radiodurans-like all other organisms-introduces nucleotide modifications into its ribosomal RNA. We have previously found that the bacterium contains a Carbon-5 methylation on cytidine 2499 of its 23S ribosomal RNA, which is so far the only modified version of cytidine 2...

  9. Multi-site-specific 16S rRNA methyltransferase RsmF from Thermus thermophilus

    Demirci, Hasan; Larsen, Line H G; Hansen, Trine;

    2010-01-01

    Cells devote a significant effort toward the production of multiple modified nucleotides in rRNAs, which fine tune the ribosome function. Here, we report that two methyltransferases, RsmB and RsmF, are responsible for all four 5-methylcytidine (m(5)C) modifications in 16S rRNA of Thermus...... thermophilus. Like Escherichia coli RsmB, T. thermophilus RsmB produces m(5)C967. In contrast to E. coli RsmF, which introduces a single m(5)C1407 modification, T. thermophilus RsmF modifies three positions, generating m(5)C1400 and m(5)C1404 in addition to m(5)C1407. These three residues are clustered near...

  10. The Cfr rRNA methyltransferase confers resistance to Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A antibiotics

    Long, K. S.; Poehlsgaard, Jacob; Kehrenberg, C.; Schwarz, S.; Vester, B.

    2006-01-01

    A novel multidrug resistance phenotype mediated by the Cfr rRNA methyltransferase is observed in Staphylococcus aureus and Escherichia coli. The cfr gene has previously been identified as a phenicol and lincosamide resistance gene on plasmids isolated from Staphylococcus spp. of animal origin and...

  11. A molecular biological study on identification of common septicemia bacteria using 16s-23s rRNA gene spacer regions

    傅君芬; 虞和永; 尚世强; 洪文澜; 陆淼泉; 李建平

    2002-01-01

    In the search for a rapid and reliable method for identification of bacteria in blood and cerebrospinal fluid , we developed a unified set of primers and used them under polymerase chain reaction(PCR) to amplify the spacer regions between the 16s and 23s genes in the prokaryotic rRNA genetic loci . Spacer regions within these loci showed a significant level of length and sequence polymorphism across most of the species lines. A generic pair of priming sequences was selected from highly conserved sequences in the 16s and 23s genes occurring adjacent to these polymorphic regions. This single set of primers and reaction conditions were used for the amplification of the 16s-23s spacer regions for 61 strains of standard bacteria and corresponding clinical isolates belonging to 20 genera and 27 species, including Listeria, Staphylococcus and Salmonella species, et al. When the spacer amplification products were resolved by electrophoresis, the resulting patterns could be used to distinguish most of the bacteria species within the test group, and the amplification products of the clinical isolates clustered at the standard species level. Some species presenting similar pattern were further analyzed by HinfI or AluI digestion or DNA clone and sequences analysis in order to establish the specific 16s-23s rRNA gene spacer regions map. Analysis of 42 blood specimens from septicemic neonates and 6 CSF specimens from suspected purulent meningitis patients by bacterial culture and PCR-RFLP(Restriction Fregament Length Polymorphism) showed that 15 specimens of blood culture were positive(35.7%) in the 42 septicemic neonates; 27 specimens were positive(64.2%) by PCR, and that the positive rate by PCR was significantly higher than that by blood culture(P<0.01). Among the 6 CSF specimens, one specimen found positive by blood culture was also positive by PCR, two found negative by blood culture showed positive by PCR; all three were S.epidermidis according to the DNA map. One C

  12. Cleavage of the sarcin–ricin loop of 23S rRNA differentially affects EF-G and EF-Tu binding

    García-Ortega, Lucía; Álvarez-García, Elisa; Gavilanes, José G.; Martínez-del-Pozo, Álvaro; Joseph, Simpson

    2010-01-01

    Ribotoxins are potent inhibitors of protein biosynthesis and inactivate ribosomes from a variety of organisms. The ribotoxin α-sarcin cleaves the large 23S ribosomal RNA (rRNA) at the universally conserved sarcin–ricin loop (SRL) leading to complete inactivation of the ribosome and cellular death. The SRL interacts with translation factors that hydrolyze GTP, and it is important for their binding to the ribosome, but its precise role is not yet understood. We studied the effect of α-sarcin on...

  13. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    Bavykin, Sergei G.; Mirzabekov, Andrei D.

    2007-10-30

    The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  14. VapC20 of Mycobacterium tuberculosis cleaves the Sarcin-Ricin loop of 23S rRNA

    Winther, Kristoffer Skovbo; Brodersen, Ditlev E.; Brown, Alistair K.; Gerdes, Kenn

    2013-01-01

    The highly persistent and often lethal human pathogen, Mycobacterium tuberculosis contains at least 88 toxin–antitoxin genes. More than half of these encode VapC PIN domain endoribonucleases that inhibit cell growth by unknown mechanisms. Here we show that VapC20 of M. tuberculosis inhibits translation by cleavage of the Sarcin–Ricin loop (SRL) of 23S ribosomal RNA at the same position where Sarcin and other eukaryotic ribotoxins cleave. Toxin-inhibited cells can be rescued by the expression ...

  15. VapC20 of Mycobacterium tuberculosis Cleaves the Sarcin Ricin Loop of 23S rRNA

    Winther, Kristoffer Skovbo; Brodersen, Ditlev E.; Brown, Alistair K;

    2013-01-01

    exhibited by M. tuberculosis. VapC20 cleavage is inhibited by mutations in the SRL that flank the cleavage site but not by changes elsewhere in the loop. Disruption of the SRL stem abolishes cleavage; however, further mutations that restore the SRL stem structure restore cleavage, revealing that the...... translation by cleavage of the Sarcin–Ricin loop (SRL) of 23S ribosomal RNA at the same position where Sarcin and other eukaryotic ribotoxins cleave. Toxin-inhibited cells can be rescued by the expression of the antitoxin, thereby raising the possibility that vapC20 contributes to the extreme persistence...... structure rather than the exact sequence of the SRL is important for this activity...

  16. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  17. Erythromycin binding is reduced in ribosomes with conformational alterations in the 23 S rRNA peptidyl transferase loop

    Douthwaite, S; Aagaard, C

    1993-01-01

    induced by mutations in the peptidyl transferase loop, and to determine how these changes affect drug interaction. Mutations at positions 2057 (G-->A) and 2058 (A-->G, or -->U), all of which confer drug resistance, induce a more open conformation in the peptidyl transferase loop. Erythromycin still...... protects against chemical modification in the mutant peptidyl transferase loops, but the affinity of the drug interaction is reduced 20-fold in the 2057A mutant, 10(3)-fold in the 2058U mutant and 10(4)-fold in the 2058G mutant. Single mutations at position 2032 in the adjacent hairpin loop, which have...... previously been shown to alter drug tolerances, gave no detectable effects on the structure of the peptidyl transferase loop or on erythromycin binding. Dual mutations at positions 2032 and 2058, however, induce a marked change in the rRNA conformation with opening of the phylogenetically conserved base...

  18. VapC20 of Mycobacterium tuberculosis cleaves the sarcin-ricin loop of 23S rRNA.

    Winther, Kristoffer S; Brodersen, Ditlev E; Brown, Alistair K; Gerdes, Kenn

    2013-01-01

    The highly persistent and often lethal human pathogen, Mycobacterium tuberculosis contains at least 88 toxin-antitoxin genes. More than half of these encode VapC PIN domain endoribonucleases that inhibit cell growth by unknown mechanisms. Here we show that VapC20 of M. tuberculosis inhibits translation by cleavage of the Sarcin-Ricin loop (SRL) of 23S ribosomal RNA at the same position where Sarcin and other eukaryotic ribotoxins cleave. Toxin-inhibited cells can be rescued by the expression of the antitoxin, thereby raising the possibility that vapC20 contributes to the extreme persistence exhibited by M. tuberculosis. VapC20 cleavage is inhibited by mutations in the SRL that flank the cleavage site but not by changes elsewhere in the loop. Disruption of the SRL stem abolishes cleavage; however, further mutations that restore the SRL stem structure restore cleavage, revealing that the structure rather than the exact sequence of the SRL is important for this activity. PMID:24225902

  19. Cyanobacterial ecotypes in different optical microenvironments of a 68 C hot spring mat community revealed by 16S-23S rRNA internal transcribed spacer region variation

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea;

    2003-01-01

    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynth......We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic...... distinct populations over the vertical interval. We were unable to identify patterns in genetic variation in Synechococcus 16S rRNA sequences that correlate with different vertically distributed populations. However, patterns of variation at the internal transcribed spacer locus separating 16S and 23S r...

  20. Identification to the species level of Lactobacillus isolated in probiotic prospecting studies of human, animal or food origin by 16S-23S rRNA restriction profiling

    Neumann Elisabeth

    2005-03-01

    Full Text Available Abstract Background The accurate identification of Lactobacillus and other co-isolated bacteria during microbial ecological studies of ecosystems such as the human or animal intestinal tracts and food products is a hard task by phenotypic methods requiring additional tests such as protein and/or lipids profiling. Results Bacteria isolated in different probiotic prospecting studies, using de Man, Rogosa and Sharpe medium (MRS, were typed at species level by PCR amplification of 16S-23S rRNA intergenic spacers using universal primers that anneal within 16S and 23S genes, followed by restriction digestion analyses of PCR products. The set of enzymes chosen differentiates most species of Lactobacillus genus and also co-isolated bacteria such as Enterococcus, Streptococcus, Weissella, Staphylococcus, and Escherichia species. The in silico predictions of restriction patterns generated by the Lactobacillus shorter spacers digested with 11 restriction enzymes with 6 bp specificities allowed us to distinguish almost all isolates at the species level but not at the subspecies one. Simultaneous theoretical digestions of the three spacers (long, medium and short with the same set of enzymes provided more complex patterns and allowed us to distinguish the species without purifying and cloning of PCR products. Conclusion Lactobacillus isolates and several other strains of bacteria co-isolated on MRS medium from gastrointestinal ecosystem and fermented food products could be identified using DNA fingerprints generated by restriction endonucleases. The methodology based on amplified ribosomal DNA restriction analysis (ARDRA is easier, faster and more accurate than the current methodologies based on fermentation profiles, used in most laboratories for the purpose of identification of these bacteria in different prospecting studies.

  1. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. PMID:26800847

  2. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    Rosendahl, G; Douthwaite, S

    1993-01-01

    23 S rRNA. Within the ribosome, L11 also interacts with this rRNA region, although the protection effects are subtly different and extend to nucleotide 1098. The pentameric r-protein complex L10.(L12)4 binds to an adjacent site on the rRNA, protecting riboses at positions 1043, 1046 to 1049, 1053 to...... by L10.(L12)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  3. Relationships between 16S-23S rRNA gene internal transcribed spacer DNA and genomic DNA similarities in the taxonomy of phototrophic bacteria

    Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.

  4. The aminoglycoside resistance methyltransferase Sgm impedes RsmF methylation at an adjacent rRNA nucleotide in the ribosomal A site

    Cubrilo, Sonja; Babić, Fedora; Douthwaite, Stephen;

    2009-01-01

    methylated nucleotides including m(4)Cm1402 and m(5)C1407. Modification at m(5)C1407 by the methyltransferase RsmF is impeded as Sgm gains access to its adjacent G1405 target on the 30S ribosomal subunit. An Sgm mutant (G135A), which is impaired in S-adenosylmethionine binding and confers lower resistance......Ribosome-targeting antibiotics block protein synthesis by binding at functionally important regions of the bacterial rRNA. Resistance is often conferred by addition of a methyl group at the antibiotic binding site within an rRNA region that is already highly modified with several nucleotide...... methylations. In bacterial rRNA, each methylation requires its own specific methyltransferase enzyme, and this raises the question as to how an extra methyltransferase conferring antibiotic resistance can be accommodated and how it can gain access to its nucleotide target within a short and functionally...

  5. 30S Subunit-Dependent Activation of the Sorangium cellulosum So ce56 Aminoglycoside Resistance-Conferring 16S rRNA Methyltransferase Kmr

    Savic, Miloje; Sunita, S.; Zelinskaya, Natalia; Desai, Pooja M.; Macmaster, Rachel; Vinal, Kellie

    2015-01-01

    Methylation of bacterial 16S rRNA within the ribosomal decoding center confers exceptionally high resistance to aminoglycoside antibiotics. This resistance mechanism is exploited by aminoglycoside producers for self-protection while functionally equivalent methyltransferases have been acquired by human and animal pathogenic bacteria. Here, we report structural and functional analyses of the Sorangium cellulosum So ce56 aminoglycoside resistance-conferring methyltransferase Kmr. Our results demonstrate that Kmr is a 16S rRNA methyltransferase acting at residue A1408 to confer a canonical aminoglycoside resistance spectrum in Escherichia coli. Kmr possesses a class I methyltransferase core fold but with dramatic differences in the regions which augment this structure to confer substrate specificity in functionally related enzymes. Most strikingly, the region linking core β-strands 6 and 7, which forms part of the S-adenosyl-l-methionine (SAM) binding pocket and contributes to base flipping by the m1A1408 methyltransferase NpmA, is disordered in Kmr, correlating with an exceptionally weak affinity for SAM. Kmr is unexpectedly insensitive to substitutions of residues critical for activity of other 16S rRNA (A1408) methyltransferases and also to the effects of by-product inhibition by S-adenosylhomocysteine (SAH). Collectively, our results indicate that adoption of a catalytically competent Kmr conformation and binding of the obligatory cosubstrate SAM must be induced by interaction with the 30S subunit substrate. PMID:25733511

  6. Recognition elements in rRNA for the tylosin resistance methyltransferase RlmA(II)

    Lebars, Isabelle; Husson, Clotilde; Yoshizawa, Satoko; Douthwaite, Stephen; Fourmy, Dominique

    2007-01-01

    antibiotics. We have previously solved the solution structure of hairpin 35 in the conformation that is recognized by the RlmA(II) methyltransferase from Streptococcus pneumoniae. It was shown that while essential recognition elements are located in hairpin 35, the interactions between RlmA(II) and hairpin 35...

  7. Distinction between the Cfr Methyltransferase Conferring Antibiotic Resistance and the Housekeeping RlmN Methyltransferase

    Atkinson, Gemma C; Hansen, Lykke H; Tenson, Tanel;

    2013-01-01

    The cfr gene encodes the Cfr methyltransferase that primarily methylates C-8 in A2503 of 23S rRNA in the peptidyl transferase region of bacterial ribosomes. The methylation provides resistance to six classes of antibiotics of clinical and veterinary importance. The rlmN gene encodes the Rlm...

  8. Identification and phyletic evolution analysis of Proteus mirabilis strains by PCR and restriction fragment length polymorphism of 16S-23S rRNA gene intergenic spacer region%16S-23S rRNA基因间隔序列PCR及RFLP对奇异变形杆菌分离株的鉴别与系统发育分析

    崔国林; 朱瑞良; 左雪梅; 钟世勋; 杨世发; 梁漫飞; 孙婧; 刘静静

    2013-01-01

    根据临床常见致病菌16S-23S rRNA基因间隔序列(ISR)两端的16S及23S rRNA保守序列设计PCR扩增的通用引物,对9株奇异变形杆菌和6株相近菌株应用通用引物PCR扩增16S-23S rRNA ISR序列.通过PCR长度多态性比较、RFLP分析以及部分序列测序比较,分析鉴别奇异变形杆菌.结果显示,PCR长度多态性可以将奇异变形杆菌同其余菌种进行区分;RFLP分析可以将所有试验菌种进行区分;部分序列测序可以对奇异变形杆菌进行分型.由此表明,16S 23S rRNA ISR序列PCR及RFLP分析可以简单、快速、准确的鉴定奇异变形杆菌.%To establish a new method to identify Proteus mirabilis strains, according to the conserved sequences of 16S and 23S which located on both ends of the clinical common pathogenic bacteria 16S-23S rRNA gene intergenic spacer region (ISR),a pair of universal primers was designed. Nine Proteus mirabilis strains and six similar bacteria strains were amplified by PCR and identified by the PCR length polymorphism comparison,restriction fragment length polymorphism (RFLP) analysis and partial sequences sequencing. The result showed that Proteus mirabilis strains could be discriminated from other similar bacteria strains by PCR length polymorphism comparison,all of test organism could be discriminated by RFLP and Proteus mirabilis strains could be typed by partial sequences sequencing. The result indicated that the identification method based on the 16S-23S rRNA ISR, using PCR and PCR-RFLP,is very suitable for the rapid low-cost identification and discrimination of Proteus mirabilis strains from other phylogenetically related bacteria strains.

  9. The unusual 23S rRNA gene of Coxiella burnetii: two self-splicing group I introns flank a 34-base-pair exon, and one element lacks the canonical omegaG.

    Raghavan, Rahul; Miller, Scott R; Hicks, Linda D; Minnick, Michael F

    2007-09-01

    We describe the presence and characteristics of two self-splicing group I introns in the sole 23S rRNA gene of Coxiella burnetii. The two group I introns, Cbu.L1917 and Cbu.L1951, are inserted at sites 1917 and 1951 (Escherichia coli numbering), respectively, in the 23S rRNA gene of C. burnetii. Both introns were found to be self-splicing in vivo and in vitro even though the terminal nucleotide of Cbu.L1917 is adenine and not the canonical conserved guanine, termed OmegaG, found in Cbu.L1951 and all other group I introns described to date. Predicted secondary structures for both introns were constructed and revealed that Cbu.L1917 and Cbu.L1951 were group IB2 and group IA3 introns, respectively. We analyzed strains belonging to eight genomic groups of C. burnetii to determine sequence variation and the presence or absence of the elements and found both introns to be highly conserved (>/=99%) among them. Although phylogenetic analysis did not identify the specific identities of donors, it indicates that the introns were likely acquired independently; Cbu.L1917 was acquired from other bacteria like Thermotoga subterranea and Cbu.L1951 from lower eukaryotes like Acanthamoeba castellanii. We also confirmed the fragmented nature of mature 23S rRNA in C. burnetii due to the presence of an intervening sequence. The presence of three selfish elements in C. burnetii's 23S rRNA gene is very unusual for an obligate intracellular bacterium and suggests a recent shift to its current lifestyle from a previous niche with greater opportunities for lateral gene transfer. PMID:17644584

  10. EmtA, a rRNA methyltransferase conferring high-level evernimicin resistance

    Mann, P. A.; Xiong, L.; Mankin, A. S.;

    2001-01-01

    Enterococcus faecium strain 9631355 was isolated from animal sources on the basis of its resistance to the growth promotant avilamycin. The strain also exhibited high-level resistance to evernimicin, a drug undergoing evaluation as a therapeutic agent in humans. Ribosomes from strain 9631355...... exhibited a dramatic reduction in evernimicin binding, shown by both cell-free translation assays and direct-binding assays. The resistance determinant was cloned from strain 9631355; sequence alignments suggested it was a methyltransferase and therefore it was designated emtA for evernimicin...

  11. Long PCR-RFLP of 16S-ITS-23S rRNA genes: a high-resolution molecular tool for bacterial genotyping

    Zeng, Yonghui; Koblížek, Michal; Li, Y. X.; Liu, Y. P.; Feng, F. Y.; Ji, J. D.; Jian, J. C.; Wu, Z. H.

    2013-01-01

    Roč. 114, č. 2 (2013), s. 433-447. ISSN 1364-5072 R&D Projects: GA MŠk(CZ) ED2.1.00/03.0110 Institutional support: RVO:61388971 Keywords : 16S-ITS-23S * bacterial genome * computer simulation Subject RIV: EE - Microbiology, Virology Impact factor: 2.386, year: 2013

  12. 山羊奇异变形杆菌分离鉴定及其16S-23S rRNA ISR序列RFLP分析%Isolation and Identification of Proteus mirabilis from Goat and the Analysis of Its 16S-23S rRNA ISR Sequence by RFLP

    崔国林; 钟世勋; 杨世发; 左雪梅; 朱瑞良

    2013-01-01

    2012年初,山东菏泽某羊场的羊群发病,从发病羊器官分离到2株病原细菌.对病原细菌进行鉴定,并对其与已知同种异源菌株相似性差异进行分析.从患病山羊内脏器官分离细菌,经形态特征、培养特性、生化试验、血清学试验及致病性试验进行鉴定;再通过设计通用引物扩增16S-23S rRNA ISR (intergenie spacer region)序列,将PCR产物经HinfⅠ单酶切获得3条可视条带,同时对扩增条带中的主带测序并进行系统发育分析.结果表明,分离菌株为奇异变形杆菌;分离菌株同本实验室保存的兔源与鸡源奇异变形杆菌PCR-RFLP结果一致;分离菌株PCR产物同GenBank收录的HI4320株奇异变形杆菌及本实验室保存的兔源与鸡源奇异变形杆菌进行序列比较,分离羊源菌株与兔源菌株相似性为94.8%、与鸡源菌株相似性为96.0%~98.2%,与人源HI4320株相似性为96.9%.研究证实发病羊致病病原为奇异变形杆菌,其与鸡源、兔源和人源奇异变形杆菌的亲缘关系较近.%At the beginning of 2012,a disease occurred in a goat farm in Heze City and two strains of pathogen were isolated from the infected goats.In order to identify the infected bacteria and analyze the homology between isolated strains and heterologous strains,bacteria were isolated from infected goats internal organs and were identified by morphologic characteristics,cultural characteristic,biochemistry test,serologic test and pathogenicity test; A pair of universal primers was designed to amplify 16S-23S rRNA ISR (intergenic spacer region) gene.and three visible straps were observed when PCR products were cut by Hinf Ⅰ,at the same time the main strap of PCR straps was sequenced and analyzed by phyletic evolution.The results showed that isolated strains were Proteus mirabilis ; the result of PCR-RFLP of isolated strains and Proteus mirabilis from rabbit and chicken was the same; The homology was 94.8% between

  13. Peptidyl transferase antibiotics perturb the relative positioning of the 3'-terminal adenosine of P/P'-site-bound tRNA and 23S rRNA in the ribosome

    Kirillov, S V; Porse, B T; Garrett, R A

    1999-01-01

    A range of antibiotic inhibitors that act within the peptidyl transferase center of the ribosome were examined for their capacity to perturb the relative positioning of the 3' end of P/P'-site-bound tRNA and the Escherichia coli ribosome. The 3'-terminal adenosines of deacylated tRNA and N......-ribosome complexes. It is concluded that the antibiotics perturb the relative positioning of the 3' end of the P/P'-site-bound tRNA and the peptidyl transferase loop region of 23S rRNA....

  14. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  15. Evaluation of a fluorescence-labelled oligonucleotide tide probe targeting 23S rRNA for in situ detection of Salmonella serovars in paraffin-embedded tissue sections and their rapid identification in bacterial smears

    Nordentoft, Steen; Christensen, H.; Wegener, Henrik Caspar

    1997-01-01

    A method for the detection of Salmonella based on fluorescence in situ hybridization (FISH) has been developed and applied for the direct detection of Salmonella in pure cultures and in formalin-fixed, paraffin-embedded tissue sections. On the basis of the 23S rRNA gene sequences representing all...... with the probe. The probe did not hybridize to serovars from subspecies IIIa (S. arizonae) or to S. bongori. No cross-reaction to 64 other strains of the family Enterobacteriaceae or 18 other bacterial strains outside this family was observed. The probe was tested with sections of formalin-fixed......, paraffin-embedded tissue from experimentally infected mice or from animals with a history of clinical salmonellosis. In these tissue sections the probe hybridized specifically to Salmonella serovars, allowing for the detection of single bacterial cells. The development of a fluorescence-labelled specific...

  16. The donor substrate site within the peptidyl transferase loop of 23 S rRNA and its putative interactions with the CCA-end of N-blocked aminoacyl-tRNA(Phe)

    Porse, B T; Thi-Ngoc, H P; Garrett, R A

    1996-01-01

    An RNA region associated with the donor substrate site, located at the base of the peptidyl transferase loop of 23 S rRNA, was subjected to a comprehensive single-site mutational study. Growth phenotypes of Escherichia coli cells were characterized on induction of synthesis of the mutated rRNAs and...... the mutated ribosomes were tested, selectively, for their capacity to generate peptide bonds under the conditions of the "fragment" assay. Most of the mutants exhibited dominant or recessive lethal growth phenotypes and, in general, defective growth correlated with low activities in peptide bond...... approach was employed to test for Watson-Crick base-pairing interactions between the -CCA end of the P-site bound tRNA(Phe) and this region of the peptidyl-transferase loop. Single nucleotide substitutions were introduced into the -CCA end of tRNA(Phe) and the ability of the 3'-terminal pentanucleotide...

  17. Persistent spread of the rmtB 16S rRNA methyltransferase gene among Escherichia coli isolates from diseased food-producing animals in China.

    Xia, Jing; Sun, Jian; Cheng, Ke; Li, Liang; Fang, Liang-Xing; Zou, Meng-Ting; Liao, Xiao-Ping; Liu, Ya-Hong

    2016-05-30

    A total of 963 non-duplicate Escherichia coli strains isolated from food-producing animals between 2002 and 2012 were screened for the presence of the 16S rRNA methyltransferase genes. Among the positive isolates, resistance determinants to extended spectrum β-lactamases, plasmid-mediated quinolone resistance genes as well as floR and fosA/A3/C2 were detected using PCR analysis. These isolates were further subjected to antimicrobial susceptibility testing, molecular typing, PCR-based plasmid replicon typing and plasmid analysis. Of the 963 E. coli isolates, 173 (18.0%), 3 (0.3%) and 2 (0.2%) were rmtB-, armA- and rmtE-positive strains, respectively. All the 16S rRNA methyltransferase gene-positive isolates were multidrug resistant and over 90% of them carried one or more type of resistance gene. IncF (especially IncFII) and non-typeable plasmids played the main role in the dissemination of rmtB, followed by the IncN plasmids. Plasmids that harbored rmtB ranged in size from 20kb to 340kb EcoRI-RFLP testing of the 109 rmtB-positive plasmids from different years and different origins suggested that horizontal (among diverse animals) and vertical transfer of IncF, non-typeable and IncN-type plasmids were responsible for the spread of rmtB gene. In summary, our findings highlight that rmtB was the most prevalent 16S rRNA methyltransferase gene, which present persistent spread in food-producing animals in China and a diverse group of plasmids was responsible for rmtB dissemination. PMID:27139028

  18. Multicentre surveillance of prevalence of the 23S rRNA A2058G and A2059G point mutations and molecular subtypes of Treponema pallidum in Taiwan, 2009-2013.

    Wu, B-R; Yang, C-J; Tsai, M-S; Lee, K-Y; Lee, N-Y; Huang, W-C; Wu, H; Lee, C-H; Chen, T-C; Ko, W-C; Lin, H-H; Lu, P-L; Chen, Y-H; Liu, W-C; Yang, S-P; Wu, P-Y; Su, Y-C; Hung, C-C; Chang, S-Y

    2014-08-01

    Resistance mutations A2058G and A2059G, within the 23S rRNA gene of Treponema pallidum, have been reported to cause treatment failures in patients receiving azithromycin for syphilis. Genotyping of T. pallidum strains sequentially isolated from patients with recurrent syphilis is rarely performed. From September 2009 to August 2013, we collected 658 clinical specimens from 375 patients who presented with syphilis for genotyping to examine the number of 60-bp repeats in the acidic repeat protein (arp) gene, T. pallidum repeat (tpr) polymorphism, and tp0548 gene, and to detect A2058G and A2059G point mutations by restriction fragment length polymorphism. Treponemal DNA was identified in 45.2% (n = 298) of the specimens that were collected from 216 (57.6%) patients; 268 (40.7%) specimens tested positive for the 23S rRNA gene, and were examined for macrolide resistance. Two isolates (0.7%) harboured the A2058G mutation, and no A2059G mutation was identified. A total of 14 strains of T. pallidum were identified, with 14f/f (57.5%) and 14b/c (10.0%) being the two predominant strains. Forty patients who presented with recurrent episodes of syphilis had T. pallidum DNA identified from the initial and subsequent episodes, with five cases showing strain discrepancies. One patient had two strains identified from different clinical specimens collected in the same episode. Our findings show that 14f/f is the most common T. pallidum strain in Taiwan, where the prevalence of T. pallidum strains that show A2058G or A2059G mutation remains low. Different genotypes of T. pallidum can be identified in patients with recurrent episodes of syphilis. PMID:24438059

  19. High frequency of the 23S rRNA A2058G mutation of Treponema pallidum in Shanghai is associated with a current strategy for the treatment of syphilis.

    Lu, Haikong; Li, Kang; Gong, Weimin; Yan, Limeng; Gu, Xin; Chai, Ze; Guan, Zhifang; Zhou, Pingyu

    2015-02-01

    The preferred drugs for the treatment of syphilis, benzathine and procaine penicillin, have not been available in Shanghai for many years, and currently, the incidence of syphilis is increasing. Alternative antibiotics for patients with syphilis during the benzathine and procaine penicillin shortage include macrolides. The failure of macrolide treatment in syphilis patients has been reported in Shanghai, but the reason for this treatment failure remains unclear. We used polymerase chain reaction technology to detect a 23S rRNA A2058G mutation in Treponema pallidum in 109 specimens from syphilis patients. The use of azithromycin/erythromycin in the syphilis patients and the physicians' prescription habits were also assessed based on two questionnaires regarding the use of macrolides. A total of 104 specimens (95.4%) were positive for the A2058G mutation in both copies of the 23S rRNA gene, indicating macrolide resistance. A questionnaire provided to 122 dermatologists showed that during the penicillin shortage, they prescribed erythromycin and azithromycin for 8.24±13.95% and 3.21±6.37% of their patients, respectively, and in the case of penicillin allergy, erythromycin and azithromycin were prescribed 15.24±22.89% and 7.23±16.60% of the time, respectively. A second questionnaire provided to the syphilis patients showed that 150 (33.7%), 106 (23.8%) and 34 (7.6%) individuals had used azithromycin, erythromycin or both, respectively, although the majority did not use the drugs for syphilis treatment. Our findings suggest that macrolide resistance in Treponema pallidum is widespread in Shanghai. More than half of the syphilis patients had a history of macrolide use for other treatment purposes, which may have led to the high prevalence of macrolide resistance. Physicians in China are advised to not use azithromycin for early syphilis. PMID:26038763

  20. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O139 outbreak based on the intergenomic heterogeneity of the 16S-23S rRNA intergenic spacer regions

    Atreyi Ghatak; Anasuya Majumdar; Ranajit K Ghosh

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O139 outbreak. ISR classes ‘a’ and ‘g’ were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O139 serogroup and post-O139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  1. Evaluation of a fluorescence-labelled oligonucleotide tide probe targeting 23S rRNA for in situ detection of Salmonella serovars in paraffin-embedded tissue sections and their rapid identification in bacterial smears

    Nordentoft, Steen; Christensen, H.; Wegener, Henrik Caspar

    1997-01-01

    A method for the detection of Salmonella based on fluorescence in situ hybridization (FISH) has been developed and applied for the direct detection of Salmonella in pure cultures and in formalin-fixed, paraffin-embedded tissue sections. On the basis of the 23S rRNA gene sequences representing all...... oligonucleotide probe makes the FISH technique a promising tool for the rapid identification of S. enterica in bacterial smears, as well as for the detection of S. enterica in histological tissue sections....... of the S. enterica subspecies and S. bongori, an 18-mer oligonucleotide probe was selected. The specificity of the probe was tested by in situ hybridization to bacterial cell smears of pur cultures. Forty-nine of 55 tested Salmonella serovars belonging to subspecies I, II, IIIb, IV, and VI hybridized...... with the probe. The probe did not hybridize to serovars from subspecies IIIa (S. arizonae) or to S. bongori. No cross-reaction to 64 other strains of the family Enterobacteriaceae or 18 other bacterial strains outside this family was observed. The probe was tested with sections of formalin...

  2. Identification of 8-methyladenosine as the modification catalyzed by the radical SAM methyltransferase Cfr that confers antibiotic resistance in bacteria

    Giessing, Anders; Jensen, Søren Skov; Rasmussen, Anette;

    2009-01-01

    The Cfr methyltransferase confers combined resistance to five different classes of antibiotics that bind to the peptidyl transferase center of bacterial ribosomes. The Cfr-mediated modification has previously been shown to occur on nucleotide A2503 of 23S rRNA and has a mass corresponding to an a...

  3. Detection of the A2058G and A2059G 23S rRNA Gene Point Mutations Associated with Azithromycin Resistance in Treponema pallidum by Use of a TaqMan Real-Time Multiplex PCR Assay

    Chi, Kai-Hua; Pillay, Allan; Nachamkin, Eli; Su, John R.; Ballard, Ronald C.

    2013-01-01

    Macrolide treatment failure in syphilis patients is associated with a single point mutation (either A2058G or A2059G) in both copies of the 23S rRNA gene in Treponema pallidum strains. The conventional method for the detection of both point mutations uses nested PCR combined with restriction enzyme digestions, which is laborious and time-consuming. We initially developed a TaqMan-based real-time duplex PCR assay for detection of the A2058G mutation, and upon discovery of the A2059G mutation, we modified the assay into a triplex format to simultaneously detect both mutations. The point mutations detected by the real-time triplex PCR were confirmed by pyrosequencing. A total of 129 specimens PCR positive for T. pallidum that were obtained from an azithromycin resistance surveillance study conducted in the United States were analyzed. Sixty-six (51.2%) of the 129 samples with the A2058G mutation were identified by both real-time PCR assays. Of the remaining 63 samples that were identified as having a macrolide-susceptible genotype by the duplex PCR assay, 17 (27%) were found to contain the A2059G mutation by the triplex PCR. The proportions of macrolide-susceptible versus -resistant genotypes harboring either the A2058G or the A2059G mutation among the T. pallidum strains were 35.6, 51.2, and 13.2%, respectively. None of the T. pallidum strains examined had both point mutations. The TaqMan-based real-time triplex PCR assay offers an alternative to conventional nested PCR and restriction fragment length polymorphism analyses for the rapid detection of both point mutations associated with macrolide resistance in T. pallidum. PMID:23284026

  4. Comparison of multiple genes and 16S-23S rRNA intergenic space region for their capacity in high resolution melt curve analysis to differentiate Mycoplasma gallisepticum vaccine strain ts-11 from field strains.

    Ghorashi, Seyed A; Bradbury, Janet M; Ferguson-Noel, Naola M; Noormohammadi, Amir H

    2013-12-27

    Mycoplasma gallisepticum (MG) is an important avian pathogen causing significant economic losses in the global poultry industry. In an attempt to compare and evaluate existing genotyping methods for differentiation of MG strains/isolates, high resolution melt (HRM) curve analysis was applied to 5 different PCR methods targeting vlhA, pvpA, gapA, mgc2 genes and 16S-23S rRNA intergenic space region (IGSR). To assess the discriminatory power of PCR-HRM of examined genes and IGSR, MG strains ts-11, F, 6/85 and S6, and, initially, 8 field isolates were tested. All MG strains/isolates were differentiated using PCR-HRM curve analysis and genotype confidence percentage (GCP) values of vlhA and pvpA genes, while only 0, 3 and 4 out of 12 MG strains/isolates were differentiated using gapA, mgc2 genes and IGSR, respectively. The HRM curve analysis of vlhA and pvpA genes was found to be highly correlated with the genetic diversity of the targeted genes confirmed by sequence analysis of amplicons generated from MG strains. The potential of the vlhA and pvpA genes was also demonstrated for genotyping of 12 additional MG strains from Europe and the USA. Results from this study provide a direct comparison between genes previously used in sequencing-based genotyping methods for MG strain identification and highlight the usefulness of vlhA and pvpA HRM curve analyses as rapid and reliable tools specially for diagnosis and differentiation of MG strains used here. PMID:24238667

  5. Eukaryotic rRNA Modification by Yeast 5-Methylcytosine-Methyltransferases and Human Proliferation-Associated Antigen p120.

    Gabrielle Bourgeois

    Full Text Available Modified nucleotide 5-methylcytosine (m5C is frequently present in various eukaryotic RNAs, including tRNAs, rRNAs and in other non-coding RNAs, as well as in mRNAs. RNA:m5C-methyltranferases (MTases Nop2 from S. cerevisiae and human proliferation-associated nucleolar antigen p120 are both members of a protein family called Nop2/NSUN/NOL1. Protein p120 is well-known as a tumor marker which is over-expressed in various cancer tissues. Using a combination of RNA bisulfite sequencing and HPLC-MS/MS analysis, we demonstrated here that p120 displays an RNA:m5C- MTase activity, which restores m5C formation at position 2870 in domain V of 25S rRNA in a nop2Δ yeast strain. We also confirm that yeast proteins Nop2p and Rcm1p catalyze the formation of m5C in domains V and IV, respectively. In addition, we do not find any evidence of m5C residues in yeast 18S rRNA. We also performed functional complementation of Nop2-deficient yeasts by human p120 and studied the importance of different sequence and structural domains of Nop2 and p120 for yeast growth and m5C-MTase activity. Chimeric protein formed by Nop2 and p120 fragments revealed the importance of Nop2 N-terminal domain for correct protein localization and its cellular function. We also validated that the presence of Nop2, rather than the m5C modification in rRNA itself, is required for pre-rRNA processing. Our results corroborate that Nop2 belongs to the large family of pre-ribosomal proteins and possesses two related functions in pre-rRNA processing: as an essential factor for cleavages and m5C:RNA:modification. These results support the notion of quality control during ribosome synthesis by such modification enzymes.

  6. Elucidation of separate, but collaborative functions of the rRNA methyltransferase-related human mitochondrial transcription factors B1 and B2 in mitochondrial biogenesis reveals new insight into maternally inherited deafness

    Cotney, Justin; McKay, Sharen E.; Shadel, Gerald S.

    2009-01-01

    Mitochondrial biogenesis is controlled by signaling networks that relay information to and from the organelles. However, key mitochondrial factors that mediate such pathways and how they contribute to human disease are not understood fully. Here we demonstrate that the rRNA methyltransferase-related human mitochondrial transcription factors B1 and B2 are key downstream effectors of mitochondrial biogenesis that perform unique, yet cooperative functions. The primary function of h-mtTFB2 is mtD...

  7. Diversity of the marine picocyanobacteria Prochlorococcus and Synechococcus assessed by terminal restriction fragment length polymorphisms of 16S-23S rRNA internal transcribed spacer sequences Diversidad de las picocianobacterias marinas Prochlorococcus y Synechococcus por medio de polimorfismos de longitud de fragmentos de restricción terminal en secuencias del espaciador transcrito interno del ARNr 16S - 23S

    PARIS LAVIN

    2008-12-01

    Full Text Available In order to assess the appropriateness of the use of internal transcribed spacer (ITS sequences for the study of population genetics of marine cyanobacteria, we amplified and cloned the 16S rRNA gene plus the 16S-23S ITS regions of six strains of Prochlorococcus and Synechococcus. We analyzed them by denaturing gradient gel electrophoresis (DGGE and terminal restriction fragment length polymorphisms (T-RFLP. When using the standard application of these techniques, we obtained more than one band or terminal restriction fragment (T-RF per strain or cloned sequence. Reports in literature have suggested that these anomalies can result from the formation of secondary structures. Secondary structures of the ITS sequences of Prochlorococcus and Synechococcus strains were computationally modelled at the different temperatures that were used during the polymerase chain reaction (PCR. Modelling results predicted the existence of hairpin loops that would still be present at the extensión temperature; it is likely that these loops produced incomplete and single stranded PCR products. We modified the standard T-RFLP procedure by adding the labelled ITS primer in the last two cycles of the PCR reaction; this resulted, in most cases, in only one T-RF per ribotype. Application of this technique to a natural picoplankton community in marine waters off northern Chile, showed that it was possible to identify the presence, and determine the relative abundance, of several phylogenetic lineages within the genera Prochlorococcus and Synechococcus inhabiting the euphotic zone. Phylogenetic analysis of ITS sequences obtained by cloning and sequencing DNA from the same sample confirmed the presence of the different genotypes. With the proposed modification, T-RFLP profiles should therefore be suitable for studying the diversity of natural populations of cyanobacteria, and should become an important tool to study the factors influencing the genetic structure and

  8. Interaction of the tylosin-resistance methyltransferase RlmA II at its rRNA target differs from the orthologue RlmA I

    Douthwaite, Stephen; Jakobsen, Lene; Yoshizawa, Satoko;

    2008-01-01

    footprint contacts with nucleotides in stem-loops 33, 34 and 35, and does not interact elsewhere in the rRNA. Binding of RlmA(II) to the rRNA is dependent on the cofactor S-adenosylmethionine (or S-adenosylhomocysteine). RlmA(II) interacts with the same rRNA region as the orthologous enzyme RlmA(I) that...

  9. Application of the Sequences Analysis of the 16S rRNA Gene and ITS of 16S-23S rRNA to the Systematic Study of the Genus Arthrospira and Spirulina%16S rRNA基因与16S-23S rRNA转录单元内间隔区序列分析及其在节旋藻和螺旋藻分类鉴定中的应用

    茅云翔; 杨官品; 张宝红; 张学成

    2001-01-01

    测定了节旋藻属3个品系和螺旋藻属1个品系的全长16S rRNA基因和16S-23S rRNA转录单元内间隔区序列(ITS),分析了已知的节旋藻、螺旋藻和相关品系的相应序列的同源性,构建了系统发生树,并评价了这两段DNA序列在节旋藻、螺旋藻种属分类和种质鉴定中的意义.结果表明:(1)16S rRNA基因序列和ITS序列均可用于节旋藻属和螺旋藻属的属间分类,以两序列为基础的系统学分析结果一致;(2)ITS序列变异程度高于16S rDNA序列,适用于节旋藻和螺旋藻属内品系或种质鉴定;(3)节旋藻属可明确界定,16S rRNA基因序列相似性大于98%,ITS序列相似性大于88%;(4)螺旋藻属某些品系间16S rDNA序列和ITS序列相似性较低,与不同属间的序列相似性程度为同一水平.

  10. Specificity shifts in the rRNA and tRNA nucleotide targets of archaeal and bacterial m5U methyltransferases

    Auxilien, Sylvie; Rasmussen, Anette; Rose, Simon;

    2011-01-01

    Methyltransferase enzymes that use S-adenosylmethionine as a cofactor to catalyze 5-methyl uridine (m(5)U) formation in tRNAs and rRNAs are widespread in Bacteria and Eukaryota, but are restricted to the Thermococcales and Nanoarchaeota groups amongst the Archaea. The RNA m(5)U methyltransferases...... appear to have arisen in Bacteria and were then dispersed by horizontal transfer of an rlmD-type gene to the Archaea and Eukaryota. The bacterium Escherichia coli has three gene paralogs and these encode the methyltransferases TrmA that targets m(5)U54 in tRNAs, RlmC (formerly RumB) that modifies m(5)U......, however, neither of the two P. abyssi enzymes displays RlmD-like activity in vitro. PAB0719 acts in a TrmA-like manner to catalyze m(5)U54 methylation in P. abyssi tRNAs, and here we show that PAB0760 possesses RlmC-like activity and specifically methylates the nucleotide equivalent to U747 in P. abyssi...

  11. Biochemical and Computational Analysis of the Substrate Specificities of Cfr and RlmN Methyltransferases

    Ntokou, Eleni; Hansen, Lykke Haastrup; Kongsted, Jacob;

    2015-01-01

    -ray structure of RlmN. We used a trinucleotide as target sequence and assessed its positioning at the active site for methylation. The calculations are in accordance with different poses of the trinucleotide in the two enzymes indicating major evolutionary changes to shift the C2/C8 specificities. To explore......Cfr and RlmN methyltransferases both modify adenine 2503 in 23S rRNA (Escherichia coli numbering). RlmN methylates position C2 of adenine while Cfr methylates position C8, and to a lesser extent C2, conferring antibiotic resistance to peptidyl transferase inhibitors. Cfr and RlmN show high sequence...... interchangeability between Cfr and RlmN we constructed various combinations of their genes. The function of the mixed genes was investigated by RNA primer extension analysis to reveal methylation at 23S rRNA position A2503 and by MIC analysis to reveal antibiotic resistance. The catalytic site is expected to be...

  12. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    Aagaard, C; Douthwaite, S

    1994-01-01

    A putative base-pairing interaction that determines the folding of the central region of 23S rRNA has been investigated by mutagenesis. Each of the possible base substitutions has been made at the phylogenetically covariant positions adenine-1262 (A1262) and U2017 in Escherichia coli 23S rRNA. Ev...

  13. Phylogenetic relationships of Salmonella based on rRNA sequences

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

  14. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repeti...

  15. Human TRMU encoding the mitochondrial 5-methylaminomethyl-2-thiouridylate-methyltransferase is a putative nuclear modifier gene for the phenotypic expression of the deafness-associated 12S rRNA mutations

    Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations

  16. Substrate recognition and modification by the nosiheptide resistance methyltransferase.

    Sitao Yin

    Full Text Available The proliferation of antibiotic resistant pathogens is an increasing threat to the general public. Resistance may be conferred by a number of mechanisms including covalent or mutational modification of the antibiotic binding site, covalent modification of the drug, or the over-expression of efflux pumps. The nosiheptide resistance methyltransferase (NHR confers resistance to the thiazole antibiotic nosiheptide in the nosiheptide producer organism Streptomyces actuosus through 2'O-methylation of 23S rRNA at the nucleotide A1067. Although the crystal structures of NHR and the closely related thiostrepton-resistance methyltransferase (TSR in complex with the cofactor S-Adenosyl-L-methionine (SAM are available, the principles behind NHR substrate recognition and catalysis remain unclear.We have analyzed the binding interactions between NHR and model 58 and 29 nucleotide substrate RNAs by gel electrophoresis mobility shift assays (EMSA and fluorescence anisotropy. We show that the enzyme binds to RNA as a dimer. By constructing a hetero-dimer complex composed of one wild-type subunit and one inactive mutant NHR-R135A subunit, we show that only one functional subunit of the NHR homodimer is required for its enzymatic activity. Mutational analysis suggests that the interactions between neighbouring bases (G1068 and U1066 and A1067 have an important role in methyltransfer activity, such that the substitution of a deoxy sugar spacer (5' to the target nucleotide achieved near wild-type levels of methylation. A series of atomic substitutions at specific positions on the substrate adenine show that local base-base interactions between neighbouring bases are important for methylation.Taken together these data suggest that local base-base interactions play an important role in aligning the substrate 2' hydroxyl group of A1067 for methyl group transfer. Methylation of nucleic acids is playing an increasingly important role in fundamental biological processes

  17. Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli 23S ribosomal RNA

    Douthwaite, S

    1992-01-01

    Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli ribosomes has been compared by chemical footprinting. The protection afforded by both drugs is limited to the peptidyl transferase loop of 23S rRNA. Under conditions of stoichiometric binding at 1 mM drug concentration...... in vitro, both drugs strongly protect 23S rRNA bases A2058 and A2451 from dimethyl sulphate and G2505 from kethoxal modification; G2061 is also weakly protected from kethoxal. The modification patterns differ in that A2059 is additionally protected by clindamycin but not by lincomycin. The affinity...... of the two drugs for the ribosome, estimated by footprinting, is approximately the same, giving Kdiss values of 5 microM for lincomycin and 8 microM for clindamycin. The results show that in vitro the drugs are equally potent in blocking their ribosomal target site. Their inhibitory effects on...

  18. Binding induced RNA conformational changes control substrate recognition and catalysis by the thiostrepton resistance methyltransferase (Tsr).

    Kuiper, Emily G; Conn, Graeme L

    2014-09-19

    Ribosomal RNA (rRNA) post-transcriptional modifications are essential for ribosome maturation, translational fidelity, and are one mechanism used by both antibiotic-producing and pathogenic bacteria to resist the effects of antibiotics that target the ribosome. The thiostrepton producer Streptomyces azureus prevents self-intoxication by expressing the thiostrepton-resistance methyltransferase (Tsr), which methylates the 2'-hydroxyl of 23 S rRNA nucleotide adenosine 1067 within the thiostrepton binding site. Tsr is a homodimer with each protomer containing an L30e-like amino-terminal domain (NTD) and a SPOUT methyltransferase family catalytic carboxyl-terminal domain (CTD). We show that both enzyme domains are required for high affinity RNA substrate binding. The Tsr-CTD has intrinsic, weak RNA affinity that is necessary to direct the specific high-affinity Tsr-RNA interaction via NTDs, which have no detectable RNA affinity in isolation. RNA structure probing experiments identify the Tsr footprint on the RNA and structural changes in the substrate, induced specifically upon NTD binding, which are necessary for catalysis by the CTD. Additionally, we identify a key amino acid in each domain responsible for CTD-RNA binding and the observed NTD-dependent RNA structural changes. These studies allow us to develop a model for Tsr-RNA interaction in which the coordinated substrate recognition of each Tsr structural domain is an obligatory pre-catalytic recognition event. Our findings underscore the complexity of substrate recognition by RNA modification enzymes and the potential for direct involvement of the RNA substrate in controlling the process of its modification. PMID:25086036

  19. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    Triman, K; Becker, E; Dammel, C;

    1989-01-01

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alle...

  20. Biochemical and Computational Analysis of the Substrate Specificities of Cfr and RlmN Methyltransferases.

    Eleni Ntokou

    Full Text Available Cfr and RlmN methyltransferases both modify adenine 2503 in 23S rRNA (Escherichia coli numbering. RlmN methylates position C2 of adenine while Cfr methylates position C8, and to a lesser extent C2, conferring antibiotic resistance to peptidyl transferase inhibitors. Cfr and RlmN show high sequence homology and may be evolutionarily linked to a common ancestor. To explore their individual specificity and similarity we performed two sets of experiments. We created a homology model of Cfr and explored the C2/C8 specificity using docking and binding energy calculations on the Cfr homology model and an X-ray structure of RlmN. We used a trinucleotide as target sequence and assessed its positioning at the active site for methylation. The calculations are in accordance with different poses of the trinucleotide in the two enzymes indicating major evolutionary changes to shift the C2/C8 specificities. To explore interchangeability between Cfr and RlmN we constructed various combinations of their genes. The function of the mixed genes was investigated by RNA primer extension analysis to reveal methylation at 23S rRNA position A2503 and by MIC analysis to reveal antibiotic resistance. The catalytic site is expected to be responsible for the C2/C8 specificity and most of the combinations involve interchanging segments at this site. Almost all replacements showed no function in the primer extension assay, apart from a few that had a weak effect. Thus Cfr and RlmN appear to be much less similar than expected from their sequence similarity and common target.

  1. Mutations in 23S rRNA Confer Resistance against Azithromycin in Pseudomonas aeruginosa

    Marvig, Rasmus Lykke; Søndergaard, Mette S. R.; Pedersen, Søren Damkiær;

    2012-01-01

    The emergence of antibiotic-resistant Pseudomonas aeruginosa is an important concern in the treatment of long-term airway infections in cystic fibrosis patients. In this study, we report the occurrence of azithromycin resistance among clinical P. aeruginosa DK2 isolates. We demonstrate that...

  2. Amplification and direct sequence analysis of the 23S rRNA gene from thermophilic bacteria

    Ibrahim, Ashraf; Hofman-Bang, H. Jacob Peider; Ahring, Birgitte Kiær

    2001-01-01

    We present a simplified and fast method to obtain high-quality sequences directly from PCRs without the traditional gel purification. We also report on an improved method to obtain sequence-quality PCR products from microorganisms that are difficult to lyse with no need for DNA extraction. The...

  3. Cooperative assembly of proteins in the ribosomal GTPase centre demonstrated by their interactions with mutant 23S rRNAs

    Rosendahl, G; Douthwaite, S

    1995-01-01

    within a hairpin loop (1068-1072), where the protein probably makes nucleotide contacts. Some of these mutations also interfere with binding of the r-protein complex L10.(L12)4 to an adjacent site on the rRNA. When added together to rRNA, proteins L10.(L12)4 and L11 bind cooperatively to overcome the......The ribosomal protein L11 binds to the region of 23S rRNA associated with the GTPase-dependent steps of protein synthesis. Nucleotides 1054-1107 within this region of the Escherichia coli 23S rRNA gene were mutagenized with bisulphite. Twenty point mutations (G-->A and C-->T transitions) and...... numerous multiple mutations were generated. Expression of mutant 23S rRNAs in vivo shows that all the mutations detectably alter the phenotype, with effects ranging from a slight growth rate reduction to lack of viability. Temperature sensitivity is conferred by 1071G-->A and 1092C-->U substitutions. These...

  4. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. PMID:22510214

  5. Synthesis of Lysine Methyltransferase Inhibitors

    Ye, Tao; Hui, Chunngai

    2015-07-01

    Lysine methyltransferase which catalyze methylation of histone and nonhistone proteins, play a crucial role in diverse biological processes and has emerged as a promising target for the development of various human diseases, including cancer, inflammation, and psychiatric disorders. However, inhibiting Lysine methyltransferases selectively has presented many challenges to medicinal chemists. During the past decade, lysine methyltransferase inhibitors covering many different structural classes have been designed and developed. In this review, we describe the development of selective, small-molecule inhibitors of lysine methyltransferases with an emphasis on their discovery and chemical synthesis. We highlight the current state of lysine methyltransferase inhibitors and discuss future directions and opportunities for lysine methyltransferase inhibitor discovery.

  6. Fragmentations of the large-subunit rRNA in the family Rhizobiaceae.

    Selenska-Pobell, S; Evguenieva-Hackenberg, E

    1995-01-01

    A 130-nucleotide-long rRNA species corresponding to the 5' end of the 23S rRNA gene was found in 96 strains belonging to different Rhizobium, Bradyrhizobium, and Agrobacterium species. Additional fragmentation in the central region of the large-subunit rRNA occurred in all agrobacteria, except Agrobacterium vitis, and in most Rhizobium leguminosarum and Rhizobium etli strains but did not occur in any of the other rhizobia and bradyrhizobia studied.

  7. 'View From A Bridge': A New Perspective on Eukaryotic rRNA Base Modification.

    Sharma, Sunny; Lafontaine, Denis L J

    2015-10-01

    Eukaryotic rRNA are modified frequently, although the diversity of modifications is low: in yeast rRNA, there are only 12 different types out of a possible natural repertoire exceeding 112. All nine rRNA base methyltransferases (MTases) and one acetyltransferase have recently been identified in budding yeast, and several instances of crosstalk between rRNA, tRNA, and mRNA modifications are emerging. Although the machinery has largely been identified, the functions of most rRNA modifications remain to be established. Remarkably, a eukaryote-specific bridge, comprising a single ribosomal protein (RP) from the large subunit (LSU), contacts four rRNA base modifications across the ribosomal subunit interface, potentially probing for their presence. We hypothesize in this article that long-range allosteric communication involving rRNA modifications is taking place between the two subunits during translation or, perhaps, the late stages of ribosome assembly. PMID:26410597

  8. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  9. Structural basis for S-adenosylmethionine binding and methyltransferase activity by mitochondrial transcription factor B1

    Guja, Kip E.; Venkataraman, Krithika; Yakubovskaya, Elena; Hui SHI; Mejia, Edison; Hambardjieva, Elena; Karzai, A. Wali; Garcia-Diaz, Miguel

    2013-01-01

    Eukaryotic transcription factor B (TFB) proteins are homologous to KsgA/Dim1 ribosomal RNA (rRNA) methyltransferases. The mammalian TFB1, mitochondrial (TFB1M) factor is an essential protein necessary for mitochondrial gene expression. TFB1M mediates an rRNA modification in the small ribosomal subunit and thus plays a role analogous to KsgA/Dim1 proteins. This modification has been linked to mitochondrial dysfunctions leading to maternally inherited deafness, aminoglycoside sensitivity and di...

  10. Histone methyltransferases in cancer

    Albert, Mareike; Helin, Kristian

    2009-01-01

    Cancer is perceived as a heterogeneous group of diseases that is characterized by aberrant patterns of gene expression. In the last decade, an increasing amount of data has pointed to a key role for epigenetic alterations in human cancer. In this review, we focus on a subclass of epigenetic...... regulators, namely histone methyltransferases (HMTs). Several HMTs have been linked to different types of cancer; however, in most cases we only have limited knowledge regarding the molecular mechanisms by which the HMTs contribute to disease development. We summarize the current knowledge regarding some of...

  11. Subnuclear partitioning of rRNA genes between the nucleolus and nucleoplasm reflects alternative epiallelic states

    Pontvianne, Frederic; Blevins, Todd; Chandrasekhara, Chinmayi; Mozgová, Iva; Hassel, Christiane; Pontes, Olga M.F.; Tucker, Sarah; Mokroš, Petr; Muchová, Veronika; Fajkus, Jiří; Pikaard, Craig S.

    2013-01-01

    Eukaryotes can have thousands of 45S ribosomal RNA (rRNA) genes, many of which are silenced during development. Using fluorescence-activated sorting techniques, we show that active rRNA genes in Arabidopsis thaliana are present within sorted nucleoli, whereas silenced rRNA genes are excluded. DNA methyltransferase (met1), histone deacetylase (hda6), or chromatin assembly (caf1) mutants that disrupt silencing abrogate this nucleoplasmic–nucleolar partitioning. Bisulfite sequencing data indicate that active nucleolar rRNA genes are nearly completely demethylated at promoter CGs, whereas silenced genes are nearly fully methylated. Collectively, the data reveal that rRNA genes occupy distinct but changeable nuclear territories according to their epigenetic state. PMID:23873938

  12. Structural basis for S-adenosylmethionine binding and methyltransferase activity by mitochondrial transcription factor B1.

    Guja, Kip E; Venkataraman, Krithika; Yakubovskaya, Elena; Shi, Hui; Mejia, Edison; Hambardjieva, Elena; Karzai, A Wali; Garcia-Diaz, Miguel

    2013-09-01

    Eukaryotic transcription factor B (TFB) proteins are homologous to KsgA/Dim1 ribosomal RNA (rRNA) methyltransferases. The mammalian TFB1, mitochondrial (TFB1M) factor is an essential protein necessary for mitochondrial gene expression. TFB1M mediates an rRNA modification in the small ribosomal subunit and thus plays a role analogous to KsgA/Dim1 proteins. This modification has been linked to mitochondrial dysfunctions leading to maternally inherited deafness, aminoglycoside sensitivity and diabetes. Here, we present the first structural characterization of the mammalian TFB1 factor. We have solved two X-ray crystallographic structures of TFB1M with (2.1 Å) and without (2.0 Å) its cofactor S-adenosyl-L-methionine. These structures reveal that TFB1M shares a conserved methyltransferase core with other KsgA/Dim1 methyltransferases and shed light on the structural basis of S-adenosyl-L-methionine binding and methyltransferase activity. Together with mutagenesis studies, these data suggest a model for substrate binding and provide insight into the mechanism of methyl transfer, clarifying the role of this factor in an essential process for mitochondrial function. PMID:23804760

  13. Renibacterium salmoninarum isolates from different sources possess two highly conserved copies of the rRNA operon .

    Grayson, T H; Alexander, S M; Cooper, L F; Gilpin, M L

    2000-07-01

    The nucleotide sequences of the rRNA genes and the 5' flanking region were determined for R. salmoninarum ATCC 33209T from overlapping products generated by PCR amplification from the genomic DNA. Comparison of the sequences with rRNA genes from a variety of bacteria demonstrated the close relatedness between R. salmoninarum and the high G+C group of the actinobacteria, in particular, Arthrobacter species. A regulatory element within the 5' leader of the rRNA operon was identical to an element, CL2, described for mycobacteria. PCR, DNA sequence analysis, and DNA hybridisation were performed to examine variation between isolates from diverse sources which represented the four 16S-23S rRNA intergenic spacer sequevars previously described for R. salmoninarum. Two 23S-5S rRNA intergenic spacer sequevars of identical length were found. DNA hybridisation using probes complementary to 23S rDNA and 16S rDNA identified two rRNA operons which were identical or nearly identical amongst 40 isolates sourced from a variety of countries. PMID:11016696

  14. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    The peptidyl transfer site has been localized at the centre of domain V of 23S-like ribosomal RNA (rRNA) primarily on the basis of a chloramphenicol binding site. The implicated region constitutes an unstructured circle in the current secondary structural model which contains several universally....... In addition, a G2502----A transition caused a decreased growth rate, probably due to a partial selection against mutant ribosome incorporation into polysomes, while an A2503----C transversion produced a decreased growth rate and conferred resistance to chloramphenicol. All of the mutant RNAs were...

  15. Rapid Identification and Differentiation of the Soft Rot Erwinias by 16S-23S Intergenic Transcribed Spacer-PCR and Restriction Fragment Length Polymorphism Analyses

    Toth, I. K.; Avrova, A. O.; Hyman, L. J.

    2001-01-01

    Current identification methods for the soft rot erwinias are both imprecise and time-consuming. We have used the 16S-23S rRNA intergenic transcribed spacer (ITS) to aid in their identification. Analysis by ITS-PCR and ITS-restriction fragment length polymorphism was found to be a simple, precise, and rapid method compared to current molecular and phenotypic techniques. The ITS was amplified from Erwinia and other genera using universal PCR primers. After PCR, the banding patterns generated al...

  16. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan

    Martínez, Allyson K.; GORDON, EMILY; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M.; Benedik, Michael J.; Yanofsky, Charles; Mankin, Alexander S.; Vazquez-Laslop, Nora; Sachs, Matthew S.; Cruz-Vera, Luis R.

    2013-01-01

    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome’s ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the con...

  17. The use of 16S and 16S-23S rDNA to easily detect and differentiate common Gram-negative orchard epiphytes.

    Jeng, R S; Svircev, A M; Myers, A L; Beliaeva, L; Hunter, D M; Hubbes, M

    2001-02-01

    The identification of Gram-negative pathogenic and non-pathogenic bacteria commonly isolated from an orchard phylloplane may result in a time consuming and tedious process for the plant pathologist. The paper provides a simple "one-step" protocol that uses the polymerase chain reaction (PCR) to amplify intergenic spacer regions between 16S and 23S genes and a portion of 16S gene in the prokaryotic rRNA genetic loci. Amplified 16S rDNA, and restriction fragment length polymorphisms (RFLP) following EcoRI digestion produced band patterns that readily distinguished between the plant pathogen Erwinia amylovora (causal agent of fire blight in pear and apple) and the orchard epiphyte Pantoea agglomerans (formerly E. herbicola). The amplified DNA patterns of 16S-23S spacer regions may be used to differentiate E. amylovora at the intraspecies level. Isolates of E. amylovora obtained from raspberries exhibited two major fragments while those obtained from apples showed three distinct amplified DNA bands. In addition, the size of the 16S-23S spacer region differs between Pseudomonas syringae and Pseudomonas fluorescens. The RFLP pattern generated by HaeIII digestion may be used to provide a rapid and accurate identification of these two common orchard epiphytes. PMID:11166101

  18. Mutations in 23S rRNA at the Peptidyl Transferase Center and Their Relationship to Linezolid Binding and Cross-Resistance

    Long, Katherine; Munck, Christian

    2010-01-01

    linezolid. Smaller decreases were observed with the A2503G, U2504G, and G2505A mutations at nucleotides proximal to linezolid, showing that the degree of resistance conferred is not simply inversely proportional to the nucleotide-drug distance. The double mutations G2032A-C2499A, G2032A-U2504G, C2055A-U2504...

  19. Mutations in conserved helix 69 of 23S rRNA of Thermus thermophilus that affect capreomycin resistance but not posttranscriptional modifications

    Monshupanee, Tanakarn; Gregory, Steven T; Douthwaite, Stephen; Chungjatupornchai, Wipa; Dahlberg, Albert E

    2008-01-01

    Translocation during the elongation phase of protein synthesis involves the relative movement of the 30S and 50S ribosomal subunits. This movement is the target of tuberactinomycin antibiotics. Here, we describe the isolation and characterization of mutants of Thermus thermophilus selected for...

  20. Overexpression of the mitochondrial methyltransferase TFB1M in the mouse does not impact mitoribosomal methylation status or hearing

    Lee, Seungmin; Rose, Simon; Metodiev, Metodi D;

    2015-01-01

    Mitochondrial dysfunction is a well-established cause of sensorineural deafness, but the pathophysiological events are poorly understood. Non-syndromic deafness and predisposition to aminoglycoside-induced deafness can be caused by specific mutations in the 12S rRNA gene of mtDNA and are thus...... 'hypermethylation' of two conserved adenosines of 12S rRNA in the mitoribosome is of key pathophysiological importance in sensorineural deafness. In support for this concept, it was reported that overexpression of the essential mitochondrial methyltransferase TFB1M in the mouse was sufficient to induce...... mitoribosomal hypermethylation and deafness. At variance with this model, we show here that 12S rRNA is near fully methylated in vivo in the mouse and thus cannot be further methylated to any significant extent. Furthermore, bacterial artificial chromosome transgenic mice overexpressing TFB1M have no increase...

  1. Length polymorphisms for intergenic spacer regions of 16S-23S rDNA in members of the new hydrogen-producing bacteria

    2007-01-01

    A method based on PCR amplification of the 16S rRNA gene (rDNA) -23S rDNA intergenic spacer regions (ISR) was developed for the identification of species within the novel group hydrogen-producing anaerobes. The sizes of the PCR products varied from 1264 to 398 bp. Strain of isolate Rennanqilyf 3 was characterized as having products of 1262, 398, 638, 437 and 436 bp. The isolate Rennanqilyf 1 had product of 1264 bp. The isolate Rennanqilyf 13 had products of 1261, 579 and 485 bp. Of the 3 species of the novel group hydrogenproducing anaerobes examined, no one was indistinguishable. Two environmental isolates were identified as hydrogen-producing bacteria, which were new species in present taxon. Rennanqilyf 3 could not be associated With any Clostridium sp. Studied. Rennanqilyf 1 could be classified into Clostridium genus. The combination between 16S rDNA equencing and length polymorphisms of IRS in 16S-23S rDNA is a better method for determining species of the hydrogen-producing bacteria.

  2. Caffeine synthase and related methyltransferases in plants.

    Misako, Kato; Kouichi, Mizuno

    2004-05-01

    Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in high concentrations in tea and coffee and it is also found in a number of beverages such as coca cola. It is necessary to elucidate the caffeine biosynthetic pathway and to clone the genes related to the production of caffeine not only to determine the metabolism of the purine alkaloid but also to control the content of caffeine in tea and coffee. The available data support the operation of a xanthosine-->7-methylxanthosine-->7-methylxanthine-->theobromine-->caffeine pathway as the major route to caffeine. Since the caffeine biosynthetic pathway contains three S-adenosyl-L-methionine (SAM) dependent methylation steps, N-methyltransferases play important roles. This review focuses on the enzymes and genes involved in the methylation of purine ring. Caffeine synthase, the SAM-dependent methyltransferase involved in the last two steps of caffeine biosynthesis, was originally purified from young tea leaves (Camellia sinensis). The isolated cDNA, termed TCS1, consists of 1,483 base pairs and encodes a protein of 369 amino acids. Subsequently, the homologous genes that encode caffeine biosynthetic enzymes from coffee (Coffea arabica) were isolated. The recombinant proteins are classified into the three types on the basis of their substrate specificity i.e. 7-methylxanthosine synthase, theobromine synthase and caffeine synthase. The predicted amino acid sequences of caffeine biosynthetic enzymes derived from C. arabica exhibit more than 80% homology with those of the clones and but show only 40% homology with TCS1 derived from C. sinensis. In addition, they share 40% homology with the amino acid sequences of salicylic carboxyl methyltransferase, benzoic acid carboxyl methyltransferase and jasmonic acid carboxyl methyltransferase which belong to a family of motif B' methyltransferases which are novel plant methyltransferases with motif B' instead of motif B as the conserved region. PMID:14977590

  3. A nested array of rRNA targeted probes for the detection and identification of enterococci by reverse hybridization.

    Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W

    2000-12-01

    Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants. PMID:11249027

  4. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A

    2013-01-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show – using proteomic analysis and dual fluorescence reporter in vivo assays – that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requi...

  5. Human Mitochondrial Transcription Factor B1 Interacts with the C-Terminal Activation Region of h-mtTFA and Stimulates Transcription Independently of Its RNA Methyltransferase Activity

    McCulloch, Vicki; Shadel, Gerald S.

    2003-01-01

    A significant advancement in understanding mitochondrial gene expression is the recent identification of two new human mitochondrial transcription factors, h-mtTFB1 and h-mtTFB2. Both proteins stimulate transcription in collaboration with the high-mobility group box transcription factor, h-mtTFA, and are homologous to rRNA methyltransferases. In fact, the dual-function nature of h-mtTFB1 was recently demonstrated by its ability to methylate a conserved rRNA substrate. Here, we demonstrate tha...

  6. Directed evolution of improved zinc finger methyltransferases.

    Brian Chaikind

    Full Text Available The ability to target DNA methylation toward a single, user-designated CpG site in vivo may have wide applicability for basic biological and biomedical research. A tool for targeting methylation toward single sites could be used to study the effects of individual methylation events on transcription, protein recruitment to DNA, and the dynamics of such epigenetic alterations. Although various tools for directing methylation to promoters exist, none offers the ability to localize methylation solely to a single CpG site. In our ongoing research to create such a tool, we have pursued a strategy employing artificially bifurcated DNA methyltransferases; each methyltransferase fragment is fused to zinc finger proteins with affinity for sequences flanking a targeted CpG site for methylation. We sought to improve the targeting of these enzymes by reducing the methyltransferase activity at non-targeted sites while maintaining high levels of activity at a targeted site. Here we demonstrate an in vitro directed evolution selection strategy to improve methyltransferase specificity and use it to optimize an engineered zinc finger methyltransferase derived from M.SssI. The unusual restriction enzyme McrBC is a key component of this strategy and is used to select against methyltransferases that methylate multiple sites on a plasmid. This strategy allowed us to quickly identify mutants with high levels of methylation at the target site (up to ∼80% and nearly unobservable levels of methylation at a off-target sites (<1%, as assessed in E. coli. We also demonstrate that replacing the zinc finger domains with new zinc fingers redirects the methylation to a new target CpG site flanked by the corresponding zinc finger binding sequences.

  7. (e, 3e) differential cross section of He (21s) and He (23s)

    The angular distribution of the five-fold differential cross section for the electron impact double ionization of He (21s) and He (23s) has been studied. The kinematical conditions for maxima/minima in the angular distribution for the two cases have been compared. The two-step process for the double ionization is found to contribute very little in the triplet case. (author)

  8. Lifetime of the metastable 23S1 state in stored Li+ ions

    A laser-induced fluorescence technique combined with the observation of spontaneous magnetic dipole photons from the highly metastable 23S1 state of Li+ was used to measure the radiative lifetime of this state. The ions are created by electron impact on a lithium atomic beam and are subsequently stored for periods of many seconds in an RF-quadrupole ion trap. A tunable dye laser excites the 23S--23P, transition at 5485A, and the intercombination electric dipole transition 23P1--1 1S0 at 202A is observed. This process depletes the metastable population in a time tau/sub d/ 3S1/ and provides a measure of the total number of metastables. Comparison with the rate of 210A spontaneously emitted photons yields a measured value for the 23S1 radiative lifetime of tau/sub rad/ = 58.6 +- 12.9 sec, where the quoted error represents 95% confidence levels. The theoretical lifetime is tau/sub theory/ = 49.0 sec. The measured value includes data taken with both 6Li+ and 7Li+ isotopes and was corrected for the slightly different detector efficiencies at 202A and 210A. A careful study of nonradiative quenching of the metastable state was necessary to understand observed differences between tau/sub rad/ and tau/sub 3S1/, the total metastable lifetime. Spatial density profiles of the ions within the trap, useful for determining the ion temperature, were obtained by scanning the laser beam horizontally across the ion trap while storing 23P1--1S0 photon counts as a function of the laser beam's position. Agreement with a simple equilibrium model, including space charge effects, is satisfactory. A study of the optical pumping process is necessary to understand the laser-ion interaction, and observational and theoretical data are presented. 47 references

  9. Catechol-O-Methyltransferase Polymorphism and Endometriosis

    Wieser, Fritz; Wenzl, Rene; Tempfer, Clemens; Worda, Christoph; Huber, Johannes; Schneeberger, Christian

    2002-01-01

    Purpose: Catechol-O-methyltransferase (COMT) inactivates the estradiol metabolites, 2-hydroxy and 4-hydroxy catechols, which have been implicated in the pathogenesis of endometriosis. A COMT valine to methionine polymorphism (G-to-A) in exon 4 of the COMT gene is polymorphic in the human population, with 25% of Caucasians being homozygous for the low-activity allele (COMT-L) of the enzyme. In a case-control study we investigated whether this COMT polymorphism is associated with endometriosis.

  10. Structural Chemistry of Human RNA Methyltransferases.

    Schapira, Matthieu

    2016-03-18

    RNA methyltransferases (RNMTs) play important roles in RNA stability, splicing, and epigenetic mechanisms. They constitute a promising target class that is underexplored by the medicinal chemistry community. Information of relevance to drug design can be extracted from the rich structural coverage of human RNMTs. In this work, the structural chemistry of this protein family is analyzed in depth. Unlike most methyltransferases, RNMTs generally feature a substrate-binding site that is largely open on the cofactor-binding pocket, favoring the design of bisubstrate inhibitors. Substrate purine or pyrimidines are often sandwiched between hydrophobic walls that can accommodate planar ring systems. When the substrate base is laying on a shallow surface, a 5' flanking base is sometimes anchored in a druggable cavity. The cofactor-binding site is structurally more diverse than in protein methyltransferases and more druggable in SPOUT than in Rossman-fold enzymes. Finally, conformational plasticity observed both at the substrate and cofactor binding sites may be a challenge for structure-based drug design. The landscape drawn here may inform ongoing efforts toward the discovery of the first human RNMT inhibitors. PMID:26566070

  11. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan.

    Martínez, Allyson K; Gordon, Emily; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M; Benedik, Michael J; Yanofsky, Charles; Mankin, Alexander S; Vazquez-Laslop, Nora; Sachs, Matthew S; Cruz-Vera, Luis R

    2014-01-01

    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome's ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the concentration dependence of L-Trp-mediated tna operon induction, whereas the TnaC I19L change suppresses this phenotype, restoring the sensitivity of the translating A2058U mutant ribosome to free L-Trp. These findings suggest that interactions between TnaC residue I19 and 23S rRNA nucleotide A2058 contribute to the creation of a regulatory L-Trp binding site within the translating ribosome. PMID:24137004

  12. Precise determination of the magnetic moment of helium in its 23S1 metastable state

    The electronic magnetic moment of helium was measured by the atomic beam magnetic resonance method using separated oscillating fields. Actually, the magnetic moment of helium relative to that of rubidium was measured. The result was combined with the ratio g/sub J/(Rb)/g/sub J/(H) to get R = g/sub J/(He, 23S1)/g/sub J/(H,2S/sub 1/2/) = 1 - (23.19 +- 0.1) x 10-6. The motivation for this Zeeman measurement was to provide as sensitive a test of the theory of atomic magnetism for a multielectron atom as possible. In particular, the experiment provides a test of the relativistic corrections to the Zeeman effect. The experiment also tests the additivity of the radiative corrections to the magnetic moments of the two electrons. Another motivation concerns the determination of the fine structure constant α from measurements of the 23P fine structure intervals of 4He; namely, the understanding of the 23S states contributes to the knowledge of the theoretical expressions for the 23P intervals. For the chosen magnetic field of 9.5 kG, the helium resonance frequency was 26.8 GHz, the rubidium frequency, 26.4 GHz. The linewidth associated with the microwave double loop was 25 KHz. Thus it was necessary to pick the resonance line centers to only 1 part in 10 to achieve a 0.1 ppM accuracy. This result is in excellent agreement with the latest theoretical value, R = 1 - 23.21 x 10-6; and with earlier, less precise atomic beam measurements; and with the latest, comparably accurate optical pumping value. Many possible sources of error were investigated. The quoted error is based on analysis of residual systematic effects

  13. Designing PCR Primers from 16S-23S rDNA Intergenic Spacer Region for the Identification of Pasteurella multocida%以 16S-23S rDNA 间区序列为目的基因设计 PCR 引物鉴定多杀巴斯德氏菌

    周浩; 刘寅; 陈一军; 郑泽军; 黄熙泰

    2008-01-01

    多杀巴斯德氏菌是养殖动物(鸡,猪,牛等)的重要致病菌.本研究以16S-23S rDNA间区序列为目的基因设计PCR引物鉴定多杀巴斯德氏菌.通过对多杀巴斯德氏菌ITS-IA(含有tDNA-Ile和tDNA-Ala的16S-23S rDNA间区序列)的测序和与GenBank中序列的BLAST,设计筛选了一对特异引物PS-F/PS-R.对引物的特异性和有效性,用PCR方法进行了验证.结果表明:所有的多杀巴斯德氏菌标准菌株和分离菌株都能被检出,而全部39株非多杀巴斯德氏菌都没有扩增出特异性条带.其检测灵敏度能达到102CFU/mL.研究结果表明,发展了的PCR鉴定方法是省时的和可靠的,整个过程只需要20 h,而传统的鉴定方法需要至少5 d的时间.%Pasteurella multocida is an important pathogen that infects many kinds of animals. In present study, a polymerase chain reaction (PCR) assay using primers derived from the 16S-23S rRNA intergenic spacer (ITS) of P. multocida was developed. One pairs of specific PCR primers were designed by sequencing the ITS-IA (ITS containing tDNA-Ile and tDNA-Ala) of P. multocida and BLAST of GenBank. The specificity and efficiency of the PCR methods were tested against a panel of numerous strains from 39 different bacterial strains. All of the P. multocida strains generated positive signal, and no cross-reaction was observed with non-P, multocida strains in the PCR detection. Sensitivity of the detection is 102 CFU/mL cultures. The newly developed PCR array procedures take only 20 hours for each time, whereas the conventional methods required at least five days. This study demonstrated that the PCR detection for P. multocida is time-saved and reliable.

  14. Resistance to ketolide antibiotics by coordinated expression of rRNA methyltransferases in a bacterial producer of natural ketolides

    Almutairi, Mashal M; Park, Sung Ryeol; Rose, Simon;

    2015-01-01

    Ketolides are promising new antimicrobials effective against a broad range of Gram-positive pathogens, in part because of the low propensity of these drugs to trigger the expression of resistance genes. A natural ketolide pikromycin and a related compound methymycin are produced by Streptomyces...... activation by ketolide antibiotics. The resistance genes and the induction mechanism remain fully functional when transferred to heterologous bacterial hosts. The anticipated wide use of ketolide antibiotics could promote horizontal transfer of these highly efficient resistance genes to pathogens. Taken...... together, these findings emphasized the need for surveillance of pikR1/pikR2-based bacterial resistance and the preemptive development of drugs that can remain effective against the ketolide-specific resistance mechanism....

  15. Interaction potentials and energy transfer cross sections for collisions of metastable helium and neon I: He (23S) + Ne

    Differential cross sections have been measured for He(23S) + Ne at kinetic energies between 28 and 370 meV. For energies above 90 meV the elastic cross sections show Stueckelberg oscillations from curve crossings, which lead to the energy exchange process: He(23S) + Ne → He(11S) + Ne(2p54s,3d,4p). Differential cross sections for this inelastic process could be measured above 200 meV. A fit to the data gives the potentials for He(23S) + Ne and, less accurately, for He + Nesup(*). These results offer a simple explanation, why the exothermic pumping process of the infrared lines of the HeNe laser has a threshold of about 80 meV and a small cross section. (orig.)

  16. Expanded versions of the 16S and 23S ribosomal RNA mutation databases (16SMDBexp and 23SMDBexp)

    Triman, K L; Peister, A; R. A. Goel

    1998-01-01

    Expanded versions of the Ribosomal RNA Mutation Databases provide lists of mutated positions in 16S and 16S-like ribosomal RNA (16SMDBexp) and 23S and 23S-like ribosomal RNA (23SMDBexp) and the identity of each alteration. Alterations from organisms other than Escherichia coli are reported at positions according to the E.coli numbering system. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation, (ii) whether a mutant pheno...

  17. Monolignol 4-O-methyltransferases and uses thereof

    Liu, Chang-Jun; Bhuiya, Mohammad-Wadud; Zhang, Kewei

    2014-11-18

    Modified (iso)eugenol 4-O-methyltransferase enzymes having novel capacity for methylation of monolignols and reduction of lignin polymerization in plant cell wall are disclosed. Sequences encoding the modified enzymes are disclosed.

  18. The inheritance of human erythrocyte catechol-O-methyltransferase activity

    Erythrocyte catechol-O-methyltransferase (COMT) activity was analyzed in 107 individuals from 23 families. The observed activities were consistent with an autosomal codominant inheritance of the gene coding for erythrocyte COMT activity. (author)

  19. Functional characterization of a rice de novo DNA methyltransferase, OsDRM2, expressed in Escherichia coli and yeast

    Highlights: ► A rice de novo DNA methyltransferase OsDRM2 was cloned. ► In vitro methylation activity of OsDRM2 was characterized with Escherichia coli. ► Assays of OsDRM2 in vivo methylation were done with Saccharomyces cerevisiae. ► OsDRM2 methylation activity is not preferential to any type of cytosine context. ► The activity of OsDRM2 is independent of RdDM pathway. - Abstract: DNA methylation of cytosine nucleotides is an important epigenetic modification that occurs in most eukaryotic organisms and is established and maintained by various DNA methyltransferases together with their co-factors. There are two major categories of DNA methyltransferases: de novo and maintenance. Here, we report the isolation and functional characterization of a de novo methyltransferase, named OsDRM2, from rice (Oryza sativa L.). The full-length coding region of OsDRM2 was cloned and transformed into Escherichia coli and Saccharomyces cerevisiae. Both of these organisms expressed the OsDRM2 protein, which exhibited stochastic de novo methylation activity in vitro at CG, CHG, and CHH di- and tri-nucleotide patterns. Two lines of evidence demonstrated the de novo activity of OsDRM2: (1) a 5′-CCGG-3′ containing DNA fragment that had been pre-treated with OsDRM2 protein expressed in E. coli was protected from digestion by the CG-methylation-sensitive isoschizomer HpaII; (2) methylation-sensitive amplified polymorphism (MSAP) analysis of S. cerevisiae genomic DNA from transformants that had been introduced with OsDRM2 revealed CG and CHG methylation levels of 3.92–9.12%, and 2.88–6.93%, respectively, whereas the mock control S. cerevisiae DNA did not exhibit cytosine methylation. These results were further supported by bisulfite sequencing of the 18S rRNA and EAF5 genes of the transformed S. cerevisiae, which exhibited different DNA methylation patterns, which were observed in the genomic DNA. Our findings establish that OsDRM2 is an active de novo DNA

  20. Functional characterization of a rice de novo DNA methyltransferase, OsDRM2, expressed in Escherichia coli and yeast

    Pang, Jinsong, E-mail: pangjs542@nenu.edu.cn [Key Laboratory of Molecular Epigenetics of the Ministry of Education, Northeast Normal University, Changchun, Jilin 130024 (China); Dong, Mingyue; Li, Ning; Zhao, Yanli [Key Laboratory of Molecular Epigenetics of the Ministry of Education, Northeast Normal University, Changchun, Jilin 130024 (China); Liu, Bao, E-mail: baoliu@nenu.edu.cn [Key Laboratory of Molecular Epigenetics of the Ministry of Education, Northeast Normal University, Changchun, Jilin 130024 (China)

    2013-03-01

    Highlights: ► A rice de novo DNA methyltransferase OsDRM2 was cloned. ► In vitro methylation activity of OsDRM2 was characterized with Escherichia coli. ► Assays of OsDRM2 in vivo methylation were done with Saccharomyces cerevisiae. ► OsDRM2 methylation activity is not preferential to any type of cytosine context. ► The activity of OsDRM2 is independent of RdDM pathway. - Abstract: DNA methylation of cytosine nucleotides is an important epigenetic modification that occurs in most eukaryotic organisms and is established and maintained by various DNA methyltransferases together with their co-factors. There are two major categories of DNA methyltransferases: de novo and maintenance. Here, we report the isolation and functional characterization of a de novo methyltransferase, named OsDRM2, from rice (Oryza sativa L.). The full-length coding region of OsDRM2 was cloned and transformed into Escherichia coli and Saccharomyces cerevisiae. Both of these organisms expressed the OsDRM2 protein, which exhibited stochastic de novo methylation activity in vitro at CG, CHG, and CHH di- and tri-nucleotide patterns. Two lines of evidence demonstrated the de novo activity of OsDRM2: (1) a 5′-CCGG-3′ containing DNA fragment that had been pre-treated with OsDRM2 protein expressed in E. coli was protected from digestion by the CG-methylation-sensitive isoschizomer HpaII; (2) methylation-sensitive amplified polymorphism (MSAP) analysis of S. cerevisiae genomic DNA from transformants that had been introduced with OsDRM2 revealed CG and CHG methylation levels of 3.92–9.12%, and 2.88–6.93%, respectively, whereas the mock control S. cerevisiae DNA did not exhibit cytosine methylation. These results were further supported by bisulfite sequencing of the 18S rRNA and EAF5 genes of the transformed S. cerevisiae, which exhibited different DNA methylation patterns, which were observed in the genomic DNA. Our findings establish that OsDRM2 is an active de novo DNA

  1. Hypnotizability and Catechol-O-Methyltransferase (COMT) polymorphysms in Italians

    Alessandro Gialluisi; Serena Barbuti; Giancarlo Carli; Enrica Laura Santarcangelo

    2014-01-01

    Higher brain dopamine content depending on lower activity of Catechol-O-Methyltransferase (COMT) in subjects with high hypnotisability scores (highs) has been considered responsible for their attentional characteristics. However, the results of the previous genetic studies on association between hypnotisability and the Catechol-O-Methyltransferase (COMT) single nucleotide polymorphism (SNP) rs4680 (Val158Met) were inconsistent. Here, we used a selective genotyping approach to re-evaluate the ...

  2. Downregulation of rRNA Transcription Triggers Cell Differentiation

    Yuki Hayashi; Takao Kuroda; Hiroyuki Kishimoto; Changshan Wang; Atsushi Iwama; Keiji Kimura

    2014-01-01

    Responding to various stimuli is indispensable for the maintenance of homeostasis. The downregulation of ribosomal RNA (rRNA) transcription is one of the mechanisms involved in the response to stimuli by various cellular processes, such as cell cycle arrest and apoptosis. Cell differentiation is caused by intra- and extracellular stimuli and is associated with the downregulation of rRNA transcription as well as reduced cell growth. The downregulation of rRNA transcription during differentiati...

  3. Purification and properties of thioether methyltransferase

    A method to assay activity was developed which measures acceptance of methyl groups from [methyl-3H]-S-adenosylmethionine by dimethyl selenide. The product, [3H]trimethylselenonium ion, is separated by HPLC and quantitated by scintillation counting. Thioether methyltransferase from mouse liver and lung resides primarily in the cytosol. In terms of specific activity the enzyme is most active in the lung and liver. Purification from lung cytosol requires a three-step process of DEAE and gel filtration column chromatographies followed by chromatofocusing. SDS-Polyacrylamide gel electrophoresis shows a single homogeneous band with a molecular mass of 28,000 daltons. Vmax and Km values for dimethyl selenide as a substrate are 15. 7 pmol/min and 0.44 μM, respectively. Our studies have also shown that this purified enzyme is capable of methylating a wide range of compounds. To further test the enzyme's role in detoxification, in vivo studies were performed by injecting mice with substrate and [methyl-3H]methionine and analyzing tissue extracts and urine for [methyl-3H]sulfonium

  4. Isolation of DNA methyltransferase from plants

    DNA methyltransferases (DMT) were isolated from nuclei of cauliflower, soybean, and pea by extraction with 0.35 M NaCl. Assays were performed on hemimethylated Micrococcus luteus DNA or on M. luteus DNA to test for maintenance or de novo methylase activity, respectively. Fully methylated DNA was used as a substrate to determine background levels of methylation. Based on these tests, yields of maintenance DMT activity in the crude extract from pea hypocotyl, soybean hypocotyl, and cauliflower inflorescence were 2.8, 0.9, and 1.6 units per g wet tissue (one unit equals 1 pmol of methyl from [3H]AdoMet incorporated into acid precipitable material per h at 300). Two peaks of DMT activity were detected in the soybean nuclear extract following phosphocellulose chromatography. One eluted at 0.4 M and the other at 0.8 M KCl. With both fractions maintenance activity was approximately 2 times that of the de novo activity. Using gel filtration the DMT eluted at 220,000 Daltons. The optimal pH for activity was between 6.5 and 7.0, and the optimal temperature was 300

  5. lncRNA-Induced Nucleosome Repositioning Reinforces Transcriptional Repression of rRNA Genes upon Hypotonic Stress

    Zhongliang Zhao

    2016-03-01

    Full Text Available The activity of rRNA genes (rDNA is regulated by pathways that target the transcription machinery or alter the epigenetic state of rDNA. Previous work has established that downregulation of rRNA synthesis in quiescent cells is accompanied by upregulation of PAPAS, a long noncoding RNA (lncRNA that recruits the histone methyltransferase Suv4-20h2 to rDNA, thus triggering trimethylation of H4K20 (H4K20me3 and chromatin compaction. Here, we show that upregulation of PAPAS in response to hypoosmotic stress does not increase H4K20me3 because of Nedd4-dependent ubiquitinylation and proteasomal degradation of Suv4-20h2. Loss of Suv4-20h2 enables PAPAS to interact with CHD4, a subunit of the chromatin remodeling complex NuRD, which shifts the promoter-bound nucleosome into the transcriptional “off” position. Thus, PAPAS exerts a “stress-tailored” dual function in rDNA silencing, facilitating either Suv4-20h2-dependent chromatin compaction or NuRD-dependent changes in nucleosome positioning.

  6. DNA Methyltransferases Inhibitors from Natural Sources.

    Zwergel, Clemens; Valente, Sergio; Mai, Antonello

    2016-01-01

    DNA methyltransferases (DNMTs) catalyze the methylation at cytosine-C5 mainly in a CpG dinucleotide context. Although DNA methylation is essential for fundamental processes like embryonic development or differentiation, aberrant expression and/or activities of DNMTs are involved in several pathologies, from neurodegeneration to cancer. DNMTs inhibition can arrest tumor growth, cells invasiveness and induce differentiation, whereas their increased expression is shown in numerous cancer types. Moreover, hypermethylated promoters of tumor suppressor genes lead to their silencing. Hence, the use of specific inhibitors of DNMT might reactivate those genes and stop or even reverse the aberrant cell processes. To date, the only approved DNMTs inhibitors for therapy belong to the nucleoside-based family of drugs, but they display relevant side effects as well as high chemical instability. Thus, there is a keen interest actually exists to develop novel, potent and safe inhibitors possessing a nonnucleoside structure. Increasing literature evidence is highlighting that natural sources could help the researchers to achieve this goal. Indeed, several polyphenols, flavonoids, antraquinones, and others are described able to inhibit DNMTs activity and/or expression, thus decreasing the methylation/silencing of different genes involved in tumorigenesis. These events can lead to re-expression of such genes and to cell death in diverse cancer cell lines. Epigallocatechin-3-gallate (1) and laccaic acid A (11) resulted the most effective DNMT1 inhibitors with submicromolar IC50 values, acting as competitive inhibitors. Compound 1 and 11 both displayed gene demethylation and re-activation in several cancers. However, all of the natural compounds described in this review showed important results, from gene reactivation to cell growth inhibition. Moreover, some of them displayed interesting activity even in rodent cancer models and very recently entered clinical trials. PMID:26303417

  7. Multiple lysine methylation of PCAF by Set9 methyltransferase

    The molecular functions of several non-histone proteins are regulated through lysine modification by histone methyltransferases. The p300/CBP-associated factor (PCAF) is an acetyltransferase that has been implicated in many cellular processes. Here, we report that PCAF is a novel substrate of Set9 methyltransferase. In vitro mapping experiments revealed six lysine residues could be methylated by Set9. A comparison of amino acid sequences of target sites revealed the novel consensus motif which differs from previously identified Set9-consensus sequence. Further methyltransferase assays focusing on the six lysine residues showed that K78 and K89 are preferentially methylated in full-length PCAF in vitro. Using specific antibodies recognizing mono-methylated K89, in vivo PCAF methylation and its nuclear localization were demonstrated. Our data may lead to a new insight into PCAF functions and provide additional information to identify unknown targets of Set9.

  8. Downregulation of rRNA transcription triggers cell differentiation.

    Yuki Hayashi

    Full Text Available Responding to various stimuli is indispensable for the maintenance of homeostasis. The downregulation of ribosomal RNA (rRNA transcription is one of the mechanisms involved in the response to stimuli by various cellular processes, such as cell cycle arrest and apoptosis. Cell differentiation is caused by intra- and extracellular stimuli and is associated with the downregulation of rRNA transcription as well as reduced cell growth. The downregulation of rRNA transcription during differentiation is considered to contribute to reduced cell growth. However, the downregulation of rRNA transcription can induce various cellular processes; therefore, it may positively regulate cell differentiation. To test this possibility, we specifically downregulated rRNA transcription using actinomycin D or a siRNA for Pol I-specific transcription factor IA (TIF-IA in HL-60 and THP-1 cells, both of which have differentiation potential. The inhibition of rRNA transcription induced cell differentiation in both cell lines, which was demonstrated by the expression of the common differentiation marker CD11b. Furthermore, TIF-IA knockdown in an ex vivo culture of mouse hematopoietic stem cells increased the percentage of myeloid cells and reduced the percentage of immature cells. We also evaluated whether differentiation was induced via the inhibition of cell cycle progression because rRNA transcription is tightly coupled to cell growth. We found that cell cycle arrest without affecting rRNA transcription did not induce differentiation. To the best of our knowledge, our results demonstrate the first time that the downregulation of rRNA levels could be a trigger for the induction of differentiation in mammalian cells. Furthermore, this phenomenon was not simply a reflection of cell cycle arrest. Our results provide a novel insight into the relationship between rRNA transcription and cell differentiation.

  9. Calculation and comparative analysis of the ir spectra of homobrassinolide and (22s,23s)-homobrassinolide

    Normal vibrational frequencies and absolute IR band intensities of the biologically active steroid phytohormones homobrassinolide and (22S,23S)-homobrassinolide were calculated in the framework of an original approach that combined classical analysis of normal modes using molecular mechanics with quantum-chemical estimation of the absolute intensities. IR absorption bands were interpreted based on a comparison of the experimental and theoretical absorption spectra. The impact of structural differences in the side chains of these molecules on the formation of their IR spectra in the region 1500-950 cm -1 was estimated. (authors)

  10. Calculation and Comparative Analysis of the IR Spectra of Homobrassinolide and (22S,23S)-Homobrassinolide

    Andrianov, V. M.; Korolevich, M. V.

    2015-09-01

    Normal vibrational frequencies and absolute IR band intensities of the biologically active steroid phytohormones homobrassinolide and (22S,23S)-homobrassinolide were calculated in the framework of an original approach that combined classical analysis of normal modes using molecular mechanics with quantum-chemical estimation of the absolute intensities. IR absorption bands were interpreted based on a comparison of the experimental and theoretical absorption spectra. The impact of structural differences in the side chains of these molecules on the formation of their IR spectra in the region 1500-950 cm -1 was estimated.

  11. Simulation of the structures and calculation of IR Spectra of (22 s,23 s)-Homobrassinolide conformers

    Andrianov, V. M.; Korolevich, M. V.

    2012-07-01

    Frequencies and intensities of normal vibrations of (22 S,23 S)-homobrassinolide, a biologically active representative of steroidal phytohormones, were calculated within the framework of an original approach that combined a classical analysis of normal vibrations by a molecular mechanics method with a quantum-chemical estimation of absolute intensities. Two molecular structures with different side-chain conformations were considered. The molecular IR absorption bands in the range 1500-900 cm-1 were interpreted for the first time and the influence of the side-chain conformation on the IR spectrum was analyzed based on a comparison of the experimental and calculated spectra.

  12. Simulation of the structures and calculation of IR Spectra of (22S,23S)-Homobrassinolide conformers

    Frequencies and intensities of normal vibrations of (22S,23S)-homobrassinolide, a biologically active representative of steroidal phytohormones, were calculated within the framework of an original approach that combined a classical analysis of normal vibrations by a molecular mechanics method with a quantum-chemical estimation of absolute intensities. Two molecular structures with different side-chain conformations were considered. The molecular IR absorption bands in the range 1500-900 cm-1 were interpreted for the first time and the influence of the side-chain conformation on the IR spectrum was analyzed based on a comparison of the experimental and calculated spectra. (authors)

  13. Measurement of the positronium 13S1-23S1 interval by continuous-wave two-photon excitation

    Fee, M.; Mills, A.; Chu, S.; Shaw, E; Danzmann, K.; Chichester, R.; Zuckerman, D.

    1993-01-01

    Using continuous-wave excitation to eliminate the problems inherent with pulsed laser measurements of nonlinear transitions, we have measured the 13S1-23S1 interval in positronium (Ps) to be 1 233 607 216.4±3.2 MHz. The quoted 2.6 ppb (parts per 109) uncertainty is primarily due to the determination of the Ps resonance relative to the Te2 reference line, with a 1.5 ppb contribution from a recent calibration of the Te2 line relative to the hydrogen 1S-2S transition. The uncertainty corresponds...

  14. AtPPR2, an Arabidopsis pentatricopeptide repeat protein, binds to plastid 23S rRNA and plays an important role in the first mitotic division during gametogenesis and in cell proliferation during embryogenesis

    Lu, Yuqing; Li, Cong; Wang, Hai; Chen, Hao; Berg, Howard; Xia, Yiji

    2011-01-01

    Pentatricopeptide repeat (PPR) proteins are mainly involved in regulating post-transcriptional processes in mitochondria and plastids, including chloroplasts. Mutations in the Arabidopsis PPR2 gene have previously been found to cause defects in seed development and reduced transmission through male and female gametophytes. However, the exact function of AtPPR2 has not been defined. We found that a loss-of-function mutation of AtPPR2 leads to arrest of the first mitotic division during both ma...

  15. Chromosomal replication incompatibility in Dam methyltransferase deficient Escherichia coli cells

    Freiesleben, Ulrik Von

    1996-01-01

    Dam methyltransferase deficient Escherichia coli cells containing minichromosomes were constructed. Free plasmid DNA could not be detected in these cells and the minichromosomes were found to be integrated in multiple copies in the origin of replication (oriC) region of the host chromosome. The...

  16. Label-free electrochemical detection of human methyltransferase from tumors.

    Furst, Ariel L; Muren, Natalie B; Hill, Michael G; Barton, Jacqueline K

    2014-10-21

    The role of abnormal DNA methyltransferase activity in the development and progression of cancer is an essential and rapidly growing area of research, both for improved diagnosis and treatment. However, current technologies for the assessment of methyltransferase activity, particularly from crude tumor samples, limit this work because they rely on radioactivity or fluorescence and require bulky instrumentation. Here, we report an electrochemical platform that overcomes these limitations for the label-free detection of human DNA(cytosine-5)-methyltransferase1 (DNMT1) methyltransferase activity, enabling measurements from crude cultured colorectal cancer cell lysates (HCT116) and biopsied tumor tissues. Our multiplexed detection system involving patterning and detection from a secondary electrode array combines low-density DNA monolayer patterning and electrocatalytically amplified DNA charge transport chemistry to measure selectively and sensitively DNMT1 activity within these complex and congested cellular samples. Based on differences in DNMT1 activity measured with this assay, we distinguish colorectal tumor tissue from healthy adjacent tissue, illustrating the effectiveness of this two-electrode platform for clinical applications. PMID:25288757

  17. Structure and Function of Flavivirus NS5 Methyltransferase

    Zhou,Y.; Ray, D.; Zhao, Y.; Dong, H.; Ren, S.; Li, Z.; Guo, Y.; Bernard, K.; Shi, P.; Li, H.

    2007-01-01

    The plus-strand RNA genome of flavivirus contains a 5' terminal cap 1 structure (m{sup 7}GpppAmG). The flaviviruses encode one methyltransferase, located at the N-terminal portion of the NS5 protein, to catalyze both guanine N-7 and ribose 2'-OH methylations during viral cap formation. Representative flavivirus methyltransferases from dengue, yellow fever, and West Nile virus (WNV) sequentially generate GpppA {yields} m{sup 7}GpppA {yields} m{sup 7}GpppAm. The 2'-O methylation can be uncoupled from the N-7 methylation, since m{sup 7}GpppA-RNA can be readily methylated to m{sup 7}GpppAm-RNA. Despite exhibiting two distinct methylation activities, the crystal structure of WNV methyltransferase at 2.8 {angstrom} resolution showed a single binding site for S-adenosyl-L-methionine (SAM), the methyl donor. Therefore, substrate GpppA-RNA should be repositioned to accept the N-7 and 2'-O methyl groups from SAM during the sequential reactions. Electrostatic analysis of the WNV methyltransferase structure showed that, adjacent to the SAM-binding pocket, is a highly positively charged surface that could serve as an RNA binding site during cap methylations. Biochemical and mutagenesis analyses show that the N-7 and 2'-O cap methylations require distinct buffer conditions and different side chains within the K{sub 61}-D{sub 146}-K{sub 182}-E{sub 218} motif, suggesting that the two reactions use different mechanisms. In the context of complete virus, defects in both methylations are lethal to WNV; however, viruses defective solely in 2'-O methylation are attenuated and can protect mice from later wild-type WNV challenge. The results demonstrate that the N-7 methylation activity is essential for the WNV life cycle and, thus, methyltransferase represents a novel target for flavivirus therapy.

  18. Engineering Monolignol 4-O-Methyltransferases to Modulate Lignin Biosynthesis

    Bhuiya, M.W.; Liu, C.

    2010-01-01

    Lignin is a complex polymer derived from the oxidative coupling of three classical monolignols. Lignin precursors are methylated exclusively at the meta-positions (i.e. 3/5-OH) of their phenyl rings by native O-methyltransferases, and are precluded from substitution of the para-hydroxyl (4-OH) position. Ostensibly, the para-hydroxyls of phenolics are critically important for oxidative coupling of phenoxy radicals to form polymers. Therefore, creating a 4-O-methyltransferase to substitute the para-hydroxyl of monolignols might well interfere with the synthesis of lignin. The phylogeny of plant phenolic O-methyltransferases points to the existence of a batch of evolutionarily 'plastic' amino acid residues. Following one amino acid at a time path of directed evolution, and using the strategy of structure-based iterative site-saturation mutagenesis, we created a novel monolignol 4-O-methyltransferase from the enzyme responsible for methylating phenylpropenes. We show that two plastic residues in the active site of the parental enzyme are vital in dominating substrate discrimination. Mutations at either one of these separate the evolutionarily tightly linked properties of substrate specificity and regioselective methylation of native O-methyltransferase, thereby conferring the ability for para-methylation of the lignin monomeric precursors, primarily monolignols. Beneficial mutations at both sites have an additive effect. By further optimizing enzyme activity, we generated a triple mutant variant that may structurally constitute a novel phenolic substrate binding pocket, leading to its high binding affinity and catalytic efficiency on monolignols. The 4-O-methoxylation of monolignol efficiently impairs oxidative radical coupling in vitro, highlighting the potential for applying this novel enzyme in managing lignin polymerization in planta.

  19. Phylogenetic relationships of Salmonella based on rRNA sequences

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    To establish the phylogenetic relationships between the subspecies of Salmonella enterica (official name Salmonella choleraesuis), Salmonella bongori and related members of Enterobacteriaceae, sequence comparison of rRNA was performed by maximum-likelihood analysis. The two Salmonella species were...

  20. RNA:(guanine-N2) methyltransferases RsmC/RsmD and their homologs revisited – bioinformatic analysis and prediction of the active site based on the uncharacterized Mj0882 protein structure

    Rychlewski Leszek; Bujnicki Janusz M

    2002-01-01

    Abstract Background Escherichia coli guanine-N2 (m2G) methyltransferases (MTases) RsmC and RsmD modify nucleosides G1207 and G966 of 16S rRNA. They possess a common MTase domain in the C-terminus and a variable region in the N-terminus. Their C-terminal domain is related to the YbiN family of hypothetical MTases, but nothing is known about the structure or function of the N-terminal domain. Results Using a combination of sequence database searches and fold recognition methods it has been demo...

  1. Molecular identification of carnosine N-methyltransferase as chicken histamine N-methyltransferase-like protein (hnmt-like.

    Jakub Drozak

    Full Text Available Anserine (beta-alanyl-N(Pi-methyl-L-histidine, a naturally occurring derivative of carnosine (beta-alanyl-L-histidine, is an abundant constituent of skeletal muscles and brain of many vertebrates. Although it has long been proposed to serve as a proton buffer, radicals scavenger and transglycating agent, its physiological function remains obscure. The formation of anserine is catalyzed by carnosine N-methyltransferase which exhibits unknown molecular identity. In the present investigation, we have purified carnosine N-methyltransferase from chicken pectoral muscle about 640-fold until three major polypeptides of about 23, 26 and 37 kDa coeluting with the enzyme were identified in the preparation. Mass spectrometry analysis of these polypeptides resulted in an identification of histamine N-methyltransferase-like (HNMT-like protein as the only meaningful candidate. Analysis of GenBank database records indicated that the hnmt-like gene might be a paralogue of histamine N-methyltransferase gene, while comparison of their protein sequences suggested that HNMT-like protein might have acquired a new activity. Chicken HNMT-like protein was expressed in COS-7 cells, purified to homogeneity, and shown to catalyze the formation of anserine as confirmed by both chromatographic and mass spectrometry analysis. Both specificity and kinetic studies carried out on the native and recombinant enzyme were in agreement with published data. Particularly, several compounds structurally related to carnosine, including histamine and L-histidine, were tested as potential substrates for the enzyme, and carnosine was the only methyl group acceptor. The identification of the gene encoding carnosine N-methyltransferase might be beneficial for estimation of the biological functions of anserine.

  2. The 11S → 23S and 11S → 13P excitation of helium by electron impact

    The R-matrix method calculations of Berrington et al (J. Phys. B.; 8: 1459 (1975)) and Fon et al (J. Phys. B.; 11: 325 (1978)) are extended to the calculation of the integrated and differential cross sections for electron excitation of the ground-state helium atom to the 23S and 23P states in the energy ranges (21.4 <= E <= 30 eV) and (80 <= E <= 200 eV). For intermediate energies (30 <= E <= 80 eV) pseudo-resonances arise which make accurate cross sections difficult to calculate and this region is therefore not considered. The calculations are compared with recent theoretical calculations and experimental measurements. (author)

  3. Functional Role of G9a Histone Methyltransferase in Cancer

    Casciello, Francesco; Windloch, Karolina; Gannon, Frank; Lee, Jason S.

    2015-01-01

    Post-translational modifications of DNA and histones are epigenetic mechanisms, which affect the chromatin structure, ultimately leading to gene expression changes. A number of different epigenetic enzymes are actively involved in the addition or the removal of various covalent modifications, which include acetylation, methylation, phosphorylation, ubiquitination, and sumoylation. Deregulation of these processes is a hallmark of cancer. For instance, G9a, a histone methyltransferase responsib...

  4. Epigenetic Regulation of Autophagy by the Methyltransferase G9a

    Artal-Martinez de Narvajas, Amaia; Gomez, Timothy S.; Zhang, Jin-San; Mann, Alexander O.; Taoda, Yoshiyuki; Gorman, Jacquelyn A.; Herreros-Villanueva, Marta; Gress, Thomas M; Ellenrieder, Volker; Bujanda, Luis; Kim, Do-Hyung; Kozikowski, Alan P.; Koenig, Alexander; Billadeau, Daniel D.

    2013-01-01

    Macroautophagy is an evolutionarily conserved cellular process involved in the clearance of proteins and organelles. Although the cytoplasmic machinery that orchestrates autophagy induction during starvation, hypoxia, or receptor stimulation has been widely studied, the key epigenetic events that initiate and maintain the autophagy process remain unknown. Here we show that the methyltransferase G9a coordinates the transcriptional activation of key regulators of autophagosome formation by remo...

  5. Histamine N-methyltransferase Modulates Human Bronchial Smooth Muscle Contraction

    Tamaoki, J.; Chiyotani, A.; Tagaya, E; Isono, K; Konno, K

    1994-01-01

    To elucidate the modulatory role of histamine-degrading enzymes in airway constrictor responses, human bronchial strips were studied under isometric conditions in vitro. Pretreatment of tissues with the histamine N-methyltransferase (HMT) inhibitor SKF 91488 specifically potentiated the contractile responses to histamine, causing a leftward displacement of the concentration response curves, whereas the diamine oxidase inhibitor aminoguanidine had no effect. This potentiation was attenuated by...

  6. Betaine-homocysteine methyltransferase: human liver genotype-phenotype correlation

    Feng, Qiping; Kalari, Krishna; Fridley, Brooke L.; Jenkins, Gregory; Ji, Yuan; Abo, Ryan; Hebbring, Scott; Zhang, Jianping; Nye, Monica D.; Leeder, J Steven; Weinshilboum, Richard M.

    2010-01-01

    Betaine-homocysteine methyltransferase (BHMT) catalyzes the remethylation of homocysteine. BHMT is highly expressed in the human liver. In the liver, BHMT catalyzes up to 50% of homocysteine metabolism. Understanding the relationship between BHMT genetic polymorphisms and function might increase our understanding of the role of this reaction in homocysteine remethylation and in S-adenosylmethionine-dependent methylation. To help achieve those goals, we measured levels of BHMT enzyme activity ...

  7. Plant isoflavone and isoflavanone O-methyltransferase genes

    Broeckling, Bettina E.; Liu, Chang-Jun; Dixon, Richard A.

    2014-08-19

    The invention provides enzymes that encode O-methyltransferases (OMTs) from Medicago truncatula that allow modification to plant (iso)flavonoid biosynthetic pathways. In certain aspects of the invention, the genes encoding these enzymes are provided. The invention therefore allows the modification of plants for isoflavonoid content. Transgenic plants comprising such enzymes are also provided, as well as methods for improving disease resistance in plants. Methods for producing food and nutraceuticals, and the resulting compositions, are also provided.

  8. Structural characterization of the mitomycin 7-O-methyltransferase

    Singh, Shanteri; Chang, Aram; Goff, Randal D.; Bingman, Craig A.; Grüschow, Sabine; Sherman, David H.; Phillips, Jr., George N.; Thorson, Jon S. (Michigan); (UW)

    2014-10-02

    Mitomycins are quinone-containing antibiotics, widely used as antitumor drugs in chemotherapy. Mitomycin-7-O-methyltransferase (MmcR), a key tailoring enzyme involved in the biosynthesis of mitomycin in Streptomyces lavendulae, catalyzes the 7-O-methylation of both C9{beta}- and C9{alpha}-configured 7-hydroxymitomycins. We have determined the crystal structures of the MmcR-S-adenosylhomocysteine (SAH) binary complex and MmcR-SAH-mitomycin A (MMA) ternary complex at resolutions of 1.9 and 2.3 {angstrom}, respectively. The study revealed MmcR to adopt a common S-adenosyl-L-methionine-dependent O-methyltransferase fold and the presence of a structurally conserved active site general acid-base pair is consistent with a proton-assisted methyltransfer common to most methyltransferases. Given the importance of C7 alkylation to modulate mitomycin redox potential, this study may also present a template toward the future engineering of catalysts to generate uniquely bioactive mitomycins.

  9. DNA repair methyltransferase (Mgmt) knockout mice are sensitive to the lethal effects of chemotherapeutic alkylating agents.

    Glassner, Brian; Weeda, Geert; Allan, James; Broekhof, Jose'; Carls, Nick; Donker, Ingrid; Engelward, Bevin; Hampson, Richard; Hersmus, Remko; Hickman, Mark; Roth, Richard; Warren, Henry; Wu, Mavis; Hoeijmakers, Jan; Samson, Leona

    1999-01-01

    textabstractWe have generated mice deficient in O6-methylguanine DNA methyltransferase activity encoded by the murine Mgmt gene using homologous recombination to delete the region encoding the Mgmt active site cysteine. Tissues from Mgmt null mice displayed very low O6-methylguanine DNA methyltransferase activity, suggesting that Mgmt constitutes the major, if not the only, O6-methylguanine DNA methyltransferase. Primary mouse embryo fibroblasts and bone marrow cells from Mgmt -/- mice were s...

  10. Molecular Mechanism of Action of Plant DRM De Novo DNA Methyltransferases

    Zhong, Xuehua; Du, Jiamu; Hale, Christopher J.; Gallego-Bartolome, Javier; Feng, Suhua; Vashisht, Ajay A.; Chory, Joanne; Wohlschlegel, James A.; Patel, Dinshaw J.; Jacobsen, Steven E.

    2014-01-01

    DNA methylation is a conserved epigenetic gene regulation mechanism. DOMAINS REARRANGED METHYLTRANSFERASE (DRM) is a key de novo methyltransferase in plants, but how DRM acts mechanistically is poorly understood. Here, we report the crystal structure of the methyltransferase domain of tobacco DRM (NtDRM) and reveal a molecular basis for its rearranged structure. NtDRM forms a functional homo-dimer critical for catalytic activity. We also show that Arabidopsis DRM2 exists in complex with the s...

  11. Polarized 3He ion source for the Van de Graaff based on the 23S1 state of helium

    We have reached an important stage in the construction of a source of polarized 3He ions since the end of June, 1981, when a grant was received for its construction. The production of an intense beam of metastables in the 23S1 state has been achieved, as well as Stern-Gerlach separation. We have set up a method of recirculating gas in the metastable production step, which permits the operation of the polarized ion source in the same way as an ordinary ion source. The design of the adiabatic transition according to the method of Abragam and Winter was prepared. We are now studying ionization methods. The fact that the ionization potential is very low allows us to envisage nontraditional methods for this type of ion source. These methods permit high ionization efficiency. The objective set out at the beginning, a source of polarized 3He ions producing 100 nA-Particle with a polarization of 80 percent will be surpassed easily by our source

  12. rRNA fragmentation induced by a yeast killer toxin.

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  13. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S.; McBee, Megan E.; Dedon, Peter C.

    2014-01-01

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and...

  14. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

    2013-11-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  15. Modified nucleotides m(2)G966/m(5)C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon.

    Prokhorova, Irina V; Osterman, Ilya A; Burakovsky, Dmitry E; Serebryakova, Marina V; Galyamina, Maria A; Pobeguts, Olga V; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G; Govorun, Vadim M; Bogdanov, Alexey A; Sergiev, Petr V; Dontsova, Olga A

    2013-01-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show--using proteomic analysis and dual fluorescence reporter in vivo assays--that m(2)G966 and m(5)C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m(2)G966 and m(5)C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon. PMID:24241179

  16. Structural Biology of Human H3K9 Methyltransferases

    Wu, H.; Min, J; Lunin, V; Antoshenko, T; Dombrovsk, L; Zeng, H; Allali-Hassani, A; Campagna-Slater, V; Vedadi, M; et. al.

    2010-01-01

    SET domain methyltransferases deposit methyl marks on specific histone tail lysine residues and play a major role in epigenetic regulation of gene transcription. We solved the structures of the catalytic domains of GLP, G9a, Suv39H2 and PRDM2, four of the eight known human H3K9 methyltransferases in their apo conformation or in complex with the methyl donating cofactor, and peptide substrates. We analyzed the structural determinants for methylation state specificity, and designed a G9a mutant able to tri-methylate H3K9. We show that the I-SET domain acts as a rigid docking platform, while induced-fit of the Post-SET domain is necessary to achieve a catalytically competent conformation. We also propose a model where long-range electrostatics bring enzyme and histone substrate together, while the presence of an arginine upstream of the target lysine is critical for binding and specificity. Post-translational modifications of histone proteins regulate chromatin compaction, mediate epigenetic regulation of transcription, and control cellular differentiation in health and disease. Methylation of histone tails is one of the fundamental events of epigenetic signaling. Tri-methylation of lysine 9 of histone 3 (H3K9) mediates chromatin recruitment of HP1, heterochromatin condensation and gene silencing. Similarly, methylation of H3K27 and H4K20 are associated with a repressed state of chromatin, whereas expressed genes are methylated at H3K4, H3K36 and H3K79. Histone methyltransferases are divided into protein arginine methyltransferases (PRMTs) and histone lysine methyltransferases (HKMTs). HKMTs catalyze the transfer of a methyl group from the co-factor S-adenosyl-L-methionine (SAM) to a substrate lysine and, with the exception of DOT1L, are all organized around a canonical SET domain. The structures of a number of HKMTs have been reported, including ternary complexes of human orthologs with co-factor and substrate peptides (SETD7-H3K4, SETD8-H4K20 and MLL1-H3K4), as well

  17. A SABATH Methyltransferase from the moss Physcomitrella patens catalyzes

    Zhao, Nan [ORNL; Ferrer, Jean-Luc [Universite Joseph Fourier, France; Moon, Hong S [Department of Plant Sciences, University of Tennessee; Kapteyn, Jeremy [Institute of Biological Chemistry, Washington State University; Zhuang, Xiaofeng [Department of Plant Sciences, University of Tennessee; Hasebe, Mitsuyasu [Laboratory of Evolutionary Biology, National Institute for Biology, 38 Nishigounaka; Stewart, Neal C. [Department of Plant Sciences, University of Tennessee; Gang, David R. [Institute of Biological Chemistry, Washington State University; Chen, Feng [University of Tennessee, Knoxville (UTK)

    2012-01-01

    Known SABATH methyltransferases, all of which were identified from seed plants, catalyze methylation of either the carboxyl group of a variety of low molecular weight metabolites or the nitrogen moiety of precursors of caffeine. In this study, the SABATH family from the bryophyte Physcomitrella patens was identified and characterized. Four SABATH-like sequences (PpSABATH1, PpSABATH2, PpSABATH3, and PpSABATH4) were identified from the P. patens genome. Only PpSABATH1 and PpSABATH2 showed expression in the leafy gametophyte of P. patens. Full-length cDNAs of PpSABATH1 and PpSABATH2 were cloned and expressed in soluble form in Escherichia coli. Recombinant PpSABATH1 and PpSABATH2 were tested for methyltransferase activity with a total of 75 compounds. While showing no activity with carboxylic acids or nitrogen-containing compounds, PpSABATH1 displayed methyltransferase activity with a number of thiols. PpSABATH2 did not show activity with any of the compounds tested. Among the thiols analyzed, PpSABATH1 showed the highest level of activity with thiobenzoic acid with an apparent Km value of 95.5 lM, which is comparable to those of known SABATHs. Using thiobenzoic acid as substrate, GC MS analysis indicated that the methylation catalyzed by PpSABATH1 is on the sulfur atom. The mechanism for S-methylation of thiols catalyzed by PpSABATH1 was partially revealed by homology-based structural modeling. The expression of PpSABATH1 was induced by the treatment of thiobenzoic acid. Further transgenic studies showed that tobacco plants overexpressing PpSABATH1 exhibited enhanced tolerance to thiobenzoic acid, suggesting that PpSABATH1 have a role in the detoxification of xenobiotic thiols.

  18. Archease from Pyrococcus abyssi improves substrate specificity and solubility of a tRNA m5C methyltransferase

    Auxilien, Sylvie; El Khadali, Fatima; Rasmussen, Anette;

    2007-01-01

    reading frame (PAB1947), which is shown here to encode a tRNA m(5)C methyltransferase. In vitro, the purified recombinant methyltransferase catalyzes m(5)C formation at several cytosines within tRNAs with preference for C49. The specificity of the methyltransferase is increased by the archease...

  19. Human placental DNA methyltransferase: DNA substrate and DNA binding specificity.

    Wang, R.Y.; Huang, L. H.; Ehrlich, M

    1984-01-01

    We have partially purified a DNA methyltransferase from human placenta using a novel substrate for a highly sensitive assay of methylation of hemimethylated DNA. This substrate was prepared by extensive nick translation of bacteriophage XP12 DNA, which normally has virtually all of its cytosine residues replaced by 5-methylcytosine (m5C). Micrococcus luteus DNA was just as good a substrate if it was first similarly nick translated with m5dCTP instead of dCTP in the polymerization mixture. At ...

  20. Expanding Cofactor Repertoire of Protein Lysine Methyltransferase for Substrate Labeling

    Islam, Kabirul; Zheng, Weihong; Yu, Haiqiang; Deng, Haiteng; Luo, Minkui

    2011-01-01

    Protein lysine methyltransferases (PKMTs) play crucial roles in normal physiology and disease processes. Profiling PKMT targets is an important but challenging task. With cancer-relevant G9a as a target, we have demonstrated the success in developing S-adenosyl-L-methionine (SAM) analogues, particularly (E)-hex-2-en-5-ynyl SAM (Hey-SAM), as cofactors for engineered G9a. Hey-SAM analogue in combination with G9a Y1154A mutant modifies the same set of substrates as their native counterparts with...

  1. Purification and characterization of DNA methyltransferases from Neisseria gonorrhoeae.

    Piekarowicz, A; Yuan, R.; Stein, D C

    1988-01-01

    Three DNA methyltransferases, M.NgoAI, and M.NgoBI and M.NgoBII, free of any nuclease activities were isolated from Neisseria gonorrhoeae strains WR220 and MUG116 respectively. M.NgoAI recognizes the sequence 5' GGCC 3' and methylates the first 5' cytosine on both strands. M.NgoBI and M.NgoBII recognize 5' TCACC 3' and 5' GTAN5CTC 3' respectively. M.NgoBII methylates cytosine on only one strand to produce 5' GTAN5mCTC 3'.

  2. High level expression and purification of HhaI methyltransferase.

    Wu, J. C.; Santi, D V

    1988-01-01

    A cloning system for the DNA-(cytosine-5)-methyltransferase MHhaI and high level expression of the enzyme are described. A parent plasmid was constructed from fragments of the MHhaI gene and synthetic oligonucleotides. The construct permits introduction of various restriction sites for cloning at precise positions near the initiation codon, and beyond the termination codon. The entire MHhaI coding sequence was introduced as a 1042 b.p. NdeI-XbaI fragment into the vector pAR3040 which contains...

  3. Catalytic site remodelling of the DOT1L methyltransferase by selective inhibitors

    Yu, Wenyu [Univ. of Toronto, ON (Canada); Chory, Emma J. [Dana-Farber Cancer Inst., Boston, MA (United States); Northeastern Univ., Boston, MA (United States); Wernimont, Amy K. [Univ. of Toronto, ON (Canada); Tempel, Wolfram [Univ. of Toronto, ON (Canada); Scopton, Alex [Univ. of Toronto, ON (Canada); Federation, Alexander [Dana-Farber Cancer Inst., Boston, MA (United States); Marineau, Jason J. [Dana-Farber Cancer Inst., Boston, MA (United States); Qi, Jun [Dana-Farber Cancer Inst., Boston, MA (United States); Barsyte-Lovejoy, Dalia [Univ. of Toronto, ON (Canada); Yi, Joanna [Dana-Farber Cancer Inst., Boston, MA (United States); Marcellus, Richard [Ontario Inst. for Cancer Research, Toronto, ON (Canada); Iacob, Roxana E. [Northeastern Univ., Boston, MA (United States); Engen, John R. [Northeastern Univ., Boston, MA (United States); Griffin, Carly [Ontario Inst. for Cancer Research, Toronto, ON (Canada); Aman, Ahmed [Ontario Inst. for Cancer Research, Toronto, ON (Canada); Wienholds, Erno [Univ. of Toronto, ON (Canada); Li, Fengling [Univ. of Toronto, ON (Canada); Pineda, Javier [Dana-Farber Cancer Inst., Boston, MA (United States); Univ. of Notre Dame, IN (United States); Estiu, Guillermina [Univ. of Notre Dame, IN (United States); Shatseva, Tatiana [Univ. of Toronto, ON (Canada); Hajian, Taraneh [Univ. of Toronto, ON (Canada); Al-awar, Rima [Ontario Inst. for Cancer Research, Toronto, ON (Canada); Dick, John E. [Univ. of Toronto, ON (Canada); Vedadi, Masoud [Univ. of Toronto, ON (Canada); Brown, Peter J. [Univ. of Toronto, ON (Canada); Arrowsmith, Cheryl H. [Univ. of Toronto, ON (Canada); Bradner, James E. [Dana-Farber Cancer Inst., Boston, MA (United States); Harvard Medical School, Boston, MA (United States); Schapira, Matthieu [Univ. of Toronto, ON (Canada)

    2012-12-18

    Selective inhibition of protein methyltransferases is a promising new approach to drug discovery. An attractive strategy towards this goal is the development of compounds that selectively inhibit binding of the cofactor, S-adenosylmethionine, within specific protein methyltransferases. Here we report the three-dimensional structure of the protein methyltransferase DOT1L bound toEPZ004777, the first S-adenosylmethionine-competitive inhibitor of a protein methyltransferase with in vivo efficacy. This structure and those of four new analogues reveal remodelling of the catalytic site. EPZ004777 and a brominated analogue, SGC0946, inhibit DOT1L in vitro and selectively kill mixed lineage leukaemia cells, in which DOT1L is aberrantly localized via interaction with an oncogenic MLL fusion protein. These data provide important new insight into mechanisms of cell-active S-adenosylmethionine-competitive protein methyltransferase inhibitors, and establish a foundation for the further development of drug-like inhibitors of DOT1L for cancer therapy.

  4. Lipid substrate specificity of phosphatidylethanolamine N-methyltransferase of Tetrahymena

    The ciliate protozoan Tetrahymena thermophila forms about 60% of its phosphatidylcholine by methylation of phosphatidylethanolamine with S-adenosylmethionine using the enzyme phosphatidylethanolamine N-methyltransferase. Analogues of ethanolamine or of ethanolamine phosphate are incorporated into the phospholipids of Tetrahymena when cells are cultured in their presence. These compounds, 3-amino-1-propanol, 2-aminoethylphosphonate, 3-aminopropylphosphonate and N,N-dimethylaminoethylphosphonate replace from 50 to 75% of the ethanolamine phosphate in phosphatidylethanolamine. However, analysis of the phospholipids of lipid-altered Tetrahymena showed that none of the phosphatidylethanolamine analogues had been converted to the corresponding phosphatidylcholine analogue. No incorration of [14C-CH3]methionine into the phosphatidylcholine analogues could be demonstrated in vivo, nor was label from [3H-CH3]S-adenosylmethionine incorporated in virto. Thus, only phosphatidylethanolamine and its monomethyl and dimethyl derivatives have been found to be substrates for the phosphatidylethanoiamine N-methyltransferase. The enzyme therefore requires a phospholipid substrate containing an ester linkage between the alkylamine and phosphorus, with the amino group required to be β to the alcohol

  5. Hypnotizability and Catechol-O-Methyltransferase (COMT polymorphysms in Italians

    Alessandro Gialluisi

    2014-01-01

    Full Text Available Higher brain dopamine content depending on lower activity of Catechol-O-Methyltransferase (COMT in subjects with high hypnotisability scores (highs has been considered responsible for their attentional characteristics. However, the results of the previous genetic studies on association between hypnotisability and the Catechol-O-Methyltransferase (COMT single nucleotide polymorphism (SNP rs4680 (Val158Met were inconsistent. Here, we used a selective genotyping approach to re-evaluate the association between hypnotisability and COMT in the context of a two-SNP haplotype analysis, considering not only the Val158Met polymorphism, but also the closely located rs4818 SNP. An Italian sample of 53 highs, 49 low hypnotizable subjects (lows and 57 controls, were genotyped for a segment of 805 bp of the COMT gene, including Val158Met and the closely located rs4818 SNP. Our selective genotyping approach had 97.1% power to detect the previously reported strongest association at the significance level of 5%. We found no evidence of association at the SNP, haplotype and diplotype levels. Thus, our results challenge the dopamine-based theory of hypnosis and indirectly support recent neuropsychological and neurophysiological findings reporting the lack of any association between hypnotisability and focused attention abilities.

  6. Structural biology of human H3K9 methyltransferases.

    Hong Wu

    Full Text Available UNLABELLED: SET domain methyltransferases deposit methyl marks on specific histone tail lysine residues and play a major role in epigenetic regulation of gene transcription. We solved the structures of the catalytic domains of GLP, G9a, Suv39H2 and PRDM2, four of the eight known human H3K9 methyltransferases in their apo conformation or in complex with the methyl donating cofactor, and peptide substrates. We analyzed the structural determinants for methylation state specificity, and designed a G9a mutant able to tri-methylate H3K9. We show that the I-SET domain acts as a rigid docking platform, while induced-fit of the Post-SET domain is necessary to achieve a catalytically competent conformation. We also propose a model where long-range electrostatics bring enzyme and histone substrate together, while the presence of an arginine upstream of the target lysine is critical for binding and specificity. ENHANCED VERSION: This article can also be viewed as an enhanced version in which the text of the article is integrated with interactive 3D representations and animated transitions. Please note that a web plugin is required to access this enhanced functionality. Instructions for the installation and use of the web plugin are available in Text S1.

  7. Intrinsic resistance to aminoglycosides in Enterococcus faecium is conferred by the 16S rRNA m5C1404-specific methyltransferase EfmM

    Galimand, Marc; Schmitt, Emmanuelle; Panvert, Michel; Desmolaize, Benoît; Douthwaite, Stephen Roger; Mechulam, Yves; Courvalin, Patrice

    2011-01-01

    Aminoglycosides are ribosome-targeting antibiotics and a major drug group of choice in the treatment of serious enterococcal infections. Here we show that aminoglycoside resistance in Enterococcus faecium strain CIP 54-32 is conferred by the chromosomal gene efmM, encoding the E. faecium methyltr......Aminoglycosides are ribosome-targeting antibiotics and a major drug group of choice in the treatment of serious enterococcal infections. Here we show that aminoglycoside resistance in Enterococcus faecium strain CIP 54-32 is conferred by the chromosomal gene efmM, encoding the E. faecium...... locations are required for catalysis. The tertiary structure of EfmM is highly similar to that of RsmF, consistent with m(5)C formation at adjacent sites on the 30S subunit, while distinctive structural features account for the enzymes' respective specificities for nucleotides C1404 and C1407....

  8. Higher-order structure in the 3'-terminal domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus

    Garrett, R A; Christensen, A; Douthwaite, S

    1984-01-01

    ribonuclease from Naja naja oxiana, and the relatively unstructured and accessible sequences were detected with the single-strand-specific ribonucleases A, T1 and T2. The data enabled the three secondary structural models, proposed for the E. coli 23 S RNAs, to be examined critically and it was concluded that......An experimental approach was used to determine, and compare, the higher-order structure within domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus. This domain, which encompasses approximately 300 nucleotides at the 3' end of the RNAs, consists of two large...... ribosomes of flowering plants. The structure of domain VI within the eubacterial RNAs was probed with chemical reagents in order to establish the degree of stacking and/or accessibility of each adenosine, cytidine and guanosine residue; the double-helical segments were localized with the cobra venom...

  9. Identification of Clinically Relevant Nonhemolytic Streptococci on the Basis of Sequence Analysis of 16S-23S Intergenic Spacer Region and Partial gdh Gene▿

    Nielsen, Xiaohui Chen; Justesen, Ulrik Stenz; Dargis, Rimtas; Kemp, Michael; Christensen, Jens Jørgen

    2009-01-01

    Nonhemolytic streptococci (NHS) cause serious infections, such as endocarditis and septicemia. Many conventional phenotypic methods are insufficient for the identification of bacteria in this group to the species level. Genetic analysis has revealed that single-gene analysis is insufficient for the identification of all species in this group of bacteria. The aim of the present study was to establish a method based on sequence analysis of the 16S-23S intergenic spacer (ITS) region and the part...

  10. An audit of thiopurine methyltransferase genotyping and phenotyping before intended azathioprine treatment for dermatological conditions

    Vestergaard, T; Bygum, A

    2009-01-01

    Summary Background. Determining thiopurine methyltransferase (TPMT) genotype and phenotype before azathioprine treatment predicts which patients are most likely to develop myelosuppression. Aim. To evaluate the course of azathioprine treatment in people with TPMT heterozygosity and whether this d...

  11. Arsenic (+3 oxidation state) methyltransferase and the methylation of arsenicals in the invertebrate chordate Ciona intestinalis

    Biotransformation of inorganic arsenic (iAs) involves methylation catalyzed by arsenic (+3 oxidation state) methyltransferase (As3mt), yielding mono- , di- , and trimethylated arsenicals. To investigate the evolution of molecular mechanisms that mediate arsenic biotransformation,...

  12. Erythrocuyte catechol-O-methyltransferase activity in related families with schizophrenia

    Erythrocyte catechol-O-methyltransferase (COMT) activity has been analyzed in 72 individuals from 17 related families with 18 schizophrenic members. No association with any of the three COMT genotypes could be found in this pedigree. (author)

  13. “MGMT for pt mgmt”: Is Methylguanine-DNA Methyltransferase Testing Ready for Patient Management?

    Iafrate, A. John; Louis, David N.

    2008-01-01

    This Commentary reports on a robust quantitative assay for the interpretation of O6-methylguanine-DNA methyltransferase (MGMT) promoter methylation assays that should facilitate the comparison and implementation of such assays across laboratories.

  14. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  15. The RNA–Methyltransferase Misu (NSun2) Poises Epidermal Stem Cells to Differentiate

    Sandra Blanco; Agata Kurowski; Jennifer Nichols; Watt, Fiona M.; Salvador Aznar Benitah; Michaela Frye

    2011-01-01

    Homeostasis of most adult tissues is maintained by balancing stem cell self-renewal and differentiation, but whether post-transcriptional mechanisms can regulate this process is unknown. Here, we identify that an RNA methyltransferase (Misu/Nsun2) is required to balance stem cell self-renewal and differentiation in skin. In the epidermis, this methyltransferase is found in a defined sub-population of hair follicle stem cells poised to undergo lineage commitment, and its depletion results in e...

  16. Engineering the DNA cytosine-5 methyltransferase reaction for sequence-specific labeling of DNA

    Lukinavičius, Gražvydas; Lapinaitė, Audronė; Urbanavičiūtė, Giedrė; Gerasimaitė, Rūta; Klimašauskas, Saulius

    2012-01-01

    DNA methyltransferases catalyse the transfer of a methyl group from the ubiquitous cofactor S-adenosyl-L-methionine (AdoMet) onto specific target sites on DNA and play important roles in organisms from bacteria to humans. AdoMet analogs with extended propargylic side chains have been chemically produced for methyltransferase-directed transfer of activated groups (mTAG) onto DNA, although the efficiency of reactions with synthetic analogs remained low. We performed steric engineering of the co...

  17. Structure–function analysis of vaccinia virus mRNA cap (guanine-N7) methyltransferase

    Zheng, Sushuang; Shuman, Stewart

    2008-01-01

    The guanine-N7 methyltransferase domain of vaccinia virus mRNA capping enzyme is a heterodimer composed of a catalytic subunit and a stimulatory subunit. Structure–function analysis of the catalytic subunit by alanine scanning and conservative substitutions (49 mutations at 25 amino acids) identified 12 functional groups essential for methyltransferase activity in vivo, most of which were essential for cap methylation in vitro. Defects in cap binding were demonstrated for a subset of lethal m...

  18. Crystal structure of dengue virus methyltransferase without S-adenosyl-L-methionine.

    Noble, Christian G; Li, Shi-Hua; Dong, Hongping; Chew, Sock Hui; Shi, Pei-Yong

    2014-11-01

    Flavivirus methyltransferase is a genetically-validated antiviral target. Crystal structures of almost all available flavivirus methyltransferases contain S-adenosyl-L-methionine (SAM), the methyl donor molecule that co-purifies with the enzymes. This raises a possibility that SAM is an integral structural component required for the folding of dengue virus (DENV) methyltransferase. Here we exclude this possibility by solving the crystal structure of DENV methyltransferase without SAM. The SAM ligand was removed from the enzyme through a urea-mediated denaturation-and-renaturation protocol. The crystal structure of the SAM-depleted enzyme exhibits a vacant SAM-binding pocket, with a conformation identical to that of the SAM-enzyme co-crystal structure. Functionally, equivalent enzymatic activities (N-7 methylation, 2'-O methylation, and GMP-enzyme complex formation) were detected for the SAM-depleted and SAM-containing recombinant proteins. These results clearly indicate that the SAM molecule is not an essential component for the correct folding of DENV methyltransferase. Furthermore, the results imply a potential antiviral approach to search for inhibitors that can bind to the SAM-binding pocket and compete against SAM binding. To demonstrate this potential, we have soaked crystals of DENV methyltransferase without a bound SAM with the natural product Sinefungin and show that preformed crystals are capable of binding ligands in this pocket. PMID:25241250

  19. Determination of the differential cross section for electron excitation of the 23S1 state of helium near threshold via metastable time-of-flight spectra

    The differential cross section for the inelastic process He(11S0) + e- → He(23S1) + e- just above threshold. For a given detector angle and metastable atom speed there corresponds only one value of cos theta, where theta is the electron scattering angle. Since the excitation cross section for unpolarized beams is symmetric in theta, there is a one-to-one relation between atom times of flight and electron scattering angles. Since the kinematics of the problem are understood, the differential cross section can be extracted from the time-of-flight spectrum by using a computer analysis that incorporates factors such as the finite angular resolutions, the finite energy resolution of the electron gun, and the Maxwellian distribution of velocities in the ground state atomic beam. The angular range and resolution available in both conventional electron scattering experiments and in the present time-of-flight experiment show that there is considerable anisotropy in the electron distribution at energies just a few millivolts above the 19.82 eV, 23S1 threshold. Recent theoretical calculations predict that interference should be apparent, in agreement with what we observe. The total cross section for production of the 23S1 state by electron impact shows a peak near 20.4 eV that has been previously interpreted as a p-wave resonance. It is found that the cross section is most ''p-like'' at about 20.2 eV, but evidence for still more partial waves seems to appear even at this relatively low energy

  20. Attachment sites of primary binding proteins L1, L2 and L23 on 23 S ribosomal RNA of Escherichia coli

    Egebjerg, Jan; Christiansen, Jan; Garrett, Roger Antony

    1991-01-01

    The attachment sites of the primary binding proteins L1, L2 and L23 on 23 S ribosomal RNA of Escherichia coli were examined by a chemical and ribonuclease footprinting method using several probes with different specificities. The results show that the sites are confined to localized RNA regions...... within the large ribonuclease-protected ribonucleoprotein fragments that were characterized earlier. They are as follows: 1. (1) L1 recognizes a tertiary structural motif in domain V centred on two interacting internal loops; the main protein interaction sites occur at the internal loop/helix junctions.2...

  1. Applicability of the 16S-23S rDNA internal spacer for PCR detection of the phytostimulatory PGPR inoculant Azospirillum lipoferum CRT1 in field soil

    Baudoin, Ezékiel; Couillerot, O.; Spaepen, S.; Moenne-Loccoz, Y.; Nazaret, S.

    2010-01-01

    Aims: To assess the applicability of the 16S-23S rDNA internal spacer regions (ISR) as targets for PCR detection of Azospirillum ssp. and the phytostimulatory plant growth-promoting rhizobacteria seed inoculant Azospirillum lipoferum CRT1 in soil. Methods and Results: Primer sets were designed after sequence analysis of the ISR of A. lipoferum CRT1 and Azospirillum brasilense Sp245. The primers fAZO/rAZO targeting the Azospirillum genus successfully yielded PCR amplicons (400-550 bp) from Azo...

  2. High throughput 16S rRNA gene amplicon sequencing

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup;

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r...... belonging to the phylum Chloroflexi. Based on knowledge about their ecophysiology, other control measures were introduced and the bulking problem was reduced after 2 months. Besides changes in the filament abundance and composition also other changes in the microbial community were observed that likely...... correlated with the bacterial species composition in 25 Danish full-scale WWTPs with nutrient removal. Examples of properties were SVI, filament index, floc size, floc strength, content of cations and amount of extracellular polymeric substances. Multivariate statistics provided several important insights...

  3. Louse (Insecta : Phthiraptera) mitochondrial 12S rRNA secondary structure is highly variable

    Page, R.D.M.; Cruickshank, R.; Johnson, K P

    2002-01-01

    Lice are ectoparasitic insects hosted by birds and mammals. Mitochondrial 12S rRNA sequences obtained from lice show considerable length variation and are very difficult to align. We show that the louse 12S rRNA domain III secondary structure displays considerable variation compared to other insects, in both the shape and number of stems and loops. Phylogenetic trees constructed from tree edit distances between louse 12S rRNA structures do not closely resemble trees constructed from sequence ...

  4. DNA methyltransferase inhibitor CDA-II inhibits myogenic differentiation

    Highlights: ► CDA-II inhibits myogenic differentiation in a dose-dependent manner. ► CDA-II repressed expression of muscle transcription factors and structural proteins. ► CDA-II inhibited proliferation and migration of C2C12 myoblasts. -- Abstract: CDA-II (cell differentiation agent II), isolated from healthy human urine, is a DNA methyltransferase inhibitor. Previous studies indicated that CDA-II played important roles in the regulation of cell growth and certain differentiation processes. However, it has not been determined whether CDA-II affects skeletal myogenesis. In this study, we investigated effects of CDA-II treatment on skeletal muscle progenitor cell differentiation, migration and proliferation. We found that CDA-II blocked differentiation of murine myoblasts C2C12 in a dose-dependent manner. CDA-II repressed expression of muscle transcription factors, such as Myogenin and Mef2c, and structural proteins, such as myosin heavy chain (Myh3), light chain (Mylpf) and MCK. Moreover, CDA-II inhibited C1C12 cell migration and proliferation. Thus, our data provide the first evidence that CDA-II inhibits growth and differentiation of muscle progenitor cells, suggesting that the use of CDA-II might affect skeletal muscle functions.

  5. Theoretical insights into catalytic mechanism of protein arginine methyltransferase 1.

    Ruihan Zhang

    Full Text Available Protein arginine methyltransferase 1 (PRMT1, the major arginine asymmetric dimethylation enzyme in mammals, is emerging as a potential drug target for cancer and cardiovascular disease. Understanding the catalytic mechanism of PRMT1 will facilitate inhibitor design. However, detailed mechanisms of the methyl transfer process and substrate deprotonation of PRMT1 remain unclear. In this study, we present a theoretical study on PRMT1 catalyzed arginine dimethylation by employing molecular dynamics (MD simulation and quantum mechanics/molecular mechanics (QM/MM calculation. Ternary complex models, composed of PRMT1, peptide substrate, and S-adenosyl-methionine (AdoMet as cofactor, were constructed and verified by 30-ns MD simulation. The snapshots selected from the MD trajectory were applied for the QM/MM calculation. The typical SN2-favored transition states of the first and second methyl transfers were identified from the potential energy profile. Deprotonation of substrate arginine occurs immediately after methyl transfer, and the carboxylate group of E144 acts as proton acceptor. Furthermore, natural bond orbital analysis and electrostatic potential calculation showed that E144 facilitates the charge redistribution during the reaction and reduces the energy barrier. In this study, we propose the detailed mechanism of PRMT1-catalyzed asymmetric dimethylation, which increases insight on the small-molecule effectors design, and enables further investigations into the physiological function of this family.

  6. Characterization of the phospholipid methyltransferase in RBC ghost preparations

    The activity of the phospholipid methyltransferase from human RBC ghosts was studied using radio-HPLC techniques to analyze the products. Both monomethyl phosphatidyl ethanolamine (MMPE) and dimethyl phosphatidyl ethanolamine (DMPE) were used as substrated. The reaction rate was linear for 45 min. Apparent K/sub M/s of 24-28 uM and 19-21 uM were measured for these two substrates, respectively. The reaction rate was not linear with protein. It appeared to increase logarithmic. An apparent K/sub M/ for S-adenosylmethionine was 36-45 uM. These K/sub M/ values are similar to those reported by others for liver. As the concentration of MMPE was increased, the ratio of DMPE/PC also increased due largely to a greater increase in DMPE formation. Optimal reaction rates for the formation of DMPE were 0.9-1.3 pmol/mg/min, and an optimal rate of about 1.7-2.4 pmol/min/mg was measured for the conversion of DMPE to phosphatidyl choline (PC). Freezing the ghost preparation did not affect the activity of the enzyme. When no exogenous phospholipid was added to the incubation, the sum of the formation rates of all three methylated products was about 26 pmol/mg/hr. The relative amount of each product was 46% MMPE, 32% DMPE and 22% PC. When either MMPE or DMPE was added as substrate, the formation of MMPE was reduced to less than 1%

  7. Thiopurine methyltransferase activity in red blood cells of dogs.

    Kidd, Linda Benjamin; Salavaggione, Oreste E; Szumlanski, Carol L; Miller, Jackie L; Weinshilboum, Richard M; Trepanier, Lauren

    2004-01-01

    Thiopurine methyltransferase (TPMT) is an important enzyme in the metabolism of thiopurine medications such as azathioprine. In humans, activity varies widely among individuals, primarily because of genetic polymorphisms. Low TPMT activity increases the risk of myelosuppression from azathioprine and 6-mercaptopurine, whereas high TPMT activity is associated with poor drug efficacy. The purpose of this study was to determine whether dogs also show a wide range of TPMT activity. Heparinized blood samples were obtained from 177 dogs associated with a veterinary teaching hospital. Red blood cell (RBC) TPMT activity was measured by means of a modification of a radiochemical method as established for use in people. TPMT activity varied across a 9-fold range (7.9-71.8 U of RBC per milliliter; median, 21.7). Variation in TPMT activity was not associated with age, sex, or neutering status. Giant Schnauzers had much lower TPMT activity (7.9-20 U of RBC per milliliter; median, 13.1; P dogs could affect thiopurine drug toxicity and efficacy in canine patients. PMID:15058773

  8. Human erythrocyte thiol methyltransferase: radiochemical microassay and biochemical properties

    A radiochemical microassay for the measurement of thiol methyltransferase (TMT) activity in human red blood cell (RBC) membranes has been developed. Both 2-mercaptoethanol and dithiothreitol were used as substrates for the enzyme. The pH optimum of the reaction was approximately 9.0 when glycine-NaOH was used as a buffer. The apparent Michaelis-Menten (Ksub(M)) value for the methyl donor for the reaction, S-adenosyl-L-methionine, was 43 μmol/l. Human RBC TMT activity was neither activated nor inhibited by Ca2+, Mg2+, or tropolone, but the enzyme was inhibited by SKF 525A and by reagents that react with sulfhydryl grcups. The mean TMT activity in blood from 289 randomly selected adult white subjects was 10.93 +- 3.22 units per mg protein (mean +- S.D.). The activity was the same in samples from men and women. The results of experiments in which TMT activity was measured in mixtures of RBC membranes with relatively ''low'' and relatively ''high'' activities provided no evidence that individual variations in the enzyme activity were due to variations in endogenous TMT activators or inhibitors. (Auth.)

  9. Identification and functional characterization of lysine methyltransferases of Entamoeba histolytica.

    Borbolla-Vázquez, Jessica; Orozco, Esther; Medina-Gómez, Christian; Martínez-Higuera, Aarón; Javier-Reyna, Rosario; Chávez, Bibiana; Betanzos, Abigail; Rodríguez, Mario A

    2016-07-01

    Lysine methylation of histones, a posttranslational modification catalyzed by lysine methyltransferases (HKMTs), plays an important role in the epigenetic regulation of transcription. Lysine methylation of non-histone proteins also impacts the biological function of proteins. Previously it has been shown that lysine methylation of histones of Entamoeba histolytica, the protozoan parasite that infects 50 million people worldwide each year and causing up to 100,000 deaths annually, is implicated in the epigenetic machinery of this microorganism. However, the identification and characterization of HKMTs in this parasite had not yet been determined. In this work we identified four HKMTs in E. histolytica (EhHKMT1 to EhHKMT4) that are expressed by trophozoites. Enzymatic assays indicated that all of them are able to transfer methyl groups to commercial histones. EhHKMT1, EhHKMT2 and EhHKMT4 were detected in nucleus and cytoplasm of trophozoites. In addition EhHKMT2 and EhHKMT4 were located in vesicles containing ingested cells during phagocytosis, and they co-immunoprecipitated with EhADH, a protein involved in the phagocytosis of this parasite. Results suggest that E. histolytica uses its HKMTs to regulate transcription by epigenetic mechanisms, and at least two of them could also be implicated in methylation of proteins that participate in phagocytosis. PMID:27062489

  10. DNA methyltransferase inhibitor CDA-II inhibits myogenic differentiation

    Chen, Zirong [State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-Sen University, Guangzhou 510060 (China); Department of Molecular Genetics and Microbiology, Shands Cancer Center, University of Florida, Gainesville, FL 32610 (United States); Jin, Guorong [State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-Sen University, Guangzhou 510060 (China); Lin, Shuibin [Department of Molecular Genetics and Microbiology, Shands Cancer Center, University of Florida, Gainesville, FL 32610 (United States); Lin, Xiumei [Department of Hematology, Guangzhou First Municipal People' s Hospital, Guangzhou 510180 (China); Gu, Yumei [Department of Molecular Genetics and Microbiology, Shands Cancer Center, University of Florida, Gainesville, FL 32610 (United States); Zhu, Yujuan; Hu, Chengbin; Zhang, Qingjiong [State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-Sen University, Guangzhou 510060 (China); Wu, Lizi [Department of Molecular Genetics and Microbiology, Shands Cancer Center, University of Florida, Gainesville, FL 32610 (United States); Shen, Huangxuan, E-mail: shenhx@mail.sysu.edu.cn [State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-Sen University, Guangzhou 510060 (China)

    2012-06-08

    Highlights: Black-Right-Pointing-Pointer CDA-II inhibits myogenic differentiation in a dose-dependent manner. Black-Right-Pointing-Pointer CDA-II repressed expression of muscle transcription factors and structural proteins. Black-Right-Pointing-Pointer CDA-II inhibited proliferation and migration of C2C12 myoblasts. -- Abstract: CDA-II (cell differentiation agent II), isolated from healthy human urine, is a DNA methyltransferase inhibitor. Previous studies indicated that CDA-II played important roles in the regulation of cell growth and certain differentiation processes. However, it has not been determined whether CDA-II affects skeletal myogenesis. In this study, we investigated effects of CDA-II treatment on skeletal muscle progenitor cell differentiation, migration and proliferation. We found that CDA-II blocked differentiation of murine myoblasts C2C12 in a dose-dependent manner. CDA-II repressed expression of muscle transcription factors, such as Myogenin and Mef2c, and structural proteins, such as myosin heavy chain (Myh3), light chain (Mylpf) and MCK. Moreover, CDA-II inhibited C1C12 cell migration and proliferation. Thus, our data provide the first evidence that CDA-II inhibits growth and differentiation of muscle progenitor cells, suggesting that the use of CDA-II might affect skeletal muscle functions.

  11. A Picrinine N-Methyltransferase Belongs to a New Family of γ-Tocopherol-Like Methyltransferases Found in Medicinal Plants That Make Biologically Active Monoterpenoid Indole Alkaloids.

    Levac, Dylan; Cázares, Paulo; Yu, Fang; De Luca, Vincenzo

    2016-04-01

    Members of the Apocynaceae plant family produce a large number of monoterpenoid indole alkaloids (MIAs) with different substitution patterns that are responsible for their various biological activities. A novel N-methyltransferase involved in the vindoline pathway in Catharanthus roseus showing distinct similarity to γ-tocopherol C-methyltransferases was used in a bioinformatic screen of transcriptomes from Vinca minor, Rauvolfia serpentina, and C. roseus to identify 10 γ-tocopherol-like N-methyltransferases from a large annotated transcriptome database of different MIA-producing plant species (www.phytometasyn.ca). The biochemical function of two members of this group cloned from V. minor (VmPiNMT) and R. serpentina (RsPiNMT) have been characterized by screening their biochemical activities against potential MIA substrates harvested from the leaf surfaces of MIA-accumulating plants. The approach was validated by identifying the MIA picrinine from leaf surfaces of Amsonia hubrichtii as a substrate of VmPiNMT and RsPiNMT. Recombinant proteins were shown to have high substrate specificity and affinity for picrinine, converting it to N-methylpicrinine (ervincine). Developmental studies with V. minor and R. serpentina showed that RsPiNMT and VmPiNMT gene expression and biochemical activities were highest in younger leaf tissues. The assembly of at least 150 known N-methylated MIAs within members of the Apocynaceae family may have occurred as a result of the evolution of the γ-tocopherol-like N-methyltransferase family from γ-tocopherol methyltransferases. PMID:26848097

  12. Measurement of metastable He*(23S1) density in dielectric barrier discharges with two different configurations operating at around atmospheric pressure

    We have measured the density of metastable He atoms in the lowest triplet state (23S1) with a diode-laser absorption spectroscopic technique in atmospheric pressure plasmas produced by dielectric barrier discharge schemes. Two different types of electrode configuration are employed: one is a conventional parallel-plate system and the other is a microdischarge integrated system with stacked metal-mesh electrodes covered by insulating films. We have analyzed the pressure-broadened spectral line corresponding to the 23S1→23PJ (J=0-2) transition to derive the broadening coefficient and to calibrate absolute densities. The measured density ranges from 1011 to 1012 cm-3, but the values in the mesh-type system are larger than those in the parallel-plate system by about one order of magnitude. The density, however, depends strongly on the gas flow rate, showing the influence of quenching by the Penning-ionization process with impurities. Those behaviors are consistent with the variation of the electron density estimated by millimeter-wave transmittance measurement

  13. An enzyme-coupled continuous spectrophotometric assay for S-adenosylmethionine-dependent methyltransferases.

    Dorgan, Kathleen M; Wooderchak, Whitney L; Wynn, Donraphael P; Karschner, Erin L; Alfaro, Joshua F; Cui, Yinqiu; Zhou, Zhaohui Sunny; Hevel, Joan M

    2006-03-15

    Modification of small molecules and proteins by methyltransferases affects a wide range of biological processes. Here, we report an enzyme-coupled continuous spectrophotometric assay to quantitatively characterize S-adenosyl-L-methionine (AdoMet/SAM)-dependent methyltransferase activity. In this assay, S-adenosyl-L-homocysteine (AdoHcy/SAH), the transmethylation product of AdoMet-dependent methyltransferases, is hydrolyzed to S-ribosylhomocysteine and adenine by recombinant S-adenosylhomocysteine/5'-methylthioadenosine nucleosidase (SAHN/MTAN, EC 3.2.2.9). Subsequently, adenine generated from AdoHcy is further hydrolyzed to hypoxanthine and ammonia by recombinant adenine deaminase (EC 3.5.4.2). This deamination is associated with a decrease in absorbance at 265 nm that can be monitored continuously. Coupling enzymes are recombinant and easily purified. The utility of this assay was shown using recombinant rat protein arginine N-methyltransferase 1 (PRMT1, EC 2.1.1.125), which catalyzes the mono- and dimethylation of guanidino nitrogens of arginine residues in select proteins. Using this assay, the kinetic parameters of PRMT1 with three synthetic peptides were determined. An advantage of this assay is the destruction of AdoHcy by AdoHcy nucleosidase, which alleviates AdoHcy product feedback inhibition of S-adenosylmethionine-dependent methyltransferases. Finally, this method may be used to assay other enzymes that produce AdoHcy, 5'-methylthioadenosine, or compounds that can be cleaved by AdoHcy nucleosidase. PMID:16460659

  14. Conservation and Functional Importance of Carbon-Oxygen Hydrogen Bonding in AdoMet-Dependent Methyltransferases

    Horowitz, Scott; Dirk, Lynnette M.A.; Yesselman, Joseph D.; Nimtz, Jennifer S.; Adhikari, Upendra; Mehl, Ryan A.; Scheiner, Steve; Houtz, Robert L.; Al-Hashimi, Hashim M.; Trievel, Raymond C. [Oregon State U.; (Michigan); (Utah SU); (HHMI); (Kentucky)

    2013-09-06

    S-Adenosylmethionine (AdoMet)-based methylation is integral to metabolism and signaling. AdoMet-dependent methyltransferases belong to multiple distinct classes and share a catalytic mechanism that arose through convergent evolution; however, fundamental determinants underlying this shared methyl transfer mechanism remain undefined. A survey of high-resolution crystal structures reveals that unconventional carbon–oxygen (CH···O) hydrogen bonds coordinate the AdoMet methyl group in different methyltransferases irrespective of their class, active site structure, or cofactor binding conformation. Corroborating these observations, quantum chemistry calculations demonstrate that these charged interactions formed by the AdoMet sulfonium cation are stronger than typical CH···O hydrogen bonds. Biochemical and structural studies using a model lysine methyltransferase and an active site mutant that abolishes CH···O hydrogen bonding to AdoMet illustrate that these interactions are important for high-affinity AdoMet binding and transition-state stabilization. Further, crystallographic and NMR dynamics experiments of the wild-type enzyme demonstrate that the CH···O hydrogen bonds constrain the motion of the AdoMet methyl group, potentially facilitating its alignment during catalysis. Collectively, the experimental findings with the model methyltransferase and structural survey imply that methyl CH···O hydrogen bonding represents a convergent evolutionary feature of AdoMet-dependent methyltransferases, mediating a universal mechanism for methyl transfer.

  15. Methyltransferases mediate cell memory of a genotoxic insult.

    Rugo, R E; Mutamba, J T; Mohan, K N; Yee, T; Chaillet, J R; Greenberger, J S; Engelward, B P

    2011-02-10

    Characterization of the direct effects of DNA-damaging agents shows how DNA lesions lead to specific mutations. Yet, serum from Hiroshima survivors, Chernobyl liquidators and radiotherapy patients can induce a clastogenic effect on naive cells, showing indirect induction of genomic instability that persists years after exposure. Such indirect effects are not restricted to ionizing radiation, as chemical genotoxins also induce heritable and transmissible genomic instability phenotypes. Although such indirect induction of genomic instability is well described, the underlying mechanism has remained enigmatic. Here, we show that mouse embryonic stem cells exposed to γ-radiation bear the effects of the insult for weeks. Specifically, conditioned media from the progeny of exposed cells can induce DNA damage and homologous recombination in naive cells. Notably, cells exposed to conditioned media also elicit a genome-destabilizing effect on their neighbouring cells, thus demonstrating transmission of genomic instability. Moreover, we show that the underlying basis for the memory of an insult is completely dependent on two of the major DNA cytosine methyltransferases, Dnmt1 and Dnmt3a. Targeted disruption of these genes in exposed cells completely eliminates transmission of genomic instability. Furthermore, transient inactivation of Dnmt1, using a tet-suppressible allele, clears the memory of the insult, thus protecting neighbouring cells from indirect induction of genomic instability. We have thus demonstrated that a single exposure can lead to long-term, genome-destabilizing effects that spread from cell to cell, and we provide a specific molecular mechanism for these persistent bystander effects. Collectively, our results impact the current understanding of risks from toxin exposures and suggest modes of intervention for suppressing genomic instability in people exposed to carcinogenic genotoxins. PMID:21057543

  16. Catechol-O-methyltransferase, dopamine, and sleep-wake regulation.

    Dauvilliers, Yves; Tafti, Mehdi; Landolt, Hans Peter

    2015-08-01

    Sleep and sleep disorders are complex and highly variable phenotypes regulated by many genes and environment. The catechol-O-methyltransferase (COMT) gene is an interesting candidate, being one of the major mammalian enzymes involved in the catabolism of catecholamines. The activity of COMT enzyme is genetically polymorphic due to a guanine-to-adenine transition at codon 158, resulting in a valine (Val) to methionine (Met) substitution. Individuals homozygous for the Val allele show higher COMT activity, and lower dopaminergic signaling in prefrontal cortex (PFC) than subjects homozygous for the Met allele. Since COMT has a crucial role in metabolising dopamine, it was suggested that the common functional polymorphism in the COMT gene impacts on cognitive function related to PFC, sleep-wake regulation, and potentially on sleep pathologies. The COMT Val158Met polymorphism may predict inter-individual differences in brain electroencephalography (EEG) alpha oscillations and recovery processes resulting from partial sleep loss in healthy individuals. The Val158Met polymorphism also exerts a sexual dimorphism and has a strong effect on objective daytime sleepiness in patients with narcolepsy-cataplexy. Since the COMT enzyme inactivates catecholamines, it was hypothesized that the response to stimulant drugs differs between COMT genotypes. Modafinil maintained executive functioning performance and vigilant attention throughout sleep deprivation in subjects with Val/Val genotype, but less in those with Met/Met genotype. Also, homozygous Met/Met patients with narcolepsy responded to lower doses of modafinil compared to Val/Val carriers. We review here the critical role of the common functional COMT gene polymorphism, COMT enzyme activity, and the prefrontal dopamine levels in the regulation of sleep and wakefulness in normal subjects, in narcolepsy and other sleep-related disorders, and its impact on the response to psychostimulants. PMID:25466290

  17. Demonstration of thiopurine methyltransferase activity in the erythrocytes of cats.

    Foster, A P; Shaw, S E; Duley, J A; Shobowale-Bakre, E M; Harbour, D A

    2000-01-01

    Azathioprine is a purine analogue used as an immunosuppressive and immunomodulator agent in various mammals, including cats. Several adverse reactions have been reported and have limited the use of the drug in the cat. Adverse reactions to azathioprine in humans have been correlated with reduced activity of thiopurine methyltransferase (TPMT) in erythrocytes. The purpose of this preliminary study was to determine if cats have TPMT activity in their erythrocytes and to compare the values obtained with the normal range for humans and the normal range for dogs in a preliminary report. Activity of the enzyme was measured in blood samples drawn from 41 cats. Blood also was taken from 5 dogs. The mean erythrocyte TPMT activity in the cats was 2.4 +/- 0.4 nmol (range, 1.2-3.9 nmol) per hour per milliliter of red blood cells (U/mL RBC) or 2-8 nmol per hour per gram of hemoglobin (U/g Hb). This range was far lower than the normal human range (8-15 U/mL RBC; 16-33 U/g Hb) and was of monopolar distribution. This observation apparently precludes any diagnostic purpose in assaying erythrocyte TPMT in this species. Erythrocyte TPMT activity in the 5 dogs ranged from 5.5 to 13.1 U/mL RBC (11-27 U/g Hb), which was comparable with normal and carrier ranges for humans, but proof of TPMT genetic polymorphism in either species will require genotyping studies. PMID:11012121

  18. Two distinct arginine methyltransferases are required for biogenesis of Sm-class ribonucleoproteins

    Gonsalvez, Graydon B.; Tian, Liping; Ospina, Jason K.; Boisvert, François-Michel; Lamond, Angus I.; Matera, A. Gregory

    2007-01-01

    Small nuclear ribonucleoproteins (snRNPs) are core components of the spliceosome. The U1, U2, U4, and U5 snRNPs each contain a common set of seven Sm proteins. Three of these Sm proteins are posttranslationally modified to contain symmetric dimethylarginine (sDMA) residues within their C-terminal tails. However, the precise function of this modification in the snRNP biogenesis pathway is unclear. Several lines of evidence suggest that the methyltransferase protein arginine methyltransferase 5 (PRMT5) is responsible for sDMA modification of Sm proteins. We found that in human cells, PRMT5 and a newly discovered type II methyltransferase, PRMT7, are each required for Sm protein sDMA modification. Furthermore, we show that the two enzymes function nonredundantly in Sm protein methylation. Lastly, we provide in vivo evidence demonstrating that Sm protein sDMA modification is required for snRNP biogenesis in human cells. PMID:17709427

  19. Novel mutation in 16S rRNA associated with streptomycin dependence in Mycobacterium tuberculosis.

    Honoré, N; Marchal, G.; Cole, S T

    1995-01-01

    Molecular characterization of a streptomycin-dependent mutant of Mycobacterium tuberculosis revealed the presence of a novel mutation in the rrs gene encoding 16S rRNA. Insertion of an additional cytosine in the 530 loop of 16S rRNA, a region known to be involved in streptomycin susceptibility and resistance, was associated with streptomycin dependence.

  20. The effect of secondary compounds on the rumen microbial population structure measured by 16S rRNA and 18S rRNA

    Full text: Plant secondary compounds in the forages have an important role in determining forage quality. A method for evaluating their effects on microbial population structure was carried out using the in vitro gas syringe system followed by extraction of RNA and gel separation of 16S rRNA and 18S rRNA. Quantification of 16S rRNA and 18S rRNA bands indicated the prokaryote and eukaryote populations, respectively. Five types of plant materials, i.e. Nothopanax scutellarium (Mangkokan) leaves, Morinda citrifolia (Mengkudu) fruit, Sapindus rarak (lerak) fruit and two types of Sesbania sesban leaves (hgh saponin and low saponin) were tested and Pennisetum purpureum (rumput gajah, Indonesian name) was used as a control roughage. Presence of saponin in these plant materials was determined qualitatively by thin layer chromatography. Eukaryote population was found to be significantly affected by the above plant materials. Both types of S. sesban leaves caused total elimination of eukaryotes. S. rarak reduced both eukaryote and prokaryote populations. The observed inhibition of eukaryote population might be due to the presence of saponin in these plant materials. In another experiment, a methanol extract of S. rarak which contained saponin was included and its effect on in vitro fermentation of P. purpureum was evaluated. The results showed that at higher levels of inclusion of S. rarak methanol extract, eukaroytes were totally eliminated. Comparison was made between microbial mass calculated based on difference between apparent undigested residue and true undigested residue and microbial mass calculations based on 16S rRNA and 18S rRNA. Microbial mass calculated by difference method was much higher than the microbial mass calculated on the basis of 16S rRNA and 18S rRNA. The quantification of RNA can be a useful and rapid technique for an accurate assessment of the effect of new forage materials on the microbial population structure. Other parameters from in vitro

  1. A cfr-Like Gene from Clostridium difficile Confers Multiple Antibiotic Resistance by the Same Mechanism as the cfr Gene

    Hansen, Lykke H; Vester, Birte

    2015-01-01

    The Cfr RNA methyltransferase causes multiple resistances to peptidyl transferase inhibitors by methylation of A2503 23S rRNA. Many cfr-like gene sequences in the databases code for unknown functions. This study confirms that a Cfr-like protein from a Peptoclostridium difficile (formerly Clostrid...... Clostridium difficile) strain does function as a Cfr protein. The enzyme is expressed in Escherichia coli and shows elevated MICs for five classes of antibiotics. A primer extension stop indicates a modification at A2503 in 23S rRNA.......The Cfr RNA methyltransferase causes multiple resistances to peptidyl transferase inhibitors by methylation of A2503 23S rRNA. Many cfr-like gene sequences in the databases code for unknown functions. This study confirms that a Cfr-like protein from a Peptoclostridium difficile (formerly...

  2. Parity nonconservation effect with laser-induced 2^3S_1 - 2^1S_0 transition in heavy heliumlike ions

    Shabaev, V M; Kozhuharov, C; Plunien, G; Stöhlker, Th

    2010-01-01

    The parity nonconservation (PNC) effect on the laser-induced 2^3S_1 - 2^1S_0 transition in heavy heliumlike ions is considered. A simple analytical formula for the PNC correction to the cross section is derived for the case, when the opposite-parity 2^1S_0 and 2^3P_0 states are almost degenerate and, therefore, the PNC effect is strongly enhanced. Numerical results are presented for heliumlike gadolinium and thorium, which seem most promising candidates for such kind of experiments. In both Gd and Th cases the photon energy required will be anticipated with a high-energy laser built at GSI. Alternatively, it can be gained with ultraviolet lasers utilizing relativistic Doppler tuning at FAIR facilities in Darmstadt.

  3. The RNA-methyltransferase Misu (NSun2 poises epidermal stem cells to differentiate.

    Sandra Blanco

    2011-12-01

    Full Text Available Homeostasis of most adult tissues is maintained by balancing stem cell self-renewal and differentiation, but whether post-transcriptional mechanisms can regulate this process is unknown. Here, we identify that an RNA methyltransferase (Misu/Nsun2 is required to balance stem cell self-renewal and differentiation in skin. In the epidermis, this methyltransferase is found in a defined sub-population of hair follicle stem cells poised to undergo lineage commitment, and its depletion results in enhanced quiescence and aberrant stem cell differentiation. Our results reveal that post-transcriptional RNA methylation can play a previously unappreciated role in controlling stem cell fate.

  4. H3K9 methyltransferase G9a and the related molecule GLP

    Shinkai, Yoichi; Tachibana, Makoto

    2011-01-01

    The discovery of Suv39h1, the first SET domain-containing histone lysine methyltransferase (HKMT), was reported in 2000. Since then, research on histone methylation has progressed rapidly. Among the identified HKMTs in mammals, G9a and GLP are the primary enzymes for mono- and dimethylation at Lys 9 of histone H3 (H3K9me1 and H3K9me2), and exist predominantly as a G9a–GLP heteromeric complex that appears to be a functional H3K9 methyltransferase in vivo. Recently, many important studies have ...

  5. Novel Function of Lysine Methyltransferase G9a in the Regulation of Sox2 Protein Stability

    Lee, Jae-Young; Lee, Se-Hwan; Heo, Sun-Hee; Kim, Kwang-Soo; Kim, Changhoon; Kim, Dae-Kwan; Ko, Jeong-Jae; Park, Kyung-Soon

    2015-01-01

    G9a is a lysine methyltransferase (KMTase) for histone H3 lysine 9 that plays critical roles in a number of biological processes. Emerging evidence suggests that aberrant expression of G9a contributes to tumor metastasis and maintenance of a malignant phenotype in cancer by inducing epigenetic silencing of tumor suppressor genes. Here, we show that G9a regulates Sox2 protein stability in breast cancer cells. When G9a lysine methyltransferase activity was chemically inhibited in the ER(+) brea...

  6. Radiometric assay for phenylethanolamine N-methyltransferase and catechol O-methyltransferase in a single tissue sample: application to rat hypothalamic nuclei, pineal gland, and heart

    A simple and highly sensitive method for simultaneous assay of phenylethanolamine N-methyltransferase (PNMT) and catechol O-methyltransferase (COMT) is described. These enzymes are determined in a single tissue homogenate using S-[methyl-3H] adenosyl-L-methionine as methyl donor and sequentially incubating with the substrates phenylethanolamine and epinephrine. The radioactive products of the enzymatic reactions, N-methylphenylethanolamine and metanephrine, are extracted and then separated by thin-layer chromatography. The identity of the reaction products has been established chromatographically and the conditions for both enzymatic reactions in the assay procedure have been defined. Measurement of PNMT activity in the rat pineal gland or in minute fragments of other tissues (e.g., brain nuclei) has not been possible using previously described methods. Activities of PNMT and COMT in the rat pineal gland, various hypothalamic nuclei, and the auricular and ventricular myocardia are herein reported

  7. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    Long, Katherine S.; Vester, Birte

    2012-01-01

    linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design...

  8. Betaine-homocysteine methyltransferase: human liver genotype-phenotype correlation

    Feng, Qiping; Kalari, Krishna; Fridley, Brooke L.; Jenkins, Gregory; Ji, Yuan; Abo, Ryan; Hebbring, Scott; Zhang, Jianping; Nye, Monica D.; Leeder, J. Steven; Weinshilboum, Richard. M.

    2010-01-01

    Betaine-homocysteine methyltransferase (BHMT) catalyzes the remethylation of homocysteine. BHMT is highly expressed in the human liver. In the liver, BHMT catalyzes up to 50% of homocysteine metabolism. Understanding the relationship between BHMT genetic polymorphisms and function might increase our understanding of the role of this reaction in homocysteine remethylation and in S-adenosylmethionine-dependent methylation. To help achieve those goals, we measured levels of BHMT enzyme activity and immunoreactive protein in 268 human hepatic surgical biopsy samples from adult subjects as well as 73 fetal hepatic tissue samples obtained at different gestational ages. BHMT protein levels were correlated significantly (p<0.001) with levels of enzyme activity in both fetal and adult tissue, but both were decreased in fetal tissue when compared with levels in the adult hepatic biopsies. To determine possible genotype-phenotype correlations, 12 tag SNPs for BHMT and the closely related BHMT2 gene were selected from SNPs observed during our own gene resequencing studies as well as from HapMap data were used to genotype DNA from the adult hepatic surgical biopsy samples, and genotype-phenotype association analysis was performed. Three SNPs (rs41272270, rs16876512, and rs6875201), located 28 kb upstream, in the 5′-UTR and in intron 1 of BHMT, respectively, were significantly correlated with both BHMT activity (p=3.41E-8, 2.55E-9 and 2.46E-10, respectively) and protein levels (p=5.78E-5, 1.08E-5 and 6.92E-6, respectively). We also imputed 230 additional SNPs across the BHMT and BHMT2 genes, identifying an additional imputed SNP, rs7700790, that was also highly associated with hepatic BHMT enzyme activity and protein. However, none of the 3 genotyped or one imputed SNPs displayed a “shift” during electrophoretic mobility shift assays. These observations may help us to understand individual variation in the regulation of BHMT in the human liver and its possible relationship

  9. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    Cangelosi, G A; Brabant, W H

    1997-07-01

    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA probes to measure steady-state cellular pre-16S rRNA pools during growth state transitions in Escherichia coli. Pre-16S rRNA became undetectable when cells entered the stationary phase on rich medium and was replenished upon restoration of favorable growth conditions. These fluctuations were of much greater magnitude than concurrent fluctuations in the mature 16S rRNA pool. The extent of pre-16S rRNA depletion depended upon the circumstances limiting growth. It was significantly more pronounced in carbon-energy-starved cells than in nitrogen-starved cells or in cells treated with energy uncouplers. In the presence of the transcriptional inhibitor rifampin, rates of pre-16S rRNA depletion in carbon-energy-starved cells and nitrogen-starved cells were similar, suggesting that the difference between these conditions resides primarily at the level of pre-rRNA synthesis. Chloramphenicol, which inhibits the final steps in rRNA maturation, halted pre-16S rRNA depletion under all conditions. The data show that E. coli cells continue to process pre-rRNA after growth and rrn operon transcription cease, leading to drainage of the pre-rRNA pool. This supports the feasibility of using pre-rRNA-targeted probes to monitor bacterial growth in natural systems, with the caveat that patterns of pre-rRNA depletion vary with the conditions limiting growth. PMID:9226253

  10. Wolbachia prophage DNA adenine methyltransferase genes in different Drosophila-Wolbachia associations

    Saridaki, Aggeliki; Sapountzis, Panagiotis; Harris, Harriet L;

    2011-01-01

    . The importance of DNA methylation in cell fate and biology calls for in depth studying of putative methylation-related genes. We present a molecular and phylogenetic analysis of a putative DNA adenine methyltransferase encoded by a prophage in the Wolbachia genome. Two slightly different copies of the gene, met1...

  11. Suz12 is essential for mouse development and for EZH2 histone methyltransferase activity

    Pasini, Diego; Bracken, Adrian P; Jensen, Michael R;

    2004-01-01

    SUZ12 is a recently identified Polycomb group (PcG) protein, which together with EZH2 and EED forms different Polycomb repressive complexes (PRC2/3). These complexes contain histone H3 lysine (K) 27/9 and histone H1 K26 methyltransferase activity specified by the EZH2 SET domain. Here we show tha...

  12. Association of Catechol-O-Methyltransferase (COMT) Polymorphism and Academic Achievement in a Chinese Cohort

    Yeh, Ting-Kuang; Chang, Chun-Yen; Hu, Chung-Yi; Yeh, Ting-Chi; Lin, Ming-Yeh

    2009-01-01

    Catechol-O-methyltransferase (COMT) is a methylation enzyme that catalyzes the degradation pathway and inactivation of dopamine. It is accepted widely as being involved in the modulation of dopaminergic physiology and prefrontal cortex (PFC) function. The COMT Val158Met polymorphism is associated with variation in COMT activity. COMT 158Met allele…

  13. Catechol-O-methyltransferase gene methylation and substance use in adolescents: The TRAILS study

    L.J. van der Knaap (Lisette); J.M. Schäfer (Johanna); I.H.A. Franken (Ingmar); F.C. Verhulst (Frank); F.V.A. van Oort (Floor); H. Riese (Harriëtte)

    2014-01-01

    textabstractSubstance use often starts in adolescence and poses a major problem for society and individual health. The dopamine system plays a role in substance use, and catechol-O-methyltransferase (COMT) is an important enzyme that degrades dopamine. The Val108/158Met polymorphism modul

  14. Effect of alternative temozolomide schedules on glioblastoma O 6-methylguanine-DNA methyltransferase activity and survival

    Robinson, C G; Palomo, J M; Rahmathulla, G; McGraw, M; Donze, J; L. Liu; Vogelbaum, M A

    2010-01-01

    Background: O 6-methylguanine-DNA methyltransferase (MGMT) expression in glioblastoma correlates with temozolomide resistance. Dose-intense temozolomide schedules deplete MGMT activity in peripheral blood mononuclear cells; however, no published data exist evaluating the effect of temozolomide schedules on intracranial tumour MGMT activity. Methods: Human glioblastoma cells (GBM43) with an unmethylated MGMT promoter were implanted intracranially in immunodeficient rodents. Three weeks later, ...

  15. Clinical Pharmacogenetics Implementation Consortium guidelines for thiopurine methyltransferase genotype and thiopurine dosing

    Relling, M V; Gardner, E E; Sandborn, W J;

    2011-01-01

    Thiopurine methyltransferase (TPMT) activity exhibits monogenic co-dominant inheritance, with ethnic differences in the frequency of occurrence of variant alleles. With conventional thiopurine doses, homozygous TPMT-deficient patients (~1 in 178 to 1 in 3,736 individuals with two nonfunctional TP...

  16. SABATH Methyltransferases from White Spruce (Picea glauca [Moench] Voss): Gene Cloning, Functional Characterization and Structural Analysis

    Known members of the plant SABATH family of methyltransferases have important biological functions by methylating hormones, signaling molecules and other metabolites. While all previously characterized SABATH genes were isolated from angiosperms, in this article, we report on the isolation and funct...

  17. DNA repair methyltransferase (Mgmt) knockout mice are sensitive to the lethal effects of chemotherapeutic alkylating agents.

    B.J. Glassner (Brian); G. Weeda (Geert); J.M. Allan (James); J.L.M. Broekhof (Jose'); N.H.E. Carls (Nick); I. Donker (Ingrid); B.P. Engelward (Bevin); R.J. Hampson (Richard); R. Hersmus (Remko); M.J. Hickman (Mark); R.B. Roth (Richard); H.B. Warren (Henry); M.M. Wu (Mavis); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)

    1999-01-01

    textabstractWe have generated mice deficient in O6-methylguanine DNA methyltransferase activity encoded by the murine Mgmt gene using homologous recombination to delete the region encoding the Mgmt active site cysteine. Tissues from Mgmt null mice displayed very low O6-methylguanine DNA methyltransf

  18. Functional characterization of cinnamyl alcohol dehydrogenase and caffeic acid O-methyltransferase in Brachypodium distachyon.

    Lignin is a significant recalcitrant in the conversion of plant biomass to bioethanol. Cinnamyl alcohol dehydrogenase (CAD) and caffeic acid O-methyltransferase (COMT) catalyze key steps in the pathway of lignin monomer biosynthesis. Brown midrib mutants in Zea mays and Sorghum bicolor with impaired...

  19. Mutations in the DNA methyltransferase gene DNMT3A cause an overgrowth syndrome with intellectual disability

    Tatton-Brown, Katrina; Seal, Sheila; Ruark, Elise; Harmer, Jenny; Ramsay, Emma; Del Vecchio Duarte, Silvana; Zachariou, Anna; Hanks, Sandra; O'Brien, Eleanor; Aksglaede, Lise; Baralle, Diana; Dabir, Tabib; Gener, Blanca; Goudie, David; Homfray, Tessa; Kumar, Ajith; Pilz, Daniela T; Selicorni, Angelo; Temple, I Karen; Van Maldergem, Lionel; Yachelevich, Naomi; van Montfort, Robert; Rahman, Nazneen

    2014-01-01

    and histone binding. Similar mutations were not present in 1,000 UK population controls (13/152 cases versus 0/1,000 controls; P < 0.0001). Mutation carriers had a distinctive facial appearance, intellectual disability and greater height. DNMT3A encodes a DNA methyltransferase essential for...

  20. Local chromatin microenvironment determines DNMT activity : from DNA methyltransferase to DNA demethylase or DNA dehydroxymethylase

    van der Wijst, Monique G. P.; Venkiteswaran, Muralidhar; Chen, Hui; Xu, Guo-Liang; Plosch, Torsten; Rots, Marianne G.

    2015-01-01

    Insights on active DNA demethylation disproved the original assumption that DNA methylation is a stable epigenetic modification. Interestingly, mammalian DNA methyltransferases 3A and 3B (DNMT-3A and -3B) have also been reported to induce active DNA demethylation, in addition to their well-known fun

  1. Clinical Pharmacogenetics Implementation Consortium guidelines for thiopurine methyltransferase genotype and thiopurine dosing

    Relling, M V; Gardner, E E; Sandborn, W J; Schmiegelow, K; Pui, C-H; Yee, S W; Stein, Paul C.; Carrillo, Maria Berrocal; Evans, W E; Klein, T E

    2011-01-01

    Thiopurine methyltransferase (TPMT) activity exhibits monogenic co-dominant inheritance, with ethnic differences in the frequency of occurrence of variant alleles. With conventional thiopurine doses, homozygous TPMT-deficient patients (~1 in 178 to 1 in 3,736 individuals with two nonfunctional TP...... recommendations (updates at http://www.pharmgkb.org) for azathioprine, mercaptopurine (MP), and thioguanine based on TPMT genotype....

  2. Tyrosine 87 is vital for the activity of human protein arginine methyltransferase 3 (PRMT3)

    Handrková, H.; Petrák, J.; Halada, Petr; Pospíšilová, D.; Čmejla, R.

    2011-01-01

    Roč. 1814, č. 2 (2011), s. 277-282. ISSN 1570-9639 R&D Projects: GA MŠk LC07017 Institutional research plan: CEZ:AV0Z50200510 Keywords : DIAMOND-BLACKFAN ANEMIA * SUBSTRATE-SPECIFICITY * N-METHYLTRANSFERASE Subject RIV: CE - Biochemistry Impact factor: 3.635, year: 2011

  3. A mouse speciation gene encodes a meiotic histone H3 methyltransferase

    Mihola, Ondřej; Trachtulec, Zdeněk; Vlček, Čestmír; Schimenti, J.C.; Forejt, Jiří

    2009-01-01

    Roč. 323, č. 5912 (2009), s. 373-375. ISSN 0036-8075 Institutional research plan: CEZ:AV0Z50520514 Keywords : hybrid sterility * histone H3K4 methyltransferase * Prdm9 Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 29.747, year: 2009

  4. Sequencing of 16S rRNA Gene: A Rapid Tool for Identification of Bacillus anthracis

    Sacchi, Claudio T.; Whitney, Anne M.; Mayer, Leonard W.; Morey, Roger; Steigerwalt, Arnold; Boras, Ariana; Weyant, Robin S.; Popovic, Tanja

    2002-01-01

    In a bioterrorism event, a tool is needed to rapidly differentiate Bacillus anthracis from other closely related spore-forming Bacillus species. During the recent outbreak of bioterrorism-associated anthrax, we sequenced the 16S rRNA generom these species to evaluate the potential of 16S rRNA gene sequencing as a diagnostic tool. We found eight distinct 16S types among all 107 16S rRNA gene seqs fuences that differed from each other at 1 to 8 positions (0.06% to 0.5%). All 86 B. anthracis had...

  5. 16s-23S rDNA: polymorphisms and their use for detection and identification of Xylella fastidiosa strains 16S-23S rDNA: polimorfismos e sua aplicação na detecção e identificação de linhagens de Xylella fastidiosa

    Juliana Camargo Martinati

    2007-03-01

    Full Text Available Strains of Xylella fastidiosa from several hosts (coffee, citrus, grape, almond, oleander, peach, plum, etc. were characterized by analyzing the content of the nucleotide sequences of 16S-23S rDNA (coding for a small subunit ribosomal RNA spacer region (ITS. Current methods for sequencing the ITS region yields partial sequences that do not contribute with significant information. According to this fact, new primers have been designed in order to obtain a complete sequence and facilitate the sequencing. The complete 16S-23S sequences from 08 strains were amplified through PCR using the primers designed in our lab. The 16S-23S sequences obtained were compared with 52 others sequences entries in GenBank database. The results revealed a higher level of variation than that found in 16S gene sequences, with similarity values ranging from 0.79-1.00. The dendogram based on similarity data revealed 5 main groups. This spacer sequence contains two genes for tRNA (tRNAala and tRNAile. The sequence analysis of the tRNA content showed a conserved region with a few differences in the nucleotide composition.Linhagens de Xylella fastidiosa de diferentes hospedeiros (café, uva, amêndoa, ameixa, etc. foram caracterizados analisando as sequências de nucleotídeos do espaço intergênico 16S-23S (ITS. Os métodos atuais para o sequenciamento da região ITS produzem fragmentos parciais das sequências que não contribuem com informações significantes. Em vista disso, novos primers foram desenhados a fim de obter uma sequência completa e facilitar o sequenciamento. A sequencia completa da região ITS de 08 linhagens de X. Fastidiosa foram amplificadas via PCR, sequenciadas e comparadas com outras 52 sequencias depositadas no GenBank. Os resultados revelaram um alto nível de variação sendo maior que os níveis encontrados quando se utiliza o gene 16S para este tipo de análise, com valores variando entre 0.79 a 1.00. O dendograma baseado em dados de

  6. Physiology and Posttranscriptional Regulation of Methanol:Coenzyme M Methyltransferase Isozymes in Methanosarcina acetivorans C2A ▿ §

    Opulencia, Rina B.; Bose, Arpita; Metcalf, William W.

    2009-01-01

    Methanosarcina species possess three operons (mtaCB1, mtaCB2, and mtaCB3) encoding methanol-specific methyltransferase 1 (MT1) isozymes and two genes (mtaA1 and mtaA2) with the potential to encode a methanol-specific methyltransferase 2 (MT2). Previous genetic studies showed that these genes are differentially regulated and encode enzymes with distinct levels of methyltransferase activity. Here, the effects of promoter strength on growth and on the rate of methane production were examined by ...

  7. Comparative 16S rRNA signatures and multilocus sequence analysis for the genus Salinicola and description of Salinicola acroporae sp. nov., isolated from coral Acropora digitifera.

    Lepcha, Rinchen T; Poddar, Abhijit; Schumann, Peter; Das, Subrata K

    2015-07-01

    A novel Gram-negative, aerobic, motile marine bacterium, strain S4-41(T), was isolated from mucus of the coral Acropora digitifera from the Andaman Sea. Heterotrophic growth was observed in 0-25 % NaCl, at 15-45 °C and pH 4.5-9. In phylogenetic trees, strain S4-41(T) was grouped within the genus Salinicola but formed a separate branch distant from a cluster composed of Salinicola salarius M27(T) and Salinicola socius SMB35(T). DNA-DNA relatedness between strain S4-41(T) and these reference strains were well below 70 %. Q-9 was the sole respiratory quinone. The DNA G+C content was determined to be 63.6 mol%. Based on a polyphasic analysis, strain S4-41(T) is concluded to represent a novel species in the genus Salinicola for which the name Salinicola acroporae sp. nov. is proposed. The type strain is S4-41(T) (=JCM 30412(T) = LMG 28587(T)). Comparative 16S rRNA analysis of the genera Salinicola, Kushneria, Chromohalobacter and Cobetia revealed the presence of genus specific sequence signatures. Multilocus sequence analysis based on concatenated sequences of rRNAs (16S and 23S) and four protein coding housekeeping genes (atpA, gyrB, secA, rpoD) was found to be unnecessary for phylogenetic studies of the genus Salinicola. PMID:25944083

  8. Investigation of molluscan phylogeny on the basis of 18S rRNA sequences.

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1996-12-01

    The 18S rRNA sequences of 12 molluscs, representing the extant classes Gastropoda, Bivalvia, Polyplacophora, Scaphopoda, and Caudofoveata, were determined and compared with selected known 18S rRNA sequences of Metazoa, including other Mollusca. These data do not provide support for a close relationship between Platyhelminthes (Turbellaria) and Mollusca, but rather suggest that the latter group belongs to a clade of eutrochozoan coelomates. The 18S rRNA data fail to recover molluscan, bivalve, or gastropod monophyly. However, the branching pattern of the eutrochozoan phyla and classes is unstable, probably due to the explosive Cambrian radiation during which these groups arose. Similarly, the 18S rRNA data do not provide a reliable signal for the molluscan interclass relationships. Nevertheless, we obtained strong preliminary support for phylogenetic inferences at more restricted taxonomic levels, such as the monophyly of Polyplacophora, Caenogastropoda, Euthyneura, Heterodonta, and Arcoida. PMID:8952075

  9. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria

    Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.

    2015-01-01

    Roč. 15, APR 2015 (2015). ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EE - Microbiology , Virology Impact factor: 2.729, year: 2014

  10. Inhibition of Escherichia coli precursor-16S rRNA processing by mouse intestinal contents

    Licht, Tine Rask; Tolker-Nielsen, Tim; Holmstrøm, Kim; Krogfelt, Karen A.; Molin, Søren

    1999-01-01

    . We have applied fluorescence in situ hybridization of pre-16S rRNA to Escherichia coli cells growing in vitro in extracts from two different compartments of the mouse intestine: the caecal mucus layer, where E. coli grew rapidly, and the contents of the caecum, which supported much slower bacterial......The correlation between ribosome content and growth rate found in many bacterial species has proved useful for estimating the growth activity of individual cells by quantitative in situ rRNA hybridization. However, in dynamic environments, the stability of mature ribosomal RNA causes problems in...... using cellular rRNA contents for direct monitoring of bacterial growth activity in situ. In a recent paper, Cangelosi and Brabant suggested monitoring the content of precursors in rRNA synthesis (pre-rRNAs) as an alternative approach. These are rapidly broken down after the cessation of bacterial growth...

  11. Mutations in the 16S rRNA Genes of Helicobacter pylori Mediate Resistance to Tetracycline

    Trieber, Catharine A.; Taylor, Diane E.

    2002-01-01

    Low-cost and rescue treatments for Helicobacter pylori infections involve combinations of several drugs including tetracycline. Resistance to tetracycline has recently emerged in H. pylori. The 16S rRNA gene sequences of two tetracycline-resistant clinical isolates (MIC = 64 μg/ml) were determined and compared to the consensus H. pylori 16S rRNA sequence. One isolate had four nucleotide substitutions, and the other had four substitutions and two deletions. Natural transformation with the 16S ...

  12. 16S rRNA Mutation Associated with Tetracycline Resistance in a Gram-Positive Bacterium

    Ross, Jeremy I.; Eady, E Anne; Cove, Jonathan H.; Cunliffe, William J.

    1998-01-01

    A genetic basis for tetracycline resistance in cutaneous propionibacteria was suggested by comparing the nucleotide sequences of the 16S rRNA genes from 16 susceptible and 21 resistant clinical isolates and 6 laboratory-selected tetracycline-resistant mutants of a susceptible strain. Fifteen clinical isolates resistant to tetracycline were found to have cytosine instead of guanine at a position cognate with Escherichia coli 16S rRNA base 1058 in a region important for peptide chain terminatio...

  13. Development of a Broad-Range 23S rDNA Real-Time PCR Assay for the Detection and Quantification of Pathogenic Bacteria in Human Whole Blood and Plasma Specimens

    Paolo Gaibani; Mara Mariconti; Gloria Bua; Sonia Bonora; Davide Sassera; Maria Paola Landini; Patrizia Mulatto; Stefano Novati; Claudio Bandi; Vittorio Sambri

    2013-01-01

    Molecular methods are important tools in the diagnosis of bloodstream bacterial infections, in particular in patients treated with antimicrobial therapy, due to their quick turn-around time. Here we describe a new broad-range real-time PCR targeting the 23S rDNA gene and capable to detect as low as 10 plasmid copies per reaction of targeted bacterial 23S rDNA gene. Two commercially available DNA extraction kits were evaluated to assess their efficiency for the extraction of plasma and whole b...

  14. N-6-Adenine-Specific DNA Methyltransferase 1 (N6AMT1) Polymorphisms and Arsenic Methylation in Andean Women

    Harari, Florencia; Engström, Karin; Concha, Gabriela; Colque, Graciela; Vahter, Marie; Broberg, Karin

    2013-01-01

    BACKGROUND: In humans, inorganic arsenic is metabolized to methylated metabolites mainly by arsenic (+3 oxidation state) methyltransferase (AS3MT). AS3MT polymorphisms are associated with arsenic metabolism efficiency. Recently, a putative N-6-adenine-specific DNA methyltransferase 1 (N6AMT1) was found to methylate arsenic in vitro. OBJECTIVE: We evaluated the role of N6AMT1 polymorphisms in arsenic methylation efficiency in humans. METHODS: We assessed arsenic methylation efficiency in 188 w...

  15. MOLECULAR AND FUNCTIONAL CHARACTERIZATION OF A JUVENILE HORMONE ACID METHYLTRANSFERASE EXPRESSED IN THE CORPORA ALLATA OF MOSQUITOES

    Mayoral, Jaime G.; Nouzova, Marcela; Yoshiyama, Michiyo; Shinoda, Tetsuro; Hernandez-Martinez, Salvador; Dolghih, Elena; Turjanski, Adrian G; Roitberg, Adrian E.; Priestap, Horacio; Perez, Mario; Mackenzie, Lucy; Li, Yiping; Noriega, Fernando G.

    2008-01-01

    A juvenile hormone acid methyltransferase (JHAMT) was isolated as an abundant EST in a library of the corpora allata of the adult female mosquito Aedes aegypti. Its full-length cDNA encodes a 278-aa protein that has 43 % amino acid identity with BmJHAMT, a juvenile hormone acid methyltransferase previously cloned from Bombyx mori. Heterologous expression produced a recombinant protein that metabolizes farnesoic acid (FA) into methyl farnesoate, as well as juvenile hormone acid into juvenile h...

  16. The Histone Methyltransferase Inhibitor A-366 Uncovers a Role for G9a/GLP in the Epigenetics of Leukemia

    Pappano, William N.; Guo, Jun; He, Yupeng; Ferguson, Debra; Jagadeeswaran, Sujatha; Osterling, Donald J.; Gao, Wenqing; Spence, Julie K.; Pliushchev, Marina; Sweis, Ramzi F.; Buchanan, Fritz G.; Michaelides, Michael R.; Shoemaker, Alexander R.; Tse, Chris; Chiang, Gary G.

    2015-01-01

    Histone methyltransferases are epigenetic regulators that modify key lysine and arginine residues on histones and are believed to play an important role in cancer development and maintenance. These epigenetic modifications are potentially reversible and as a result this class of enzymes has drawn great interest as potential therapeutic targets of small molecule inhibitors. Previous studies have suggested that the histone lysine methyltransferase G9a (EHMT2) is required to perpetuate malignant...

  17. Inhibition of G9a Histone Methyltransferase Converts Bone Marrow Mesenchymal Stem Cells to Cardiac Competent Progenitors

    Jinpu Yang; Keerat Kaur; Li Lin Ong; Eisenberg, Carol A; Leonard M. Eisenberg

    2015-01-01

    The G9a histone methyltransferase inhibitor BIX01294 was examined for its ability to expand the cardiac capacity of bone marrow cells. Inhibition of G9a histone methyltransferase by gene specific knockdown or BIX01294 treatment was sufficient to induce expression of precardiac markers Mesp1 and brachyury in bone marrow cells. BIX01294 treatment also allowed bone marrow mesenchymal stem cells (MSCs) to express the cardiac transcription factors Nkx2.5, GATA4, and myocardin when subsequently exp...

  18. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  19. Discovery of sphingosine 1-O-methyltransferase in rat kidney and liver homogenates

    Santosh J SACKET; Dong-soon IM

    2008-01-01

    Aim:To characterize sphingosine methyltransferase in rat tissues.Methods:By using S-adenosyl-L-(methyl-3H) methionine,enzymatic activity was measured in the rat liver and kidney homogenates.Results:The optimum pH and reaction time for the enzyme assay were pH 7.8 and 1 h.ZnCl2 inhibited the activity,but not MgCl2,CaCl2,CoCl2,or NiCl2.In the kidney homogenate,enzymatic activity was detectable in the cytosol and all membrane fractions from the plasma membrane and other organelles; however,in the liver homogenate,enzymatic activity was detectable in all membrane fractions,but not in the cytosol.We also tested the enzymatic activity with structurally-modified sphingosine derivatives.Conclusion:We found sphingosine l-O-methyltransferase activity in the rat liver and kidney homogenates.

  20. Super-resolution optical DNA Mapping via DNA methyltransferase-directed click chemistry

    Vranken, Charlotte; Deen, Jochem; Dirix, Lieve;

    2014-01-01

    We demonstrate an approach to optical DNA mapping, which enables near single-molecule characterization of whole bacteriophage genomes. Our approach uses a DNA methyltransferase enzyme to target labelling to specific sites and copper-catalysed azide-alkyne cycloaddition to couple a fluorophore...... to the DNA. We achieve a labelling efficiency of ∼70% with an average labelling density approaching one site every 500 bp. Such labelling density bridges the gap between the output of a typical DNA sequencing experiment and the long-range information derived from traditional optical DNA mapping. We lay...... the foundations for a wider-scale adoption of DNA mapping by screening 11 methyltransferases for their ability to direct sequence-specific DNA transalkylation; the first step of the DNA labelling process and by optimizing reaction conditions for fluorophore coupling via a click reaction. Three of 11 enzymes...

  1. Crystallization and preliminary X-ray diffraction studies of a catechol-O-methyltransferase/inhibitor complex

    Catechol-O-methyltransferase has been co-crystallized with a novel inhibitor, which has potential therapeutic application in the Parkinson’s disease therapy. Inhibitors of the enzyme catechol-O-methyltransferase (COMT) are used as co-adjuvants in the therapy of Parkinson’s disease. A recombinant form of the soluble cytosolic COMT from rat has been co-crystallized with a new potent inhibitor, BIA 8-176 [(3,4-dihydroxy-2-nitrophenyl)phenylmethanone], by the vapour-diffusion method using PEG 6K as precipitant. Crystals diffract to 1.6 Å resolution on a synchrotron-radiation source and belong to the monoclinic space group P21, with unit-cell parameters a = 52.77, b = 79.63, c = 61.54 Å, β = 91.14°

  2. Crystallization and preliminary X-ray diffraction studies of a catechol-O-methyltransferase/inhibitor complex

    Rodrigues, M. L. [Instituto de Tecnologia Química e Biológica (ITQB), Universidade Nova de Lisboa, Av. República, Apt. 127, 2781-901 Oeiras (Portugal); Bonifácio, M. J.; Soares-da-Silva, P. [Department of Research and Development, BIAL, 4785 S. Mamede do Coronado (Portugal); Carrondo, M. A.; Archer, M., E-mail: archer@itqb.unl.pt [Instituto de Tecnologia Química e Biológica (ITQB), Universidade Nova de Lisboa, Av. República, Apt. 127, 2781-901 Oeiras (Portugal)

    2005-01-01

    Catechol-O-methyltransferase has been co-crystallized with a novel inhibitor, which has potential therapeutic application in the Parkinson’s disease therapy. Inhibitors of the enzyme catechol-O-methyltransferase (COMT) are used as co-adjuvants in the therapy of Parkinson’s disease. A recombinant form of the soluble cytosolic COMT from rat has been co-crystallized with a new potent inhibitor, BIA 8-176 [(3,4-dihydroxy-2-nitrophenyl)phenylmethanone], by the vapour-diffusion method using PEG 6K as precipitant. Crystals diffract to 1.6 Å resolution on a synchrotron-radiation source and belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 52.77, b = 79.63, c = 61.54 Å, β = 91.14°.

  3. Targeting histone methyltransferases and demethylases in clinical trials for cancer therapy.

    Morera, Ludovica; Lübbert, Michael; Jung, Manfred

    2016-01-01

    The term epigenetics is defined as heritable changes in gene expression that are not due to alterations of the DNA sequence. In the last years, it has become more and more evident that dysregulated epigenetic regulatory processes have a central role in cancer onset and progression. In contrast to DNA mutations, epigenetic modifications are reversible and, hence, suitable for pharmacological interventions. Reversible histone methylation is an important process within epigenetic regulation, and the investigation of its role in cancer has led to the identification of lysine methyltransferases and demethylases as promising targets for new anticancer drugs. In this review, we describe those enzymes and their inhibitors that have already reached the first stages of clinical trials in cancer therapy, namely the histone methyltransferases DOT1L and EZH2 as well as the demethylase LSD1. PMID:27222667

  4. Aflatoxin B1 induced upregulation of protein arginine methyltransferase 5 in human cell lines.

    Ghufran, Md Sajid; Ghosh, Krishna; Kanade, Santosh R

    2016-09-01

    The exposure of naturally occurring mycotoxins affects human health and play a vital role in cancer initiation and progression. Aflatoxin B1 is a difuranocoumarin mycotoxin, classified as a group I carcinogen. The present study was conducted to assess the effect of aflatoxin B1 on epigenetic regulatory proteins. The protein arginine methyltransferase 5 expression was induced upon aflatoxin B1 treatment in a dose and time dependent manner. Further global arginine methylation was also increased in the same manner. This is the first report showing the induction of epigenetic regulatory protein, protein arginine methyltransferase 5 upon aflatoxin B1 treatment. Further study is required to establish the detailed pathway of PRMT5 induction. PMID:27242039

  5. Structure and possible mechanism of the CcbJ methyltransferase from Streptomyces caelestis

    Bauer, J.; Ondrovičová, G.; Najmanová, Lucie; Pevala, V.; Kameník, Zdeněk; Koštan, J.; Janata, Jiří; Kutejová, Eva

    2014-01-01

    Roč. 70, APR 2014 (2014), s. 943-957. ISSN 0907-4449 R&D Projects: GA MŠk(CZ) EE2.3.30.0003; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : CATECHOL-O-METHYLTRANSFERASE * SN2-LIKE TRANSITION-STATE * CRYSTAL-STRUCTURES Subject RIV: CE - Biochemistry Impact factor: 7.232, year: 2013

  6. Selenium induced selenocysteine methyltransferase gene expression and antioxidant enzyme activities in Astragalus chrysochlorus

    Çakir, Özgür; Turgut-Kara, Neslihan; Ari, Şule

    2016-01-01

    Astragalus sp. are used in folk medicine because of their biological activities and are known for the ability to accumulate high levels of selenium (Se). The purpose of this study was to explore gene expression of selenocysteine methyltransferase (SMT), responsible for forming MeSeCys, and activities of ascorbate peroxidase (APX), peroxidase (POX), catalase (CAT) and glutathione reductase (GR) enzymes in callus tissues of Astragalus chrysochlorus growing in different Se-containing media. Quan...

  7. Recombinant rat liver guanidinoacetate methyltransferase: Reactivity and function of sulfhydryl groups

    Rat liver guanidinoacetate methyltransferase, produced in Escherichia coli by recombinant DNA technique, possesses five cysteine residues per molecule. No disulfide bond is present. Analysis of the chymotryptic peptides derived from the iodo[14C]acetate-modified enzyme shows that Cys-90, Cys-15, Cys-219, and Cys-207 are alkylated by the reagent in order of decreasing reactivity. Incubation of the enzyme with excess 5,5'-dithiobis(2-nitrobenzoate) (DTNB) in the absence and presence of cystamine [2,2'-dithiobis(ethylamine)] causes the appearance of 4 and 5 mol of 2-nitro-5-mercaptobenzoate/mol of enzyme, respectively. Reaction of the methyltransferase with an equimolar amount of DTNB results in an almost quantitative disulfide cross-linking of Cys-15 and Cys-90 with loss of a large portion of the activity. The methyltransferase is completely inactivated by iodoacetate following nonlinear kinetics. Comparison of the extent of inactivation with that of modification of cysteine residues and the experiment with the enzyme whose Cys-15 and Cys-90 are cross-linked suggest that alkylation of Cys-15 and Cys-90 results in a partially active enzyme and that carboxymethylation of Cys-219 completely eliminates enzyme activity. The inactivation of guanidinoacetate methyltransferase by iodoacetate or DTNB is not protected by substrates. Furthermore, disulfide cross-linking of Cys-15 and Cys-90 or carboxymethylation of Cys-219 does not impair the enzyme's capacity to bind S-adenosylmethionine. Thus, these cysteine residues appear to occur outside the active-site region, but their integrity is crucial for the expression of enzyme activity

  8. Vector design for expression of O6-methylguanine-DNA methyltransferase in hematopoietic cells

    Schambach, Axel; Baum, Christopher

    2007-01-01

    Enhancing DNA repair activity of hematopoietic cells by stably integrating gene vectors that express O(6)-methylguanine-DNA-methyltransferase (MGMT) is of major interest for innovative approaches in tumor chemotherapy and for the control of hematopoietic chimerism in the treatment of multiple other acquired or inherited disorders. Crucial determinants of this selection principle are the stringency of treatment with O(6)-alkylating agents and the level of transgenic MGMT expression. Attempts t...

  9. Identification, Characterization, and Ontogenic Study of a Catechol O-methyltransferase from Zebrafish

    Alazizi, Adnan; Liu, Ming-Yih; Williams, Frederick E.; Kurogi, Katsuhisa; Sakakibara, Yoichi; Suiko, Masahito; Liu, Ming-Cheh

    2010-01-01

    To establish the zebrafish as a model for investigating the methylation pathway of drug metabolism, we embarked on the molecular cloning of the zebrafish catechol O-methyltransferase (COMT). By searching the GenBank database, a zebrafish nucleotide sequence encoding a putative COMT was identified. Based on the sequence information, we designed and synthesized oligonucleotides corresponding to its 5’- and 3’-coding regions of this zebrafish COMT. Using the first-strand cDNA reverse-transcribed...

  10. Expression of O6-methylguanine DNA methyltransferase (MGMT) and its clinical significance in gastroenteropancreatic neuroendocrine neoplasm

    Yang, Qiu-chen; Wang, Yu-Hong; Lin, Yuan; Xue, Ling; Chen, Yuan-Jia; Chen, Min-hu; Chen, Jie

    2014-01-01

    O6-methylguanine-DNA methyltransferase (MGMT) is a widespread DNA repair enzyme defending against mutation caused by guanine O6-alkylating agents. Until now, we know only little about the expression of MGMT in gastroenteropancreatic neuroendocrine neoplasm (GEP-NEN). To study the expression of MGMT and its clinical significance in GEP-NEN, 174 specimens of GEP-NEN were examined, of which 152 specimens came from The First Affiliated Hospital, Sun Yat-sen University during October 1995 to Novem...

  11. Survival and tumorigenesis in O6-methylguanine DNA methyltransferase-deficient mice following cyclophosphamide exposure

    Nagasubramanian, Ramamoorthy; Hansen, Ryan J.; Delaney, Shannon M.; Cherian, Mathew M.; Samson, Leona D.; Kogan, Scott C.; Dolan, M. Eileen

    2008-01-01

    O6-methylguanine DNA methyltransferase (MGMT) deficiency is associated with an increased susceptibility to alkylating agent toxicity. To understand the contribution of MGMT in protecting against cyclophosphamide (CP)-induced toxicity, mutagenesis and tumorigenesis, we compared the biological effects of this agent in transgenic Mgmt knockout and wild-type mice. In addition, neurofibromin (Nf1)+/− background was used to increase the likelihood of CP-induced tumorigenesis. Cohorts of Mgmt-profic...

  12. Somatic mutations in glioblastoma are associated with methylguanine-DNA methyltransferase methylation

    McDonald, Kerrie L.; Tabone, Tania; Nowak, Anna K; Erber, Wendy N.

    2015-01-01

    The high level of methylguanine-DNA methyltransferase (MGMT) in glioblastoma is responsible for resistance to alkylating agents, such as temozolomide (TMZ). In glioblastomas with a methylated MGMT promoter, MGMT deficiency is presumed, resulting in an enhanced effect of TMZ. The aim of the present study was to investigate whether genomic alterations work synergistically with MGMT methylation status and contribute to the response to treatment and overall prognosis in glioblastoma. The current ...

  13. Deficiency of Glycine N-Methyltransferase Aggravates Atherosclerosis in Apolipoprotein E–Null Mice

    Chen, Chien-Yu; Ching, Li-Chieh; Liao, Yi-Jen; Yu, Yuan-Bin; Tsou, Chia-Yuan; Shyue, Song-Kun; Chen, Yi-Ming Arthur; Lee, Tzong-Shyuan

    2012-01-01

    The mechanism underlying the dysregulation of cholesterol metabolism and inflammation in atherogenesis is not understood fully. Glycine N-methyltransferase (GNMT) has been implicated in hepatic lipid metabolism and the pathogenesis of liver diseases. However, little is known about the significance of GNMT in atherosclerosis. We showed the predominant expression of GNMT in foamy macrophages of mouse atherosclerotic aortas. Genetic deletion of GNMT exacerbated the hyperlipidemia, inflammation a...

  14. Nicotinamide N-methyltransferase knockdown protects against diet-induced obesity

    Kraus, Daniel; Yang, Qin; Kong, Dong; Banks, Alexander S.; Zhang, Lin; Rodgers, Joseph T; Pirinen, Eija; Pulinilkunnil, Thomas C.; Gong, Fengying; Wang, Ya-chin; Cen, Yana; Sauve, Anthony A.; Asara, John M.; Peroni, Odile D.; Monia, Brett P.

    2014-01-01

    In obesity and type 2 diabetes, Glut4 glucose transporter expression is decreased selectively in adipocytes1. Adipose-specific knockout or overexpression of Glut4 alters systemic insulin sensitivity2. Here we show, using DNA array analyses, that nicotinamide N-methyltransferase (Nnmt) is the most strongly reciprocally regulated gene when comparing gene expression in white adipose tissue (WAT) from adipose-specific Glut4-knockout or adipose-specific Glut4-overexpressing mice with their respect...

  15. Homocysteine Induces Collagen I Expression by Downregulating Histone Methyltransferase G9a

    Lei, Wenjing; Long, Yanjun; LI, Shuang; Liu, Ze; Zhu, Fengxin; Hou, Fan Fan; Nie, Jing

    2015-01-01

    Hyperhomocysteinemia (HHcy) leads to several clinical manifestations including hepatic fibrosis. Excess deposition of extracellular matrix (ECM) components including collagen is the eponymous lesion of liver fibrosis. In this study, we demonstrated that elevated concentration of Hcy induced the expression of collagen type I in cultured human liver cells as well as in liver tissue of HHcy mice. Meanwhile, Hcy inhibited the expression of histone methyltransferase G9a. Mechanistically, silencing...

  16. Histone H3K9 methyltransferase G9a represses PPARγ expression and adipogenesis

    Wang, Lifeng; Xu, Shiliyang; Lee, Ji-Eun; Baldridge, Anne; Grullon, Sean; Peng, Weiqun; Ge, Kai

    2012-01-01

    PPARγ promotes adipogenesis while Wnt proteins inhibit adipogenesis. However, the mechanisms that control expression of these positive and negative master regulators of adipogenesis remain incompletely understood. By genome-wide histone methylation profiling in preadipocytes, we find that among gene loci encoding adipogenesis regulators, histone methyltransferase (HMT) G9a-mediated repressive epigenetic mark H3K9me2 is selectively enriched on the entire PPARγ locus. H3K9me2 and G9a levels dec...

  17. HISTONE H3 LYSINE 9 METHYLTRANSFERASE G9a IS A TRANSCRIPTIONAL COACTIVATOR FOR NUCLEAR RECEPTORS*

    David Y. Lee; Northrop, Jeffrey P.; Kuo, Min-Hao; Stallcup, Michael R.

    2006-01-01

    Methylation of Lys-9 of histone H3 has been associated with repression of transcription. G9a is a histone H3 Lys-9 methyltransferase localized in euchromatin and acts as a corepressor for specific transcription factors. Here we demonstrate that G9a also functions as a coactivator for nuclear receptors, cooperating synergistically with nuclear receptor coactivators GRIP1, CARM1, and p300 in transient transfection assays. This synergy depends strongly on the arginine-specific protein methyltran...

  18. The methyltransferase G9a regulates HoxA9-dependent transcription in AML

    Lehnertz, Bernhard; Pabst, Caroline; Su, Le; Miller, Michelle; Liu, Feng; Yi, Lin; Zhang, Regan; Krosl, Jana; Yung, Eric; Kirschner, Jeanette; Rosten, Patty; Underhill, T. Michael; Jin, Jian; Hébert, Josée; Sauvageau, Guy

    2014-01-01

    Lehnertz et al. identify the histone methyltransferase G9a as a selective regulator of fast proliferating myeloid progenitors with no discernible function in hematopoietic stem cells. Loss of G9a significantly delays disease progression and reduces leukemia stem cell frequency in mouse models of acute myeloid leukemia. G9a interacts with the leukemogenic transcription factor HoxA9 and regulates HoxA9-dependent transcription. These results highlight G9a inhibition as a means to counteract the ...

  19. CCAAT displacement protein/cut homolog recruits G9a histone lysine methyltransferase to repress transcription

    Nishio, Hitomi; Walsh, Martin J.

    2004-01-01

    CCAAT displacement protein/cut homolog (CDP/cut) is a highly conserved homeodomain protein that contains three cut repeat sequences. CDP/cut is a transcriptional factor for many diverse cellular and viral genes that are involved in most cellular processes, including differentiation, development, and proliferation. Here, we report that CDP/cut interacts with a histone lysine methyltransferase (HKMT), G9a, in vivo and in vitro. The deletion of the cut repeats within CDP/cut abrogates the intera...

  20. Negative Regulation of JAK2 by H3K9 Methyltransferase G9a in Leukemia

    Son, Hye-Ju; Kim, Ji-Young; Hahn, Yoonsoo; Seo, Sang-Beom

    2012-01-01

    Histone methylation at specific lysine residues is a crucial regulatory process in transcriptional regulation. Using chromatin immunoprecipitation with microarray technology (ChIP-chip) analysis, we found that the H3K9-me2 target gene JAK2 was an important factor during differentiation of the HL-60 promyelocytic leukemia cell line by all-trans-retinoic acid (ATRA) treatment. Here, we report that the H3K9 methyltransferase G9a negatively regulated JAK2 transcription in histone methyltransferas...

  1. Three-dimensional culture sensitizes epithelial ovarian cancer cells to EZH2 methyltransferase inhibition

    Amatangelo, Michael D.; Garipov, Azat; Li, Hua; Conejo-Garcia, Jose R.; Speicher, David W.; Zhang, Rugang

    2013-01-01

    Inhibitors of EZH2 methyltransferase activity have been demonstrated to selectively suppress the growth of diffused large B cell lymphoma (DLBCL) cells with gain-of-function mutations in EZH2, while exhibiting very limited effects on the growth of DLBCL cells with wild-type EZH2. Given that EZH2 is often overexpressed but not mutated in solid tumors, it is important to investigate the determinants of sensitivity of solid tumor cells to EZH2 inhibitors. In the current study, we show that three-dimensional (3D) culture of epithelial ovarian cancer (EOC) cells that overexpress EZH2 sensitizes these cells to EZH2 methyltransferase inhibition. Treatment of EOC cells with GSK343, a specific inhibitor of EZH2 methyltransferase, decreases the level of H3K27Me3, the product of EZH2’s enzymatic activity. However, GSK343 exhibited limited effects on the growth of EOC cells in conventional two-dimensional (2D) culture. In contrast, GSK343 significantly suppressed the growth of EOC cells cultured in 3D matrigel extracellular matrix (ECM), which more closely mimics the tumor microenvironment in vivo. Notably, GSK343 induces apoptosis of EOC cells in 3D but not 2D culture. In addition, GSK343 significantly inhibited the invasion of EOC cells. In summary, we show that the 3D ECM sensitizes EOC cells to EZH2 methyltransferase inhibition, which suppresses cell growth, induces apoptosis and inhibits invasion. Our findings imply that in EZH2 wild-type solid tumors, the ECM tumor microenvironment plays an important role in determining sensitivity to EZH2 inhibition and suggest that targeting the ECM represents a novel strategy for enhancing EZH2 inhibitor efficacy. PMID:23759589

  2. Kupplung der DNA-Methyltransferase M.SssI mit Triplehelix-bildenden Oligodesoxynucleotiden

    Monami, Amélie Joséphine

    2007-01-01

    DNA modifying enzymes, like DNA methyltransferases (DNA MTases) and restriction endonucleases (REases), could in principle be used to map or manipulate genomes. However, these enzymes are inappropriate for that purpose because of their generally short recognition sequences. An increase of their sequence specificity would therefore be desirable. One strategy to produce megaspecific DNA modifying enzymes is to couple them with triple helix forming oligodeoxynucleotide (TFO). These additional DN...

  3. Catecholamine-o-methyltransferase polymorphisms are associated with postoperative pain intensity.

    Lee, Peter J

    2011-02-01

    single nucleotide polymorphisms (SNPs) in the genes for catecholamine-O-methyltransferase (COMT), μ-opioid receptor and GTP cyclohydrolase (GCH1) have been linked to acute and chronic pain states. COMT polymorphisms are associated with experimental pain sensitivity and a chronic pain state. No such association has been identified perioperatively. We carried out a prospective observational clinical trial to examine associations between these parameters and the development of postoperative pain in patients undergoing third molar (M3) extraction.

  4. Identification and Characterization of a Highly Conserved Crenarchaeal Protein Lysine Methyltransferase with Broad Substrate Specificity

    Chu, Yindi; Zhang, Zhenfeng; Wang, Qian; Luo, Yuanming; Huang, Li

    2012-01-01

    Protein lysine methylation occurs extensively in the Crenarchaeota, a major kingdom in the Archaea. However, the enzymes responsible for this type of posttranslational modification have not been found. Here we report the identification and characterization of the first crenarchaeal protein lysine methyltransferase, designated aKMT, from the hyperthermophilic crenarchaeon Sulfolobus islandicus. The enzyme was capable of transferring methyl groups to selected lysine residues in a substrate prot...

  5. Genetic, physiological and biochemical characterization of multiple methanol methyltransferase isozymes in Methanosarcina acetivorans C2A.

    Pritchett, Matthew A; Metcalf, William W

    2005-06-01

    Biochemical evidence suggests that methanol catabolism in Methanosarcina species requires the concerted effort of methanol:5-hydroxybenzimidazolylcobamide methyltransferase (MtaB), a corrinoid-containing methyl-accepting protein (MtaC) and Co-methyl-5-hydroxybenzimidazolylcobamide:2-mercapto-ethanesulphonic acid methyltransferase (MtaA). Here we show that Methanosarcina acetivorans possesses three operons encoding putative methanol-specific MtaB and corrinoid proteins: mtaCB1, mtaCB2 and mtaCB3. Deletion mutants lacking the three operons, in all possible combinations, were constructed and characterized. Strains deleted for any two of the operons grew on methanol, whereas strains lacking all three did not. Therefore, each operon encodes a bona fide methanol-utilizing MtaB/corrinoid protein pair. Most of the mutants were similar to the wild-type strain, with the exception of the DeltamtaCB1 DeltamtaCB2 double mutant, which grew more slowly and had reduced cell yields on methanol medium. However, all mutants displayed significantly longer lag times when switching from growth on trimethylamine to growth on methanol. This indicates that all three operons are required for wild-type growth on methanol and suggests that each operon has a distinct role in the metabolism of this substrate. The combined methanol:CoM methyltransferase activity of strains carrying only mtaCB1 was twofold higher than strains carrying only mtaCB2 and fourfold higher than strains carrying only mtaCB3. Interestingly, the presence of the mtaCB2 and mtaCB3 operons, in addition to the mtaCB1 operon, did not increase the overall methyltransferase activity, suggesting that these strains may be limited by MtaA availability. All deletion mutants were unaffected with respect to growth on trimethylamine and acetate corroborating biochemical evidence indicating that each methanogenic substrate has specific methyltransfer enzymes. PMID:15882413

  6. The histone methyltransferase and putative oncoprotein MMSET is overexpressed in a large variety of human tumors

    Hudlebusch, Heidi Rye; Santoni-Rugiu, Eric; Simon, Ronald;

    2011-01-01

    Multiple myeloma SET (Suppressor of variegation, Enhancer of zeste, and Trithorax) domain (MMSET) is a histone lysine methyltransferase deregulated in a subgroup of multiple myelomas with the t(4;14)(p16;q32) translocation and poor prognosis. With the aim of understanding, if MMSET can be involve...... in other types of cancer we investigated the expression of MMSET protein in different types of human tumors....

  7. Is catechol-o-methyltransferase gene polymorphism a risk factor in the development of premenstrual syndrome?

    Deveci, Esma Ozturk; Incebiyik, Adnan; Selek, Salih; Camuzcuoglu, Aysun; Hilali, Nese Gul; Camuzcuoglu, Hakan; Erdal, Mehmet Emin; Vural, Mehmet

    2014-01-01

    Objective The objective of this study was to investigate whether there was a correlation between catechol-o-methyltransferase (COMT) gene polymorphism, which is believed to play a role in the etiology of psychotic disorders, and premenstrual syndrome (PMS). Methods Fifty-three women with regular menstrual cycles, aged between 18 and 46 years and diagnosed with PMS according to the American Congress of Obstetrics and Gynecology criteria were included in this study as the study group, and 53 he...

  8. Sensorimotor gating of schizophrenia patients depends on catechol O-methyltransferase Val158Met polymorphism

    Quednow, B B; Wagner, M.; Mössner, R; Maier, W; Kühn, K U

    2010-01-01

    It has been recently shown that Catechol O-methyltransferase (COMT) Val(158)Met polymorphism strongly influences prepulse inhibition (PPI) of the acoustic startle response (ASR) in healthy human volunteers. Given that schizophrenia patients exhibit impairment in PPI and that COMT is a putative susceptibility gene for schizophrenia, we investigated the impact of the COMT Val(158)Met polymorphisms on PPI in schizophrenic inpatients. We analyzed COMT Val(158)Met polymorphisms and assessed startl...

  9. Genetic Contribution of Catechol-O-methyltransferase Polymorphism in Patients with Migraine without Aura

    Park, Jeong Wook; Lee, Kwang Soo; Kim, Joong Seok; Kim, Yeong In; Shin, Hae Eun

    2007-01-01

    Background Recent genetic association studies have investigated the possible genetic role of the dopaminergic system in migraine. Catechol-O-methyltransferase (COMT) is an enzyme that plays a crucial role in the metabolism of dopamine and its genetic polymorphism is associated with three- to fourfold variation of enzymatic activity. Objectives The objective of this study was to elucidate the role of the COMT polymorphism in the genetic susceptibility to migraine and its phenotypic expression ...

  10. Polymorphism of the catechol-O-methyltransferase gene in Han Chinese patients with psoriasis vulgaris

    Lin Gao; Hong Li; Kai Li; Zhu Shen; Ling Liu; Chunying Li; Zhengdong Zhang; Yufeng Liu

    2009-01-01

    Psoriasis vulgaris is defined by a series of linked cellular changes in the skin: hyperplasia of epidermal keratinocytes, vascular hyperplasia and ectasia, and infiltration of T lymphocytes, neutrophils and other types of leukocytes in the affected skin. Catechol-O-methyltransferase ( COMT ) 158 polymorphism can reduce the activity of the COMT enzyme that may trigger defective differentiation of keratinocytes in psoriasis. Immunocytes can degrade and inactivate catecholamines via monamine oxi...

  11. Catechol-O-methyltransferase (COMT) influences the connectivity of the prefrontal cortex at rest

    Tunbridge, Elizabeth M.; Farrell, Sarah M.; Harrison, Paul J; Mackay, Clare E

    2013-01-01

    Catechol-O-methyltransferase (COMT) modulates dopamine in the prefrontal cortex (PFC) and influences PFC dopamine-dependent cognitive task performance. A human COMT polymorphism (Val158Met) alters enzyme activity and is associated with both the activation and functional connectivity of the PFC during task performance, particularly working memory. Here, we used functional magnetic resonance imaging and a data-driven, independent components analysis (ICA) approach to compare resting state funct...

  12. Polymorphism of the catechol-O-methyltransferase gene in Han Chinese patients with psoriasis vulgaris

    Gao, Lin; Li, Hong; Li, Kai; Shen, Zhu; Liu, Ling; Li, Chunying; Zhang, Zhengdong; Liu, Yufeng

    2009-01-01

    Psoriasis vulgaris is defined by a series of linked cellular changes in the skin: hyperplasia of epidermal keratinocytes, vascular hyperplasia and ectasia, and infiltration of T lymphocytes, neutrophils and other types of leukocytes in the affected skin. Catechol-O-methyltransferase (COMT) 158 polymorphism can reduce the activity of the COMT enzyme that may trigger defective differentiation of keratinocytes in psoriasis. Immunocytes can degrade and inactivate catecholamines via monamine oxida...

  13. Towards more specific O6-Methylguanine-DNA methyltransferase (MGMT) inactivators

    CORDEIRO MACHADO, ALESSANDRA; MC MURRY, THOMAS; Rozas, Isabel

    2011-01-01

    PUBLISHED Searching for a novel family of inactivators of the human DNA repair protein O6?methylguanine?DNA methyltransferase (MGMT) which is known to bind to the DNA minor groove, we have computationally modelled and synthesised two series of 2?amino?6?aryloxy?5?nitropyrimidines with morpholino or aminodiaryl substituents (potential minor groove binders) at the 4?position. Synthesis of these compounds was achieved by successive substitution of each of the two Cl atoms of 2?amino?4,6?dichl...

  14. miR-221/222 Target the DNA Methyltransferase MGMT in Glioma Cells

    Cristina Quintavalle; Davide Mangani; Giuseppina Roscigno; Giulia Romano; Angel Diaz-Lagares; Margherita Iaboni; Elvira Donnarumma; Danilo Fiore; Pasqualino De Marinis; Ylermi Soini; Manel Esteller; Gerolama Condorelli

    2013-01-01

    Glioblastoma multiforme (GBM) is one of the most deadly types of cancer. To date, the best clinical approach for treatment is based on administration of temozolomide (TMZ) in combination with radiotherapy. Much evidence suggests that the intracellular level of the alkylating enzyme O(6)-methylguanine-DNA methyltransferase (MGMT) impacts response to TMZ in GBM patients. MGMT expression is regulated by the methylation of its promoter. However, evidence indicates that this is not the only regula...

  15. O6-methylguanine-DNA methyltransferase (MGMT): can function explain a suicidal mechanism?

    Gouws, Chrisna; Pretorius, Petrus Jacobus

    2011-01-01

    Why does O6-methylguanine-DNA methyltransferase (MGMT), an indispensable DNA repair enzyme, have a mechanism which seems to run counter to its importance? This enzyme is key to the removal of detrimental alkyl adducts from guanine bases. Although the mechanism is well known, an unusual feature surrounds its mode of action, which is its so-called suicidal endpoint. In addition, induction of MGMT is highly variable and its kinetics is atypical. These features raise some questions on the seeming...

  16. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  17. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    William Orsi

    Full Text Available The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC, nitrate, sulfide, and dissolved inorganic carbon (DIC. These correlations are supported by terminal restriction length polymorphism (TRFLP analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  18. Arsenic (+3 oxidation state) methyltransferase and the inorganic arsenic methylation phenotype

    Inorganic arsenic is enzymatically methylated; hence, its ingestion results in exposure to the parent compound and various methylated arsenicals. Both experimental and epidemiological evidences suggest that some of the adverse health effects associated with chronic exposure to inorganic arsenic may be mediated by these methylated metabolites. If i As methylation is an activation process, then the phenotype for inorganic arsenic methylation may determine risk associated with exposure to this metalloid. We examined inorganic arsenic methylation phenotypes and arsenic (+3 oxidation state) methyltransferase genotypes in four species: three that methylate inorganic arsenic (human (Homo sapiens), rat (Rattus norwegicus), and mouse (Mus musculus)) and one that does not methylate inorganic arsenic (chimpanzee, Pan troglodytes). The predicted protein products from arsenic (+3 oxidation state) methyltransferase are similar in size for rat (369 amino acid residues), mouse (376 residues), and human (375 residues). By comparison, a 275-nucleotide deletion beginning at nucleotide 612 in the chimpanzee gene sequence causes a frameshift that leads to a nonsense mutation for a premature stop codon after amino acid 205. The null phenotype for inorganic arsenic methylation in the chimpanzee is likely due to the deletion in the gene for arsenic (+3 oxidation state) methyltransferase that yields an inactive truncated protein. This lineage-specific loss of function caused by the deletion event must have occurred in the Pan lineage after Homo-Pan divergence about 5 million years ago

  19. Chromatin Targeting of de Novo DNA Methyltransferases by the PWWP Domain

    Ying-ZiGe; Min-TiePu; HumairaGowher; Hai-PingWu; Jian-PingDing; AlbertJeltsch; Guo-LiangXu

    2005-01-01

    DNA methylation patterns of mammalian genomes are generated in gametogenesis and early embryonic development. Two de novo DNA methyltransferases, Dnmt3a and Dnmt3b, are responsible for the process. Both en-zymes contain a long N-terminal regulatory region linked to a conserved C-terminal domain responsible forthe catalytic activity. Although a PWWP domain in the N-terminal region has been shown to bind DNA in vitro, it is unclear how the DNA methyltransferases access their substrate in chromatin in vivo. We show here that the two proteins are associated with chromatin including mitotic chromosomes in mammalian cells, and the PWWP domain is essential for the chromatin targeting of the enzymes. The functional significance of PWWPmediated chromatin targeting is suggested by the fact that a missense mutation in this domain of human DNMT3B causes immunodeficiency, centromeric heterochromatin instability, facial anomalies (ICF) syndrome, which is characterized by loss of methylation insatellite DNA, pericentromeric instability, and immunodeficiency. We demonstrate that the mutant protein completely loses its chromatin targeting capacity. Our data establish the PWWP domain as a novel chromatin/chromosome-targeting module and suggest that the PWWP-mediated chromatin association is essential for the function of the de novo methyltransferases during development.

  20. Transcriptome profiling of Set5 and Set1 methyltransferases: Tools for visualization of gene expression

    Glòria Mas Martín

    2014-12-01

    Full Text Available Cells regulate transcription by coordinating the activities of multiple histone modifying complexes. We recently identified the yeast histone H4 methyltransferase Set5 and discovered functional overlap with the histone H3 methyltransferase Set1 in gene expression. Specifically, using next-generation RNA sequencing (RNA-Seq, we found that Set5 and Set1 function synergistically to regulate specific transcriptional programs at subtelomeres and transposable elements. Here we provide a comprehensive description of the methodology and analysis tools corresponding to the data deposited in NCBI's Gene Expression Omnibus (GEO under the accession number GSE52086. This data complements the experimental methods described in Mas Martín G et al. (2014 and provides the means to explore the cooperative functions of histone H3 and H4 methyltransferases in the regulation of transcription. Furthermore, a fully annotated R code is included to enable researchers to use the following computational tools: comparison of significant differential expression (SDE profiles; gene ontology enrichment of SDE; and enrichment of SDE relative to chromosomal features, such as centromeres, telomeres, and transposable elements. Overall, we present a bioinformatics platform that can be generally implemented for similar analyses with different datasets and in different organisms.

  1. Rapid restriction enzyme free detection of DNA methyltransferase activity based on DNA-templated silver nanoclusters.

    Kermani, Hanie Ahmadzade; Hosseini, Morteza; Dadmehr, Mehdi; Ganjali, Mohammad Reza

    2016-06-01

    DNA methylation has significant roles in gene regulation. DNA methyltransferase (MTase) enzyme characterizes DNA methylation and also induces an aberrant methylation pattern that is related to many diseases, especially cancers. Thus, it is required to develop a method to detect the DNA MTase activity. In this study, we developed a new sensitive and reliable method for methyltransferase activity assay by employing DNA-templated silver nanoclusters (DNA/Ag NCs) without using restriction enzymes. The Ag NCs have been utilized for the determination of M.SssI MTase activity and its inhibition. We designed an oligonucleotide probe which contained an inserted six-cytosine loop as Ag NCs formation template. The changes in fluorescence intensity were monitored to quantify the M.SssI activity. The fluorescence spectra showed a linear decrease in the range of 0.4 to 20 U/ml with a detection limit of 0.1 U/ml, which was significant compared with previous reports. The proposed method was applied successfully for demonstrating the Gentamicin effect as MTase inhibitor. The proposed method showed convenient reproducibility and sensitivity indicating its potential for the determination of methyltransferase activity. PMID:27052776

  2. miR-29 Represses the Activities of DNA Methyltransferases and DNA Demethylases

    Izuho Hatada

    2013-07-01

    Full Text Available Members of the microRNA-29 (miR-29 family directly target the DNA methyltransferases, DNMT3A and DNMT3B. Disturbances in the expression levels of miR-29 have been linked to tumorigenesis and tumor aggressiveness. Members of the miR-29 family are currently thought to repress DNA methylation and suppress tumorigenesis by protecting against de novo methylation. Here, we report that members of the miR-29 family repress the activities of DNA methyltransferases and DNA demethylases, which have opposing roles in control of DNA methylation status. Members of the miR-29 family directly inhibited DNA methyltransferases and two major factors involved in DNA demethylation, namely tet methylcytosine dioxygenase 1 (TET1 and thymine DNA glycosylase (TDG. Overexpression of miR-29 upregulated the global DNA methylation level in some cancer cells and downregulated DNA methylation in other cancer cells, suggesting that miR-29 suppresses tumorigenesis by protecting against changes in the existing DNA methylation status rather than by preventing de novo methylation of DNA.

  3. Purification of homologous protein carboxyl methyltransferase isozymes from human and bovine erythrocytes

    The authors have purified the two major isozymes of the L-isoaspartyl/D-aspartyl protein methyltransferase from both human and bovine erythrocytes. These four enzymes all have polypeptide molecular weights of approximately 26,500 and appear to be monomers in solution. Each of these enzymes cross-reacts with antibodies directed against protein carboxyl methyltransferase I from bovine brain. Their structures also appear to be similar when analyzed by dodecyl sulfate gel electrophoresis for the large fragments produced by digestion with Staphylococcus aureus protease V8 or when analyzed by high-performance liquid chromatography (HPLC) for tryptic peptides. The structural relatedness of these enzymes was confirmed by sequence analysis of a total of 433 residues in 32 tryptic fragments of the human erythrocyte isozymes I and II and of the bovine erythrocyte isozyme II. They found sequence identity or probable identity in 111 out of 112 residues when they compared the human isozymes I and II and identities in 127 out of 134 residues when the human and bovine isozymes II were compared. These results suggest that the erythrocyte isozymes from both organisms may have nearly identical structures and confirm the similarities in the function of these methyltransferases that have been previously demonstrated

  4. Preliminary characterization of (nucleoside-2′-O-)-methyltransferase crystals from Meaban and Yokose flaviviruses

    Mastrangelo, Eloise; Bollati, Michela; Milani, Mario [Department of Biomolecular Sciences and Biotechnology, CNR-INFM, University of Milano, Via Celoria 26, 20133 Milano (Italy); Lamballeire, Xavier de; Brisbare, Nadege [Unité des Virus Emergents, Faculté de Médecine, 27 Boulevard Jean Moulin, 13005 Marseille (France); Dalle, Karen; Lantez, Violaine; Egloff, Marie-Pierre; Coutard, Bruno; Canard, Bruno [Laboratoire Architecture et Fonction des Macromolécules Biologiques, UMR 6098 CNRS ESIL, Case 932, 163 Avenue de Luminy, 13288 Marseille CEDEX 9 (France); Gould, Ernest; Forrester, Naomi [CEH Oxford, Mansfield Road, Oxford OX1 3SR (United Kingdom); Bolognesi, Martino, E-mail: martino.bolognesi@unimi.it [Department of Biomolecular Sciences and Biotechnology, CNR-INFM, University of Milano, Via Celoria 26, 20133 Milano (Italy)

    2006-08-01

    Two methyltransferases from flaviviruses (Meaban and Yokose viruses) have been overexpressed and crystallized. Diffraction data and characterization of the two crystal forms are presented, together with a preliminary molecular-replacement solution for both enzymes. Viral methyltranferases (MTase) are involved in the third step of the mRNA-capping process, transferring a methyl group from S-adenosyl-l-methionine (SAM) to the capped mRNA. MTases are classified into two groups: (guanine-N7)-methyltransferases (N7MTases), which add a methyl group onto the N7 atom of guanine, and (nucleoside-2′-O-)-methyltransferases (2′OMTases), which add a methyl group to a ribose hydroxyl. The MTases of two flaviviruses, Meaban and Yokose viruses, have been overexpressed, purified and crystallized in complex with SAM. Characterization of the crystals together with details of preliminary X-ray diffraction data collection (at 2.8 and 2.7 Å resolution, respectively) are reported here. The sequence homology relative to Dengue virus 2′OMTase and the structural conservation of specific residues in the putative active sites suggest that both enzymes belong to the 2′OMTase subgroup.

  5. MtrA of the sodium ion pumping methyltransferase binds cobalamin in a unique mode.

    Wagner, Tristan; Ermler, Ulrich; Shima, Seigo

    2016-01-01

    In the three domains of life, vitamin B12 (cobalamin) is primarily used in methyltransferase and isomerase reactions. The methyltransferase complex MtrA-H of methanogenic archaea has a key function in energy conservation by catalysing the methyl transfer from methyl-tetrahydromethanopterin to coenzyme M and its coupling with sodium-ion translocation. The cobalamin-binding subunit MtrA is not homologous to any known B12-binding proteins and is proposed as the motor of the sodium-ion pump. Here, we present crystal structures of the soluble domain of the membrane-associated MtrA from Methanocaldococcus jannaschii and the cytoplasmic MtrA homologue/cobalamin complex from Methanothermus fervidus. The MtrA fold corresponds to the Rossmann-type α/β fold, which is also found in many cobalamin-containing proteins. Surprisingly, the cobalamin-binding site of MtrA differed greatly from all the other cobalamin-binding sites. Nevertheless, the hydrogen-bond linkage at the lower axial-ligand site of cobalt was equivalently constructed to that found in other methyltransferases and mutases. A distinct polypeptide segment fixed through the hydrogen-bond linkage in the relaxed Co(III) state might be involved in propagating the energy released upon corrinoid demethylation to the sodium-translocation site by a conformational change. PMID:27324530

  6. Molecular phylogeny of Pneumocystis based on 5.8S rRNA gene and the internal transcribed spacers of rRNA gene sequences

    2008-01-01

    To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis.

  7. Primary and secondary structures of Tetrahymena and aphid 5.8S rRNAs: structural features of 5.8S rRNA which interacts with the 28S rRNA containing the hidden break.

    Fujiwara, H.; H. Ishikawa

    1982-01-01

    The Tetrahymena 5.8S rRNA is 154 nucleotides long, the shortest so far reported except for the split 5.8S rRNAs of Diptera (m5.8S plus 2S rRNA). In this molecule several nucleotides are deleted in the helix e (GC-rich stem) region. Upon constructing the secondary structure in accordance with "burp-gun" model, the Tetrahymena 5.8S rRNA forms a wide-open "muzzle" of the terminal regions due to both extra nucleotides and several unpaired bases. The aphid 5.8S rRNA consists of 161 nucleotides and...

  8. Exploring microbial diversity and taxonomy using SSU rRNA hypervariable tag sequencing.

    Susan M Huse

    2008-11-01

    Full Text Available Massively parallel pyrosequencing of hypervariable regions from small subunit ribosomal RNA (SSU rRNA genes can sample a microbial community two or three orders of magnitude more deeply per dollar and per hour than capillary sequencing of full-length SSU rRNA. As with full-length rRNA surveys, each sequence read is a tag surrogate for a single microbe. However, rather than assigning taxonomy by creating gene trees de novo that include all experimental sequences and certain reference taxa, we compare the hypervariable region tags to an extensive database of rRNA sequences and assign taxonomy based on the best match in a Global Alignment for Sequence Taxonomy (GAST process. The resulting taxonomic census provides information on both composition and diversity of the microbial community. To determine the effectiveness of using only hypervariable region tags for assessing microbial community membership, we compared the taxonomy assigned to the V3 and V6 hypervariable regions with the taxonomy assigned to full-length SSU rRNA sequences isolated from both the human gut and a deep-sea hydrothermal vent. The hypervariable region tags and full-length rRNA sequences provided equivalent taxonomy and measures of relative abundance of microbial communities, even for tags up to 15% divergent from their nearest reference match. The greater sampling depth per dollar afforded by massively parallel pyrosequencing reveals many more members of the "rare biosphere" than does capillary sequencing of the full-length gene. In addition, tag sequencing eliminates cloning bias and the sequences are short enough to be completely sequenced in a single read, maximizing the number of organisms sampled in a run while minimizing chimera formation. This technique allows the cost-effective exploration of changes in microbial community structure, including the rare biosphere, over space and time and can be applied immediately to initiatives, such as the Human Microbiome Project.

  9. Strength and Regulation of Seven rRNA Promoters in Escherichia coli.

    Michihisa Maeda

    Full Text Available The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed.

  10. A yeast transcription system for the 5S rRNA gene.

    Keulen, H.; Thomas, D. Y.

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA gen...

  11. Oligonucleotide Fingerprinting of rRNA Genes for Analysis of Fungal Community Composition

    Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

    2002-01-01

    Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones d...

  12. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    Cangelosi, G A; Brabant, W H

    1997-01-01

    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA prob...

  13. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  14. TaxMan: a server to trim rRNA reference databases and inspect taxonomic coverage

    Brandt, B. W.; Bonder, M. J.; Huse, S.M.; Zaura, E.

    2012-01-01

    Amplicon sequencing of the hypervariable regions of the small subunit ribosomal RNA gene is a widely accepted method for identifying the members of complex bacterial communities. Several rRNA gene sequence reference databases can be used to assign taxonomic names to the sequencing reads using BLAST, USEARCH, GAST or the RDP classifier. Next-generation sequencing methods produce ample reads, but they are short, currently ∼100-450 nt (depending on the technology), as compared to the full rRNA g...

  15. In Vivo Effect of NusB and NusG on rRNA Transcription Antitermination

    Torres, Martha; Balada, Joan-Miquel; Zellars, Malcolm; Squires, Craig; Squires, Catherine L.

    2004-01-01

    Similarities between lambda and rRNA transcription antitermination have led to suggestions that they involve the same Nus factors. However, direct in vivo confirmation that rRNA antitermination requires all of the lambda Nus factors is lacking. We have therefore analyzed the in vivo role of NusB and NusG in rRNA transcription antitermination and have established that both are essential for it. We used a plasmid test system in which reporter gene mRNA was measured to monitor rRNA antiterminato...

  16. The catechol-O-methyltransferase inhibitory potential of Z-vallesiachotamine by in silicoand in vitro approaches

    Carolina dos Santos Passos

    2015-08-01

    Full Text Available AbstractZ-Vallesiachotamine is a monoterpene indole alkaloid that has a β-N-acrylate group in its structure. This class of compounds has already been described in different Psychotriaspecies. Our research group observed that E/Z-vallesiachotamine exhibits a multifunctional feature, being able to inhibit targets related to neurodegeneration, such as monoamine oxidase A, sirtuins 1 and 2, and butyrylcholinesterase enzymes. Aiming at better characterizing the multifunctional profile of this compound, its effect on cathecol-O-methyltransferase activity was investigated. The cathecol-O-methyltransferase activity was evaluated in vitro by a fluorescence-based method, using S-(5′-adenosyl-l-methionine as methyl donor and aesculetin as substrate. The assay optimization was performed varying the concentrations of methyl donor (S-(5′-adenosyl-l-methionine and enzyme. It was observed that the highest concentrations of both factors (2.25 U of the enzyme and 100 µM of S-(5′-adenosyl-l-methionine afforded the more reproducible results. The in vitro assay demonstrated that Z-vallesiachotamine was able to inhibit the cathecol-O-methyltransferase activity with an IC50 close to 200 µM. Molecular docking studies indicated that Z-vallesiachotamine can bind the catechol pocket of catechol-O-methyltransferase enzyme. The present work demonstrated for the first time the inhibitory properties of Z-vallesiachotamine on cathecol-O-methyltransferase enzyme, affording additional evidence regarding its multifunctional effects in targets related to neurodegenerative diseases.

  17. The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

    Hori, H; Sawada, M.; Osawa, S; Murao, K; Ishikura, H

    1981-01-01

    The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

  18. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten; Dalgaard, Jacob; Lykke-Andersen, Jens; Phan, Hoa T.N.; Trevisanato, Siro; Østergaard, Laust; Larsen, Niels; Leffers, Henrik

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows is a...

  19. An alternative strategy for bacterial ribosome synthesis: Bacillus subtilis rRNA transcription regulation

    Krásný, Libor; Gourse, Richard. L.

    2004-01-01

    Roč. 23, č. 22 (2004), s. 4473-4483. ISSN 0261-4189 Grant ostatní: National Institutes of Health(US) RO1 GM37048 Institutional research plan: CEZ:AV0Z5052915 Keywords : B. subtilis , GTP concentrations, rRNA transcription Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 10.492, year: 2004

  20. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    van Wezel, G P; Krab, I M; Douthwaite, S; Bibb, M J; Vijgenboom, E; Bosch, L

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, correspondi...

  1. Supramolecular hydrogel of kanamycin selectively sequesters 16S rRNA

    Yang, Zhimou; Kuang, Yi; Li, Xinming; Zhou, Ning; Zhang, Ye; Xu, Bing

    2012-01-01

    As the first example of hydrogelator derived from aminoglycoside antibiotics, the hydrogel of kanamycin indicates that the hydrogel of aminoglycosides preserve the specific interaction with their macromolecular targets (e.g., 16S rRNA), thus illustrating a simple approach to explore and identify possible biological targets of supramolecular nanofibers/hydrogels.

  2. Oral microbiome profiles: 16S rRNA pyrosequencing and microarray assay comparison.

    Jiyoung Ahn

    Full Text Available OBJECTIVES: The human oral microbiome is potentially related to diverse health conditions and high-throughput technology provides the possibility of surveying microbial community structure at high resolution. We compared two oral microbiome survey methods: broad-based microbiome identification by 16S rRNA gene sequencing and targeted characterization of microbes by custom DNA microarray. METHODS: Oral wash samples were collected from 20 individuals at Memorial Sloan-Kettering Cancer Center. 16S rRNA gene survey was performed by 454 pyrosequencing of the V3-V5 region (450 bp. Targeted identification by DNA microarray was carried out with the Human Oral Microbe Identification Microarray (HOMIM. Correlations and relative abundance were compared at phylum and genus level, between 16S rRNA sequence read ratio and HOMIM hybridization intensity. RESULTS: The major phyla, Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, and Fusobacteria were identified with high correlation by the two methods (r = 0.70∼0.86. 16S rRNA gene pyrosequencing identified 77 genera and HOMIM identified 49, with 37 genera detected by both methods; more than 98% of classified bacteria were assigned in these 37 genera. Concordance by the two assays (presence/absence and correlations were high for common genera (Streptococcus, Veillonella, Leptotrichia, Prevotella, and Haemophilus; Correlation = 0.70-0.84. CONCLUSION: Microbiome community profiles assessed by 16S rRNA pyrosequencing and HOMIM were highly correlated at the phylum level and, when comparing the more commonly detected taxa, also at the genus level. Both methods are currently suitable for high-throughput epidemiologic investigations relating identified and more common oral microbial taxa to disease risk; yet, pyrosequencing may provide a broader spectrum of taxa identification, a distinct sequence-read record, and greater detection sensitivity.

  3. Magnetic and electrical properties of Fe{sub 0.9}Ag{sub 0.1}In{sub 2.3}S{sub 4.4} single crystals

    Bodnar, I. V., E-mail: chemzav@bsuir.by [Belarusian State University of Information and Radio Electronics (Belarus); Trukhanov, S. V. [National Academy of Sciences of Belarus, Scientific and Practical Materials Research Center (Belarus); Barugu, T. H. [Belarusian State University of Information and Radio Electronics (Belarus)

    2015-10-15

    The magnetic and electrical properties of the Fe{sub 0.9}Ag{sub 0.1}In{sub 2.3}S{sub 4.4} single crystal are studied in the temperature range 4–300 K and in magnetic fields of 0–14 T. It is established that the sample under study is paramagnetic. In the ground state, short-range-order correlations typical of a spin glass with a freezing temperature of 10 K are detected. The magnetic ordering temperature is 15 K. The sample is a semiconductor with a resistivity of 3.5 kΩ cm at room temperature. For the Fe{sub 0.9}Ag{sub 0.1}In{sub 2.3}S{sub 4.4} single crystal, a mechanism for the formation of magnetic and electrical states is suggested.

  4. Genetic examination of SETD7 and SUV39H1/H2 methyltransferases and the risk of diabetes complications in patients with type 1 diabetes

    Syreeni, Anna; El-Osta, Assam; Forsblom, Carol;

    2011-01-01

    episodes of hyperglycemia. Epigenetic modifications mediated by histone methyltransferases are associated with gene-activating events that promote enhanced expression of key proinflammatory molecules implicated in vascular injury. In this study, we investigated genetic polymorphisms of the SETD7, SUV39H1......, and SUV39H2 methyltransferases as predictors of risk for micro- and macrovascular complications in type 1 diabetes....

  5. Epigenetic changes of Arabidopsis genome associated with altered DNA methyltransferase and demethylase expressions after gamma irradiation

    Kim, Ji Eun; Cho, Eun Ju; Kim, Ji Hong; Chung, Byung Yeoup; Kim, Jin Hong [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2012-05-15

    DNA methylation at carbon 5 of cytosines is a hall mark of epigenetic inactivation and heterochromatin in both plants and mammals. In Arabidopsis, DNA methylation has two roles that protect the genome from selfish DNA elements and regulate gene expression. Plant genome has three types of DNA methyltransferase, METHYLTRANSFERASE 1 (MET1), DOMAINREARRANGED METHYLASE (DRM) and CHROMOMETHYLASE 3 (CMT3) that are capable of methylating CG, CHG (where H is A, T, or C) and CHH sites, respectively. MET1 is a maintenance DNA methyltransferase that controls CG methylation. Two members of the DRM family, DRM1 and DRM2, are responsible for de novo methylation of CG, CHG, and CHH sites but show a preference for CHH sites. Finally, CMT3 principally carries out CHG methylation and is involved in both de novo methylation and maintenance. Alternatively, active DNA demethylation may occur through the glycosylase activity by removing the methylcytosines from DNA. It may have essential roles in preventing transcriptional silencing of transgenes and endogenous genes and in activating the expression of imprinted genes. DNA demetylation in Arabidopsis is mediated by the DEMETER (DME) family of bifunctional DNA glycosylase. Three targets of DME are MEA (MEDEA), FWA (FLOWERING WAGENINGEN), and FIS2 (FERTILIZATION INDEPENDENT SEED 2). The DME family contains DEMETER-LIKE 2 (DML2), DML3, and REPRESSOR OF SILENING 1 (ROS1). DNA demetylation by ROS1, DML2, and DML3 protect the hypermethylation of specific genome loci. ROS1 is necessary to suppress the promoter methylation and the silencing of endogenous genes. In contrast, the function of DML2 and DML3 has not been reported. Several recent studies have suggested that epigenetic alterations such as change in DNA methylation and histone modification should be caused in plant genomes upon exposure to ionizing radiation. However, there is a lack of data exploring the underlying mechanisms. Therefore, the present study aims to characterize and

  6. Epigenetic changes of Arabidopsis genome associated with altered DNA methyltransferase and demethylase expressions after gamma irradiation

    DNA methylation at carbon 5 of cytosines is a hall mark of epigenetic inactivation and heterochromatin in both plants and mammals. In Arabidopsis, DNA methylation has two roles that protect the genome from selfish DNA elements and regulate gene expression. Plant genome has three types of DNA methyltransferase, METHYLTRANSFERASE 1 (MET1), DOMAINREARRANGED METHYLASE (DRM) and CHROMOMETHYLASE 3 (CMT3) that are capable of methylating CG, CHG (where H is A, T, or C) and CHH sites, respectively. MET1 is a maintenance DNA methyltransferase that controls CG methylation. Two members of the DRM family, DRM1 and DRM2, are responsible for de novo methylation of CG, CHG, and CHH sites but show a preference for CHH sites. Finally, CMT3 principally carries out CHG methylation and is involved in both de novo methylation and maintenance. Alternatively, active DNA demethylation may occur through the glycosylase activity by removing the methylcytosines from DNA. It may have essential roles in preventing transcriptional silencing of transgenes and endogenous genes and in activating the expression of imprinted genes. DNA demetylation in Arabidopsis is mediated by the DEMETER (DME) family of bifunctional DNA glycosylase. Three targets of DME are MEA (MEDEA), FWA (FLOWERING WAGENINGEN), and FIS2 (FERTILIZATION INDEPENDENT SEED 2). The DME family contains DEMETER-LIKE 2 (DML2), DML3, and REPRESSOR OF SILENING 1 (ROS1). DNA demetylation by ROS1, DML2, and DML3 protect the hypermethylation of specific genome loci. ROS1 is necessary to suppress the promoter methylation and the silencing of endogenous genes. In contrast, the function of DML2 and DML3 has not been reported. Several recent studies have suggested that epigenetic alterations such as change in DNA methylation and histone modification should be caused in plant genomes upon exposure to ionizing radiation. However, there is a lack of data exploring the underlying mechanisms. Therefore, the present study aims to characterize and

  7. 2'-O methylation of internal adenosine by flavivirus NS5 methyltransferase.

    Hongping Dong

    Full Text Available RNA modification plays an important role in modulating host-pathogen interaction. Flavivirus NS5 protein encodes N-7 and 2'-O methyltransferase activities that are required for the formation of 5' type I cap (m(7GpppAm of viral RNA genome. Here we reported, for the first time, that flavivirus NS5 has a novel internal RNA methylation activity. Recombinant NS5 proteins of West Nile virus and Dengue virus (serotype 4; DENV-4 specifically methylates polyA, but not polyG, polyC, or polyU, indicating that the methylation occurs at adenosine residue. RNAs with internal adenosines substituted with 2'-O-methyladenosines are not active substrates for internal methylation, whereas RNAs with adenosines substituted with N⁶-methyladenosines can be efficiently methylated, suggesting that the internal methylation occurs at the 2'-OH position of adenosine. Mass spectroscopic analysis further demonstrated that the internal methylation product is 2'-O-methyladenosine. Importantly, genomic RNA purified from DENV virion contains 2'-O-methyladenosine. The 2'-O methylation of internal adenosine does not require specific RNA sequence since recombinant methyltransferase of DENV-4 can efficiently methylate RNAs spanning different regions of viral genome, host ribosomal RNAs, and polyA. Structure-based mutagenesis results indicate that K61-D146-K181-E217 tetrad of DENV-4 methyltransferase forms the active site of internal methylation activity; in addition, distinct residues within the methyl donor (S-adenosyl-L-methionine pocket, GTP pocket, and RNA-binding site are critical for the internal methylation activity. Functional analysis using flavivirus replicon and genome-length RNAs showed that internal methylation attenuated viral RNA translation and replication. Polymerase assay revealed that internal 2'-O-methyladenosine reduces the efficiency of RNA elongation. Collectively, our results demonstrate that flavivirus NS5 performs 2'-O methylation of internal adenosine of

  8. Molecular Evolution of the Substrate Specificity of Chloroplastic Aldolases/Rubisco Lysine Methyltransferases in Plants.

    Ma, Sheng; Martin-Laffon, Jacqueline; Mininno, Morgane; Gigarel, Océane; Brugière, Sabine; Bastien, Olivier; Tardif, Marianne; Ravanel, Stéphane; Alban, Claude

    2016-04-01

    Rubisco and fructose-1,6-bisphosphate aldolases (FBAs) are involved in CO2 fixation in chloroplasts. Both enzymes are trimethylated at a specific lysine residue by the chloroplastic protein methyltransferase LSMT. Genes coding LSMT are present in all plant genomes but the methylation status of the substrates varies in a species-specific manner. For example, chloroplastic FBAs are naturally trimethylated in both Pisum sativum and Arabidopsis thaliana, whereas the Rubisco large subunit is trimethylated only in the former species. The in vivo methylation status of aldolases and Rubisco matches the catalytic properties of AtLSMT and PsLSMT, which are able to trimethylate FBAs or FBAs and Rubisco, respectively. Here, we created chimera and site-directed mutants of monofunctional AtLSMT and bifunctional PsLSMT to identify the molecular determinants responsible for substrate specificity. Our results indicate that the His-Ala/Pro-Trp triad located in the central part of LSMT enzymes is the key motif to confer the capacity to trimethylate Rubisco. Two of the critical residues are located on a surface loop outside the methyltransferase catalytic site. We observed a strict correlation between the presence of the triad motif and the in vivo methylation status of Rubisco. The distribution of the motif into a phylogenetic tree further suggests that the ancestral function of LSMT was FBA trimethylation. In a recent event during higher plant evolution, this function evolved in ancestors of Fabaceae, Cucurbitaceae, and Rosaceae to include Rubisco as an additional substrate to the archetypal enzyme. Our study provides insight into mechanisms by which SET-domain protein methyltransferases evolve new substrate specificity. PMID:26785049

  9. Human erythrocyte phenol O-methyltransferase: Radiochemical microassay and biochemical properties

    A radiochemical microassay for the determination of phenol O-methyltransferase (PMT) activity in human red blood cell membranes has been developed. Acetaminophen was used as the substrate. The apparent Michaelis-Menten Ksub(M) value for acetaminophen was 21.2 X 10-3M. The apparent Ksub(M) value for S-adenosyl-L-methionine, a co-substrate for the reaction, was 4.8 X 10-6 M, and the pH optimum of the reaction was approximately 9.0 with four different buffer systems. Phenol was also tested as a substrate and had an apparent Ksub(M) value of 2.0 X 10-3 M. Human erythrocyte (RBC) membrane PMT activity did not have the biochemical characteristics of catechol O-methyltransferase, another RBC membrane methyltransferase enzyme activity. Blood samples obtained from 212 randomly selected adult white subjects had a mean activity of 134.5 +41.5 pmol of p-acetanisidide formed per mg protein per hour (mean +- S.D.). Activities varied from 44 to 282 units. There were no differences in the mean activities of samples from men and women. Experiments in which mixtures of 'low' and 'high' activity RBC membrane preparations were assayed for PMT provided no evidence that the variations in enzyme activity were due to the presence of endogenous PMT activators or inhibitors. RBC membrane PMT activity in blood from 9 patients with renal failure, a pathological state in which there are elevated circulating levels of phenols, was found to be significantly decreased with average activity of 76.2+-9.7 (mean +- S.E.M., P <0.001). (Auth.)

  10. Arabidopsis DNA methyltransferase AtDNMT2 associates with histone deacetylase AtHD2s activity

    DNA methyltransferase2 (DNMT2) is always deemed to be enigmatic, because it contains highly conserved DNA methyltransferase motifs but lacks the DNA methylation catalytic capability. Here we show that Arabidopsis DNA methyltransferase2 (AtDNMT2) is localized in nucleus and associates with histone deacetylation. Bimolecular fluorescence complementation and pull-down assays show AtDNMT2 interacts with type-2 histone deacetylases (AtHD2s), a unique type of histone deacetylase family in plants. Through analyzing the expression of AtDNMT2: ss-glucuronidase (GUS) fusion protein, we demonstrate that AtDNMT2 has the ability to repress gene expression at transcription level. Meanwhile, the expression of AtDNMT2 gene is altered in athd2c mutant plants. We propose that AtDNMT2 possibly involves in the activity of histone deacetylation and plant epigenetic regulatory network.

  11. Arabidopsis DNA methyltransferase AtDNMT2 associates with histone deacetylase AtHD2s activity

    Song, Yuan [Key Laboratory of Arid and Grassland Agroecology, Ministry of Education, School of Life Science, Lanzhou University, Lanzhou 730000 (China); Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada, 1391 Sandford Street, London, ON, Canada N5V4T3 (Canada); Wu, Keqiang [Institute of Plant Biology, National Taiwan University, Taipei 106, Taiwan (China); Dhaubhadel, Sangeeta [Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada, 1391 Sandford Street, London, ON, Canada N5V4T3 (Canada); An, Lizhe, E-mail: lizhean@lzu.edu.cn [Key Laboratory of Arid and Grassland Agroecology, Ministry of Education, School of Life Science, Lanzhou University, Lanzhou 730000 (China); Tian, Lining, E-mail: tianl@agr.gc.ca [Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada, 1391 Sandford Street, London, ON, Canada N5V4T3 (Canada)

    2010-05-28

    DNA methyltransferase2 (DNMT2) is always deemed to be enigmatic, because it contains highly conserved DNA methyltransferase motifs but lacks the DNA methylation catalytic capability. Here we show that Arabidopsis DNA methyltransferase2 (AtDNMT2) is localized in nucleus and associates with histone deacetylation. Bimolecular fluorescence complementation and pull-down assays show AtDNMT2 interacts with type-2 histone deacetylases (AtHD2s), a unique type of histone deacetylase family in plants. Through analyzing the expression of AtDNMT2: ss-glucuronidase (GUS) fusion protein, we demonstrate that AtDNMT2 has the ability to repress gene expression at transcription level. Meanwhile, the expression of AtDNMT2 gene is altered in athd2c mutant plants. We propose that AtDNMT2 possibly involves in the activity of histone deacetylation and plant epigenetic regulatory network.

  12. Development of fed-batch profiles for efficient biosynthesis of catechol-O-methyltransferase

    G.M. Espírito Santo; A.Q. Pedro; D. Oppolzer; Bonifácio, M J; Queiroz, J. A.; Silva, F.; L.A. Passarinha

    2014-01-01

    Catechol-O-methyltransferase (COMT, EC 2.1.1.6) plays a crucial role in dopamine metabolism which has intimately linked this enzyme to some neurodegenerative diseases, such as Parkinson's disease. In recent years, in the attempt of developing new therapeutic strategies for Parkinson's disease, there has been a growing interest in the search for effective COMT inhibitors. In order to do so, large amounts of COMT in an active form are needed, and the best way to achieve this is by up-scaling it...

  13. Structural Basis for Binding of RNA and Cofactor by a KsgA Methyltransferase

    Tu, Chao; Tropea, Joseph E.; Austin, Brian P; Court, Donald L.; Waugh, David S.; Ji, Xinhua

    2009-01-01

    Among methyltransferases, KsgA and the reaction it catalyzes are conserved throughout evolution. However, the specifics of substrate recognition by the enzyme remain unknown. Here, we report structures of Aquifex aeolicus KsgA, in its ligand-free form, in complex with RNA and in complex with both RNA and S-adenosylhomocysteine (SAH, reaction product of cofactor S-adenosylmethionine), providing the first pieces of structural information on KsgA-RNA and KsgA-SAH interactions. Moreover, the stru...

  14. Inhibition of SUV39H1 Methyltransferase Activity by DBC1*

    Li, Zhenyu; Chen, Lihong; Kabra, Neha; Wang, Chuangui; Fang, Jia; Chen, Jiandong

    2009-01-01

    SUV39H1 is a histone H3K9-specific methyltransferase important for heterochromatin formation, regulation of gene expression, and induction of senescence in premalignant cells. SUV39H1 forms a complex with SirT1, and its activity is stimulated by SirT1 binding. Here we present evidence that the product of the DBC1 (deleted in breast cancer 1) gene disrupts the SUV39H1-SirT1 complex. Furthermore, DBC1 binds to the SUV39H1 catalytic domain and inhibits its ability to ...

  15. Histone methyltransferase Suv39h1 represses MyoD-stimulated myogenic differentiation

    Mal, Asoke K.

    2006-01-01

    Suv39h1 is a histone H3 lysine-9 (H3-K9) specific methyltransferase (HMT) that is associated with gene silencing through chromatin modification. The transition from proliferation into differentiation of muscle cell is accompanied by transcriptional activation of previously silent muscle genes. I report Suv39h1 interaction with myogenic regulator MyoD in proliferating muscle cells and its HMT activity, which is associated with MyoD, diminishes as differentiation proceeds. The Suv39h1–MyoD comp...

  16. The DmtA methyltransferase contributes to Aspergillus flavus conidiation, sclerotial production, aflatoxin biosynthesis and virulence

    Kunlong Yang; Linlin Liang; Fanlei Ran; Yinghang Liu; Zhenguo Li; Huahui Lan; Peili Gao; Zhenhong Zhuang; Feng Zhang; Xinyi Nie; Shimuye Kalayu Yirga; Shihua Wang

    2016-01-01

    DNA methylation is essential for epigenetic regulation of gene transcription and development in many animals, plants and fungi. We investigated whether DNA methylation plays a role in the development and secondary metabolism of Aspergillus flavus, identified the DmtA methyltransferase from A. flavus, and produced a dmtA knock-out mutant by replacing the dmtA coding sequence with the pyrG selectable marker. The A. flavus dmtA null mutant lines produced white fluffy mycelium in liquid medium, a...

  17. Histone methyltransferase G9a contributes to H3K27 methylation in vivo

    Hui Wu; Bing Zhu; Xiuzhen Chen; Jun Xiong; Yingfeng Li; Hong Li; Xiaojun Ding; Sheng Liu; She Chen; Shaorong Gao

    2011-01-01

    @@ Dear Editor, Histone modifications play a vital role in the conformation and function of their associated chromatin templates[1].Histone H3K27 methylation mediated by the PRC2 complex is critical for transcriptional regulation,Polycomb silencing,Drosophila segmentation,mammalian X inactivation and cancer[1].Interestingly,H3K27me1(H3 mono-methylated at residue K27)levels in vivo remain unaffected after PRC2 disruption[2,3],which is an indication for the existence of other contributing histone methyltransferase(s)to H3K27me1.

  18. Juvenile hormone acid methyltransferase: A key regulatory enzyme for insect metamorphosis

    Shinoda, Tetsuro; Itoyama, Kyo

    2003-01-01

    Juvenile hormone (JH) acid methyltransferase (JHAMT) is an enzyme that converts JH acids or inactive precursors of JHs to active JHs at the final step of JH biosynthesis pathway in insects. By fluorescent mRNA differential display, we have cloned a cDNA encoding JHAMT from the corpora allata (CA) of the silkworm, Bombyx mori (BmJHAMT). The BmJHAMT cDNA encodes an ORF of 278 aa with a calculated molecular mass of 32,544 Da. The predicted amino acid sequence contains a conserved S-adenosyl-l-me...

  19. Crystal structure of phosphoethanolamine methyltransferase from Plasmodium falciparum in complex with amodiaquine

    Lee, Soon Goo; Alpert, Tara D.; Jez, Joseph M. (WU)

    2012-07-17

    Phosphoethanolamine N-methyltransferase (PMT) is essential for phospholipid biogenesis in the malarial parasite Plasmodium falciparum. PfPMT catalyzes the triple methylation of phosphoethanolamine to produce phosphocholine, which is then used for phosphatidylcholine synthesis. Here we describe the 2.0 {angstrom} resolution X-ray crystal structure of PfPMT in complex with amodiaquine. To better characterize inhibition of PfPMT by amodiaquine, we determined the IC{sub 50} values of a series of aminoquinolines using a direct radiochemical assay. Both structural and functional analyses provide a possible approach for the development of new small molecule inhibitors of PfPMT.

  20. O6-Methylguanine-DNA methyltransferase deficiency in developing brain: Implications for brain tumorigenesis

    Bobola, Michael S.; Blank, A.; Berger, Mitchel S.; Silber, John R

    2007-01-01

    The DNA repair protein O6-methylguanine-DNA methyltransferase (MGMT) is a cardinal defense against the mutagenic and carcinogenic effects of alkylating agents. We have reported evidence that absence of detectable MGMT activity (MGMT− phenotype) in human brain is a predisposing factor for primary brain tumors that affects ca. 12% of individuals [J.R. Silber, et. al. Proc. Natl. Acad. Sci. USA 93 (1996) 6941–6946]. We report here that MGMT− phenotype in the brain of children and adults, and the...

  1. Verminderte Expression von O6-Methylguanin-DNA-Methyltransferase bei Gliomen durch Promotormethylierung

    Nickolay, Carla

    2009-01-01

    Pro Jahr erkranken 10 von 100 000 Menschen an einem malignen Hirntumor. Die Prognose ist schlecht. Die Therapie schließt Chirurgie, Bestrahlung und Chemotherapie ein. Das DNA-Reparaturenzym O6-Methylguanin-DNA-Methyltransferase, MGMT, erkennt DNA-Schäden, die durch alkylierende Substanzen wie Temozolomid entstanden sind. Übermäßige Methylierung der Promotorregion von MGMT führt zum Funktionsverlust des Enzyms. Dieser kann zu einer erhöhten Sensibilität für Alkylanzien führen. In der Therapie ...

  2. DNA Methyltransferase Gene dDnmt2 and Longevity of Drosophila

    Meng-JauLin; Lin-YaTang; M.NarsaReddy; C.K.JamesShen

    2005-01-01

    The DNA methylation program of the fruit fly Drosophila melanogaster is carried out by the single DNA methyltransferase gene dDnmt2, the function of which is unknown before. We present evidence that intactness of the gene is required for maintenance of the normal life span of the fruit flies. In contrast, overexpression of dDnmt2 could extend Drosophila life span. The study links the Drosophila DNA methylation program with the small heatshock proteins and longevity/aging and has interesting implication on the eukaryotic DNA methyl-ation programs in general.

  3. Discovery of an in vivo Chemical Probe of the Lysine Methyltransferases G9a and GLP

    Liu, Feng; Barsyte-Lovejoy, Dalia; Li, Fengling; Xiong, Yan; Korboukh, Victoria; Huang, Xi-Ping; Allali-Hassani, Abdellah; Janzen, William P.; Roth, Bryan L.; Frye, Stephen V.; Arrowsmith, Cheryl H.; Brown, Peter J.; Vedadi, Masoud; Jin, Jian

    2013-01-01

    Among epigenetic “writers”, “readers”, and “erasers”, the lysine methyltransferases G9a and GLP, which catalyze mono- and dimethylation of histone H3 lysine 9 (H3K9me2) and non-histone proteins, have been implicated in a variety of human diseases. A “toolkit” of well-characterized chemical probes will allow biological and disease hypotheses concerning these proteins to be tested in cell-based and animal models with high confidence. We previously discovered potent and selective G9a/GLP inhibit...

  4. Protein lysine methyltransferase G9a acts on non-histone targets

    Rathert, Philipp; Dhayalan, Arunkumar; Murakami, Marie; Zhang, Xing; Tamas, Raluca; Jurkowska, Renata; Komatsu, Yasuhiko; Shinkai, Yoichi; Cheng, Xiaodong; Jeltsch, Albert

    2008-01-01

    By methylation of peptide arrays, we determined the specificity profile of the protein methyltransferase G9a. We show that it mostly recognizes an Arg-Lys sequence and that its activity is inhibited by methylation of the arginine residue. Using the specificity profile, we identified new non-histone protein targets of G9a, including CDYL1, WIZ, ACINUS and G9a (automethylation), as well as peptides derived from CSB. We demonstrate potential downstream signaling pathways for methylation of non-h...

  5. A chemical probe selectively inhibits G9a and GLP methyltransferase activity in cells

    Vedadi, Masoud; Barsyte-Lovejoy, Dalia; Liu, Feng; Rival-Gervier, Sylvie; Allali-Hassani, Abdellah; Labrie, Viviane; Wigle, Tim J.; DiMaggio, Peter A.; Wasney, Gregory A.; Siarheyeva, Alena; Dong, Aiping; Tempel, Wolfram; Wang, Sun-Chong; Chen, Xin; Chau, Irene

    2011-01-01

    Protein lysine methyltransferases G9a and GLP modulate the transcriptional repression of a variety of genes via dimethylation of Lys9 on histone H3 (H3K9me2) as well as dimethylation of non-histone targets. Here we report the discovery of UNC0638, an inhibitor of G9a and GLP with excellent potency and selectivity over a wide range of epigenetic and non-epigenetic targets. UNC0638 treatment of a variety of cell lines resulted in lower global H3K9me2 levels, equivalent to levels observed for sm...

  6. Quantitative proteomics reveals direct and indirect alterations in the histone code following methyltransferase knockdown

    Plazas-Mayorca, Mariana D.; Bloom, Joshua S.; Zeissler, Ulrike; LeRoy, Gary; Young, Nicolas L.; DiMaggio, Peter A.; Krugylak, Leonid; Schneider, Robert; Garcia, Benjamin A

    2010-01-01

    Histones are highly conserved proteins that organize cellular DNA. These proteins, especially their N-terminal domains, are adorned with many post-translational modifications (PTMs) such as lysine methylation, which are associated with active or repressed transcriptional states. The lysine methyltransferase G9a and its interaction partner Glp1 can mono- or dimethylate histone H3 on lysine (H3K9me1 or me2); possible cross-talk between these modifications and other PTMs on the same or other his...

  7. A fluorescence resonance energy transfer-based method for histone methyltransferases

    Devkota, Kanchan; Lohse, Brian; Nyby Jakobsen, Camilla;

    2015-01-01

    A simple dye–quencher fluorescence resonance energy transfer (FRET)-based assay for methyltransferases was developed and used to determine kinetic parameters and inhibitory activity at EHMT1 and EHMT2. Peptides mimicking the truncated histone H3 tail were functionalized in each end with a dye and a...... quencher, respectively. When lysine-9 residues in the peptides were methylated, they were protected from cleavage by endoproteinase–EndoLysC, whereas unmethylated peptides were cleaved, resulting in an increase in fluorescent intensity....

  8. Regioselectivity of catechol O-methyltransferase confers enhancement of catalytic activity

    Tsao, Douglas; Liu, Shubin; Dokholyan, Nikolay V.

    2011-04-01

    Catechol O-methyltransferase (COMT) metabolizes catechol moieties by methylating a single hydroxyl group at the meta- or para- hydroxyl position. Hydrophobic amino acids near the active site of COMT influence the regioselectivity of this reaction. Our sequence analysis highlights their importance by showing that these residues are highly conserved throughout evolution. Reaction barriers calculated in the gas phase reveal a lower barrier during methylation at the meta- position, suggesting that the observed meta-regioselectivity of COMT can be attributed to the substrate itself, and that COMT has evolved residues to orient the substrate in a manner that increases the rate of catalysis.

  9. Small RNA-mediated DNA (cytosine-5) methyltransferase 1 inhibition leads to aberrant DNA methylation

    Zhang, Guoqiang; Estève, Pierre-Olivier; Chin, Hang Gyeong; Terragni, Jolyon; Dai, Nan; Corrêa, Ivan R.; Pradhan, Sriharsa

    2015-01-01

    Mammalian cells contain copious amounts of RNA including both coding and noncoding RNA (ncRNA). Generally the ncRNAs function to regulate gene expression at the transcriptional and post-transcriptional level. Among ncRNA, the long ncRNA and small ncRNA can affect histone modification, DNA methylation targeting and gene silencing. Here we show that endogenous DNA methyltransferase 1 (DNMT1) co-purifies with inhibitory ncRNAs. MicroRNAs (miRNAs) bind directly to DNMT1 with high affinity. The bi...

  10. Queen pheromones modulate DNA methyltransferase activity in bee and ant workers.

    Holman, Luke; Trontti, Kalevi; Helanterä, Heikki

    2016-01-01

    DNA methylation is emerging as an important regulator of polyphenism in the social insects. Research has concentrated on differences in methylation between queens and workers, though we hypothesized that methylation is involved in mediating other flexible phenotypes, including pheromone-dependent changes in worker behaviour and physiology. Here, we find that exposure to queen pheromone affects the expression of two DNA methyltransferase genes in Apis mellifera honeybees and in two species of Lasius ants, but not in Bombus terrestris bumblebees. These results suggest that queen pheromones influence the worker methylome, pointing to a novel proximate mechanism for these key social signals. PMID:26814223

  11. DNA methyltransferase-dependent transcription of the phage Mu mom gene.

    Hattman, S

    1982-01-01

    The phage Mu mom gene controls an unusual DNA modification. Expression of the mom function requires an active host (dam+) DNA adenine methylase [S-adenosyl-L-methionine:DNA (6-aminopurine)-methyltransferase]; in dam- hosts, Mu development is normal except that the viral DNA does not undergo the mom modification. The present communication compares transcription of the mom gene in dam+ versus dam- cells. 32P-labeled probes were prepared by nick-translation of a purified mom gene-containing rest...

  12. Nucleolin is required for DNA methylation state and the expression of rRNA gene variants in Arabidopsis thaliana.

    Frédéric Pontvianne

    2010-11-01

    Full Text Available In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1. Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre-rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis.

  13. New erythromycin derivatives from Saccharopolyspora erythraea using sugar O-methyltransferases from the spinosyn biosynthetic gene cluster.

    Gaisser, S; Lill, R; Wirtz, G; Grolle, F; Staunton, J; Leadlay, P F

    2001-09-01

    Using a previously developed expression system based on the erythromycin-producing strain of Saccharopolyspora erythraea, O-methyltransferases from the spinosyn biosynthetic gene cluster of Saccharopolyspora spinosa have been shown to modify a rhamnosyl sugar attached to a 14-membered polyketide macrolactone. The spnI, spnK and spnH methyltransferase genes were expressed individually in the S. erythraea mutant SGT2, which is blocked both in endogenous macrolide biosynthesis and in ery glycosyltransferases eryBV and eryCIII. Exogenous 3-O-rhamnosyl-erythronolide B was efficiently converted into 3-O-(2'-O-methylrhamnosyl)-erythronolide B by the S. erythraea SGT2 (spnI) strain only. When 3-O-(2'-O-methylrhamnosyl)-erythronolide B was, in turn, fed to a culture of S. erythraea SGT2 (spnK), 3-O-(2',3'-bis-O-methylrhamnosyl)-erythronolide B was identified in the culture supernatant, whereas S. erythraea SGT2 (spnH) was without effect. These results confirm the identity of the 2'- and 3'-O-methyltransferases, and the specific sequence in which they act, and they demonstrate that these methyltransferases may be used to methylate rhamnose units in other polyketide natural products with the same specificity as in the spinosyn pathway. In contrast, 3-O-(2',3'-bis-O-methylrhamnosyl)-erythronolide B was found not to be a substrate for the 4'-O-methyltransferase SpnH. Although rhamnosylerythromycins did not serve directly as substrates for the spinosyn methyltransferases, methylrhamnosyl-erythromycins were obtained by subsequent conversion of the corresponding methylrhamnosyl-erythronolide precursors using the S. erythraea strain SGT2 housing EryCIII, the desosaminyltransferase of the erythromycin pathway. 3-O-(2'-O-methylrhamnosyl)-erythromycin D was tested and found to be significantly active against a strain of erythromycin-sensitive Bacillus subtilis. PMID:11555300

  14. The Drosophila G9a gene encodes a multi-catalytic histone methyltransferase required for normal development

    Stabell, Marianne; Eskeland, Ragnhild; Bjørkmo, Mona; Larsson, Jan; Aalen, Reidunn B.; Imhof, Axel; Lambertsson, Andrew

    2006-01-01

    Mammalian G9a is a histone H3 Lys-9 (H3–K9) methyltransferase localized in euchromatin and acts as a co-regulator for specific transcription factors. G9a is required for proper development in mammals as g9a−/g9a− mice show growth retardation and early lethality. Here we describe the cloning, the biochemical and genetical analyses of the Drosophila homolog dG9a. We show that dG9a shares the structural organization of mammalian G9a, and that it is a multi-catalytic histone methyltransferase wit...

  15. Functional analysis of the N- and C-terminus of mammalian G9a histone H3 methyltransferase

    Estève, Pierre-Olivier; Patnaik, Debasis; Chin, Hang Gyeong; Benner, Jack; Teitell, Michael A.; Pradhan, Sriharsa

    2005-01-01

    Methylation of lysine 9 (K9) in the N-terminus tail of histone H3 (H3) in chromatin is associated with transcriptionally silenced genes and is mediated by histone methyltransferases. Murine G9a is a 1263 amino acid H3-K9 methyltransferase that possesses characteristic SET domain and ANK repeats. In this paper, we have used a series of green fluorescent protein-tagged deletion constructs to identify two nuclear localization signals (NLS), the first NLS embedded between amino acids 24 and 109 a...

  16. CpG underrepresentation and the bacterial CpG-specific DNA methyltransferase M.MpeI

    Wojciechowski, Marek; Czapinska, Honorata; Bochtler, Matthias

    2013-01-01

    Cytosine methylation promotes deamination. In eukaryotes, CpG methylation is thought to account for CpG underrepresentation. Whether scarcity of CpGs in prokaryotic genomes is diagnostic for methylation is not clear. Here, we report that Mycoplasms tend to be CpG depleted and to harbor a family of constitutively expressed or phase variable CpG-specific DNA methyltransferases. The very CpG poor Mycoplasma penetrans and its constitutively active CpG-specific methyltransferase M.MpeI were chosen...

  17. Hippocampal dysfunction in the Euchromatin histone methyltransferase 1 heterozygous knockout mouse model for Kleefstra syndrome.

    Balemans, Monique C M; Kasri, Nael Nadif; Kopanitsa, Maksym V; Afinowi, Nurudeen O; Ramakers, Ger; Peters, Theo A; Beynon, Andy J; Janssen, Sanne M; van Summeren, Rik C J; Eeftens, Jorine M; Eikelenboom, Nathalie; Benevento, Marco; Tachibana, Makoto; Shinkai, Yoichi; Kleefstra, Tjitske; van Bokhoven, Hans; Van der Zee, Catharina E E M

    2013-03-01

    Euchromatin histone methyltransferase 1 (EHMT1) is a highly conserved protein that catalyzes mono- and dimethylation of histone H3 lysine 9, thereby epigenetically regulating transcription. Kleefstra syndrome (KS), is caused by haploinsufficiency of the EHMT1 gene, and is an example of an emerging group of intellectual disability (ID) disorders caused by genes encoding epigenetic regulators of neuronal gene activity. Little is known about the mechanisms underlying this disorder, prompting us to study the Euchromatin histone methyltransferase 1 heterozygous knockout (Ehmt1(+/-)) mice as a model for KS. In agreement with the cognitive disturbances observed in patients with KS, we detected deficits in fear extinction learning and both novel and spatial object recognition in Ehmt1(+/-) mice. These learning and memory deficits were associated with a significant reduction in dendritic arborization and the number of mature spines in hippocampal CA1 pyramidal neurons of Ehmt1(+/-) mice. In-depth analysis of the electrophysiological properties of CA3-CA1 synapses revealed no differences in basal synaptic transmission or theta-burst induced long-term potentiation (LTP). However, paired-pulse facilitation (PPF) was significantly increased in Ehmt1(+/-) neurons, pointing to a potential deficiency in presynaptic neurotransmitter release. Accordingly, a reduction in the frequency of miniature excitatory post-synaptic currents (mEPSCs) was observed in Ehmt1(+/-) neurons. These data demonstrate that Ehmt1 haploinsufficiency in mice leads to learning deficits and synaptic dysfunction, providing a possible mechanism for the ID phenotype in patients with KS. PMID:23175442

  18. Protein arginine methyltransferase 5 (PRMT5) is a novel coactivator of constitutive androstane receptor (CAR).

    Kanno, Yuichiro; Inajima, Jun; Kato, Sayaka; Matsumoto, Maika; Tokumoto, Chikako; Kure, Yuki; Inouye, Yoshio

    2015-03-27

    The constitutive androstane receptor (CAR) plays a key role in the expression of xenobiotic/steroid and drug metabolizing enzymes and their transporters. In this study, we demonstrated that protein arginine methyltransferase 5 (PRMT5) is a novel CAR-interacting protein. Furthermore, the PRMT-dependent induction of a CAR reporter gene, which was independent of methyltransferase activity, was enhanced in the presence of steroid receptor coactivator 1 (SRC1), peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1α) or DEAD box DNA/RNA helicase DP97. Using tetracycline inducible-hCAR system in HepG2 cells, we showed that knockdown of PRMT5 with small interfering RNA suppressed tetracycline -induced mRNA expression of CYP2B6 but not of CYP2C9 or CYP3A4. PRMT5 enhanced phenobarbital-mediated transactivation of a phenobarbital-responsive enhancer module (PBREM)-driven reporter gene in co-operation with PGC-1α in rat primary hepatocytes. Based on these findings, we suggest PRMT5 to be a gene (or promoter)-selective coactivator of CAR by mediating the formation of complexes between hCAR and appropriate coactivators. PMID:25721668

  19. PML-RARA requires DNA methyltransferase 3A to initiate acute promyelocytic leukemia.

    Cole, Christopher B; Verdoni, Angela M; Ketkar, Shamika; Leight, Elizabeth R; Russler-Germain, David A; Lamprecht, Tamara L; Demeter, Ryan T; Magrini, Vincent; Ley, Timothy J

    2016-01-01

    The DNA methyltransferases DNMT3A and DNMT3B are primarily responsible for de novo methylation of specific cytosine residues in CpG dinucleotides during mammalian development. While loss-of-function mutations in DNMT3A are highly recurrent in acute myeloid leukemia (AML), DNMT3A mutations are almost never found in AML patients with translocations that create oncogenic fusion genes such as PML-RARA, RUNX1-RUNX1T1, and MLL-AF9. Here, we explored how DNMT3A is involved in the function of these fusion genes. We used retroviral vectors to express PML-RARA, RUNX1-RUNX1T1, or MLL-AF9 in bone marrow cells derived from WT or DNMT3A-deficient mice. Additionally, we examined the phenotypes of hematopoietic cells from Ctsg-PML-RARA mice, which express PML-RARA in early hematopoietic progenitors and myeloid precursors, with or without DNMT3A. We determined that the methyltransferase activity of DNMT3A, but not DNMT3B, is required for aberrant PML-RARA-driven self-renewal ex vivo and that DNMT3A is dispensable for RUNX1-RUNX1T1- and MLL-AF9-driven self-renewal. Furthermore, both the PML-RARA-driven competitive transplantation advantage and development of acute promyelocytic leukemia (APL) required DNMT3A. Together, these findings suggest that PML-RARA requires DNMT3A to initiate APL in mice. PMID:26595813

  20. Thiopurine methyltransferase activity in the erythrocytes of adults and children: and HPLC-linked assay.

    Micheli, V; Jacomelli, G; Fioravanti, A; Morozzi, G; Marcolongo, R; Pompucci, G

    1997-03-18

    A non-radioactive method that uses reverse-phase high performance liquid chromatography is described for the determination of thiopurine methyltransferase (E.C. 2.1.1.67) activity in human erythrocytes. The method is based on the direct quantitation of 6-methyl-mercaptopurine produced from 6-mercaptopurine by crude erythrocyte lysates. The method is accurate and reliable and suitable for diagnostic use. Activity values in control adults ranged from 5 to 32 pmol/h/mg haemoglobin. The activity in the erythrocytes of adult males was significantly higher compared to females (21 +/- 5 and 15 +/- 8 pmol/h/mg haemoglobin, respectively). The activity measured in the erythrocytes of children (22 +/- 5 pmol/h/mg haemoglobin) did not show any significant difference compared to adults. Thiopurine methyltransferase activity was measured in a female patient with systemic sclerosis who developed severe bone marrow depression after treatment with azathioprine and allopurinol. Activity (6.3 +/- 0.5 pmol/h/mg haemoglobin) was found in the lowest range of controls thus supporting the hypothesis that it could be responsible for increased azathioprine cytotoxicity. PMID:9086303

  1. Crystallization and preliminary X-ray crystallographic studies of O-methyltransferase from Anabaena PCC 7120

    The O-methyltransferase (OMT) from the Anabaena PCC 7120 has been overexpressed in a soluble form in E. coli, purified and crystallized. The crystals belonged to space group C2221 and diffracted to 2.4 Å resolution. O-Methyltransferase (OMT) is a ubiquitous enzyme that exists in bacteria, plants and humans and catalyzes a methyl-transfer reaction using S-adenosyl-l-methionine as a methyl donor and a wide range of phenolics as acceptors. To investigate the structure and function of OMTs, omt from Anabaena PCC 7120 was cloned into expression vector pET21a and expressed in a soluble form in Escherichia coli strain BL21 (DE3). The recombinant OMT protein was purified to homogeneity using a two-step strategy. Crystals of OMT that diffracted to a resolution of 2.4 Å were obtained using the hanging-drop vapour-diffusion method. The crystals belonged to space group C2221, with unit-cell parameters a = 131.620, b = 227.994, c = 150.777 Å, α = β = γ = 90°. There are eight molecules per asymmetric unit

  2. Identification and expression profiling of DNA methyltransferases during development and stress conditions in Solanaceae.

    Kumar, Rahul; Chauhan, Pankaj Kumar; Khurana, Ashima

    2016-09-01

    DNA methyltransferase (DMTase) enzymes contribute to plant development and stress responses by de novo establishment and subsequent maintenance of DNA methylation during replication. However, the molecular mechanism underlying this activity remains obscure, especially in crop species. Using DMTase homolog complement in six Solanaceae species, we demonstrated here that their number remained conserved in Solanum lineage, whereas it was expanded in both pepper and Nicotiana benthamiana. Non-synonymous vs synonymous (Ka/Ks) substitution ratio revealed that most of the Solanaceous DMTase homologs undergo purifying selection. The genomic sequences of tomato DMT homologs in its wild relative, Solanum pennellii, remained highly conserved in their exons and methyltransferase domains. Structure analysis further revealed highly similar folding of DMTase homologs and conservation in the residues participating in protein-protein interaction in Solanum lineage, whereas a considerable diversification was observed of pepper homologs. Transcript profiling of DMTases highlighted both similar and distinct expression patterns of tomato homologs in other species during fruit development and stress responses. Overall, our analysis provides a strong basis for in-depth exploration of both conserved as well as distinct functions of tomato DMTase homologs in other economically important Solanaceae species. PMID:27380018

  3. The Histone Methyltransferase Activity of MLL1 Is Dispensable for Hematopoiesis and Leukemogenesis

    Bibhu P. Mishra

    2014-05-01

    Full Text Available Despite correlations between histone methyltransferase (HMT activity and gene regulation, direct evidence that HMT activity is responsible for gene activation is sparse. We address the role of the HMT activity for MLL1, a histone H3 lysine 4 (H3K4 methyltransferase critical for maintaining hematopoietic stem cells (HSCs. Here, we show that the SET domain, and thus HMT activity of MLL1, is dispensable for maintaining HSCs and supporting leukemogenesis driven by the MLL-AF9 fusion oncoprotein. Upon Mll1 deletion, histone H4 lysine 16 (H4K16 acetylation is selectively depleted at MLL1 target genes in conjunction with reduced transcription. Surprisingly, inhibition of SIRT1 is sufficient to prevent the loss of H4K16 acetylation and the reduction in MLL1 target gene expression. Thus, recruited MOF activity, and not the intrinsic HMT activity of MLL1, is central for the maintenance of HSC target genes. In addition, this work reveals a role for SIRT1 in opposing MLL1 function.

  4. Human catechol-O-methyltransferase: Cloning and expression of the membrane-associated form

    A cDNA clone for human catechol-O-methyltransferase was isolated from a human hepatoma cell line (Hep G2) cDNA library by hybridization screening with a porcine cDNA probe. The cDNA clone was sequenced and found to have an insert of 1226 nucleotides. The deduced primary structure of hCOMT is composed of 271 amino acid residues with the predicted molecular mass of 30 kDa. At its N terminus it has a hydrophobic segment of 21 amino acid residues that may be responsible for insertion of hCOMT into the endoplasmic reticulum membrane. The primary structure of hCOMT exhibits high homology to the porcine partial cDNA sequence (93%). The deduced amino acid sequence contains two tryptic peptide sequences (T-22, T-33) found in porcine liver catechol-O-methyltransferase (CEMT). The coding region of hCOMT cDNA was placed under the control of the cytomegalovirus promoter to transfect human kidney 293 cells. The recombinant hCOMT was shown by immunoblot analysis to be mainly associated with the membrane fraction. RNA blot analysis revealed one COMT mRNA transcript of 1.4 kilobases in Hep G2 poly(A)+ RNA

  5. Biochemical characterization of maintenance DNA methyltransferase DNMT-1 from silkworm, Bombyx mori.

    Mitsudome, Takumi; Mon, Hiroaki; Xu, Jian; Li, Zhiqing; Lee, Jae Man; Patil, Anandrao Ashok; Masuda, Atsushi; Iiyama, Kazuhiro; Morokuma, Daisuke; Kusakabe, Takahiro

    2015-03-01

    DNA methylation is an important epigenetic mechanism involved in gene expression of vertebrates and invertebrates. In general, DNA methylation profile is established by de novo DNA methyltransferases (DNMT-3A, -3B) and maintainance DNA methyltransferase (DNMT-1). DNMT-1 has a strong substrate preference for hemimethylated DNA over the unmethylated one. Because the silkworm genome lacks an apparent homologue of de novo DNMT, it is still unclear that how silkworm chromosome establishes and maintains its DNA methylation profile. As the first step to unravel this enigma, we purified recombinant BmDNMT-1 using baculovirus expression system and characterized its DNA-binding and DNA methylation activity. We found that the BmDNMT-1 preferentially methylates hemimethylated DNA despite binding to both unmethylated and hemimethylated DNA. Interestingly, BmDNMT-1 formed a complex with DNA in the presence or absence of methyl group donor, S-Adenosylmethionine (AdoMet) and the AdoMet-dependent complex formation was facilitated by Zn(2+) and Mn(2+). Our results provide clear evidence that BmDNMT-1 retained the function as maintenance DNMT but its sensitivity to metal ions is different from mammalian DNMT-1. PMID:25623240

  6. Bacteriophage adenine methyltransferase: a life cycle regulator? Modelled using Vibrio harveyi myovirus like.

    Bochow, S; Elliman, J; Owens, L

    2012-11-01

    The adenine methyltransferase (DAM) gene methylates GATC sequences that have been demonstrated in various bacteria to be a powerful gene regulator functioning as an epigenetic switch, particularly with virulence gene regulation. However, overproduction of DAM can lead to mutations, giving rise to variability that may be important for adaptation to environmental change. While most bacterial hosts carry a DAM gene, not all bacteriophage carry this gene. Currently, there is no literature regarding the role DAM plays in life cycle regulation of bacteriophage. Vibrio campbellii strain 642 carries the bacteriophage Vibrio harveyi myovirus like (VHML) that has been proven to increase virulence. The complete genome sequence of VHML bacteriophage revealed a putative adenine methyltransferase gene. Using VHML, a new model of phage life cycle regulation, where DAM plays a central role between the lysogenic and lytic states, will be hypothesized. In short, DAM methylates the rha antirepressor gene and once methylation is removed, homologous CI repressor protein becomes repressed and non-functional leading to the switching to the lytic cycle. Greater understanding of life cycle regulation at the genetic level can, in the future, lead to the genesis of chimeric bacteriophage with greater control over their life cycle for their safe use as probiotics within the aquaculture industry. PMID:22681538

  7. Improved radioenzymatic assay for plasma norepinephrine using purified phenylethanolamine n-methyltransferase

    Radioenzymatic assays have been developed for catecholamines using either catechol O-methyltransferase (COMT) or phenylethanolamine N-methyltransferase (PNMT). Assays using PNMT are specific for norepinephrine (NE) and require minimal manipulative effort but until now have been less sensitive than the more complex procedures using COMT. The authors report an improved purification scheme for bovine PNMT which has permitted development of an NE assay with dramatically improved sensitivity (0.5 pg), specificity and reproducibility (C.V. < 5%). PNMT was purified by sequential pH 5.0 treatment and dialysis and by column chromatographic procedures using DEAE-Sephacel, Sepharcryl S-200 and Phenyl-Boronate Agarose. Recovery of PNMT through the purification scheme was 50%, while blank recovery was <.001%. NE can be directly quantified in 25 ul of human plasma and an 80 tube assay can be completed within 4 h. The capillary to venous plasma NE gradient was examined in 8 normotensive male subjects. Capillary plasma (NE (211.2 +/- 61.3 pg/ml)) was lower than venous plasma NE (366.6 +/- 92.5 pg/ml) in all subjects (p < 0.005). This difference suggests that capillary (NE) may be a unique indicator of sympathetic nervous system activity in vivo. In conclusion, purification of PNMT has facilitated development of an improved radioenzymatic for NE with significantly improved sensitivity

  8. X-ray crystal structure of N-6 adenine deoxyribose nucleic acid methyltransferase from Streptococcus pneumoniae

    Tran, Phidung Hong

    X-ray diffraction by using resonant anomalous scattering has become a popular tool for solving crystal structures in the last ten years with the expanded availability of tunable synchrotron radiation for protein crystallography. Mercury atoms were used for phasing. The crystal structure of N-6 deoxyribose nucleic acid methyltransferase from Streptoccocus pneumoniae (DpnM) was solved by using the Multiple Anomalous Diffraction technique. The crystal structure reveals the formation of mercaptide between the mercury ion and the thiol group on the cysteine amino acid in a hydrophobic environment. The crystal structure contains the bound ligand, S- adenosyl-l-methionine on the surface of the concave opening. The direction of the β-strands on the beta sheets are identical to other solved methyltransferases. The highly conserved motifs, DPPY and the FxGxG, are found to be important in ligand binding and possibly in methyl group transfer. The structure has a concave cleft with an opening on the order of 30 Å that can accommodate a DNA duplex. By molecular modelling coupled to sequence alignment, two other highly conserved residues Arg21 and Gly19 are found to be important in catalysis.

  9. Inactivating mutations of the histone methyltransferase gene EZH2 in myeloid disorders.

    Ernst, Thomas; Chase, Andrew J; Score, Joannah; Hidalgo-Curtis, Claire E; Bryant, Catherine; Jones, Amy V; Waghorn, Katherine; Zoi, Katerina; Ross, Fiona M; Reiter, Andreas; Hochhaus, Andreas; Drexler, Hans G; Duncombe, Andrew; Cervantes, Francisco; Oscier, David; Boultwood, Jacqueline; Grand, Francis H; Cross, Nicholas C P

    2010-08-01

    Abnormalities of chromosome 7q are common in myeloid malignancies, but no specific target genes have yet been identified. Here, we describe the finding of homozygous EZH2 mutations in 9 of 12 individuals with 7q acquired uniparental disomy. Screening of a total of 614 individuals with myeloid disorders revealed 49 monoallelic or biallelic EZH2 mutations in 42 individuals; the mutations were found most commonly in those with myelodysplastic/myeloproliferative neoplasms (27 out of 219 individuals, or 12%) and in those with myelofibrosis (4 out of 30 individuals, or 13%). EZH2 encodes the catalytic subunit of the polycomb repressive complex 2 (PRC2), a highly conserved histone H3 lysine 27 (H3K27) methyltransferase that influences stem cell renewal by epigenetic repression of genes involved in cell fate decisions. EZH2 has oncogenic activity, and its overexpression has previously been causally linked to differentiation blocks in epithelial tumors. Notably, the mutations we identified resulted in premature chain termination or direct abrogation of histone methyltransferase activity, suggesting that EZH2 acts as a tumor suppressor for myeloid malignancies. PMID:20601953

  10. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment.

    Kwasniewska, Jolanta; Jaskowiak, Joanna

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  11. A renaissance for the pioneering 16S rRNA gene

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  12. Rapid identification of Renibacterium salmoninarum using an oligonucleotide probe complementary to 16S rRNA.

    Mattsson, J G; Gersdorf, H; Jansson, E; Hongslo, T; Göbel, U B; Johansson, K E

    1993-02-01

    Bacterial kidney disease in salmonid fish is caused by the slow-growing Gram-positive rod, Renibacterium salmoninarum. The partial sequence of 16S rRNA from R. salmoninarum was determined and compared with published bacterial 16S rRNA sequences. From this sequence information, a 30-bases-long oligonucleotide was designed and used as a specific probe for identification of R. salmoninarum in filter hybridization experiments. Strong specific hybridization signals were observed for all strains of R. salmoninarum tested. Furthermore, no cross-hybridization could be seen against 22 other bacterial species, among them other salmonid fish pathogens. The detection limit for the probe in direct filter hybridization by the dot-blot technique was 2.5 x 10(4) bacteria. It was also possible to detect R. salmoninarum in clinical samples by direct filter hybridization. PMID:8455640

  13. Phylogeny of the malarial genus Plasmodium, derived from rRNA gene sequences.

    Escalante, A A; Ayala, F. J.

    1994-01-01

    Malaria is among mankind's worst scourges, affecting many millions of people, particularly in the tropics. Human malaria is caused by several species of Plasmodium, a parasitic protozoan. We analyze the small subunit rRNA gene sequences of 11 Plasmodium species, including three parasitic to humans, to infer their evolutionary relationships. Plasmodium falciparum, the most virulent of the human species, is closely related to Plasmodium reichenowi, which is parasitic to chimpanzee. The estimate...

  14. Direct ribosome isolation from soil to extract bacterial rRNA for community analysis.

    Felske, A; B. Engelen; Nübel, U; Backhaus, H

    1996-01-01

    A simple method that combines an adapted ribosome isolation method and a common RNA extraction step has been developed for selective recovery of intact rRNA from natural microbial communities in soil. After mechanical cell lysis, ribosomes are separated by centrifugation steps, avoiding massive humic acid contamination and RNA degradation. The protocol accommodates the complex composition of soils by blocking adsorbing surfaces and humic acids with polyvinylpyrrolidone and bovine serum albumi...

  15. New bioinformatic tools for analysis of nucleotide modifications in eukaryotic rRNA

    Piekna-Przybylska, Dorota; Decatur, Wayne A.; Fournier, Maurille J.

    2007-01-01

    This report presents a valuable new bioinformatics package for research on rRNA nucleotide modifications in the ribosome, especially those created by small nucleolar RNA:protein complexes (snoRNPs). The interactive service, which is not available elsewhere, enables a user to visualize the positions of pseudouridines, 2′-O-methylations, and base methylations in three-dimensional space in the ribosome and also in linear and secondary structure formats of ribosomal RNA. Our tools provide additio...

  16. rRNA genes from the lower chordate Herdmania momus: structural similarity with higher eukaryotes.

    Degnan, B M; Yan, J.; Hawkins, C J; Lavin, M F

    1990-01-01

    Ascidians, primitive chordates that have retained features of the likely progenitors to all vertebrates, are a useful model to study the evolutionary relationship of chordates to other animals. We have selected the well characterized ribosomal RNA (rRNA) genes to investigate this relationship, and we describe here the cloning and characterization of an entire ribosomal DNA (rDNA) tandem repeat unit from a lower chordate, the ascidian Herdmania momus. rDNA copy number and considerable sequence...

  17. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    Haltiner, M M; Smale, S T; Tjian, R

    1986-01-01

    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this...

  18. 18S rRNA suggests that Entoprocta are protostomes, unrelated to Ectoprocta

    Mackey, L.Y.; Winnepenninckx, B.; Wachter, R.; Backeljau, T.; Emschermann, P.; Garey, J.R.

    1996-01-01

    The Ento- and Ectoprocta are sometimes placed together in the Bryozoa, which have variously been regarded as proto- or deuterostomes. However, Entoprocta have also been allied to the pseudocoelomates, while Ectoprocta are often united with the Brachiopoda and Phoronida in the (super)phylum Lophophorata. Hence, the phylogenetic relationships of these taxa are still much debated. We determined complete 18S rRNA sequences of two entoprocts, an ectoproct, an inarticulate brachiopod, a phoronid, t...

  19. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    Mohammad Bagher Javadi Nobandegani; Halimi Mohd Saud; Wong Mui Yun

    2015-01-01

    Phosphate solubilizing bacteria (PSB) can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang) oil palm field (University Putra Malaysia). Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta sub...

  20. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    Anna eKiryk

    2013-11-01

    Full Text Available Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer´s disease (AD and may play a role in dementia. Moreover aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3 and dentate gyrus. Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that thirty-six transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the dentate gyrus a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving

  1. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  2. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness.

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan

    2016-06-01

    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general. PMID:26119842

  3. Conversion of nicotinic acid to trigonelline is catalyzed by N-methyltransferase belonged to motif B′ methyltransferase family in Coffea arabica

    Mizuno, Kouichi, E-mail: koumno@akita-pu.ac.jp [Faculty of Bioresource Sciences, Akita Prefectural University, Akita City, Akita 010-0195 (Japan); Matsuzaki, Masahiro [Faculty of Bioresource Sciences, Akita Prefectural University, Akita City, Akita 010-0195 (Japan); Kanazawa, Shiho [Graduate School of Humanities and Sciences, Ochanomizu University, Otsuka, Bunkyo-ku, Tokyo 112-8610 (Japan); Tokiwano, Tetsuo; Yoshizawa, Yuko [Faculty of Bioresource Sciences, Akita Prefectural University, Akita City, Akita 010-0195 (Japan); Kato, Misako [Graduate School of Humanities and Sciences, Ochanomizu University, Otsuka, Bunkyo-ku, Tokyo 112-8610 (Japan)

    2014-10-03

    Graphical abstract: Trigonelline synthase catalyzes the conversion of nicotinic acid to trigonelline. We isolated and characterized trigonelline synthase gene(s) from Coffea arabica. - Highlights: • Trigonelline is a major compound in coffee been same as caffeine is. • We isolated and characterized trigonelline synthase gene. • Coffee trigonelline synthases are highly homologous with coffee caffeine synthases. • This study contributes the fully understanding of pyridine alkaloid metabolism. - Abstract: Trigonelline (N-methylnicotinate), a member of the pyridine alkaloids, accumulates in coffee beans along with caffeine. The biosynthetic pathway of trigonelline is not fully elucidated. While it is quite likely that the production of trigonelline from nicotinate is catalyzed by N-methyltransferase, as is caffeine synthase (CS), the enzyme(s) and gene(s) involved in N-methylation have not yet been characterized. It should be noted that, similar to caffeine, trigonelline accumulation is initiated during the development of coffee fruits. Interestingly, the expression profiles for two genes homologous to caffeine synthases were similar to the accumulation profile of trigonelline. We presumed that these two CS-homologous genes encoded trigonelline synthases. These genes were then expressed in Escherichiacoli, and the resulting recombinant enzymes that were obtained were characterized. Consequently, using the N-methyltransferase assay with S-adenosyl[methyl-{sup 14}C]methionine, it was confirmed that these recombinant enzymes catalyzed the conversion of nicotinate to trigonelline, coffee trigonelline synthases (termed CTgS1 and CTgS2) were highly identical (over 95% identity) to each other. The sequence homology between the CTgSs and coffee CCS1 was 82%. The pH-dependent activity curve of CTgS1 and CTgS2 revealed optimum activity at pH 7.5. Nicotinate was the specific methyl acceptor for CTgSs, and no activity was detected with any other nicotinate derivatives, or

  4. Conversion of nicotinic acid to trigonelline is catalyzed by N-methyltransferase belonged to motif B′ methyltransferase family in Coffea arabica

    Graphical abstract: Trigonelline synthase catalyzes the conversion of nicotinic acid to trigonelline. We isolated and characterized trigonelline synthase gene(s) from Coffea arabica. - Highlights: • Trigonelline is a major compound in coffee been same as caffeine is. • We isolated and characterized trigonelline synthase gene. • Coffee trigonelline synthases are highly homologous with coffee caffeine synthases. • This study contributes the fully understanding of pyridine alkaloid metabolism. - Abstract: Trigonelline (N-methylnicotinate), a member of the pyridine alkaloids, accumulates in coffee beans along with caffeine. The biosynthetic pathway of trigonelline is not fully elucidated. While it is quite likely that the production of trigonelline from nicotinate is catalyzed by N-methyltransferase, as is caffeine synthase (CS), the enzyme(s) and gene(s) involved in N-methylation have not yet been characterized. It should be noted that, similar to caffeine, trigonelline accumulation is initiated during the development of coffee fruits. Interestingly, the expression profiles for two genes homologous to caffeine synthases were similar to the accumulation profile of trigonelline. We presumed that these two CS-homologous genes encoded trigonelline synthases. These genes were then expressed in Escherichiacoli, and the resulting recombinant enzymes that were obtained were characterized. Consequently, using the N-methyltransferase assay with S-adenosyl[methyl-14C]methionine, it was confirmed that these recombinant enzymes catalyzed the conversion of nicotinate to trigonelline, coffee trigonelline synthases (termed CTgS1 and CTgS2) were highly identical (over 95% identity) to each other. The sequence homology between the CTgSs and coffee CCS1 was 82%. The pH-dependent activity curve of CTgS1 and CTgS2 revealed optimum activity at pH 7.5. Nicotinate was the specific methyl acceptor for CTgSs, and no activity was detected with any other nicotinate derivatives, or with

  5. rRNA Binding Sites and the Molecular Mechanism of Action of the Tetracyclines.

    Chukwudi, Chinwe U

    2016-08-01

    The tetracycline antibiotics are known to be effective in the treatment of both infectious and noninfectious disease conditions. The 16S rRNA binding mechanism currently held for the antibacterial action of the tetracyclines does not explain their activity against viruses, protozoa that lack mitochondria, and noninfectious conditions. Also, the mechanism by which the tetracyclines selectively inhibit microbial protein synthesis against host eukaryotic protein synthesis despite conservation of ribosome structure and functions is still questionable. Many studies have investigated the binding of the tetracyclines to the 16S rRNA using the small ribosomal subunit of different bacterial species, but there seems to be no agreement between various reports on the exact binding site on the 16S rRNA. The wide range of activity of the tetracyclines against a broad spectrum of bacterial pathogens, viruses, protozoa, and helminths, as well as noninfectious conditions, indicates a more generalized effect on RNA. In the light of recent evidence that the tetracyclines bind to various synthetic double-stranded RNAs (dsRNAs) of random base sequences, suggesting that the double-stranded structures may play a more important role in the binding of the tetracyclines to RNA than the specific base pairs, as earlier speculated, it is imperative to consider possible alternative binding modes or sites that could help explain the mechanisms of action of the tetracyclines against various pathogens and disease conditions. PMID:27246781

  6. Characterization of Hydrocortisone Biometabolites and 18S rRNA Gene in Chlamydomonas reinhardtii Cultures

    Seyed Bagher Mosavi-Azam

    2008-10-01

    Full Text Available A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1. This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25ºC for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17b-Dihydroxyandrost-4-en-3-one (2, 11b-hydroxyandrost-4-en-3,17-dione (3, 11b,17a,20b,21-tetrahydroxypregn-4-en-3-one (4 and prednisolone (5 were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  7. Molecular systematics of Volvocales (Chlorophyceae, Chlorophyta) based on exhaustive 18S rRNA phylogenetic analyses.

    Nakada, Takashi; Misawa, Kazuharu; Nozaki, Hisayoshi

    2008-07-01

    The taxonomy of Volvocales (Chlorophyceae, Chlorophyta) was traditionally based solely on morphological characteristics. However, because recent molecular phylogeny largely contradicts the traditional subordinal and familial classifications, no classification system has yet been established that describes the subdivision of Volvocales in a manner consistent with the phylogenetic relationships. Towards development of a natural classification system at and above the generic level, identification and sorting of hundreds of sequences based on subjective phylogenetic definitions is a significant step. We constructed an 18S rRNA gene phylogeny based on 449 volvocalean sequences collected using exhaustive BLAST searches of the GenBank database. Many chimeric sequences, which can cause fallacious phylogenetic trees, were detected and excluded during data collection. The results revealed 21 strongly supported primary clades within phylogenetically redefined Volvocales. Phylogenetic classification following PhyloCode was proposed based on the presented 18S rRNA gene phylogeny along with the results of previous combined 18S and 26S rRNA and chloroplast multigene analyses. PMID:18430591

  8. Details of gastropod phylogeny inferred from 18S rRNA sequences.

    Winnepenninckx, B; Steiner, G; Backeljau, T; De Wachter, R

    1998-02-01

    Some generally accepted viewpoints on the phylogenetic relationships within the molluscan class Gastropoda are reassessed by comparing complete 18S rRNA sequences. Phylogenetic analyses were performed using the neighbor-joining and maximum parsimony methods. The previously suggested basal position of Archaeogastropoda, including Neritimorpha and Vetigastropoda, in the gastropod clade is confirmed. The present study also provides new molecular evidence for the monophyly of both Caenogastropoda and Euthyneura (Pulmonata and Opisthobranchia), making Prosobranchia paraphyletic. The relationships within Caenogastropoda and Euthyneura data turn out to be very unstable on the basis of the present 18S rRNA sequences. The present 18S rRNA data question, but are insufficient to decide on, muricacean (Neogastropoda), neotaenioglossan, pulmonate, or stylommatophoran monophyly. The analyses also focus on two systellommatophoran families, namely, Veronicellidae and Onchidiidae. It is suggested that Systellommatophora are not a monophyletic unit but, due to the lack of stability in the euthyneuran clade, their affinity to either Opisthobranchia or Pulmonata could not be determined. PMID:9479694

  9. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  10. Burkholderia glumae ToxA Is a Dual-Specificity Methyltransferase That Catalyzes the Last Two Steps of Toxoflavin Biosynthesis.

    Fenwick, Michael K; Philmus, Benjamin; Begley, Tadhg P; Ealick, Steven E

    2016-05-17

    Toxoflavin is a major virulence factor of the rice pathogen Burkholderia glumae. The tox operon of B. glumae contains five putative toxoflavin biosynthetic genes toxABCDE. ToxA is a predicted S-adenosylmethionine-dependent methyltransferase, and toxA knockouts of B. glumae are less virulent in plant infection models. In this study, we show that ToxA performs two consecutive methylations to convert the putative azapteridine intermediate, 1,6-didemethyltoxoflavin, to toxoflavin. In addition, we report a series of crystal structures of ToxA complexes that reveals the molecular basis of the dual methyltransferase activity. The results suggest sequential methylations with initial methylation at N6 of 1,6-didemethyltoxoflavin followed by methylation at N1. The two azapteridine orientations that position N6 or N1 for methylation are coplanar with a 140° rotation between them. The structure of ToxA contains a class I methyltransferase fold having an N-terminal extension that either closes over the active site or is largely disordered. The ordered conformation places Tyr7 at a position of a structurally conserved tyrosine site of unknown function in various methyltransferases. Crystal structures of ToxA-Y7F consistently show a closed active site, whereas structures of ToxA-Y7A consistently show an open active site, suggesting that the hydroxyl group of Tyr7 plays a role in opening and closing the active site during the multistep reaction. PMID:27070241

  11. Thirteen new patients with guanidinoacetate methyltransferase deficiency and functional characterization of nineteen novel missense variants in the GAMT gene

    Mercimek-Mahmutoglu, Saadet; Ndika, Joseph; Kanhai, Warsha;

    2014-01-01

    Guanidinoacetate methyltransferase deficiency (GAMT-D) is an autosomal recessively inherited disorder of creatine biosynthesis. Creatine deficiency on cranial proton magnetic resonance spectroscopy, and elevated guanidinoacetate levels in body fluids are the biomarkers of GAMT-D. In 74 patients 5...

  12. Impaired Homocysteine Transmethylation and Protein-Methyltransferase Activity Reduce Expression of Selenoprotein P: Implications for Obesity and Metabolic Syndrome

    Obesity causes Metabolic Syndrome and Type-II Diabetes, disrupting hepatic function, methionine (Met)/homocysteine (Hcy) transmethylation and methyltransferase (PRMT) activities. Selenoprotein P (SEPP1), exported from the liver, is the predominate form of plasma selenium (Se) and the physiological S...

  13. No up-regulation of the phosphatidylethanolamine N-methyltransferase pathway and choline production by sex hormones in cats

    Valtolina, Chiara; Vaandrager, Arie B; Favier, Robert P; Robben, Joris H; Tuohetahuntila, Maidina; Kummeling, Anne; Jeusette, Isabelle; Rothuizen, Jan

    2015-01-01

    BACKGROUND: Feline hepatic lipidosis (FHL) is a common cholestatic disease affecting cats of any breed, age and sex. Both choline deficiency and low hepatic phosphatidylethanolamine N-methyltransferase (PEMT) activity are associated with hepatic lipidosis (HL) in humans, mice and rats. The PEMT expr

  14. Implications of fast-time scale dynamics of human DNA/RNA cytosine methyltransferases (DNMTs) for protein function

    Evans, D. A.; Bronowska, Agnieszka Katarzyna

    2010-01-01

    Roč. 125, 3/6 (2010), s. 407-418. ISSN 1432-881X Institutional research plan: CEZ:AV0Z40550506 Keywords : MD simulations * DNA/RNA methyltransferase * enthalpy-entropy compensation Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.903, year: 2010

  15. Flexible double-headed cytosine-linked 2'-deoxycytidine nucleotides. Synthesis, polymerase incorporation to DNA and interaction with DNA methyltransferases

    Kielkowski, Pavel; Cahová, Hana; Pohl, Radek; Hocek, Michal

    2016-01-01

    Roč. 24, č. 6 (2016), s. 1268-1276. ISSN 0968-0896 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * pyrimidines * DNA methyltransferases * DNA polymerases Subject RIV: CC - Organic Chemistry Impact factor: 2.793, year: 2014

  16. An assay for human erythrocyte catechol-O-methyltransferase activity using a catechol estrogen as the substrate

    A radiometric assay for catechol-O-methyltransferase (COMT) activity in human erythrocytes is described that employs 2-hydroxy[3H]estrone, and nonradiolabeled S-adenosylmethionine (SAM) as the cosubstrates. The ease of separation of the product of the reaction, 2-methoxy[3H)estrone from 2-hydroxy-[3H]estrone makes it possible to achieve low reaction blanks. The assay is very sensitive, and only 200 μl of whole blood are used per determination. The assay is highly reproducible. The interassay variability (coefficient of variation) was 6.5% for 24 assays of COMT activity in red blood cells in blood obtained daily for 24 days from one person. In incubations conducted at 370C for 30 min, the catechol-O-methyltransferase activity was a linear function of enzyme concentration (equivalent to 11 to 180 μl of packed red blood cells). Employing this assay, we evaluated the catalytic conversion of 2-hydroxyestrone to 2-methoxy-estrone by catechol-O-methyltransferase from human red blood cells and found that the apparent Michaelis constant and the apparent maximal rate of reaction were 3 X 10-7 M and 6.7 X 10-9 mol.ml-1 erythrocytes . h-1, respectively. The catechol-O-methyltransferase activity measured in erythrocytes obtained from 100 healthy subjects (men and nonpregnant women) was 8.2 +- 0.17 (mean +- S.E.) nmol 2-methoxyestrone . ml-1 erythrocytes. h-1. (Auth.)

  17. Phylogenetic, molecular, and biochemical characterization of caffeic aicd O-methyltransferase (COMT) gene family in Brachypodium distachyon

    Caffeic acid O-methyltransferase (COMT) is one of the important enzymes controlling lignin monomer production in plant cell wall synthesis. Analysis of the genome sequence of new grass model Brachypodium distachyon identified four COMT gene homologues, designated as BdCOMT1, BdCOMT2, BdCOMT3, and ...

  18. Molecular cloning, characterization and expression of the caffeic acid O-methyltransferase (COMT) ortholog from kenaf (Hibiscus cannabinus)

    We cloned the full-length of the gene putatively encoding caffeic acid O-methyltransferase (COMT) from kenaf (Hibiscus cannabinus L.) using degenerate primers and the RACE (rapid amplification of cDNA ends) method. Kenaf is an herbaceous and rapidly growing dicotyledonous plant with great potential ...

  19. Current understanding of the interplay between catechol-O-methyltransferase genetic variants, sleep, brain development and cognitive performance in schizophrenia

    Tucci, Valter; Lassi, Glenda; Kas, Martien J

    2012-01-01

    Abnormal sleep is an endophenotype of schizophrenia. Here we provide an overview of the genetic mechanisms that link specific sleep physiological processes to schizophrenia-related cognitive defects. In particular, we will review the possible relationships between catechol-O-methyltransferase (COMT)

  20. Comparative Distribution and Retention of Arsenic in Arsenic (+3 Oxidation State) Methyltransferase Knockout and Wild Type Mice

    The mouse arsenic (+3 oxidation state) methyltransferase (As3mt) gene encodes a ~ 43 kDa protein that catalyzes conversion of inorganic arsenic into methylated products. Heterologous expression of AS3MT or its silencing by RNA interference controls arsenic methylation phenotypes...

  1. Polymorphisms in O-methyltransferase genes are associated with stover cell wall digestibility in European maize (Zea mays L.)

    Brenner, Everton A; Zein, Imad; Chen, Yongsheng;

    2010-01-01

    Background OMT (O-methyltransferase) genes are involved in lignin biosynthesis, which relates to stover cell wall digestibility. Reduced lignin content is an important determinant of both forage quality and ethanol conversion efficiency of maize stover. Results Variation in genomic sequences codi...

  2. An integrated epigenetic and genetic analysis of DNA methyltransferase genes (DNMTs) in tumor resistant and susceptible chicken lines

    Both epigenetic alterations and genetic variations play essential roles in tumorigenesis. The epigenetic modification of DNA methylation is catalyzed and maintained by the DNA methyltransferases (DNMT3a, DNMT3b and DNMT1). DNA mutations and DNA methylation profiles of DNMTs themselves and their rela...

  3. Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome

    Carlos; W; Nossa; William; E; Oberdorf; Jφrn; A; Aas; Bruce; J; Paster; Todd; Z; DeSantis; Eoin; L; Brodie; Daniel; Malamud; Michael; A; Poles

    2010-01-01

    AIM:To design and validate broad-range 16S rRNA primers for use in high throughput sequencing to classify bacteria isolated from the human foregut microbiome.METHODS:A foregut microbiome dataset was constructed using 16S rRNA gene sequences obtained from oral,esophageal,and gastric microbiomes produced by Sanger sequencing in previous studies represented by 219 bacterial species.Candidate primers evaluated were from the European rRNA database.To assess the effect of sequence length on accuracy of classifica...

  4. Primary and secondary structure of 5.8S rRNA from the silkgland of Bombyx mori.

    Fujiwara, H.; Kawata, Y.; H. Ishikawa

    1982-01-01

    Nucleotide sequence of 5.8S rRNA of the silkworm, Bombyx mori has been determined by gel sequencing methods. The 5.8S rRNA was the longest so far reported, with the 5'-terminal sequence several nucleotides longer than those of the other organisms. Upon constructing the secondary structure in accordance with the "burp gun" model (12), the Bombyx 5.8S rRNA formed a wide-open "muzzle" due to several unpaired bases at the ends. The overall structure also appeared less stable with less G . C pairs...

  5. An efficient rRNA removal method for RNA sequencing in GC-rich bacteria

    Peano Clelia

    2013-01-01

    Full Text Available Abstract Background Next generation sequencing (NGS technologies have revolutionized gene expression studies and functional genomics analysis. However, further improvement of RNA sequencing protocols is still desirable, in order to reduce NGS costs and to increase its accuracy. In bacteria, a major problem in RNA sequencing is the abundance of ribosomal RNA (rRNA, which accounts for 95-98% of total RNA and can therefore hinder sufficient coverage of mRNA, the main focus of transcriptomic studies. Thus, efficient removal of rRNA is necessary to achieve optimal coverage, good detection sensitivity and reliable results. An additional challenge is presented by microorganisms with GC-rich genomes, in which rRNA removal is less efficient. Results In this work, we tested two commercial kits for rRNA removal, either alone or in combination, on Burkholderia thailandensis. This bacterium, chosen as representative of the important Burkholderia genus, which includes both pathogenic and environmental bacteria, has a rather large (6.72 Mb and GC-rich (67.7% genome. Each enriched mRNA sample was sequenced through paired-end Illumina GAIIx run in duplicate, yielding between 10 and 40 million reads. We show that combined treatment with both kits allows an mRNA enrichment of more than 238-fold, enabling the sequencing of almost all (more than 90% B. thailandensis transcripts from less than 10 million reads, without introducing any bias in mRNA relative abundance, thus preserving differential expression profile. Conclusions The mRNA enrichment protocol presented in this work leads to an increase in detection sensitivity up to 770% compared to total RNA; such increased sensitivity allows for a corresponding reduction in the number of sequencing reads necessary for the complete analysis of whole transcriptome expression profiling. Thus we can conclude that the MICROBExpress/Ovation combined rRNA removal method could be suitable for RNA sequencing of whole

  6. Methanol:coenzyme M methyltransferase from Methanosarcina barkeri. Zinc dependence and thermodynamics of the methanol:cob(I)alamin methyltransferase reaction.

    Sauer, K; Thauer, R K

    1997-10-01

    In Methanosarcina barkeri, methanogenesis from methanol is initiated by the formation of methyl-coenzyme M from methanol and coenzyme M. This methyl transfer reaction is catalyzed by two enzymes, designated methyltransferases 1 (MT1) and 2 (MT2). Transferase MT1, which is composed of a 50-kDa subunit, MtaB, and a 27-kDa corrinoid-harbouring subunit, MtaC, has been shown recently to catalyze the methylation of free cob(I)alamin with methanol [Sauer, K., Harms, U. & Thauer, R. K. (1997) Eur. J. Biochem. 243, 670-677]. We report here that this reaction is catalyzed by subunit MtaB overproduced in Escherichia coli. MtaB also catalyzed the formation of methanol from methylcobalamin and H2O, the hydrolysis being associated with a free-energy change deltaG(o)' of approximately +7.0 kJ/mol. MtaB was found to contain 1 mol zinc, and its activity to be zinc dependent (pK(Zn2+) = 9.3). The zinc dependence of the MT2 (MtaA)-catalyzed reaction is also described (pK(Zn2+) = 9.6). PMID:9363780

  7. Extension of model potential methods to treat charge transfer in open shell systems. Application to the Si3+/He, He2+/He (21S) and He2+/He (23S) systems

    Charge transfer reactions in ion-atom collisions are investigated theoretically for systems involving open-shell configurations. Both model potential and ab-initio methods are used to treat the adiabatic states of the collision complex. A quantum mechanical treatment of the collision dynamics is used. Electron capture cross sections for two representative systems (He2+ in collision with either 21S or 23S metastable He and for Si3+ with ground state He) are calculated in the eV-keV energy range. (author)

  8. Caracterização da região espaçadora 16-23S rDNA para diferenciação de estirpes de rizóbios utilizadas na produção de inoculantes comerciais no Brasil Characterization of the spacer region 16-23S rDNA for differentiation of strains of rhizobia used in the production of commercial inoculants in Brazil

    Andréia Mara Rotta Oliveira

    2012-08-01

    Full Text Available A identificação de estirpes de rizóbio tem sido feita pela especificidade por hospedeiros e ensaios microbiológicos tradicionais. Por constituírem um grupo filogeneticamente heterogêneo, diferentes técnicas moleculares têm sido empregadas para auxiliar na caracterização genética e na identificação de estirpes eficientes e competitivas para a produção de inoculantes. Este trabalho teve por objetivos caracterizar a região espaçadora 16S-23S rDNA das estirpes de rizóbios utilizadas nos inoculantes comercializados no Brasil para espécies leguminosas, utilizando a técnica da PCR em combinação com a de RFLP, e avaliar a possibilidade do uso desse marcador molecular como método auxiliar para identificação das estipes. A amplificação da região espaçadora 16-23 S rDNA das estirpes de rizóbios gerou fragmentos com tamanhos que variaram entre 700pb e 1350pb. Os produtos resultantes da amplificação foram submetidos à digestão com as endonucleases. Mps I, Dde I e Hae III. Os resultados obtidos neste estudo indicam a possibilidade do uso da técnica de PCR-RFLP da região espaçadora 16S-23S rDNA como marcador molecular para a diferenciar as estirpes de rizóbios, em complemento às técnicas microbiológicas tradicionais. Contudo, este marcador não é suficientemente discriminatório para ser usado na identificação das estirpes recomendadas para a produção de inoculantes comerciais.The identification of strains of rhizobia has been made by host specificity and regular microbiological tests. By forming a phylogenetically heterogeneous group, different molecular techniques have been employed to assist in the genetic characterization and identification of efficient and competitive strains for production of inoculants. This study aimed to characterize the spacer region 16S-23S rDNA of the strains of rhizobia used in commercial inoculants in Brazil for legume species, using PCR combined with RFLP, and assess the possibility

  9. O6-methylguanine-DNA methyltransferase (MGMT): can function explain a suicidal mechanism?

    Gouws, Chrisna; Pretorius, Pieter J

    2011-11-01

    Why does O(6)-methylguanine-DNA methyltransferase (MGMT), an indispensable DNA repair enzyme, have a mechanism which seems to run counter to its importance? This enzyme is key to the removal of detrimental alkyl adducts from guanine bases. Although the mechanism is well known, an unusual feature surrounds its mode of action, which is its so-called suicidal endpoint. In addition, induction of MGMT is highly variable and its kinetics is atypical. These features raise some questions on the seemingly paradoxical mechanism. In this manuscript we point out that, although there is ample literature regarding the "how" of the MGMT enzyme, we found a lack of information on "why" this specific mechanism is in place. We then ask whether we know all there is to know about MGMT, or if perhaps there is a further as yet unknown function for MGMT, or if the suicidal mechanism may play some kind of protective role in the cell. PMID:21864987

  10. Structural Basis for Binding of RNA and Cofactor by a KsgA Methyltransferase

    Tu, Chao; Tropea, Joseph E.; Austin, Brian P.; Court, Donald L.; Waugh, David S.; Ji, Xinhua; (NCI)

    2009-03-27

    Among methyltransferases, KsgA and the reaction it catalyzes are conserved throughout evolution. However, the specifics of substrate recognition by the enzyme remain unknown. Here we report structures of Aquifex aeolicus KsgA, in its ligand-free form, in complex with RNA, and in complex with both RNA and S-adenosylhomocysteine (SAH, reaction product of cofactor S-adenosylmethionine), revealing critical structural information on KsgA-RNA and KsgA-SAH interactions. Moreover, the structures show how conformational changes that occur upon RNA binding create the cofactor-binding site. There are nine conserved functional motifs (motifs IVIII and X) in KsgA. Prior to RNA binding, motifs I and VIII are flexible, each exhibiting two distinct conformations. Upon RNA binding, the two motifs become stabilized in one of these conformations, which is compatible with the binding of SAH. Motif X, which is also stabilized upon RNA binding, is directly involved in the binding of SAH.

  11. Adding a Lysine Mimic in the Design of Potent Inhibitors of Histone Lysine Methyltransferases

    Chang, Yanqi; Ganesh, Thota; Horton, John R.; Spannhoff, Astrid; Liu, Jin; Sun, Aiming; Zhang, Xing; Bedford, Mark T.; Shinkai, Yoichi; Snyder, James P.; Cheng, Xiaodong (Emory); (Kyoto); (Texas)

    2010-07-19

    Dynamic histone lysine methylation involves the activities of modifying enzymes (writers), enzymes removing modifications (erasers), and readers of the histone code. One common feature of these activities is the recognition of lysines in methylated and unmethylated states, whether they are substrates, reaction products, or binding partners. We applied the concept of adding a lysine mimic to an established inhibitor (BIX-01294) of histone H3 lysine 9 methyltransferases G9a and G9a-like protein by including a 5-aminopentyloxy moiety, which is inserted into the target lysine-binding channel and becomes methylated by G9a-like protein, albeit slowly. The compound enhances its potency in vitro and reduces cell toxicity in vivo. We suggest that adding a lysine or methyl-lysine mimic should be considered in the design of small-molecule inhibitors for other methyl-lysine writers, erasers, and readers.

  12. Molecular basis for oncohistone H3 recognition by SETD2 methyltransferase.

    Yang, Shuang; Zheng, Xiangdong; Lu, Chao; Li, Guo-Min; Allis, C David; Li, Haitao

    2016-07-15

    High-frequency point mutations of genes encoding histones have been identified recently as novel drivers in a number of tumors. Specifically, the H3K36M/I mutations were shown to be oncogenic in chondroblastomas and undifferentiated sarcomas by inhibiting H3K36 methyltransferases, including SETD2. Here we report the crystal structures of the SETD2 catalytic domain bound to H3K36M or H3K36I peptides with SAH (S-adenosylhomocysteine). In the complex structure, the catalytic domain adopts an open conformation, with the K36M/I peptide snuggly positioned in a newly formed substrate channel. Our structural and biochemical data reveal the molecular basis underying oncohistone recognition by and inhibition of SETD2. PMID:27474439

  13. Nucleosome Binding Alters the Substrate Bonding Environment of Histone H3 Lysine 36 Methyltransferase NSD2.

    Poulin, Myles B; Schneck, Jessica L; Matico, Rosalie E; Hou, Wangfang; McDevitt, Patrick J; Holbert, Marc; Schramm, Vern L

    2016-06-01

    Nuclear receptor-binding SET domain protein 2 (NSD2) is a histone H3 lysine 36 (H3K36)-specific methyltransferase enzyme that is overexpressed in a number of cancers, including multiple myeloma. NSD2 binds to S-adenosyl-l-methionine (SAM) and nucleosome substrates to catalyze the transfer of a methyl group from SAM to the ε-amino group of histone H3K36. Equilibrium binding isotope effects and density functional theory calculations indicate that the SAM methyl group is sterically constrained in complex with NSD2, and that this steric constraint is released upon nucleosome binding. Together, these results show that nucleosome binding to NSD2 induces a significant change in the chemical environment of enzyme-bound SAM. PMID:27183271

  14. Species identification and profiling of complex microbial communities using shotgun Illumina sequencing of 16S rRNA amplicon sequences.

    Ong, SH; Kukkillaya, VU; Wilm, A; Lay, C; Ho, EX; Low, L; Hibberd, ML; Nagarajan, N.

    2013-01-01

    The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequenc...

  15. Transcriptional down-regulation and rRNA cleavage in Dictyostelium discoideum mitochondria during Legionella pneumophila infection.

    Chenyu Zhang

    Full Text Available Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial

  16. Imatinib causes epigenetic alterations of PTEN gene via upregulation of DNA methyltransferases and polycomb group proteins

    We have recently reported the possible imatinib-resistant mechanism; long-term exposure of leukemia cells to imatinib downregulated levels of phosphatase and tensin homolog deleted on chromosome 10 (PTEN) via hypermethylation of its promoter region (Leukemia 2010; 24: 1631). The present study explored the molecular mechanisms by which imatinib caused methylation on the promoter region of this tumor suppressor gene in leukemia cells. Real-time reverse transcription PCR found that long-term exposure of chronic eosinophilic leukemia EOL-1 cells expressing FIP1L1/platelet-derived growth factor receptor-α to imatinib induced expression of DNA methyltransferase 3A (DNMT3A) and histone-methyltransferase enhancer of zeste homolog 2 (EZH2), a family of polycomb group, thereby increasing methylation of the gene. Immunoprecipitation assay found the increased complex formation of DNMT3A and EZH2 proteins in these cells. Moreover, chromatin immunoprecipitation assay showed that amounts of both DNMT3A and EZH2 proteins bound around the promoter region of PTEN gene were increased in EOL-1 cells after exposure to imatinib. Furthermore, we found that levels of DNMT3A and EZH2 were strikingly increased in leukemia cells isolated from individuals with chronic myelogenous leukemia (n=1) and Philadelphia chromosome-positive acute lymphoblastic leukemia (n=2), who relapsed after treatment with imatinib compared with those isolated at their initial presentation. Taken together, imatinib could cause drug-resistance via recruitment of polycomb gene complex to the promoter region of the PTEN and downregulation of this gene's transcripts in leukemia patients

  17. Characterization of three O-methyltransferases involved in noscapine biosynthesis in opium poppy.

    Dang, Thu-Thuy T; Facchini, Peter J

    2012-06-01

    Noscapine is a benzylisoquinoline alkaloid produced in opium poppy (Papaver somniferum) and other members of the Papaveraceae. It has been used as a cough suppressant and more recently was shown to possess anticancer activity. However, the biosynthesis of noscapine in opium poppy has not been established. A proposed pathway leading from (S)-reticuline to noscapine includes (S)-scoulerine, (S)-canadine, and (S)-N-methylcanadine as intermediates. Stem cDNA libraries and latex extracts of eight opium poppy cultivars displaying different alkaloid profiles were subjected to massively parallel pyrosequencing and liquid chromatography-tandem mass spectrometry, respectively. Comparative transcript and metabolite profiling revealed the occurrence of three cDNAs encoding O-methyltransferases designated as SOMT1, SOMT2, and SOMT3 that correlated with the accumulation of noscapine in the eight cultivars. SOMT transcripts were detected in all opium poppy organs but were most abundant in aerial organs, where noscapine primarily accumulates. SOMT2 and SOMT3 showed strict substrate specificity and regiospecificity as 9-O-methyltransferases targeting (S)-scoulerine. In contrast, SOMT1 was able to sequentially 9- and 2-O-methylate (S)-scoulerine, yielding (S)-tetrahydropalmatine. SOMT1 also sequentially 3'- and 7-O-methylated both (S)-norreticuline and (S)-reticuline with relatively high substrate affinity, yielding (S)-tetrahydropapaverine and (S)-laudanosine, respectively. The metabolic functions of SOMT1, SOMT2, and SOMT3 were investigated in planta using virus-induced gene silencing. Reduction of SOMT1 or SOMT2 transcript levels resulted in a significant decrease in noscapine accumulation. Reduced SOMT1 transcript levels also caused a decrease in papaverine accumulation, confirming the selective roles for these enzymes in the biosynthesis of both alkaloids in opium poppy. PMID:22535422

  18. Protein arginine methyltransferase 5 (PRMT5) is a novel coactivator of constitutive androstane receptor (CAR)

    The constitutive androstane receptor (CAR) plays a key role in the expression of xenobiotic/steroid and drug metabolizing enzymes and their transporters. In this study, we demonstrated that protein arginine methyltransferase 5 (PRMT5) is a novel CAR-interacting protein. Furthermore, the PRMT-dependent induction of a CAR reporter gene, which was independent of methyltransferase activity, was enhanced in the presence of steroid receptor coactivator 1 (SRC1), peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1α) or DEAD box DNA/RNA helicase DP97. Using tetracycline inducible-hCAR system in HepG2 cells, we showed that knockdown of PRMT5 with small interfering RNA suppressed tetracycline -induced mRNA expression of CYP2B6 but not of CYP2C9 or CYP3A4. PRMT5 enhanced phenobarbital-mediated transactivation of a phenobarbital-responsive enhancer module (PBREM)-driven reporter gene in co-operation with PGC-1α in rat primary hepatocytes. Based on these findings, we suggest PRMT5 to be a gene (or promoter)-selective coactivator of CAR by mediating the formation of complexes between hCAR and appropriate coactivators. - Highlights: • Nuclear receptor CAR interact with PRMT5. • PRMT5 enhances transcriptional activity of CAR. • PRMT5 synergistically enhances transactivity of CAR by the co-expression of SRC-1, DP97 or PGC1α. • PRMT5 is a gene-selective co-activator for hCAR

  19. Protein arginine methyltransferase 5 (PRMT5) is a novel coactivator of constitutive androstane receptor (CAR)

    Kanno, Yuichiro, E-mail: ykanno@phar.toho-u.ac.jp; Inajima, Jun; Kato, Sayaka; Matsumoto, Maika; Tokumoto, Chikako; Kure, Yuki; Inouye, Yoshio

    2015-03-27

    The constitutive androstane receptor (CAR) plays a key role in the expression of xenobiotic/steroid and drug metabolizing enzymes and their transporters. In this study, we demonstrated that protein arginine methyltransferase 5 (PRMT5) is a novel CAR-interacting protein. Furthermore, the PRMT-dependent induction of a CAR reporter gene, which was independent of methyltransferase activity, was enhanced in the presence of steroid receptor coactivator 1 (SRC1), peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1α) or DEAD box DNA/RNA helicase DP97. Using tetracycline inducible-hCAR system in HepG2 cells, we showed that knockdown of PRMT5 with small interfering RNA suppressed tetracycline -induced mRNA expression of CYP2B6 but not of CYP2C9 or CYP3A4. PRMT5 enhanced phenobarbital-mediated transactivation of a phenobarbital-responsive enhancer module (PBREM)-driven reporter gene in co-operation with PGC-1α in rat primary hepatocytes. Based on these findings, we suggest PRMT5 to be a gene (or promoter)-selective coactivator of CAR by mediating the formation of complexes between hCAR and appropriate coactivators. - Highlights: • Nuclear receptor CAR interact with PRMT5. • PRMT5 enhances transcriptional activity of CAR. • PRMT5 synergistically enhances transactivity of CAR by the co-expression of SRC-1, DP97 or PGC1α. • PRMT5 is a gene-selective co-activator for hCAR.

  20. Functional characterisation of three o-methyltransferases involved in the biosynthesis of phenolglycolipids in Mycobacterium tuberculosis.

    Roxane Simeone

    Full Text Available Phenolic glycolipids are produced by a very limited number of slow-growing mycobacterial species, most of which are pathogen for humans. In Mycobacterium tuberculosis, the etiologic agent of tuberculosis, these molecules play a role in the pathogenicity by modulating the host immune response during infection. The major variant of phenolic glycolipids produced by M. tuberculosis, named PGL-tb, consists of a large lipid core terminated by a glycosylated aromatic nucleus. The carbohydrate part is composed of three sugar residues, two rhamnosyl units and a terminal fucosyl residue, which is per-O-methylated, and seems to be important for pathogenicity. While most of the genes responsible for the synthesis of the lipid core domain and the saccharide appendage of PGL-tb have been characterized, the enzymes involved in the O-methylation of the fucosyl residue of PGL-tb remain unknown. In this study we report the identification and characterization of the methyltransferases required for the O-methylation of the terminal fucosyl residue of PGL-tb. These enzymes are encoded by genes Rv2954c, Rv2955c and Rv2956. Mutants of M. tuberculosis harboring deletion within these genes were constructed. Purification and analysis of the phenolglycolipids produced by these strains, using a combination of mass spectrometry and NMR spectroscopy, revealed that Rv2954c, Rv2955c and Rv2956 encode the methyltransferases that respectively catalysed the O-methylation of the hydroxyl groups located at positions 3, 4 and 2 of the terminal fucosyl residue of PGL-tb. Our data also suggest that methylation at these positions is a sequential process, starting with position 2, followed by positions 4 and 3.

  1. Expression of a functional jasmonic acid carboxyl methyltransferase is negatively correlated with strawberry fruit development.

    Preuß, Anja; Augustin, Christiane; Figueroa, Carlos R; Hoffmann, Thomas; Valpuesta, Victoriano; Sevilla, José F; Schwab, Wilfried

    2014-09-15

    The volatile metabolite methyl jasmonate (MeJA) plays an important role in intra- and interplant communication and is involved in diverse biological processes. In this study, we report the cloning and functional characterization of a S-adenosyl-l-methionine:jasmonic acid carboxyl methyltransferase (JMT) from Fragaria vesca and Fragaria×ananassa. Biochemical assays and comprehensive transcript analyses showed that JMT has been erroneously annotated as gene fusion with a carboxyl methyltransferase (CMT) (gene15184) in the first published genome sequence of F. vesca. Recombinant FvJMT catalyzed the formation of MeJA with KM value of 22.3μM while FvCMT and the fusion protein were almost inactive. Activity of JMT with benzoic acid and salicylic acid as substrates was less than 1.5% of that with JA. Leucine at position 245, an amino acid missing in other JMT sequences is essential for activity of FvJMT. In accordance with MeJA levels, JMT transcript levels decreased steadily during strawberry fruit ripening, as did the expression levels of JA biosynthesis and regulatory genes. It appears that CMT has originated by a recent duplication of JMT and lost its enzymatic activity toward JA. In the newest version of the strawberry genome sequence (June 2014) CMT and JMT are annotated as separate genes in accordance with differential temporal and spatial expression patterns of both genes in Fragaria sp. In conclusion, MeJA, the inactive derivative of JA, is probably involved in early steps of fruit development by modulating the levels of the active plant hormone JA. PMID:25046752

  2. Computational Investigation of the Interplay of Substrate Positioning and Reactivity in Catechol O-Methyltransferase.

    Patra, Niladri; Ioannidis, Efthymios I; Kulik, Heather J

    2016-01-01

    Catechol O-methyltransferase (COMT) is a SAM- and Mg2+-dependent methyltransferase that regulates neurotransmitters through methylation. Simulations and experiments have identified divergent catecholamine substrate orientations in the COMT active site: molecular dynamics simulations have favored a monodentate coordination of catecholate substrates to the active site Mg2+, and crystal structures instead preserve bidentate coordination along with short (2.65 Å) methyl donor-acceptor distances. We carry out longer dynamics (up to 350 ns) to quantify interconversion between bidentate and monodentate binding poses. We provide a systematic determination of the relative free energy of the monodentate and bidentate structures in order to identify whether structural differences alter the nature of the methyl transfer mechanism and source of enzymatic rate enhancement. We demonstrate that the bidentate and monodentate binding modes are close in energy but separated by a 7 kcal/mol free energy barrier. Analysis of interactions in the two binding modes reveals that the driving force for monodentate catecholate orientations in classical molecular dynamics simulations is derived from stronger electrostatic stabilization afforded by alternate Mg2+ coordination with strongly charged active site carboxylates. Mixed semi-empirical-classical (SQM/MM) substrate C-O distances (2.7 Å) for the bidentate case are in excellent agreement with COMT X-ray crystal structures, as long as charge transfer between the substrates, Mg2+, and surrounding ligands is permitted. SQM/MM free energy barriers for methyl transfer from bidentate and monodentate catecholate configurations are comparable at around 21-22 kcal/mol, in good agreement with experiment (18-19 kcal/mol). Overall, the work suggests that both binding poses are viable for methyl transfer, and accurate descriptions of charge transfer and electrostatics are needed to provide balanced relative barriers when multiple binding poses are

  3. Molecular and biochemical characterization of the jasmonic acid methyltransferase gene from black cottonwood (Populus trichocarpa)

    Zhao, Nan [ORNL; Yao, Jianzhuang [University of Tennessee, Knoxville (UTK); Chaiprasongsuk, Minta [University of Tennessee, Knoxville (UTK); Li, Guanglin [University of Tennessee, Knoxville (UTK); Guan, Ju [University of Tennessee, Knoxville (UTK); Tschaplinski, Timothy J [ORNL; Guo, Hong [University of Tennessee, Knoxville (UTK); Chen, Feng [University of Tennessee, Knoxville (UTK)

    2013-01-01

    Methyl jasmonate is a metabolite known to be produced by many plants and has roles in diverse biological processes. It is biosynthesized by the action of S-adenosyl-L-methionine:jasmonic acid carboxyl methyltransferase (JMT), which belongs to the SABATH family of methyltransferases. Herein is reported the isolation and biochemical characterization of a JMT gene from black cottonwood (Populus trichocarpa). The genome of P. trichocarpa contains 28 SABATH genes (PtSABATH1 to PtSABATH28). Recombinant PtSABATH3 expressed in Escherichia coli showed the highest level of activity with jasmonic acid (JA) among carboxylic acids tested. It was therefore renamed PtJMT1. PtJMT1 also displayed activity with benzoic acid (BA), with which the activity was about 22% of that with JA. PtSABATH2 and PtSABATH4 were most similar to PtJMT1 among all PtSABATHs. However, neither of them had activity with JA. The apparent Km values of PtJMT1 using JA and BA as substrate were 175 lM and 341 lM, respectively. Mutation of Ser-153 and Asn-361, two residues in the active site of PtJMT1, to Tyr and Ser respectively, led to higher specific activity with BA than with JA. Homology-based structural modeling indicated that substrate alignment, in which Asn-361 is involved, plays a role in determining the substrate specificity of PtJMT1. In the leaves of young seedlings of black cottonwood, the expression of PtJMT1 was induced by plant defense signal molecules methyl jasmonate and salicylic acid and a fungal elicitor alamethicin, suggesting that PtJMT1 may have a role in plant defense against biotic stresses. Phylogenetic analysis suggests that PtJMT1 shares a common ancestor with the Arabidopsis JMT, and functional divergence of these two apparent JMT orthologs has occurred since the split of poplar and Arabidopsis lineages.

  4. Penning and associative ionisations of argon atoms by collisions with metastable helium atoms He(21S) and He(23S) of thermal energies 0.03-0.40eV

    This work, devoted to the 21S and 23S metastable states of the helium atom, is mainly experimental. It centres on observation of the non-bound states Ar+ and bound states HeAr+ created during collisions of these metastable atoms with argon atoms in the ground state. The Penning and associative ionisation cross-sections corresponding to these two processes were obtained as a function of the relative speed of approach of the He*+Ar particles in the thermal region 1200-4500m/s (0.3-0.40eV). The experimental time of flight method used in this experiment is original in its application to the measurement of reaction products such as Ar+ and HeAr+ ions. The results obtained testify to the efficiency of this method since the variations in the Penning ionisation cross-section sigmasub(IP)(v) and associative ionisation cross-section sigmasub(IA)(v) against speed have not been observed in other laboratories. They are given here for the couples He(23S)+Ar and He(21S) + Ar. The theoretical interpretation attempted for the cross-sections sigmasub(IP)(v) and sigmasub(IA)(v) is based on a very recent model due to the American school of Miller and the Japanese school of Nakamura. This model, common to all interpretations, can lead to different results according to whether quantum effects are taken into account

  5. The spatio-temporal distribution of He (23S1) metastable atoms in a MHz-driven helium plasma jet is influenced by the oxygen/nitrogen ratio of the surrounding atmosphere

    Winter, J.; Santos Sousa, J.; Sadeghi, N.; Schmidt-Bleker, A.; Reuter, S.; Puech, V.

    2015-04-01

    The density of helium He (23S1) metastable atoms is measured in a 1.6 mm diameter MHz-driven atmospheric pressure helium plasma jet by laser absorption spectroscopy with spatial and temporal resolution. The surrounding atmosphere of the jet is varied from pure oxygen to pure nitrogen with a gas shielding device. The highest metastable density of 1.3 × 1013 cm-3 is obtained in the center of the jet close to the nozzle exit at normal atmospheric air conditions. Within 0.3 mm in the radial direction and 2 mm in the axial direction, the He metastable density drops below the detection limit. The obtained He metastable lifetime is almost independent of the shielding gas composition. By analyzing the diffusion of shielding gas species into the effluent it is concluded that their density is too low to explain the observed He metastable lifetime. Instead, impurities from the feed gas, especially water molecules, are more likely to be responsible. However, a drastic change in metastable He density is observed when decreasing the amount of oxygen in the shielding gas. The lower the oxygen amount, the lower the metastable He density. For pure nitrogen, no He metastables are detected at all. By exchanging nitrogen with argon, a similar behavior is observed. Thus, it is concluded that it is the absence of ambient oxygen rather than the elevated presence of nitrogen, which is responsible for the observed decrease in the He (23S1) density.

  6. Molecular epidemiology of Plasmodium species prevalent in Yemen based on 18 s rRNA

    A Azazy Ahmed

    2010-11-01

    Full Text Available Abstract Background Malaria is an endemic disease in Yemen and is responsible for 4.9 deaths per 100,000 population per year and 43,000 disability adjusted life years lost. Although malaria in Yemen is caused mainly by Plasmodium falciparum and Plasmodium vivax, there are no sequence data available on the two species. This study was conducted to investigate the distribution of the Plasmodium species based on the molecular detection and to study the molecular phylogeny of these parasites. Methods Blood samples from 511 febrile patients were collected and a partial region of the 18 s ribosomal RNA (18 s rRNA gene was amplified using nested PCR. From the 86 positive blood samples, 13 Plasmodium falciparum and 4 Plasmodium vivax were selected and underwent cloning and, subsequently, sequencing and the sequences were subjected to phylogenetic analysis using the neighbor-joining and maximum parsimony methods. Results Malaria was detected by PCR in 86 samples (16.8%. The majority of the single infections were caused by P. falciparum (80.3%, followed by P. vivax (5.8%. Mixed infection rates of P. falciparum + P. vivax and P. falciparum + P. malariae were 11.6% and 2.3%, respectively. All P. falciparum isolates were grouped with the strain 3D7, while P. vivax isolates were grouped with the strain Salvador1. Phylogenetic trees based on 18 s rRNA placed the P. falciparum isolates into three sub-clusters and P. vivax into one cluster. Sequence alignment analysis showed 5-14.8% SNP in the partial sequences of the 18 s rRNA of P. falciparum. Conclusions Although P. falciparum is predominant, P. vivax, P. malariae and mixed infections are more prevalent than has been revealed by microscopy. This overlooked distribution should be considered by malaria control strategy makers. The genetic polymorphisms warrant further investigation.

  7. The role of human ribosomal proteins in the maturation of rRNA and ribosome production

    Robledo, Sara; Rachel A Idol; Crimmins, Dan L.; Ladenson, Jack H.; Mason, Philip J.; Bessler, Monica

    2008-01-01

    Production of ribosomes is a fundamental process that occurs in all dividing cells. It is a complex process consisting of the coordinated synthesis and assembly of four ribosomal RNAs (rRNA) with about 80 ribosomal proteins (r-proteins) involving more than 150 nonribosomal proteins and other factors. Diamond Blackfan anemia (DBA) is an inherited red cell aplasia caused by mutations in one of several r-proteins. How defects in r-proteins, essential for proliferation in all cells, lead to a hum...

  8. Structures of nucleolus and transcription sites of rRNA genes in rat liver cells

    2000-01-01

    We observed the ultrastructure of nucleolus in rat liver cells by conventional electronmicroscopy, and employed cytochemistry NAMA-Ur DNA specific stain method to analyze the distributionand position of nucleolar DNA in situ. The results showed that nucleolar DNA of rat livercells comes from nucleolus-associated chromatin, and continuously extends in the dense fibrillarcomponent (DFC) of nucleolus, localizes at the periphery of fibrillar center (FC) and in DFC. Furthermore,by employing anti-DNA/RNA hybrid antibodies, we directly and selectively labeled transcriptionsites of rRNA genes and testified that localization of transcription sites not only to DFC butalso to the periphery of FC.

  9. Altered features in the secondary structure of Vicia faba 5.8s rRNA.

    Nazar, R N; Wildeman, A G

    1981-01-01

    We have re-examined the nucleotide sequence of Vicia faba (broad bean) 5.8S rRNA using partial chemical degradation and a new approach to high temperature (65-80 degrees C) sequencing gels. The results indicate that the secondary structure was not completely disrupted in previous studies (Tanaka, Y., Dyer, T.A. and Brownlee, G.G. (1980) Nucleic Acid Res. 8, 1259-1272) and explain ambiguities between the nucleotide sequence and T1 ribonuclease digests. Despite this revision, estimates in the s...

  10. Evolution of green plants as deduced from 5S rRNA sequences

    Hori, Hiroshi; Lim, Byung-Lak; OSAWA, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land pl...

  11. Large-Scale, Protection-Free Synthesis of Se-Adenosyl-l-selenomethionine Analogues and Their Application as Cofactor Surrogates of Methyltransferases

    Bothwell, Ian R.; Luo, Minkui

    2014-01-01

    S-Adenosyl-l-methionine (SAM) analogues have previously demonstrated their utility as chemical reporters of methyltransferases. Here we describe the facile, large-scale synthesis of Se-alkyl Se-adenosyl-l-selenomethionine (SeAM) analogues and their precursor, Se-adenosyl-l-selenohomocysteine (SeAH). Comparison of SeAM analogues with their equivalent SAM analogues suggests that sulfonium-to-selenonium substitution can enhance their compatibility with certain protein methyltransferases, favorin...

  12. Interplay among coactivator-associated arginine methyltransferase 1, CBP, and CIITA in IFN-γ-inducible MHC-II gene expression

    Zika, Eleni; Fauquier, Lucas; Vandel, Laurence; Ting, Jenny P -Y

    2005-01-01

    Class II major histocompatibility (MHC-II) genes are prototype targets of IFN-γ. IFN-γ activates the expression of the non-DNA-binding master regulator of MHC-II, class II transactivator (CIITA), which is crucial for enhanceosome formation and gene activation. This report shows the importance of the histone methyltransferase, coactivator-associated arginine methyltransferase (CARM1/PRMT4), during IFN-γ-induced MHC-II gene activation. It also demonstrates the coordinated regulation of CIITA, C...

  13. O6-Methylguanine-DNA Methyltransferase (MGMT) mRNA Expression Predicts Outcome in Malignant Glioma Independent of MGMT Promoter Methylation

    Simone Kreth; Niklas Thon; Sabina Eigenbrod; Juergen Lutz; Carola Ledderose; Rupert Egensperger; Tonn, Joerg C.; Kretzschmar, Hans A.; Ludwig C Hinske; Kreth, Friedrich W.

    2011-01-01

    Background: We analyzed prospectively whether MGMT (O(6)-methylguanine-DNA methyltransferase) mRNA expression gains prognostic/predictive impact independent of MGMT promoter methylation in malignant glioma patients undergoing radiotherapy with concomitant and adjuvant temozolomide or temozolomide alone. As DNA-methyltransferases (DNMTs) are the enzymes responsible for setting up and maintaining DNA methylation patterns in eukaryotic cells, we analyzed further, whether MGMT promoter methylatio...

  14. A SAM-dependent methyltransferase cotranscribed with arsenate reductase alters resistance to peptidyl transferase center-binding antibiotics in Azospirillum brasilense Sp7.

    Singh, Sudhir; Singh, Chhaya; Tripathi, Anil Kumar

    2014-05-01

    The genome of Azospirillum brasilense harbors a gene encoding S-adenosylmethionine-dependent methyltransferase, which is located downstream of an arsenate reductase gene. Both genes are cotranscribed and translationally coupled. When they were cloned and expressed individually in an arsenate-sensitive strain of Escherichia coli, arsenate reductase conferred tolerance to arsenate; however, methyltransferase failed to do so. Sequence analysis revealed that methyltransferase was more closely related to a PrmB-type N5-glutamine methyltransferase than to the arsenate detoxifying methyltransferase ArsM. Insertional inactivation of prmB gene in A. brasilense resulted in an increased sensitivity to chloramphenicol and resistance to tiamulin and clindamycin, which are known to bind at the peptidyl transferase center (PTC) in the ribosome. These observations suggested that the inability of prmB:km mutant to methylate L3 protein might alter hydrophobicity in the antibiotic-binding pocket of the PTC, which might affect the binding of chloramphenicol, clindamycin, and tiamulin differentially. This is the first report showing the role of PrmB-type N5-glutamine methyltransferases in conferring resistance to tiamulin and clindamycin in any bacterium. PMID:24573606

  15. GENE 16S RRNA SEQUENCE PHYLOGENETIC ANALYSIS OF LYSINE PRODUCERS STRAINS

    G. S. Andriiash

    2014-12-01

    Full Text Available The phylogenetic relationships of strainsproducers of essential amino acids of aspartate family Brevibacterium sp. UCM Ac-674 (Brevibacterium sp. 90, Brevibacterium sp. IMV Ac-5004 (Brevibacterium sp. 90H, Brevibacterium sp. UCM Ac-675 (Brevibacterium sp. E531, mutant strain Brevibacterium sp. IMV B-7447 from the «Collections strains and lines of plants for food and agricultural biotechnology SO “Institute for Food Biotechnology and Genomics” of National Academy of Sciences of Ukraine were investigated. The affiliation strain Brevibacterium sp. IMV B-7447 to the genus Brevibacterium within the sequences of the genes based on 16S rRNA was confirmed. The dendogram of phylogenetic relationships of studied strains and related strains Brevibacterium from database GenBank was constructed. It was shown that by the criterion of homology gene sequences based on 16S rRNA the investigated strains-producers belong to three phylogenetic groups. It was established that the mutant strain Brevibacterium sp. ІMV B-7447 has no analogues in the database GenBank.

  16. (Accumulation of methyl-deficient rat liver messenger ribonucleic acid on ethionine administration). Progress report. [Methyltransferase activity in Ehrlich ascites tumor cells and effects of phorbol ester on methyltransferase activity

    Borek, E.

    1980-01-01

    Enzyme fractions were isolated from Ehrlich ascites cells which introduced methyl groups into methyl deficient rat liver mRNA and unmethylated vaccinia mRNA. The methyl groups were incorporated at the 5' end into cap 1 structures by the viral enzyme, whereas both cap 0 and cap 1 structures were formed by the Ehrlich ascites cell enzymes. Preliminary results indicate the presence of adenine N/sup 6/-methyltransferase activity in Ehrlich ascites cells. These results indicate that mRNA deficient in 5'-cap methylation and in internal methylation of adenine accumulated in rats on exposure to ethionine. The methyl-deficient mRNA isolated from the liver of ethionine-fed rats differed in its translational properties from mRNA isolated from control animals. Preliminary experiments indicate that single topical application of 17n moles of TPA to mouse skin altered tRNA methyltransferases. The extent of methylation was increased over 2-fold in mouse skin treated with TPA for 48 hours. These changes have been observed as early as 12 hours following TPA treatment. In contrast, the application of initiating dose of DMBA had no effect on these enzymes. It should be emphasized that the changes in tRNA methyltransferases produced by TPA are not merely an increase of the concentration of the enzyme, rather that they represent alterations of specificity of a battery of enzymes. In turn the change in enzyme specificity can produce alterations in the structure of tRNA. (ERB)

  17. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  18. The ankyrin repeats of G9a and GLP histone methyltransferases are mono- and dimethyllysine binding modules

    Collins, Robert E.; Northrop, Jeffrey P.; Horton, John R.; Lee, David Y.; Zhang, Xing; Stallcup, Michael R.; Cheng, Xiaodong (USC); (Emory)

    2008-03-19

    Histone modifications have important roles in transcriptional control, mitosis and heterochromatin formation. G9a and G9a-like protein (GLP) are euchromatin-associated methyltransferases that repress transcription by mono- and dimethylating histone H3 at Lys9 (H3K9). Here we demonstrate that the ankyrin repeat domains of G9a and GLP bind with strong preference to N-terminal H3 peptides containing mono- or dimethyl K9. X-ray crystallography revealed the basis for recognition of the methylated lysine by a partial hydrophobic cage with three tryptophans and one acidic residue. Substitution of key residues in the cage eliminated the H3 tail interaction. Hence, G9a and GLP contain a new type of methyllysine binding module (the ankyrin repeat domains) and are the first examples of protein (histone) methyltransferases harboring in a single polypeptide the activities that generate and read the same epigenetic mark.

  19. A female adnexal tumor of probable Wolffian origin showing positive O-6-methylguanine-DNA methyltransferase methylation

    Kwon, Min Jung; Yun, Min Jeong

    2016-01-01

    Female adnexal tumor of probable Wolffian origin (FATWO) is a rare disease entity that arises from the mesonephric duct system. FATWO is different than other gynecological cancers in terms of embryology. Here, we describe the case of a 52-year-old woman with malignant FATWO. The patient underwent explorative laparotomy and surgical staging after a frozen section revealed malignancy. Detailed examination of the pathologic findings were consistent with FATWO. Counseling and further testing were provided to the patient to assess the risk of germline mutation and epigenetic change. An O-6-methylguanine-DNA methyltransferase gene methylation test was positive, and all other tests were normal. This is the first study to report a case of O-6-methylguanine-DNA methyltransferase methylation with FATWO in Korea. PMID:27462603

  20. Analysis of the Precursor rRNA Fractions of Rapidly Growing Mycobacteria: Quantification by Methods That Include the Use of a Promoter (rrnA P1) as a Novel Standard†

    Menéndez, María del Carmen; Rebollo, María José; Núñez, María del Carmen; Cox, Robert A.; García, María Jesús

    2005-01-01

    Mycobacterial species are able to control rRNA production through variations in the number and strength of promoters controlling their rrn operons. Mycobacterium chelonae and M. fortuitum are members of the rapidly growing mycobacterial group. They carry a total of five promoters each, encoded, respectively, by one and two rrn operons per genome. Quantification of precursor rrn transcriptional products (pre-rrn) has allowed detection of different promoter usage during cell growth. Bacteria growing in several culture media with different nutrient contents were compared. Balanced to stationary phases were analyzed. Most promoters were found to be used at different levels depending on the stage of bacterial growth and the nutrient content of the culture medium. Some biological implications are discussed. Sequences of the several promoters showed motifs that could be correlated to their particular level of usage. A product corresponding to the first rrnA promoter in both species, namely, rrnA P1, was found to contribute at a low and near-constant level to pre-rRNA synthesis, regardless of the culture medium used and the stage of growth analyzed. This product was used as a standard to quantitate rRNA gene expression by real-time PCR when M. fortuitum infected macrophages. It was shown that this bacterium actively synthesizes rRNA during the course of infection and that one of its rrn operons is preferentially used under such conditions. PMID:15629925

  1. Changes in rRNA levels during stress invalidates results from mRNA blotting: Fluorescence in situ rRNA hybridization permits renormalization for estimation of cellular mRNA levels

    Hansen, M.C.; Nielsen, A.K.; Molin, Søren; Hammer, Karin; Kilstrup, Mogens

    2001-01-01

    experiments, in which mRNA levels routinely are normalized to a fixed amount of extracted total RNA. The cellular levels of specific mRNA species were estimated using a renormalization with the total RNA content per cell. By a combination of fluorescence in situ rRNA hybridization, which estimates the...... relative level of rRNA per cell, and slot blotting to rRNA probes, which estimates the level of rRNA per extracted total RNA, the amount of RNA per cell was calculated in a series of heat shock experiments with the gram-positive bacterium Lactococcus lactis. It was found that the level of rRNA per cell......Regulation of gene expression can be analyzed by a number of different techniques. Some techniques monitor the level of specific mRNA directly, and others monitor indirectly by determining the level of enzymes encoded by the mRNA. Each method has its own inherent way of normalization. When results...

  2. Structure of the Q237W mutant of HhaI DNA methyltransferase: an insight into protein-protein interactions

    Dong, Aiping; Zhou, Lan; Zhang, Xing; Stickel, Shawn; Roberts, Richard J.; Cheng, Xiaodong

    2004-01-01

    We have determined the structure of a mutant (Q237W) of HhaI DNA methyltransferase, complexed with the methyl-donor product AdoHcy. The Q237W mutant proteins were crystallized in the monoclinic space group C2 with two molecules in the crystallographic asymmetric unit. Protein-protein interface calculations in the crystal lattices suggest that the dimer interface has the specific characteristics for homodimer protein-protein interactions, while the two active sites are spatially...

  3. O6-methylguanine DNA methyltransferase as a promising target for the treatment of temozolomide-resistant gliomas

    Fan, C-H; Liu, W-L; Cao, H.; Wen, C; Chen, L.; G. Jiang

    2013-01-01

    Temozolomide (TMZ) is an alkylating agent currently used as first-line therapy for gliomas treatment due to its DNA-damaging effect. However, drug resistance occurs, preventing multi-cycle use of this chemotherapeutic agent. One of the major mechanisms of cancer drug resistance is enhanced activity of a DNA repair enzyme, O6-methylguanine-DNA-methyltransferase (MGMT), which counteracts chemotherapy-induced DNA alkylation and is a key component of chemoresistance. MGMT repairs TMZ-induced DNA ...

  4. Cytoplasmic sequestration of an O6-methylguanine-DNA methyltransferase enhancer binding protein in DNA repair-deficient human cells

    Frank Y. Chen; Harris, Linda C.; Joanna S Remack; Brent, Thomas P.

    1997-01-01

    O6-Methylguanine-DNA methyltransferase (MGMT), an enzyme that repairs adducts at O6 of guanine in DNA, is a major determinant of susceptibility to simple methylating carcinogens or of tumor response to anticancer chloroethylating drugs. To investigate the mechanisms underlying cellular expression of this DNA repair enzyme, we focused on the role of a 59-bp enhancer of the human MGMT gene in the regulation of its expression. By using chloramphenicol acetyltransferase reporter assays, we found ...

  5. A novel route to product specificity in the Suv4-20 family of histone H4K20 methyltransferases

    Southall, Stacey M.; Cronin, Nora B.; Wilson, Jon R.

    2013-01-01

    The delivery of site-specific post-translational modifications to histones generates an epigenetic regulatory network that directs fundamental DNA-mediated processes and governs key stages in development. Methylation of histone H4 lysine-20 has been implicated in DNA repair, transcriptional silencing, genomic stability and regulation of replication. We present the structure of the histone H4K20 methyltransferase Suv4-20h2 in complex with its histone H4 peptide substrate and S-adenosyl methion...

  6. Effects of Active‐Site Modification and Quaternary Structure on the Regioselectivity of Catechol‐O‐Methyltransferase

    Law, Brian J. C.; Bennett, Matthew R.; Thompson, Mark L; Levy, Colin; Shepherd, Sarah A; Leys, David; Micklefield, Jason

    2016-01-01

    Abstract Catechol‐O‐methyltransferase (COMT), an important therapeutic target in the treatment of Parkinson's disease, is also being developed for biocatalytic processes, including vanillin production, although lack of regioselectivity has precluded its more widespread application. By using structural and mechanistic information, regiocomplementary COMT variants were engineered that deliver either meta‐ or para‐methylated catechols. X‐ray crystallography further revealed how the active‐site r...

  7. Noncompetitive Inhibition of Indolethylamine-N-methyltransferase by N,N-Dimethyltryptamine and N,N-Dimethylaminopropyltryptamine

    Chu, Uyen B.; Vorperian, Sevahn K.; Satyshur, Kenneth; Eickstaedt, Kelsey; Cozzi, Nicholas V; Mavlyutov, Timur; Hajipour, Abdol R.; Ruoho, Arnold E.

    2014-01-01

    Indolethylamine-N-methyltransferase (INMT) is a Class 1 transmethylation enzyme known for its production of N,N-dimethyltryptamine (DMT), a hallucinogen with affinity for various serotonergic, adrenergic, histaminergic, dopaminergic, and sigma-1 receptors. DMT is produced via the action of INMT on the endogenous substrates tryptamine and S-adenosyl-l-methionine (SAM). The biological, biochemical, and selective small molecule regulation of INMT enzyme activity remain largely unknown. Kinetic m...

  8. Protein Isoaspartate Methyltransferase Prevents Apoptosis Induced by Oxidative Stress in Endothelial Cells: Role of Bcl-Xl Deamidation and Methylation

    Amelia Cimmino; Rosanna Capasso; Fabbri Muller; Irene Sambri; Lucia Masella; Marianna Raimo; Maria Luigia De Bonis; Stefania D'Angelo; Vincenzo Zappia; Patrizia Galletti; Diego Ingrosso

    2008-01-01

    BACKGROUND: Natural proteins undergo in vivo spontaneous post-biosynthetic deamidation of specific asparagine residues with isoaspartyl formation. Deamidated-isomerized molecules are both structurally and functionally altered. The enzyme isoaspartyl protein carboxyl-O-methyltransferase (PCMT; EC 2.1.1.77) has peculiar substrate specificity towards these deamidated proteins. It catalyzes methyl esterification of the free alpha-carboxyl group at the isoaspartyl site, thus initiating the repair ...

  9. Genome-wide identification and comparative analysis of cytosine-5 DNA methyltransferases and demethylase families in wild and cultivated peanut

    Pengfei eWang

    2016-02-01

    Full Text Available AbstractDNA methylation plays important roles in genome protection, regulation of gene expression and was associated with plants development. Plant DNA methylation pattern was mediated by cytosine-5 DNA methyltransferases and demethylase. Although the genomes of AA and BB wild peanuts have been fully sequence, these two gene families have not been studied. In this study we report the identification and analysis of putative cytosine-5 DNA methyltransferases (C5-MTases and demethylase in AA and BB wild peanuts. Cytosine-5 DNA methyltransferases in AA and BB wild peanuts could be classified in known MET, CMT and DRM2 groups based on their domain organization. This result was supported by the gene and protein structural characteristics and phylogenetic analysis. We found that some wild peanut DRM2 numbers didn’t contain UBA domain which was different from other plants such as Arabidopsis, maize, soybean. Five DNA demethylase were found in AA genome and five in BB genome. The selective pressure analysis showed that wild peanut C5-MTases gene mainly underwent purifying selection but many positive selection sites can be detected. Conversely, DNA demethylase genes mainly underwent positive selection during evolution. Additionally, the expression dynamic of cytosine-5 DNA methyltransferases and demethylase genes in different cultivated peanut tissues were analyzed. Expression result showed that cold, heat or drought stress could influence the expression level of C5-MTases and DNA demethylase genes in cultivated peanut. These results are useful for better understanding the complexity of these two gene families, and will facilitate epigenetic studies in peanut.

  10. O6-Methylguanine-DNA methyltransferase status in neuroendocrine tumours: prognostic relevance and association with response to alkylating agents

    Walter, T.; van Brakel, B; Vercherat, C; Hervieu, V; Forestier, J.; Chayvialle, J-A; Molin, Y.; Lombard-Bohas, C; Joly, M-O; Scoazec, J-Y

    2015-01-01

    Background: O6-Methylguanine-DNA methyltransferase (MGMT) loss of expression has been suggested to be predictive of response to temozolomide in neuroendocrine tumours (NETs), but so far, only limited data are available. We evaluated the prognostic and predictive value of MGMT status, assessed by two molecular methods and immunohistochemistry, in a large series of NETs of different origins. Methods: A total of 107 patients, including 53 treated by alkylants (temozolomide, dacarbazine or strept...

  11. Methylation pattern of the O6-methylguanine-DNA methyltransferase gene in colon during progressive colorectal tumorigenesis

    NAGASAKA, Takeshi; Goel, Ajay; Notohara, Kenji; Takahata, Takaomi; Sasamoto, Hiromi; Uchida, Takuyuki; Nishida, Naoshi; Tanaka, Noriaki; Boland, Clement Richard; Matsubara, Nagahide

    2008-01-01

    O6-methylguanine-DNA methyltransferase (MGMT) is a DNA repair gene which is frequently methylated in colorectal cancer (CRC). However, it remains controversial whether methylation of specific CpG sequences within MGMT promoter leads to loss of its protein expression, and if MGMT methylation correlates with G to A transition mutations in KRAS. Two methylation sensitive regions (Mp and Eh region) of MGMT promoter were investigated in 593 specimens of colorectal tissue: 233 CRCs, 104 adenomatous...

  12. O6-Methylguanine DNA methyltransferase protein expression in tumor cells predicts outcome of temozolomide therapy in glioblastoma patients

    Spiegl-Kreinecker, Sabine; Pirker, Christine; Filipits, Martin; Lötsch, Daniela; Buchroithner, Johanna; Pichler, Josef; Silye, Rene; Weis, Serge; Micksche, Michael; Fischer, Johannes; Berger, Walter

    2009-01-01

    O6-Methylguanine DNA methyltransferase (MGMT) is implicated as a major predictive factor for treatment response to alkylating agents including temozolomide (TMZ) of glioblastoma multiforme (GBM) patients. However, whether the MGMT status in GBM patients should be detected at the level of promoter methylation or protein expression is still a matter of debate. Here, we compared promoter methylation (by methylation-specific polymerase chain reaction) and protein expression (by Western blot) in t...

  13. A Small-Molecule Probe of the Histone Methyltransferase G9a Induces Cellular Senescence in Pancreatic Adenocarcinoma

    Wang, Qiu; Paulk, Joshiawa Lanair James; Kubicek, Stefan; Kemp, Melissa M.; Adams, Drew J.; Shamji, Alykhan Farid; Wagner, Bridget K.; Schreiber, Stuart L.; Yuan, Yuan

    2012-01-01

    Post-translational modifications of histones alter chromatin structure and play key roles in gene expression and specification of cell states. Small molecules that target chromatin-modifying enzymes selectively are useful as probes and have promise as therapeutics, although very few are currently available. G9a (also named euchromatin histone methyltransferase 2 (EHMT2)) catalyzes methylation of lysine 9 on histone H3 (H3K9), a modification linked to aberrant silencing of tumor-suppressor gen...

  14. Downregulation of Histone H3 Lysine 9 Methyltransferase G9a Induces Centrosome Disruption and Chromosome Instability in Cancer Cells

    Kondo, Yutaka; Shen, Lanlan; Ahmed, Saira; Boumber, Yanis; Sekido, Yoshitaka; Haddad, Bassem R; Issa, Jean-Pierre J.

    2008-01-01

    Background Modifications of the histone amino-terminal tails affect access of regulatory factors and complexes to chromatin and thereby influence biological processes. Cancer cells are characterized by prominent epigenetic dysregulation, including histone modifications. However, the functional roles of the histone methyltransferases (HMT) in cancer remain unclear. Methodology/Principal Findings We studied RNAi-based inhibition (knockdown, KD) of 2 different H3K9 HMTs, SUV39H1 and G9a. Knockdo...

  15. Activating and inhibitory functions for the histone lysine methyltransferase G9a in T helper cell differentiation and function

    Lehnertz, Bernhard; Northrop, Jeffrey P.; Antignano, Frann; Burrows, Kyle; Hadidi, Sima; Mullaly, Sarah C.; Rossi, Fabio M.V.; Zaph, Colby

    2010-01-01

    Accumulating evidence suggests that the regulation of gene expression by histone lysine methylation is crucial for several biological processes. The histone lysine methyltransferase G9a is responsible for the majority of dimethylation of histone H3 at lysine 9 (H3K9me2) and is required for the efficient repression of developmentally regulated genes during embryonic stem cell differentiation. However, whether G9a plays a similar role in adult cells is still unclear. We identify a critical role...

  16. Epistasis between catechol-O-methyltransferase and type II metabotropic glutamate receptor 3 genes on working memory brain function

    Tan, Hao-Yang; Chen, Qiang; Sust, Steven; Joshua W Buckholtz; Meyers, John D.; Egan, Michael F.; Mattay, Venkata S.; Meyer-Lindenberg, Andreas; Weinberger, Daniel R.; Callicott, Joseph H.

    2007-01-01

    Dopaminergic and glutamatergic systems are critical components responsible for prefrontal signal-to-noise tuning in working memory. Recent functional MRI (fMRI) studies of genetic variation in these systems in catechol-O-methyltransferase (COMT) and in metabotropic glutamate receptor mgluR3 (GRM3), respectively, suggest that these genes influence prefrontal physiological signal-to-noise in humans. Here, using fMRI, we extend these individual gene findings to examine the combined effects of CO...

  17. Therapy and progression – induced O6-methylguanine-DNA methyltransferase and mismatch repair alterations in recurrent glioblastoma multiforme

    Agarwal, S.; Suri, V.; M C Sharma; C. Sarkar

    2015-01-01

    Despite multimodality treatment protocol including surgical resection, radiotherapy, and chemotherapy in patients with glioblastoma multiforme (GBM), most suffer from treatment failure and tumor recurrence within a few months of initial surgery. The effectiveness of temozolomide (TMZ), the most commonly used chemotherapeutic agent, is largely dependent on the methylation status of the promoter of the gene O6-methylguanine-DNA methyltransferase (MGMT) and the integrity of the mismatch repair (...

  18. Affect-Modulated Startle: Interactive Influence of Catechol-O-Methyltransferase Val158Met Genotype and Childhood Trauma

    Klauke, Benedikt; Winter, Bernward; Gajewska, Agnes; Zwanzger, Peter; Reif, Andreas; Herrmann, Martin J.; Dlugos, Andrea; Warrings, Bodo; Jacob, Christian; Mühlberger, Andreas; Arolt, Volker; Pauli, Paul; Deckert, Jürgen; Domschke, Katharina

    2012-01-01

    The etiology of emotion-related disorders such as anxiety or affective disorders is considered to be complex with an interaction of biological and environmental factors. Particular evidence has accumulated for alterations in the dopaminergic and noradrenergic system – partly conferred by catechol-O-methyltransferase (COMT) gene variation – for the adenosinergic system as well as for early life trauma to constitute risk factors for those conditions. Applying a multi-level approach, in a sample...

  19. Catechol O-Methyltransferase Haplotype Predicts Immediate Musculoskeletal Neck Pain and Psychological Symptoms after Motor Vehicle Collision

    McLean, Samuel A.; Diatchenko, Luda; Lee, Young M.; Swor, Robert A.; Domeier, Robert M; Jones, Jeffrey S.; Jones, Christopher W.; Reed, Caroline; Harris, Richard E; Maixner, William; Clauw, Daniel J.; Liberzon, Israel

    2010-01-01

    Genetic variations in the catechol-o-methyltransferase (COMT) gene have been associated with experimental pain and risk of chronic pain development, but no studies have examined genetic predictors of neck pain intensity and other patient characteristics after motor vehicle collision (MVC). We evaluated the association between COMT genotype and acute neck pain intensity and other patient characteristics in 89 Caucasian individuals presenting to the emergency department (ED) after MVC. In the E...

  20. Investigating the Potential Role of Genetic and Epigenetic Variation of DNA Methyltransferase Genes in Hyperplastic Polyposis Syndrome

    Drini, Musa; Nicholas C. Wong; Hamish S Scott; Craig, Jeffrey M; Dobrovic, Alexander; Chelsee A Hewitt; Dow, Christofer; Young, Joanne P; Jenkins, Mark A; Saffery, Richard; Macrae, Finlay A.

    2011-01-01

    Background Hyperplastic Polyposis Syndrome (HPS) is a condition associated with multiple serrated polyps, and an increased risk of colorectal cancer (CRC). At least half of CRCs arising in HPS show a CpG island methylator phenotype (CIMP), potentially linked to aberrant DNA methyltransferase (DNMT) activity. CIMP is associated with methylation of tumor suppressor genes including regulators of DNA mismatch repair (such as MLH1, MGMT), and negative regulators of Wnt signaling (such as WIF1). In...

  1. Methyltransferase PRMT1 Is a Binding Partner of HBx and a Negative Regulator of Hepatitis B Virus Transcription

    Benhenda, Shirine; Ducroux, Aurélie; Rivière, Lise; Sobhian, Bijan; Ward, Michael D.; Dion, Sarah; Hantz, Olivier; Protzer, Ulrike; Michel, Marie-Louise; Benkirane, Monsef; Semmes, Oliver J.; Buendia, Marie-Annick; Neuveut, Christine

    2013-01-01

    The hepatitis B virus X protein (HBx) is essential for virus replication and has been implicated in the development of liver cancer. HBx is recruited to viral and cellular promoters and activates transcription by interacting with transcription factors and coactivators. Here, we purified HBx-associated factors in nuclear extracts from HepG2 hepatoma cells and identified protein arginine methyltransferase 1 (PRMT1) as a novel HBx-interacting protein. We showed that PRMT1 overexpression reduced ...

  2. Direct methylation of FXR by Set7/9, a lysine methyltransferase, regulates the expression of FXR target genes

    Balasubramaniyan, Natarajan; Ananthanarayanan, Meena; Suchy, Frederick J.

    2012-01-01

    The farnesoid X receptor (FXR) is a ligand (bile acid)-dependent nuclear receptor that regulates target genes involved in every aspect of bile acid homeostasis. Upon binding of ligand, FXR recruits an array of coactivators and associated proteins, some of which have intrinsic enzymatic activity that modify histones or even components of the transcriptional complex. In this study, we show chromatin occupancy by the Set7/9 methyltransferase at the FXR response element (FXRE) and direct methylat...

  3. The Role of the Methyltransferase Domain of Bifunctional Restriction Enzyme RM.BpuSI in Cleavage Activity

    Arthur Sarrade-Loucheur; Shuang-yong Xu; Siu-Hong Chan

    2013-01-01

    Restriction enzyme (REase) RM.BpuSI can be described as a Type IIS/C/G REase for its cleavage site outside of the recognition sequence (Type IIS), bifunctional polypeptide possessing both methyltransferase (MTase) and endonuclease activities (Type IIC) and endonuclease activity stimulated by S-adenosyl-L-methionine (SAM) (Type IIG). The stimulatory effect of SAM on cleavage activity presents a major paradox: a co-factor of the MTase activity that renders the substrate unsusceptible to cleavag...

  4. The Putative Protein Methyltransferase LAE1 of Trichoderma atroviride Is a Key Regulator of Asexual Development and Mycoparasitism

    Aghcheh, Razieh Karimi; Irina S. Druzhinina; Kubicek, Christian P

    2013-01-01

    In Ascomycota the protein methyltransferase LaeA is a global regulator that affects the expression of secondary metabolite gene clusters, and controls sexual and asexual development. The common mycoparasitic fungus Trichoderma atroviride is one of the most widely studied agents of biological control of plant-pathogenic fungi that also serves as a model for the research on regulation of asexual sporulation (conidiation) by environmental stimuli such as light and/or mechanical injury. In order ...

  5. Genetic contribution of catechol-O-methyltransferase variants in treatment outcome of low back pain: a prospective genetic association study

    Omair, Ahmad; Benedicte A Lie; Reikeras, Olav; Holden, Marit; Brox, Jens I

    2012-01-01

    Background Treatment outcome of low back pain (LBP) is associated with inter-individual variations in pain relief and functional disability. Genetic variants of catechol-O-methyltransferase (COMT) gene have previously been shown to be associated with pain sensitivity and pain medication. This study examines the association between COMT polymorphisms and 7–11 year change in Oswestry Disability Index (ODI) and Visual Analog Score (VAS) for LBP as clinical outcome variables in...

  6. Genetic contribution of catechol-O-methyltransferase variants in treatment outcome of low back pain: a prospective genetic association study

    Omair Ahmad; Lie Benedicte; Reikeras Olav; Holden Marit; Brox Jens

    2012-01-01

    Abstract Background Treatment outcome of low back pain (LBP) is associated with inter-individual variations in pain relief and functional disability. Genetic variants of catechol-O-methyltransferase (COMT) gene have previously been shown to be associated with pain sensitivity and pain medication. This study examines the association between COMT polymorphisms and 7–11 year change in Oswestry Disability Index (ODI) and Visual Analog Score (VAS) for LBP as clinical outcome variables in patients ...

  7. Genetic contribution of catechol-O-methyltransferase variants in treatment outcome of low back pain: a prospective genetic association study

    Omair, Ahmad; Lie, Benedicte Alexandra; Reikeras, Olav; Holden, Marit; Brox, Jens Ivar

    2012-01-01

    Background Treatment outcome of low back pain (LBP) is associated with inter-individual variations in pain relief and functional disability. Genetic variants of catechol-O-methyltransferase (COMT) gene have previously been shown to be associated with pain sensitivity and pain medication. This study examines the association between COMT polymorphisms and 7–11 year change in Oswestry Disability Index (ODI) and Visual Analog Score (VAS) for LBP as clinical outcome variables in patients treated w...

  8. The histone methyltransferase SDG8 mediates the epigenetic modification of light and carbon responsive genes in plants

    Ying LI; Mukherjee, Indrani; Thum, Karen E; Tanurdzic, Milos; Katari, Manpreet S.; Obertello, Mariana; Edwards, Molly B; McCombie, W Richard; Martienssen, Robert A.; Coruzzi, Gloria M.

    2015-01-01

    Background Histone methylation modifies the epigenetic state of target genes to regulate gene expression in the context of developmental and environmental changes. Previously, we used a positive genetic screen to identify an Arabidopsis mutant, cli186, which was impaired in carbon and light signaling. Here, we report a deletion of the Arabidopsis histone methyltransferase SDG8 in this mutant (renamed sdg8-5), which provides a unique opportunity to study the global function of a specific histo...

  9. MTAP deletion confers enhanced dependency on the PRMT5 arginine methyltransferase in cancer cells | Office of Cancer Genomics

    The discovery of cancer dependencies has the potential to inform therapeutic strategies and to identify putative drug targets. Integrating data from comprehensive genomic profiling of cancer cell lines and from functional characterization of cancer cell dependencies, we discovered that loss of the enzyme methylthioadenosine phosphorylase (MTAP) confers a selective dependence on protein arginine methyltransferase 5 (PRMT5) and its binding partner WDR77. MTAP is frequently lost due to its proximity to the commonly deleted tumor suppressor gene, CDKN2A.

  10. The Histone Methyltransferase SMYD2 Methylates PARP1 and Promotes Poly(ADP-ribosyl)ation Activity in Cancer Cells

    Lianhua Piao; Daechun Kang; Takehiro Suzuki; Akiko Masuda; Naoshi Dohmae; Yusuke Nakamura; Ryuji Hamamoto

    2014-01-01

    Poly(ADP-ribose) polymerase-1 (PARP1) catalyzes the poly(ADP-ribosyl)ation of protein acceptors using NAD+ as the substrate is now considered as an important target for development of anticancer therapy. PARP1 is known to be post-translationally modified in various ways including phosphorylation and ubiquitination, but the physiological role of PARP1 methylation is not well understood. Herein we demonstrated that the histone methyltransferase SMYD2, which plays critical roles in human carcino...

  11. The Histone Methyltransferase SMYD2 Methylates PARP1 and Promotes Poly(ADP-ribosyl)ation Activity in Cancer Cells12

    Piao, Lianhua; Kang, Daechun; Suzuki, Takehiro; Masuda, Akiko; Dohmae, Naoshi; Nakamura, Yusuke; Hamamoto, Ryuji

    2014-01-01

    Poly(ADP-ribose) polymerase-1 (PARP1) catalyzes the poly(ADP-ribosyl)ation of protein acceptors using NAD+ as the substrate is now considered as an important target for development of anticancer therapy. PARP1 is known to be post-translationally modified in various ways including phosphorylation and ubiquitination, but the physiological role of PARP1 methylation is not well understood. Herein we demonstrated that the histone methyltransferase SMYD2, which plays critical roles in human carcino...

  12. DNA methyltransferase 1 functions through C/ebpa to maintain hematopoietic stem and progenitor cells in zebrafish

    Liu, Xiaohui; Jia, Xiaoe; Yuan, Hao; Ma, Ke; Chen, Yi; Jin, Yi; Deng, Min; Pan, Weijun; Chen, Saijuan; Chen, Zhu; de The, Hugues; Zon, Leonard; Zhou, Yi; Zhou, Jun; Zhu, Jun

    2015-01-01

    Background: DNA methyltransferase 1 (Dnmt1) regulates expression of many critical genes through maintaining parental DNA methylation patterns on daughter DNA strands during mitosis. It is essential for embryonic development and diverse biological processes, including maintenance of hematopoietic stem and progenitor cells (HSPCs). However, the precise molecular mechanism of how Dnmt1 is involved in HSPC maintenance remains unexplored. Methods: An N-ethyl-N-nitrosourea (ENU)-based genetic scree...

  13. The Histone Methyltransferase Inhibitor A-366 Uncovers a Role for G9a/GLP in the Epigenetics of Leukemia.

    William N Pappano

    Full Text Available Histone methyltransferases are epigenetic regulators that modify key lysine and arginine residues on histones and are believed to play an important role in cancer development and maintenance. These epigenetic modifications are potentially reversible and as a result this class of enzymes has drawn great interest as potential therapeutic targets of small molecule inhibitors. Previous studies have suggested that the histone lysine methyltransferase G9a (EHMT2 is required to perpetuate malignant phenotypes through multiple mechanisms in a variety of cancer types. To further elucidate the enzymatic role of G9a in cancer, we describe herein the biological activities of a novel peptide-competitive histone methyltransferase inhibitor, A-366, that selectively inhibits G9a and the closely related GLP (EHMT1, but not other histone methyltransferases. A-366 has significantly less cytotoxic effects on the growth of tumor cell lines compared to other known G9a/GLP small molecule inhibitors despite equivalent cellular activity on methylation of H3K9me2. Additionally, the selectivity profile of A-366 has aided in the discovery of a potentially important role for G9a/GLP in maintenance of leukemia. Treatment of various leukemia cell lines in vitro resulted in marked differentiation and morphological changes of these tumor cell lines. Furthermore, treatment of a flank xenograft leukemia model with A-366 resulted in growth inhibition in vivo consistent with the profile of H3K9me2 reduction observed. In summary, A-366 is a novel and highly selective inhibitor of G9a/GLP that has enabled the discovery of a role for G9a/GLP enzymatic activity in the growth and differentiation status of leukemia cells.

  14. Association Between the Catechol-O-Methyltransferase Val158Met Polymorphism and Self-Perceived Social Acceptance in Adolescent Girls

    Waugh, Christian E.; Dearing, Karen F.; Joormann, Jutta; GOTLIB, IAN H.

    2009-01-01

    Low perceived social acceptance is a significant risk factor for emotional difficulties in children. No studies, however, have examined genetic factors that may underlie individual differences in perceived social acceptance. In the present study we examined the relation between polymorphisms on the catechol-O-methyltransferase (COMT) Val158Met and serotonin transporter promoter (5-HTTLPR) genes and perceived social acceptance in 103 adolescent girls. Only the COMT polymorphism was related to ...

  15. Association between the Catechol-O-Methyltransferase (COMT) Val158Met Polymorphism and Manual Aiming Control in Healthy Subjects

    Lage, Guilherme M.; Miranda, Débora M.; Romano-Silva, Marco A.; Simone B. Campos; Albuquerque, Maicon R.; Corrêa, Humberto; Leandro F. Malloy-Diniz

    2014-01-01

    Background Prefrontal dopamine is catabolized by the catechol-O-methyltransferase (COMT) enzyme. Current evidence suggests that the val/met single nucleotide polymorphism in the COMT gene can predict the efficiency of executive cognition in humans. Individuals carrying the val allele perform more poorly because less synaptic dopamine is available. Methodology/Principal Findings We investigated the influence of the COMT polymorphism on motor performance in a task that requires different execut...

  16. The Catechol-O-Methyltransferase (COMT) val158met Polymorphism Affects Brain Responses to Repeated Painful Stimuli

    Marco L. Loggia; Jensen, Karin; Gollub, Randy L.; Wasan, Ajay D; Edwards, Robert R.; Kong, Jian

    2011-01-01

    Despite the explosion of interest in the genetic underpinnings of individual differences in pain sensitivity, conflicting findings have emerged for most of the identified “pain genes”. Perhaps the prime example of this inconsistency is represented by catechol-O-methyltransferase (COMT), as its substantial association to pain sensitivity has been reported in various studies, but rejected in several others. In line with findings from behavioral studies, we hypothesized that the effect of COMT o...

  17. Effects of the Val(158)Met catechol-O-methyltransferase gene polymorphism on olfactory processing in schizophrenia

    Kamath, Vidyulata; Moberg, Paul J.; Gur, Raquel E.; Doty, Richard L.; Turetsky, Bruce I.

    2011-01-01

    The catechol-O-methyltransferase (COMT) val158met polymorphism has received attention in schizophrenia due to its role in prefrontal dopamine catabolism. Given the rich dopaminergic innervations of the olfactory bulb and the influence of dopamine on the transmission of olfactory signals, we examined the influence of COMT genotype status on the olfactory processing impairment observed in schizophrenia. The University of Pennsylvania Smell Identification Test was administered unirhinally to ind...

  18. Association between Catechol-O-methyltransferase rs4680 (G > A) polymorphism and lung cancer risk

    Tan, Xiang; CHEN, MINGWU

    2014-01-01

    Background The association between the Val158Met polymorphism in the catechol-O-methyltransferase (COMT) gene and lung cancer risk remains controversial and inconclusive. Therefore, the meta-analysis was performed to provide a quality reevaluation of the association between the COMT Val158Met polymorphism and the risk of lung cancer. Methods Two major public databases (Pubmed and Embase) and several Chinese databases were searched for eligible studies. Pooled odds ratios (OR) and 95% confiden...

  19. Genetic Dissection of the Role of Catechol-O-Methyltransferase in Cognition and Stress Reactivity in Mice

    Papaleo, Francesco; Crawley, Jacqueline N.; Song, Jian; Lipska, Barbara K.; Pickel, Jim; Weinberger, Daniel R.; Chen, Jingshan

    2008-01-01

    The COMT (catechol-O-methyltransferase) gene has been linked to a spectrum of human phenotypes, including cognition, anxiety, pain sensitivity and psychosis. Doubts about its clinical impact exist, however, because of the complexity of human COMT polymorphism and clinical variability. We generated transgenic mice overexpressing a human COMT-Val polymorphism (Val-tg), and compared them with mice containing a null COMT mutation. Increased COMT enzyme activity in Val-tg mice resulted in disrupte...

  20. Catechol O-Methyltransferase (COMT) VAL158MET Functional Polymorphism, Dental Mercury Exposure, and Self-Reported Symptoms and Mood

    Heyer, Nicholas J.; Echeverria, Diana; Martin, Michael D.; Farin, Federico M.; Woods, James S.

    2009-01-01

    Associations were evaluated between a functional single nucleotide polymorphism (Val158Met) in the gene encoding the catecholamine catabolic enzyme catechol O-methyltransferase (COMT), dental mercury exposure, and self-reported symptoms and mood among 183 male dentists and 213 female dental assistants. Self-reported symptoms, mood, and detailed work histories were obtained by computerized questionnaire. Spot urine samples were collected and analyzed for mercury concentrations to evaluate rece...

  1. Catechol-O-Methyltransferase (COMT) Val 108/158 Met polymorphism does not modulate executive function in children with ADHD

    Stepanian Marina; Torkaman-Zehi Adam; Deguzman Rosherie; Mbekou Valentin; Lageix Philippe; Amor Leila; Grizenko Natalie; Taerk Evan; Baron Chantal; Joober Ridha

    2004-01-01

    Abstract Background An association has been observed between the catechol-O-methyltransferase (COMT) gene, the predominant means of catecholamine catabolism within the prefrontal cortex (PFC), and neuropsychological task performance in healthy and schizophrenic adults. Since several of the cognitive functions typically deficient in children with Attention Deficit Hyperactivity Disorder (ADHD) are mediated by prefrontal dopamine (DA) mechanisms, we investigated the relationship between a funct...

  2. Catechol-O-methyltransferase: Effects of the Val108Met polymorphism on protein turnover in human cells

    Doyle, Anne E.; Yager, James D.

    2007-01-01

    A single nucleotide polymorphism in the human COMT (catechol-O-methyltransferase) gene has been associated with increased risk for breast cancer and several CNS diseases and disorders. The G to A polymorphism causes a valine (val) to methionine (met) substitution at codon 108 soluble- (S)/ 158 membrane- (MB) COMT, generating alleles encoding high and low activity forms of the enzyme, COMTH and COMTL, respectively. Tissues and cells with a COMTLL genotype have decreased COMT activity compared ...

  3. COMT Val158Met Genotype Determines the Direction of Cognitive Effects Produced by Catechol-O-Methyltransferase Inhibition

    Farrell, Sarah M.; Tunbridge, Elizabeth M.; Braeutigam, Sven; Harrison, Paul J

    2012-01-01

    Background Catechol-O-methyltransferase (COMT) metabolizes dopamine. The COMT Val158Met polymorphism influences its activity, and multiple neural correlates of this genotype on dopaminergic phenotypes, especially working memory, have been reported. COMT activity can also be regulated pharmacologically by COMT inhibitors. The inverted-U relationship between cortical dopamine signaling and working memory predicts that the effects of COMT inhibition will differ according to COMT genotype. Method...

  4. Molecular phylogenetics and comparative modeling of HEN1, a methyltransferase involved in plant microRNA biogenesis

    Obarska Agnieszka

    2006-01-01

    Full Text Available Abstract Background Recently, HEN1 protein from Arabidopsis thaliana was discovered as an essential enzyme in plant microRNA (miRNA biogenesis. HEN1 transfers a methyl group from S-adenosylmethionine to the 2'-OH or 3'-OH group of the last nucleotide of miRNA/miRNA* duplexes produced by the nuclease Dicer. Previously it was found that HEN1 possesses a Rossmann-fold methyltransferase (RFM domain and a long N-terminal extension including a putative double-stranded RNA-binding motif (DSRM. However, little is known about the details of the structure and the mechanism of action of this enzyme, and about its phylogenetic origin. Results Extensive database searches were carried out to identify orthologs and close paralogs of HEN1. Based on the multiple sequence alignment a phylogenetic tree of the HEN1 family was constructed. The fold-recognition approach was used to identify related methyltransferases with experimentally solved structures and to guide the homology modeling of the HEN1 catalytic domain. Additionally, we identified a La-like predicted RNA binding domain located C-terminally to the DSRM domain and a domain with a peptide prolyl cis/trans isomerase (PPIase fold, but without the conserved PPIase active site, located N-terminally to the catalytic domain. Conclusion The bioinformatics analysis revealed that the catalytic domain of HEN1 is not closely related to any known RNA:2'-OH methyltransferases (e.g. to the RrmJ/fibrillarin superfamily, but rather to small-molecule methyltransferases. The structural model was used as a platform to identify the putative active site and substrate-binding residues of HEN and to propose its mechanism of action.

  5. Fine and hyperfine structure spectra of the ultra-violet 23S → 53P transition in 4He and 3He with a frequency doubled CW ring laser, detected via associative ionization

    High resolution laser spectroscopy coupled to a sensitive method of detection via mass analysis of He+2 ions produced in He(53P) + He(11S) collisions, is used to obtain the fine and hyperfine spectra of the ultra-violet He 23S → 53P transition. A cw tunable UV radiation around 294.5 nm is generated by intracavity frequency doubling a Rhodamine 6G single mode ring dye laser using an ADA crystal. Both spectra enable fine and hyperfine structures to be determined within a few MHz. The magnetic dipole coupling constant A of the 53P term of 3He is found to be -4326 +- 9 MHz (-0.1443 +- 0.0003 cm-1). (orig.)

  6. Characterization of a multifunctional caffeoyl-CoA O-methyltransferase activated in grape berries upon drought stress.

    Giordano, Debora; Provenzano, Sofia; Ferrandino, Alessandra; Vitali, Marco; Pagliarani, Chiara; Roman, Federica; Cardinale, Francesca; Castellarin, Simone D; Schubert, Andrea

    2016-04-01

    Drought stress affects anthocyanin accumulation and modification in vegetative and reproductive plant tissues. Anthocyanins are the most abundant flavonoids in grape (Vitis vinifera L.) coloured berry genotypes and are essential markers of grape winemaking quality. They are mostly mono- and di-methylated, such modifications increase their stability and improve berry quality for winemaking. Anthocyanin methylation in grape berries is induced by drought stress. A few caffeoyl-CoA O-methyltransferases (CCoAOMTs) active on anthocyanins have been described in grape. However, no drought-activated O-methyltransferases have been described in grape berries yet. In this study, we characterized VvCCoAOMT, a grapevine gene known to induce methylation of CoA esters in cultured grape cells. Transcript accumulation of VvCCoAOMT was detected in berry skins, and increased during berry ripening on the plant, and in cultured berries treated with ABA, concomitantly with accumulation of methylated anthocyanins, suggesting that anthocyanins may be substrates of this enzyme. Contrary as previously observed in cell cultures, biotic stress (Botrytis cinerea inoculation) did not affect VvCCoAOMT gene expression in leaves or berries, while drought stress increased VvCCoAOMT transcript in berries. The recombinant VvCCoAOMT protein showed in vitro methylating activity on cyanidin 3-O-glucoside. We conclude that VvCCoAOMT is a multifunctional O-methyltransferase that may contribute to anthocyanin methylation activity in grape berries, in particular under drought stress conditions. PMID:26851572

  7. Characterization of a DNA Adenine Methyltransferase Gene of Borrelia hermsii and Its Dispensability for Murine Infection and Persistence

    James, Allison E.; Rogovskyy, Artem S.; Crowley, Michael A.; Bankhead, Troy

    2016-01-01

    DNA methyltransferases have been implicated in the regulation of virulence genes in a number of pathogens. Relapsing fever Borrelia species harbor a conserved, putative DNA methyltransferase gene on their chromosome, while no such ortholog can be found in the annotated genome of the Lyme disease agent, Borrelia burgdorferi. In the relapsing fever species Borrelia hermsii, the locus bh0463A encodes this putative DNA adenine methyltransferase (dam). To verify the function of the BH0463A protein product as a Dam, the gene was cloned into a Dam-deficient strain of Escherichia coli. Restriction fragment analysis subsequently demonstrated that complementation of this E. coli mutant with bh0463A restored adenine methylation, verifying bh0463A as a Dam. The requirement of bh0463A for B. hermsii viability, infectivity, and persistence was then investigated by genetically disrupting the gene. The dam- mutant was capable of infecting immunocompetent mice, and the mean level of spirochetemia in immunocompetent mice was not significantly different from wild type B. hermsii. Collectively, the data indicate that dam is dispensable for B. hermsii viability, infectivity, and persistence. PMID:27195796

  8. RNA:(guanine-N2 methyltransferases RsmC/RsmD and their homologs revisited – bioinformatic analysis and prediction of the active site based on the uncharacterized Mj0882 protein structure

    Rychlewski Leszek

    2002-04-01

    Full Text Available Abstract Background Escherichia coli guanine-N2 (m2G methyltransferases (MTases RsmC and RsmD modify nucleosides G1207 and G966 of 16S rRNA. They possess a common MTase domain in the C-terminus and a variable region in the N-terminus. Their C-terminal domain is related to the YbiN family of hypothetical MTases, but nothing is known about the structure or function of the N-terminal domain. Results Using a combination of sequence database searches and fold recognition methods it has been demonstrated that the N-termini of RsmC and RsmD are related to each other and that they represent a "degenerated" version of the C-terminal MTase domain. Novel members of the YbiN family from Archaea and Eukaryota were also indentified. It is inferred that YbiN and both domains of RsmC and RsmD are closely related to a family of putative MTases from Gram-positive bacteria and Archaea, typified by the Mj0882 protein from M. jannaschii (1dus in PDB. Based on the results of sequence analysis and structure prediction, the residues involved in cofactor binding, target recognition and catalysis were identified, and the mechanism of the guanine-N2 methyltransfer reaction was proposed. Conclusions Using the known Mj0882 structure, a comprehensive analysis of sequence-structure-function relationships in the family of genuine and putative m2G MTases was performed. The results provide novel insight into the mechanism of m2G methylation and will serve as a platform for experimental analysis of numerous uncharacterized N-MTases.

  9. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-01-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  10. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes.

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-06-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  11. Histopathological changes in rat liver in hyper-and hypothyroidism are associated with DNA methyltransferase activity

    Zaporozhan VM; Mescheryakova NV

    2013-01-01

    [Objective] There is evidence that thyroid hormones (TH) could affect on collagen development.Also there is some data that methylation play a significant role in fibrogenesis.That's why the aim of the article was to find out if such pathomorphological changes in liver as fibrosis that were caused by TH could be associated with the changes of DNA methyltransferase activity.[Methods] Experimental study was presented on 89 mature white rats.3 experimental groups were performed:1-experimental hyperthyroidism,2-experimental hypothyroidism,3-control group.The thyroid profile for T3,T4,TTH and profile activity for DNA methyltransferase (DNMT) were determined.The weight of liver was examined.Microscopy and morphometry were performed.[Results] In experimental hyperthyroidism and hypothyroidism the respective changes in TH concentrations occur with a normal level of TTH.It was revealed gender differences in TH levels under impaired thyroid status.In hypothyroidism a decrease of TH concentration occurs in females and males,but it is more expressed in males.In hyperthyroidism the increased concentrations of TH is observed in all rodents,but it is more significant in males.The weight of liver gain in hyperthyroid rodents and decreased of liver weight in hypothyroid rats.In experimentally hyperthyroidism the pathomorphological changed in liver were characterized as an acute vascular insufficiency,hypertension,inflammation,toxic effects of hormones,an initial stage of hepatitis with a high activity,traces of old hemorrhage and a marked fibrosis in the liver.Hypothyroidism also effects on the liver with the signs of acute vascular insufficiency,hypoxia,toxic effects of hormones,necrosis and mild fibrotic changes in the liver tissue.The enzymatic activity of DNMT was increased both in hyperthyroidism and in hypothyroidism.[Conclusions] From results that were've obtained we could conclude that persistent shifts of TH cause pathomorphological changes in the liver.They were more

  12. Structure of the corrinoid:coenzyme M methyltransferase MtaA from Methanosarcina mazei.

    Hoeppner, Astrid; Thomas, Frank; Rueppel, Alma; Hensel, Reinhard; Blankenfeldt, Wulf; Bayer, Peter; Faust, Annette

    2012-11-01

    The zinc-containing corrinoid:coenzyme M methyltransferase MtaA is part of the methanol-coenzyme M-methyltransferase complex of Methanosarcina mazei. The whole complex consists of three subunits: MtaA, MtaB and MtaC. The MtaB-MtaC complex catalyses the cleavage of methanol (bound to MtaB) and the transfer of the methyl group onto the cobalt of cob(I)alamin (bound to MtaC). The MtaA-MtaC complex catalyses methyl transfer from methyl-cob(III)alamin (bound to MtaC) to coenzyme M (bound to MtaA). The crystal structure of the MtaB-MtaC complex from M. barkeri has previously been determined. Here, the crystal structures of MtaA from M. mazei in a substrate-free but Zn(2+)-bound state and in complex with Zn(2+) and coenzyme M (HS-CoM) are reported at resolutions of 1.8 and 2.1 Å, respectively. A search for homologous proteins revealed that MtaA exhibits 23% sequence identity to human uroporphyrinogen III decarboxylase, which has also the highest structural similarity (r.m.s.d. of 2.03 Å for 306 aligned amino acids). The main structural feature of MtaA is a TIM-barrel-like fold, which is also found in all other zinc enzymes that catalyse thiol-group alkylation. The active site of MtaA is situated at the narrow bottom of a funnel such that the thiolate group of HS-CoM points towards the Zn(2+) ion. The Zn(2+) ion in the active site of MtaA is coordinated tetrahedrally via His240, Cys242 and Cys319. In the substrate-free form the fourth ligand is Glu263. Binding of HS-CoM leads to exchange of the O-ligand of Glu263 for the S-ligand of HS-CoM with inversion of the zinc geometry. The interface between MtaA and MtaC for transfer of the methyl group from MtaC-bound methylcobalamin is most likely to be formed by the core complex of MtaB-MtaC and the N-terminal segment (a long loop containing three α-helices and a β-hairpin) of MtaA, which is not part of the TIM-barrel core structure of MtaA. PMID:23090404

  13. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    Recht, M I; Douthwaite, S; Dahlquist, K D;

    1999-01-01

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  14. 16S rRNA gene sequencing as a tool to study microbial populations in foods and process environments

    Buschhardt, Tasja; Hansen, Tina Beck; Bahl, Martin Iain; Asser Hansen, Martin; Abu Al-Soud, Waleed; Aabo, Søren

    and their role in food safety. During method optimization, we have identified several factors which distort the characterization of microbial populations, including DNA extraction methods, DNA polymerases, and most importantly the analyzed fragment of the 16S rRNA gene. Methods: This study...... culture methods as cross reference. Results: Taxonomic assignments and abundances of sequences in the total community and in the Enterobacteriaceae subpopulation were affected by the 16S rRNA gene variable region, DNA extraction methods, and polymerases chosen. However, community compositions were very......Introduction: Methodological constraints during culturing and biochemical testing have left the true microbiological diversity of foods and process environments unexplored. Culture-independent molecular methods, such as 16S rRNA gene sequencing, may provide deeper insight into microbial communities...

  15. 16S rRNA amplicon sequencing dataset for conventionalized and conventionally raised zebrafish larvae.

    Davis, Daniel J; Bryda, Elizabeth C; Gillespie, Catherine H; Ericsson, Aaron C

    2016-09-01

    Data presented here contains metagenomic analysis regarding the sequential conventionalization of germ-free zebrafish embryos. Zebrafish embryos that underwent a germ-free sterilization process immediately after fertilization were promptly exposed to and raised to larval stage in conventional fish water. At 6 days postfertilization (dpf), these "conventionalized" larvae were compared to zebrafish larvae that were raised in conventional fish water never undergoing the initial sterilization process. Bacterial 16S rRNA amplicon sequencing was performed on DNA isolated from homogenates of the larvae revealing distinct microbiota variations between the two groups. The dataset described here is also related to the research article entitled "Microbial modulation of behavior and stress responses in zebrafish larvae" (Davis et al., 2016) [1]. PMID:27508247

  16. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    Junko Obata

    Full Text Available While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating.

  17. Phylogenetic relationships of Arthrospira strains inferred from 16S rRNA gene and cpcBA-IGS sequences

    Chi-Yong Ahn

    2012-06-01

    Full Text Available Arthrospira platensis and Arthrospira maxima are species of cyanobacteria used in health foods, animal feed, food additives, and fine chemicals. This study conducted a comparison of the 16S rRNA gene and cpcBA-intergenic spacer (cpcBA-IGS sequences in Arthrospira strains from culture collections around the world. A cluster analysis divided the 10 Arthrospira strains into two main genotypic clusters, designated I and II, where Group I contained A. platensis SAG 86.79, UTEX 2340, A. maxima KCTC AG30054, and SAG 49.88, while Group II contained A. platensis PCC 9108, NIES 39, NIES 46, and SAG 257.80. However, although A. platensis PCC 9223 belonged to Group II-2 based on its cpcBA-IGS sequence, this strain also belonged to Group I based on its 16S rRNA gene sequence. Phylogenetic analyses based on the 16S rRNA gene and cpcBA-IGS sequences showed no division between A. platensis and A. maxima, plus the 16S rRNA gene and cpcBAIGS sequence clusters did not indicate any well-defined geographical distribution, instead overlapping in a rather interesting way. Therefore, the current study supports some previous conclusions based on 16S rRNA gene and cpcBA-IGS sequences, which found that Arthrospira taxa are monophyletic. However, when compared with 16S rRNA sequences, cpcBA-IGS sequences may be better suited to resolve close relationships and intraspecies variability.

  18. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Nathan D. Olson

    2015-03-01

    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  19. Development of fed-batch profiles for efficient biosynthesis of catechol-O-methyltransferase

    G.M. Espírito Santo

    2014-09-01

    Full Text Available Catechol-O-methyltransferase (COMT, EC 2.1.1.6 plays a crucial role in dopamine metabolism which has intimately linked this enzyme to some neurodegenerative diseases, such as Parkinson's disease. In recent years, in the attempt of developing new therapeutic strategies for Parkinson's disease, there has been a growing interest in the search for effective COMT inhibitors. In order to do so, large amounts of COMT in an active form are needed, and the best way to achieve this is by up-scaling its production through biotechnological processes. In this work, a fed-batch process for the biosynthesis of the soluble isoform of COMT in Escherichia coli is proposed. This final process was selected through the evaluation of the effect of different dissolved oxygen concentrations, carbon and nitrogen source concentrations and feeding profiles on enzymatic production and cell viability, while controlling various parameters (pH, temperature, starting time of the feeding and induction phases and carbon source concentration during the process. After several batch and fed-batch experiments, a final specific COMT activity of 442.34 nmol/h/mg with approximately 80% of viable cells at the end of the fermentation were achieved. Overall, the results described herein provide a great improvement on hSCOMT production in recombinant bacteria and provide a new and viable option for the use of a fed-batch fermentation with a constant feeding profile to the large scale production of this enzyme.

  20. Identification and characterization of arsenite methyltransferase from an archaeon, Methanosarcina acetivorans C2A.

    Wang, Pei-Pei; Sun, Guo-Xin; Zhu, Yong-Guan

    2014-11-01

    Arsenic is a ubiquitous toxic contaminant in the environment. The methylation of arsenic can affect its toxicity and is primarily mediated by biological processes. Few studies have focused on the mechanism of arsenic methylation in archaea although archaea are widespread in the environment. Here, an arsenite [As(III)] methyltransferase (ArsM) was identified and characterized from an archaeon Methanosarcina acetivorans C2A. Heterologous expression of MaarsM was shown to confer As(III) resistance to an arsenic-sensitive strain of E. coli through arsenic methylation and subsequent volatilization. Purified MaArsM protein was further identified the function in catalyzing the formation of various methylated products from As(III) in vitro. Methylation of As(III) by MaArsM is highly dependent on the characteristics of the thiol cofactors used, with some of them (coenzyme M, homocysteine, and dithiothreitol) more efficient than GSH. Site-directed mutagenesis demonstrated that three conserved cysteine (Cys) residues (Cys62, Cys150, and Cys200) in MaArsM were necessary for As(III) methylation, of which only Cys150 and Cys200 were required for the methylation of monomethylarsenic. These results present a molecular pathway for arsenic methylation in archaea and provide some insight into the role of archaea in As biogeochemistry. PMID:25295694