WorldWideScience

Sample records for 23s ribosomal rna

  1. Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli 23S ribosomal RNA

    Douthwaite, S

    1992-01-01

    Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli ribosomes has been compared by chemical footprinting. The protection afforded by both drugs is limited to the peptidyl transferase loop of 23S rRNA. Under conditions of stoichiometric binding at 1 mM drug concentration...... in vitro, both drugs strongly protect 23S rRNA bases A2058 and A2451 from dimethyl sulphate and G2505 from kethoxal modification; G2061 is also weakly protected from kethoxal. The modification patterns differ in that A2059 is additionally protected by clindamycin but not by lincomycin. The affinity...... of the two drugs for the ribosome, estimated by footprinting, is approximately the same, giving Kdiss values of 5 microM for lincomycin and 8 microM for clindamycin. The results show that in vitro the drugs are equally potent in blocking their ribosomal target site. Their inhibitory effects on...

  2. Identification of the methyltransferase targeting C2499 in Deinococcus radiodurans 23S ribosomal RNA

    Nielsen, Julie Mundus; Flyvbjerg, Karen Freund; Kirpekar, Finn

    2016-01-01

    The bacterium Deinococcus radiodurans-like all other organisms-introduces nucleotide modifications into its ribosomal RNA. We have previously found that the bacterium contains a Carbon-5 methylation on cytidine 2499 of its 23S ribosomal RNA, which is so far the only modified version of cytidine 2...

  3. Expanded versions of the 16S and 23S ribosomal RNA mutation databases (16SMDBexp and 23SMDBexp)

    Triman, K L; Peister, A; R. A. Goel

    1998-01-01

    Expanded versions of the Ribosomal RNA Mutation Databases provide lists of mutated positions in 16S and 16S-like ribosomal RNA (16SMDBexp) and 23S and 23S-like ribosomal RNA (23SMDBexp) and the identity of each alteration. Alterations from organisms other than Escherichia coli are reported at positions according to the E.coli numbering system. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation, (ii) whether a mutant pheno...

  4. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    Aagaard, C; Douthwaite, S

    1994-01-01

    A putative base-pairing interaction that determines the folding of the central region of 23S rRNA has been investigated by mutagenesis. Each of the possible base substitutions has been made at the phylogenetically covariant positions adenine-1262 (A1262) and U2017 in Escherichia coli 23S rRNA. Ev...

  5. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    reveals increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits......The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea and...... chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...

  6. Macrolide-ketolide inhibition of MLS-resistant ribosomes is improved by alternative drug interaction with domain II of 23S rRNA

    Douthwaite, S; Hansen, L H; Mauvais, P

    2000-01-01

    The macrolide antibiotic erythromycin and its 6-O-methyl derivative (clarithromycin) bind to bacterial ribosomes primarily through interactions with nucleotides in domains II and V of 23S rRNA. The domain II interaction occurs between nucleotide A752 and the macrolide 3-cladinose moiety. Removal ...

  7. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    The peptidyl transfer site has been localized at the centre of domain V of 23S-like ribosomal RNA (rRNA) primarily on the basis of a chloramphenicol binding site. The implicated region constitutes an unstructured circle in the current secondary structural model which contains several universally....... In addition, a G2502----A transition caused a decreased growth rate, probably due to a partial selection against mutant ribosome incorporation into polysomes, while an A2503----C transversion produced a decreased growth rate and conferred resistance to chloramphenicol. All of the mutant RNAs were...

  8. Evidence for functional interaction between domains II and V of 23S ribosomal RNA from an erythromycin-resistant mutant

    Douthwaite, S; Prince, J B; Noller, H F

    1985-01-01

    A mutation affording low levels of erythromycin resistance has been obtained by in vitro hydroxylamine mutagenesis of a cloned ribosomal RNA operon from Escherichia coli. The site of the mutational event responsible for antibiotic resistance was localized to the gene region encoding domain II of ...

  9. Attachment sites of primary binding proteins L1, L2 and L23 on 23 S ribosomal RNA of Escherichia coli

    Egebjerg, Jan; Christiansen, Jan; Garrett, Roger Antony

    1991-01-01

    The attachment sites of the primary binding proteins L1, L2 and L23 on 23 S ribosomal RNA of Escherichia coli were examined by a chemical and ribonuclease footprinting method using several probes with different specificities. The results show that the sites are confined to localized RNA regions...... within the large ribonuclease-protected ribonucleoprotein fragments that were characterized earlier. They are as follows: 1. (1) L1 recognizes a tertiary structural motif in domain V centred on two interacting internal loops; the main protein interaction sites occur at the internal loop/helix junctions.2...

  10. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    Rosendahl, G; Douthwaite, S

    1993-01-01

    23 S rRNA. Within the ribosome, L11 also interacts with this rRNA region, although the protection effects are subtly different and extend to nucleotide 1098. The pentameric r-protein complex L10.(L12)4 binds to an adjacent site on the rRNA, protecting riboses at positions 1043, 1046 to 1049, 1053 to...... by L10.(L12)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  11. Peptidyl transferase antibiotics perturb the relative positioning of the 3'-terminal adenosine of P/P'-site-bound tRNA and 23S rRNA in the ribosome

    Kirillov, S V; Porse, B T; Garrett, R A

    1999-01-01

    A range of antibiotic inhibitors that act within the peptidyl transferase center of the ribosome were examined for their capacity to perturb the relative positioning of the 3' end of P/P'-site-bound tRNA and the Escherichia coli ribosome. The 3'-terminal adenosines of deacylated tRNA and N......-ribosome complexes. It is concluded that the antibiotics perturb the relative positioning of the 3' end of the P/P'-site-bound tRNA and the peptidyl transferase loop region of 23S rRNA....

  12. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  13. Erythromycin binding is reduced in ribosomes with conformational alterations in the 23 S rRNA peptidyl transferase loop

    Douthwaite, S; Aagaard, C

    1993-01-01

    induced by mutations in the peptidyl transferase loop, and to determine how these changes affect drug interaction. Mutations at positions 2057 (G-->A) and 2058 (A-->G, or -->U), all of which confer drug resistance, induce a more open conformation in the peptidyl transferase loop. Erythromycin still...... protects against chemical modification in the mutant peptidyl transferase loops, but the affinity of the drug interaction is reduced 20-fold in the 2057A mutant, 10(3)-fold in the 2058U mutant and 10(4)-fold in the 2058G mutant. Single mutations at position 2032 in the adjacent hairpin loop, which have...... previously been shown to alter drug tolerances, gave no detectable effects on the structure of the peptidyl transferase loop or on erythromycin binding. Dual mutations at positions 2032 and 2058, however, induce a marked change in the rRNA conformation with opening of the phylogenetically conserved base...

  14. Antibiotic interactions at the GTPase-associated centre within Escherichia coli 23S rRNA

    Egebjerg, J; Douthwaite, S; Garrett, R A

    1989-01-01

    A comprehensive range of chemical reagents and ribonucleases was employed to investigate the interaction of the antibiotics thiostrepton and micrococcin with the ribosomal protein L11-23S RNA complex and with the 50S subunit. Both antibiotics block processes associated with the ribosomal A-site b...... important exception, however, occurred at nucleotide A1067 within a terminal loop where thiostrepton protected the N-1 position while micrococcin rendered it more reactive. This difference correlates with the opposite effects of the two antibiotics on GTPase activity....... differ in their effects on GTP hydrolysis, which is inhibited by thiostrepton and stimulated by micrococcin. The interaction sites of both drugs were shown to occur within the nucleotide sequences A1067-A1098 within the protein L11 binding site on 23S RNA. This region of the ribosome structure is......A comprehensive range of chemical reagents and ribonucleases was employed to investigate the interaction of the antibiotics thiostrepton and micrococcin with the ribosomal protein L11-23S RNA complex and with the 50S subunit. Both antibiotics block processes associated with the ribosomal A-site but...

  15. Recognition determinants for proteins and antibiotics within 23S rRNA

    Douthwalte, S; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup;

    1995-01-01

    Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of...... molecular genetic and biochemical probing techniques, we have concentrated on regions of the rRNA that are connected with specific functions. These are located in different domains within the 23S rRNA and include the ribosomal GTPase-associated center in domain II, which contains the binding sites for r......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...

  16. Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

    Dam, M; Douthwaite, S; Tenson, T;

    1996-01-01

    Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247....... This is close to a short open reading frame in the 23 S rRNA that encodes a pentapeptide (E-peptide) whose expression in vivo renders cells resistant to erythromycin. Therefore, a possible mechanism of resistance caused by domain II mutations may be related to an increased expression of the E-peptide. To test...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore...

  17. Mapping important nucleotides in the peptidyl transferase centre of 23 S rRNA using a random mutagenesis approach

    Porse, B T; Garrett, R A

    1995-01-01

    Random mutations were generated in the lower half of the peptidyl transferase loop in domain V of 23 S rRNA from Escherichia coli using a polymerase chain reaction (PCR) approach, a rapid procedure for identifying mutants and a plasmid-based expression system. The effects of 21 single......-site mutations, at 18 different positions, on cell growth, mutant rRNA incorporation into ribosomes and peptidyl transferase activity of the mutant ribosomes were analysed. The general importance of the whole region for the peptidyl transferase centre was emphasized by the finding that 14 of the mutants were...... sick, or very sick, when ribosomes containing chromosomal-encoded 23 S rRNA were inhibited by erythromycin, and all except one of these exhibited low levels of peptidyl transferase activity in their mutated ribosomes. Two mutations, psi 2580-->C and U2584-->G that both yielded inactive ribosomes were...

  18. Cooperative assembly of proteins in the ribosomal GTPase centre demonstrated by their interactions with mutant 23S rRNAs

    Rosendahl, G; Douthwaite, S

    1995-01-01

    within a hairpin loop (1068-1072), where the protein probably makes nucleotide contacts. Some of these mutations also interfere with binding of the r-protein complex L10.(L12)4 to an adjacent site on the rRNA. When added together to rRNA, proteins L10.(L12)4 and L11 bind cooperatively to overcome the......The ribosomal protein L11 binds to the region of 23S rRNA associated with the GTPase-dependent steps of protein synthesis. Nucleotides 1054-1107 within this region of the Escherichia coli 23S rRNA gene were mutagenized with bisulphite. Twenty point mutations (G-->A and C-->T transitions) and...... numerous multiple mutations were generated. Expression of mutant 23S rRNAs in vivo shows that all the mutations detectably alter the phenotype, with effects ranging from a slight growth rate reduction to lack of viability. Temperature sensitivity is conferred by 1071G-->A and 1092C-->U substitutions. These...

  19. Sites of interaction of streptogramin A and B antibiotics in the peptidyl transferase loop of 23 S rRNA and the synergism of their inhibitory mechanisms

    Porse, B T; Garrett, R A

    1999-01-01

    nucleotides in the peptidyl transferase loop of 23 S rRNA, including the two mutated nucleotides. An rRNA footprinting study, performed both in vivo and in vitro, on the A and B components complexed to Bacillus megaterium ribosomes, indicated that similar drug-induced effects occur on free ribosomes and...

  20. 23S rRNA nucleotides in the peptidyl transferase center are essential for tryptophanase operon induction.

    Yang, Rui; Cruz-Vera, Luis R; Yanofsky, Charles

    2009-06-01

    Distinct features of the ribosomal peptide exit tunnel are known to be essential for recognition of specific amino acids of a nascent peptidyl-tRNA. Thus, a tryptophan residue at position 12 of the peptidyl-tRNA TnaC-tRNA(Pro) leads to the creation of a free tryptophan binding site within the ribosome at which bound tryptophan inhibits normal ribosome functions. The ribosomal processes that are inhibited are hydrolysis of TnaC-tRNA(Pro) by release factor 2 and peptidyl transfer of TnaC of TnaC-tRNA(Pro) to puromycin. These events are normally performed in the ribosomal peptidyl transferase center. In the present study, changes of 23S rRNA nucleotides in the 2585 region of the peptidyl transferase center, G2583A and U2584C, were observed to reduce maximum induction of tna operon expression by tryptophan in vivo without affecting the concentration of tryptophan necessary to obtain 50% induction. The growth rate of strains with ribosomes with either of these changes was not altered appreciably. In vitro analyses with mutant ribosomes with these changes showed that tryptophan was not as efficient in protecting TnaC-tRNA(Pro) from puromycin action as wild-type ribosomes. However, added tryptophan did prevent sparsomycin action as it normally does with wild-type ribosomes. These findings suggest that these two mutational changes act by reducing the ability of ribosome-bound tryptophan to inhibit peptidyl transferase activity rather than by reducing the ability of the ribosome to bind tryptophan. Thus, the present study identifies specific nucleotides within the ribosomal peptidyl transferase center that appear to be essential for effective tryptophan induction of tna operon expression. PMID:19329641

  1. Eukaryotic ribosomes that lack a 5.8S RNA

    Vossbrinck, C. R.; Woese, C. R.

    1986-01-01

    The 5.8S ribosomal RNA is believed to be a universal eukaryotic characteristic. It has no (size) counterpart among the prokaryotes, although its sequence is homologous with the first 150 or so nucleotides of the prokaryotic large subunit (23S) ribosomal RNA. An exception to this rule is reported here. The microsporidian Vairimorpha necatrix is a eukaryote that has no 5.8S rRNA. As in the prokaryotes, it has a single large subunit rRNA, whose 5-prime region corresponds to the 5.8S rRNA.

  2. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  3. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  4. Characterization of the binding sites of protein L11 and the L10.(L12)4 pentameric complex in the GTPase domain of 23 S ribosomal RNA from Escherichia coli

    Egebjerg, J; Douthwaite, S R; Liljas, A; Garrett, R A

    1990-01-01

    data, were used in a computer graphics approach to build a partial RNA tertiary structural model. The model provides insight into the topography of the L11 binding site. It also provides a structural rationale for the mutually co-operative binding of protein L11 with the antibiotics thiostrepton and...

  5. Fragmentation of 23S rRNA in Strains of Proteus and Providencia Results from Intervening Sequences in the rrn (rRNA) Genes

    Miller, Wayne L.; Pabbaraju, Kanti; Sanderson, Kenneth E.

    2000-01-01

    Intervening sequences (IVSs) were originally identified in the rrl genes for 23S rRNA (rrl genes, for large ribosomal subunit, part of rrn operon encoding rRNA) of Salmonella enterica serovars Typhimurium LT2 and Arizonae. These sequences are transcribed but later removed during RNase III processing of the rRNA, resulting in fragmentation of the 23S species; IVSs are uncommon, but have been reported in at least 10 bacterial genera. Through PCR amplification of IVS-containing regions of the rr...

  6. Analysis of the function of E. coli 23S rRNA helix-loop 69 by mutagenesis

    Maiväli Ülo

    2005-07-01

    Full Text Available Abstract Background The ribosome is a two-subunit enzyme known to exhibit structural dynamism during protein synthesis. The intersubunit bridges have been proposed to play important roles in decoding, translocation, and the peptidyl transferase reaction; yet the physical nature of their contributions is ill understood. An intriguing intersubunit bridge, B2a, which contains 23S rRNA helix 69 as a major component, has been implicated by proximity in a number of catalytically important regions. In addition to contacting the small ribosomal subunit, helix 69 contacts both the A and P site tRNAs and several translation factors. Results We scanned the loop of helix 69 by mutagenesis and analyzed the mutant ribosomes using a plasmid-borne IPTG-inducible expression system. We assayed the effects of 23S rRNA mutations on cell growth, contribution of mutant ribosomes to cellular polysome pools and the ability of mutant ribosomes to function in cell-free translation. Mutations A1912G, and A1919G have very strong growth phenotypes, are inactive during in vitro protein synthesis, and under-represented in the polysomes. Mutation Ψ1917C has a very strong growth phenotype and leads to a general depletion of the cellular polysome pool. Mutation A1916G, having a modest growth phenotype, is apparently defective in the assembly of the 70S ribosome. Conclusion Mutations A1912G, A1919G, and Ψ1917C of 23S rRNA strongly inhibit translation. Mutation A1916G causes a defect in the 50S subunit or 70S formation. Mutations Ψ1911C, A1913G, C1914A, Ψ1915C, and A1918G lack clear phenotypes.

  7. Cleavage of the sarcin–ricin loop of 23S rRNA differentially affects EF-G and EF-Tu binding

    García-Ortega, Lucía; Álvarez-García, Elisa; Gavilanes, José G.; Martínez-del-Pozo, Álvaro; Joseph, Simpson

    2010-01-01

    Ribotoxins are potent inhibitors of protein biosynthesis and inactivate ribosomes from a variety of organisms. The ribotoxin α-sarcin cleaves the large 23S ribosomal RNA (rRNA) at the universally conserved sarcin–ricin loop (SRL) leading to complete inactivation of the ribosome and cellular death. The SRL interacts with translation factors that hydrolyze GTP, and it is important for their binding to the ribosome, but its precise role is not yet understood. We studied the effect of α-sarcin on...

  8. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    Karminska, K. H.; Purta, E.; Hansen, L .H.; Bujnicki, J. M.; Vester, B.; Long, Katherine

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...

  9. Oxazolidinone resistance mutations in 23S rRNA of Escherichia coli reveal the central region of domain V as the primary site of drug action

    Xiong, L; Kloss, P; Douthwaite, S; Andersen, N M; Swaney, S; Shinabarger, D L; Mankin, A S

    2000-01-01

    resistance mutations were clustered in the vicinity of the central loop of domain V of 23S rRNA, suggesting that this rRNA region plays a major role in the interaction of the drug with the ribosome. Although the central loop of domain V is an essential integral component of the ribosomal peptidyl transferase......, we selected Escherichia coli oxazolidinone-resistant mutants, which contained a randomly mutagenized plasmid-borne rRNA operon. The same mutation, G2032 to A, was identified in the 23S rRNA genes of several independent resistant isolates. Engineering of this mutation by site-directed mutagenesis in...... the wild-type rRNA operon produced an oxazolidinone resistance phenotype, establishing that the G2032A substitution was the determinant of resistance. Engineered U and C substitutions at G2032, as well as a G2447-to-U mutation, also conferred resistance to oxazolidinone. All the characterized...

  10. VapC20 of Mycobacterium tuberculosis cleaves the Sarcin-Ricin loop of 23S rRNA

    Winther, Kristoffer Skovbo; Brodersen, Ditlev E.; Brown, Alistair K.; Gerdes, Kenn

    2013-01-01

    The highly persistent and often lethal human pathogen, Mycobacterium tuberculosis contains at least 88 toxin–antitoxin genes. More than half of these encode VapC PIN domain endoribonucleases that inhibit cell growth by unknown mechanisms. Here we show that VapC20 of M. tuberculosis inhibits translation by cleavage of the Sarcin–Ricin loop (SRL) of 23S ribosomal RNA at the same position where Sarcin and other eukaryotic ribotoxins cleave. Toxin-inhibited cells can be rescued by the expression ...

  11. Functional interactions within 23S rRNA involving the peptidyltransferase center.

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S rRNA peptidyltransferase loop. All three base substitutions at position 2032 produce an erythromycin-hypersensitive phenotype. The 2032 substitutions were compared with and combined with a 12-bp deletion muta...

  12. UV-induced modifications in the peptidyl transferase loop of 23S rRNA dependent on binding of the streptogramin B antibiotic, pristinamycin IA

    Porse, B T; Kirillov, S V; Awayez, M J;

    1999-01-01

    The naturally occurring streptogramin B antibiotic, pristinamycin IA, which inhibits peptide elongation, can produce two modifications in 23S rRNA when bound to the Escherichia coli 70S ribosome and irradiated at 365 nm. Both drug-induced effects map to highly conserved nucleotides within the...... functionally important peptidyl transferase loop of 23S rRNA at positions m2A2503/psi2504 and G2061/A2062. The modification yields are influenced strongly, and differentially, by P-site-bound tRNA and strongly by some of the peptidyl transferase antibiotics tested, with chloramphenicol producing a shift in the...... latter modification to A2062/C2063. Pristinamycin IA can also produce a modification on binding to deproteinized, mature 23S rRNA, at position U2500/C2501. The same modification occurs on an approximately 37-nt fragment, encompassing positions approximately 2496-2532 of the peptidyl transferase loop that...

  13. Viral IRES RNA structures and ribosome interactions

    Kieft, Jeffrey S.

    2008-01-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide ‘cap’ on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IR...

  14. Viral IRES RNA structures and ribosome interactions.

    Kieft, Jeffrey S

    2008-06-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide 'cap' on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES-ribosome complexes are revealing the structural basis of viral IRES' 'hijacking' of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  15. Nucleolar dominance and ribosomal RNA gene silencing

    Tucker, Sarah; Vitins, Alexa; Pikaard, Craig S.

    2010-01-01

    Nucleolar dominance is an epigenetic phenomenon that occurs in genetic hybrids and describes the expression of 45S rRNA genes inherited from one progenitor due to the silencing of the other progenitor’s rRNA genes. Nucleolar dominance is a manifestation of rRNA gene dosage control, which also occurs in non-hybrids, regulating the number of active rRNA genes according to the cellular demand for ribosomes and protein synthesis. Ribosomal RNA gene silencing involves changes in DNA methylation an...

  16. VapC20 of Mycobacterium tuberculosis Cleaves the Sarcin Ricin Loop of 23S rRNA

    Winther, Kristoffer Skovbo; Brodersen, Ditlev E.; Brown, Alistair K;

    2013-01-01

    exhibited by M. tuberculosis. VapC20 cleavage is inhibited by mutations in the SRL that flank the cleavage site but not by changes elsewhere in the loop. Disruption of the SRL stem abolishes cleavage; however, further mutations that restore the SRL stem structure restore cleavage, revealing that the...... translation by cleavage of the Sarcin–Ricin loop (SRL) of 23S ribosomal RNA at the same position where Sarcin and other eukaryotic ribotoxins cleave. Toxin-inhibited cells can be rescued by the expression of the antitoxin, thereby raising the possibility that vapC20 contributes to the extreme persistence...... structure rather than the exact sequence of the SRL is important for this activity...

  17. Functional interactions within 23S rRNA involving the peptidyltransferase center

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S r...... chloramphenicol. Introduction of the domain II deletion into these double-mutation constructs gives rise to erythromycin resistance. The results are interpreted as indicating that position 2032 interacts with the peptidyltransferase loop and that there is a functional connection between domains II and V....

  18. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. PMID:26800847

  19. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    Kaminska, Katarzyna H; Purta, Elzbieta; Hansen, Lykke H; Bujnicki, Janusz M; Vester, Birte; Long, Katherine S

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...... a 4Fe-4S cluster, a SAM molecule coordinated to the iron-sulfur cluster (SAM1) and a SAM molecule that is the putative methyl group donor (SAM2). All mutations at predicted functional sites affect Cfr activity significantly as assayed by antibiotic susceptibility testing and primer extension...

  20. Structure of a mitochondrial ribosome with minimal RNA

    Sharma, Manjuli R.; Booth, Timothy M.; Simpson, Larry; Maslov, Dmitri A.; Agrawal, Rajendra K.

    2009-01-01

    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show th...

  1. Higher-order structure in the 3'-terminal domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus

    Garrett, R A; Christensen, A; Douthwaite, S

    1984-01-01

    ribonuclease from Naja naja oxiana, and the relatively unstructured and accessible sequences were detected with the single-strand-specific ribonucleases A, T1 and T2. The data enabled the three secondary structural models, proposed for the E. coli 23 S RNAs, to be examined critically and it was concluded that......An experimental approach was used to determine, and compare, the higher-order structure within domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus. This domain, which encompasses approximately 300 nucleotides at the 3' end of the RNAs, consists of two large...... ribosomes of flowering plants. The structure of domain VI within the eubacterial RNAs was probed with chemical reagents in order to establish the degree of stacking and/or accessibility of each adenosine, cytidine and guanosine residue; the double-helical segments were localized with the cobra venom...

  2. Nonenzymatic microorganism identification based on ribosomal RNA

    Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.

    1999-11-01

    Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.

  3. VapC20 of Mycobacterium tuberculosis cleaves the sarcin-ricin loop of 23S rRNA.

    Winther, Kristoffer S; Brodersen, Ditlev E; Brown, Alistair K; Gerdes, Kenn

    2013-01-01

    The highly persistent and often lethal human pathogen, Mycobacterium tuberculosis contains at least 88 toxin-antitoxin genes. More than half of these encode VapC PIN domain endoribonucleases that inhibit cell growth by unknown mechanisms. Here we show that VapC20 of M. tuberculosis inhibits translation by cleavage of the Sarcin-Ricin loop (SRL) of 23S ribosomal RNA at the same position where Sarcin and other eukaryotic ribotoxins cleave. Toxin-inhibited cells can be rescued by the expression of the antitoxin, thereby raising the possibility that vapC20 contributes to the extreme persistence exhibited by M. tuberculosis. VapC20 cleavage is inhibited by mutations in the SRL that flank the cleavage site but not by changes elsewhere in the loop. Disruption of the SRL stem abolishes cleavage; however, further mutations that restore the SRL stem structure restore cleavage, revealing that the structure rather than the exact sequence of the SRL is important for this activity. PMID:24225902

  4. Regulating the Ribosome: A Spotlight on RNA Dark Matter

    Lintner, Nathanael G.; Cate, Jamie H. D.

    2014-01-01

    In this issue Pircher et al.(2014) show that an abundant ribosome-associated 18-nt noncoding RNA (ncRNA),derived from the open reading frame of an mRNA,acts directly on the ribosome and regulates global translation levels in response to hypertonic shock.

  5. Structure of a mitochondrial ribosome with minimal RNA.

    Sharma, Manjuli R; Booth, Timothy M; Simpson, Larry; Maslov, Dmitri A; Agrawal, Rajendra K

    2009-06-16

    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show that (i) the overall structure of the Lmr is considerably more porous, (ii) the topology of the intersubunit space is significantly different, with fewer intersubunit bridges, but more tunnels, and (iii) several of the functionally-important rRNA regions, including the alpha-sarcin-ricin loop, have different relative positions within the structure. Furthermore, the major portions of the mRNA channel, the tRNA passage, and the nascent polypeptide exit tunnel contain Lmr-specific proteins, suggesting that the mechanisms for mRNA recruitment, tRNA interaction, and exiting of the nascent polypeptide in Lmr must differ markedly from the mechanisms deduced for ribosomes in other organisms. Our study identifies certain structural features that are characteristic solely of mitochondrial ribosomes and other features that are characteristic of both mitochondrial and chloroplast ribosomes (i.e., organellar ribosomes). PMID:19497863

  6. YgdE is the 2'-O-ribose methyltransferase RlmM specific for nucleotide C2498 in bacterial 23S rRNA

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M;

    2009-01-01

    The rRNAs of Escherichia coli contain four 2'-O-methylated nucleotides. Similar to other bacterial species and in contrast with Archaea and Eukaryota, the E. coli rRNA modifications are catalysed by specific methyltransferases that find their nucleotide targets without being guided by small...... ribosomes. Nucleotide C2498 is situated within a highly conserved and heavily modified rRNA sequence, and YgdE's activity is influenced by other modification enzymes that target this region. Phylogenetically, YgdE is placed in the cluster of orthologous groups COG2933 together with S...... complementary RNAs. We show here that the ygdE gene encodes the methyltransferase that catalyses 2'-O-methylation at nucleotide C2498 in the peptidyl transferase loop of E. coli 23S rRNA. Analyses of rRNAs using MALDI mass spectrometry showed that inactivation of the ygdE gene leads to loss of methylation at...

  7. An overview of pre-ribosomal RNA processing in eukaryotes

    Henras, Anthony K.; Plisson-Chastang, Célia; O'Donohue, Marie-Françoise; Chakraborty, Anirban; Gleizes, Pierre-Emmanuel

    2014-01-01

    Ribosomal RNAs are the most abundant and universal noncoding RNAs in living organisms. In eukaryotes, three of the four ribosomal RNAs forming the 40S and 60S subunits are borne by a long polycistronic pre-ribosomal RNA. A complex sequence of processing steps is required to gradually release the mature RNAs from this precursor, concomitant with the assembly of the 79 ribosomal proteins. A large set of trans-acting factors chaperone this process, including small nucleolar ribonucleoparticles. ...

  8. Intervening Sequences in rrl Genes and Fragmentation of 23S rRNA in Genera of the Family Enterobacteriaceae

    Pronk, Loes M; Sanderson, Kenneth E.

    2001-01-01

    Intervening sequences (IVSs) in the rrl genes for 23S rRNA are transcribed but later removed by RNase III without religation during RNA processing, leading to fragmented rRNA. We examined about 240 strains of the family Enterobacteriaceae for presence of IVSs using PCR. No IVSs were detected in strains belonging to Escherichia, Shigella, Enterobacter, Erwinia, Ewingella, Hafnia, Kluyvera, Morganella, Pantoea, or Serratia. Previously unreported IVSs were detected in Klebsiella oxytoca, Citroba...

  9. Absolute Quantification of Enterococcal 23S rRNA Gene Using Digital PCR.

    Wang, Dan; Yamahara, Kevan M; Cao, Yiping; Boehm, Alexandria B

    2016-04-01

    We evaluated the ability of chip-based digital PCR (dPCR) to quantify enterococci, the fecal indicator recommended by the United States Environmental Protection Agency (USEPA) for water-quality monitoring. dPCR uses Poisson statistics to estimate the number of DNA fragments in a sample with a specific sequence. Underestimation may occur when a gene is redundantly encoded in the genome and multiple copies of that gene are on one DNA fragment. When genomic DNA (gDNA) was extracted using two commercial DNA extraction kits, we confirmed that dPCR could discern individual copies of the redundant 23s rRNA gene in the enterococcal genome. dPCR quantification was accurate when compared to the nominal concentration inferred from fluorometer measurements (linear regression slope = 0.98, intercept = 0.03, R(2) = 0.99, and p value humic acid caused a similar level of inhibition in both dPCR and qPCR, but calcium inhibited dPCR to a lesser degree than qPCR. Inhibition of dPCR was partially relieved when the number of thermal cycles was increased. Based on these results, we conclude that dPCR is a viable option for enumerating enterococci in ambient water. PMID:26903207

  10. Structural and Functional Studies of Ribosome-inactivating Proteins and Ribosomal RNA

    LIU Wangyi; ZHANG Jinsong; LIU Renshui; HE Wenjun; LING Jun

    2007-01-01

    @@ A plant's ribosome-inactivating proteins (RIPs) are a group of toxic proteins. Theoretically, they can be employed as a tool enzyme in the exploration of the structure and function of the ribosomal RNA; in practical application, they can be used as an insecticide in agriculture, for preparation of immuno-toxic protein to kill cancer cells or against viral infection in medicine.

  11. Purification, crystallization and preliminary X-ray diffraction analysis of the 23S rRNA methyltransferase RlmJ from Escherichia coli

    The 23S rRNA methyltransferase RlmJ from E. coli has been cloned, expressed, purified and crystallized. X-ray diffraction data to 1.85 Å resolution have been collected from the apo RlmJ crystals. Methyltransferase RlmJ uses the cofactor S-adenosylmethionine to methylate the exocyclic nitrogen N6 of nucleotide A2030 in 23S rRNA during ribosome assembly in Escherichia coli. RlmJ with a C-terminal hexahistidine tag was overexpressed in E. coli and purified as a monomer using Ni2+-affinity and size-exclusion chromatography. The recombinant RlmJ was crystallized using the sitting-drop vapour-diffusion method and a full data set was collected to 1.85 Å resolution from a single apo crystal. The crystals belonged to space group P21, with unit-cell parameters a = 46.9, b = 77.8, c = 82.5 Å, β = 104°. Data analysis suggested two molecules per asymmetric unit and a Matthews coefficient of 2.20 Å3 Da−1

  12. Impact of P-Site tRNA and antibiotics on ribosome mediated protein folding: studies using the Escherichia coli ribosome.

    Surojit Mondal

    Full Text Available BACKGROUND: The ribosome, which acts as a platform for mRNA encoded polypeptide synthesis, is also capable of assisting in folding of polypeptide chains. The peptidyl transferase center (PTC that catalyzes peptide bond formation resides in the domain V of the 23S rRNA of the bacterial ribosome. Proper positioning of the 3' -CCA ends of the A- and P-site tRNAs via specific interactions with the nucleotides of the PTC are crucial for peptidyl transferase activity. This RNA domain is also the center for ribosomal chaperoning activity. The unfolded polypeptide chains interact with the specific nucleotides of the PTC and are released in a folding competent form. In vitro transcribed RNA corresponding to this domain (bDV RNA also displays chaperoning activity. RESULTS: The present study explores the effects of tRNAs, antibiotics that are A- and P-site PTC substrate analogs (puromycin and blasticidin and macrolide antibiotics (erythromycin and josamycin on the chaperoning ability of the E. coli ribosome and bDV RNA. Our studies using mRNA programmed ribosomes show that a tRNA positioned at the P-site effectively inhibits the ribosome's chaperoning function. We also show that the antibiotic blasticidin (that mimics the interaction between 3'-CCA end of P/P-site tRNA with the PTC is more effective in inhibiting ribosome and bDV RNA chaperoning ability than either puromycin or the macrolide antibiotics. Mutational studies of the bDV RNA could identify the nucleotides U2585 and G2252 (both of which interact with P-site tRNA to be important for its chaperoning ability. CONCLUSION: Both protein synthesis and their proper folding are crucial for maintenance of a functional cellular proteome. The PTC of the ribosome is attributed with both these abilities. The silencing of the chaperoning ability of the ribosome in the presence of P-site bound tRNA might be a way to segregate these two important functions.

  13. The donor substrate site within the peptidyl transferase loop of 23 S rRNA and its putative interactions with the CCA-end of N-blocked aminoacyl-tRNA(Phe)

    Porse, B T; Thi-Ngoc, H P; Garrett, R A

    1996-01-01

    An RNA region associated with the donor substrate site, located at the base of the peptidyl transferase loop of 23 S rRNA, was subjected to a comprehensive single-site mutational study. Growth phenotypes of Escherichia coli cells were characterized on induction of synthesis of the mutated rRNAs and...... the mutated ribosomes were tested, selectively, for their capacity to generate peptide bonds under the conditions of the "fragment" assay. Most of the mutants exhibited dominant or recessive lethal growth phenotypes and, in general, defective growth correlated with low activities in peptide bond...... approach was employed to test for Watson-Crick base-pairing interactions between the -CCA end of the P-site bound tRNA(Phe) and this region of the peptidyl-transferase loop. Single nucleotide substitutions were introduced into the -CCA end of tRNA(Phe) and the ability of the 3'-terminal pentanucleotide...

  14. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    Liu, M; Kirpekar, F; Van Wezel, G P;

    2000-01-01

    Streptomyces species indicates that in vivo TlrB modifies nucleotide G748 within helix 35 of 23S rRNA. Purified recombinant TlrB retains its activity and specificity in vitro and modifies G748 in 23S rRNA as well as in a 74 nucleotide RNA containing helix 35 and surrounding structures. Modification is...

  15. Molecular paleontology: a biochemical model of the ancestral ribosome

    Hsiao, Chiaolong; Lenz, Timothy K.; Peters, Jessica K; Fang, Po-Yu; Schneider, Dana M.; Anderson, Eric J.; Preeprem, Thanawadee; Bowman, Jessica C.; O'Neill, Eric B.; Lie, Lively; Athavale, Shreyas S.; Gossett, J. Jared; Trippe, Catherine; Murray, Jason; Anton S. Petrov

    2013-01-01

    Ancient components of the ribosome, inferred from a consensus of previous work, were constructed in silico, in vitro and in vivo. The resulting model of the ancestral ribosome presented here incorporates ∼20% of the extant 23S rRNA and fragments of five ribosomal proteins. We test hypotheses that ancestral rRNA can: (i) assume canonical 23S rRNA-like secondary structure, (ii) assume canonical tertiary structure and (iii) form native complexes with ribosomal protein fragments. Footprinting exp...

  16. Translation with frameshifting of ribosome along mRNA transcript

    Li, Jingwei

    2015-01-01

    Translation is an important process for prokaryotic and eukaryotic cells to produce necessary proteins for cell growth. Numerious experiments have been performed to explore the translational properties. Diverse models have also been developed to determine the biochemical mechanism of translation. However, to simplify the majority of the existing models, the frameshifting of ribosome along the mRNA transcript is neglected, which actually occurs in real cells and has been extensively experimentally studied. The frameshifting of ribosome evidently influences the efficiency and speed of translation, considering that the peptide chains synthesized by shifted ribosomes will not fold into functional proteins and will degrade rapidly. In this study, a theoretical model is presented to describe the translational process based on the model for totally asymmetric simple exclusion process. In this model, the frameshifting of the ribosome along the mRNA transcript and the attachment/detachment of the ribosome to/from the ...

  17. The role of human ribosomal proteins in the maturation of rRNA and ribosome production

    Robledo, Sara; Rachel A Idol; Crimmins, Dan L.; Ladenson, Jack H.; Mason, Philip J.; Bessler, Monica

    2008-01-01

    Production of ribosomes is a fundamental process that occurs in all dividing cells. It is a complex process consisting of the coordinated synthesis and assembly of four ribosomal RNAs (rRNA) with about 80 ribosomal proteins (r-proteins) involving more than 150 nonribosomal proteins and other factors. Diamond Blackfan anemia (DBA) is an inherited red cell aplasia caused by mutations in one of several r-proteins. How defects in r-proteins, essential for proliferation in all cells, lead to a hum...

  18. Hierarchical RNA Processing Is Required for Mitochondrial Ribosome Assembly.

    Rackham, Oliver; Busch, Jakob D; Matic, Stanka; Siira, Stefan J; Kuznetsova, Irina; Atanassov, Ilian; Ermer, Judith A; Shearwood, Anne-Marie J; Richman, Tara R; Stewart, James B; Mourier, Arnaud; Milenkovic, Dusanka; Larsson, Nils-Göran; Filipovska, Aleksandra

    2016-08-16

    The regulation of mitochondrial RNA processing and its importance for ribosome biogenesis and energy metabolism are not clear. We generated conditional knockout mice of the endoribonuclease component of the RNase P complex, MRPP3, and report that it is essential for life and that heart and skeletal-muscle-specific knockout leads to severe cardiomyopathy, indicating that its activity is non-redundant. Transcriptome-wide parallel analyses of RNA ends (PARE) and RNA-seq enabled us to identify that in vivo 5' tRNA cleavage precedes 3' tRNA processing, and this is required for the correct biogenesis of the mitochondrial ribosomal subunits. We identify that mitoribosomal biogenesis proceeds co-transcriptionally because large mitoribosomal proteins can form a subcomplex on an unprocessed RNA containing the 16S rRNA. Taken together, our data show that RNA processing links transcription to translation via assembly of the mitoribosome. PMID:27498866

  19. Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿

    wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

    2008-01-01

    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative s...

  20. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio

    2010-04-01

    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae. PMID:19656941

  1. Domain V of 23S rRNA contains all the structural elements necessary for recognition by the ErmE methyltransferase

    Vester, B; Douthwaite, S

    1994-01-01

    enzyme efficiently modifies 23S rRNA in vitro. Removal of most of the 23S rRNA structure, so that only domain V (nucleotides 2000 to 2624) remains, does not affect the efficiency of modification by the methyltransferase. In addition, modification still occurs after the rRNA tertiary structure has been......The ErmE methyltransferase from the erythromycin-producing actinomycete Saccharopolyspora erythraea dimethylates the N-6 position of adenine 2058 in domain V of 23S rRNA. This modification confers resistance to erythromycin and to other macrolide, lincosamide, and streptogramin B antibiotics. We...

  2. Structural Insights into tRNA Dynamics on the Ribosome

    Xabier Agirrezabala

    2015-04-01

    Full Text Available High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation.

  3. Structural Insights into tRNA Dynamics on the Ribosome.

    Agirrezabala, Xabier; Valle, Mikel

    2015-01-01

    High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation. PMID:25941930

  4. Structural Insights into tRNA Dynamics on the Ribosome

    Xabier Agirrezabala; Mikel Valle

    2015-01-01

    High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation.

  5. Identification of 5-hydroxycytidine at position 2501 concludes characterization of modified nucleotides in E. coli 23S rRNA

    Havelund, Jesper Foged; Giessing, Anders Michael Bernth; Hansen, Trine Møller;

    2011-01-01

    modification as 5-hydroxycytidine-a novel modification in RNA. Identification of 5-hydroxycytidine was completed by liquid chromatography under nonoxidizing conditions using a graphitized carbon stationary phase in combination with ion trap tandem mass spectrometry and by comparing the fragmentation behavior...... rRNA-has previously been characterized in the bacterium Escherichia coli. Despite a first report nearly 20 years ago, the chemical nature of the modification at position 2501 has remained elusive, and attempts to isolate it have so far been unsuccessful. We unambiguously identify this last unknown...... of the natural nucleoside with that of a chemically synthesized ditto. Furthermore, we show that 5-hydroxycytidine is also present in the equivalent position of 23S rRNA from the bacterium Deinococcus radiodurans. Given the unstable nature of 5-hydroxycytidine, this modification might be found in...

  6. The conformation of 23S rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase

    Vester, B; Hansen, L H; Douthwaite, S

    1995-01-01

    it was shown that the A2057 and U2611 mutations alone and in combination alter the reactivity of A2058 and adjacent bases. However, mutagenizing position G-->A2032 in an adjacent loop, which has been implicated to interact with A2058, alters neither the ErmE methylation at A2058 nor the accessibility...... effects of mutations around position A2058 on methylation. Mutagenizing A2058 (to G or U) completely abolishes methylation of 23S rRNA by ErmE. No methylation occurred at other sites in the rRNA, demonstrating the fidelity of ErmE for A2058. Breaking the neighboring G2057-C2611 Watson-Crick base pair by...... introducing either an A2057 or a U2611 mutation, greatly reduces the rate of methylation at A2058. Methylation remains impaired after these mutations have been combined to create a new A2057-U2611 Watson-Crick base interaction. The conformation of this region in 23S rRNA was probed with chemical reagents and...

  7. Interaction of tRNA with Eukaryotic Ribosome

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  8. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    Ostergaard, P; Phan, H; Johansen, L B;

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

  9. Visualization of ribosomal RNA operon copy number distribution

    DasGupta Indrani; Wu Martin; Rastogi Rajat; Fox George E

    2009-01-01

    Abstract Background Results of microbial ecology studies using 16S rRNA sequence information can be deceiving due to differences in rRNA operon copy number and genome size of the detected organisms. It therefore will be useful for investigators to have a better understanding of how these two parameters differ in various organism types. In this study, the number of ribosomal operons and genome size were separately mapped onto a Bacterial phylogenetic tree. Results A representative Bacterial tr...

  10. Identification to the species level of Lactobacillus isolated in probiotic prospecting studies of human, animal or food origin by 16S-23S rRNA restriction profiling

    Neumann Elisabeth

    2005-03-01

    Full Text Available Abstract Background The accurate identification of Lactobacillus and other co-isolated bacteria during microbial ecological studies of ecosystems such as the human or animal intestinal tracts and food products is a hard task by phenotypic methods requiring additional tests such as protein and/or lipids profiling. Results Bacteria isolated in different probiotic prospecting studies, using de Man, Rogosa and Sharpe medium (MRS, were typed at species level by PCR amplification of 16S-23S rRNA intergenic spacers using universal primers that anneal within 16S and 23S genes, followed by restriction digestion analyses of PCR products. The set of enzymes chosen differentiates most species of Lactobacillus genus and also co-isolated bacteria such as Enterococcus, Streptococcus, Weissella, Staphylococcus, and Escherichia species. The in silico predictions of restriction patterns generated by the Lactobacillus shorter spacers digested with 11 restriction enzymes with 6 bp specificities allowed us to distinguish almost all isolates at the species level but not at the subspecies one. Simultaneous theoretical digestions of the three spacers (long, medium and short with the same set of enzymes provided more complex patterns and allowed us to distinguish the species without purifying and cloning of PCR products. Conclusion Lactobacillus isolates and several other strains of bacteria co-isolated on MRS medium from gastrointestinal ecosystem and fermented food products could be identified using DNA fingerprints generated by restriction endonucleases. The methodology based on amplified ribosomal DNA restriction analysis (ARDRA is easier, faster and more accurate than the current methodologies based on fermentation profiles, used in most laboratories for the purpose of identification of these bacteria in different prospecting studies.

  11. 116S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads

    Sima eTokajian

    2016-02-01

    Full Text Available Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 to 849 bp, while their G+C content was 42.2 mol% to 57.9 mol%. Five distinct ITS types were identified: ITSnone (without tRNA genes, ITSAla(TGC, ITSAla (TGC+Ile (GAT, ITSIle (GAT+Ala (TGC and ITS Ile (GAT+Pseudo. All of the identified tRNAAla (TGC molecules consisted of 73 bases, and all of the tRNAIle (GAT molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2.

  12. New mutation points in 23S rRNA gene associated with Helicobacter Pylori resistance to clarithromycin in northeast China

    Qing Hao; Yan Li; Zhi-Jie Zhang; Yong Liu; Hong Gao

    2004-01-01

    AIM: To investigate the resistance rate of Helicobacter pylori (Hpylori) to clarithromycin, metronidazole, amoxicillin and tetracycline to guide clinical practice, and to study the mechanism of H pyloriresistant to clarithromycin.METHODS: Thirty H pyloristrains were isolated from the mucosa of peptic ulcer, gastric tumor and chronic gastritis patients, then the minimal inhibitory concentration (MIC) to clarithromycin, metronidazole, amoxicillin and tetracycline was evaluated by E-test method. The sequence analysis of PCR fragments was conducted in 23S rRNA gene of H pylori resistant to clarithromycin to get the resistance mechanism of the bacteria.RESULTS: Among 30 H pyloristrains, 7 cases were resistant to clarithromycin, 12 to metronidazole, 2 to tetracycline and no strain was found to be resistant to amoxicillin. The resistance rates were 23.3%, 40%, 6.7% and 0%,respectively. Three new mutation points were found to be related to the clarithromycin resistance in H pyloriisolates,which were G2224A, C2245T and T2289C.CONCLUSION: In northeast China, H pylorishows high resistance to metronidazole, while sensitive to amoxicillin.The mechanism of resistance to clarithromycin may be related to the mutation of G2224A, C2245T and T2289C in the 23S rRNA gene.

  13. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  14. Epigeneitc silencing of ribosomal RNA genes by Mybbp1a

    Tan Bertrand

    2012-06-01

    Full Text Available Abstract Background Transcription of the ribosomal RNA gene repeats by Pol I occurs in the nucleolus and is a fundamental step in ribosome biogenesis and protein translation. Due to tight coordination between ribosome biogenesis and cell proliferation, transcription of rRNA and stable maintenance of rDNA clusters are thought to be under intricate control by intercalated mechanisms, particularly at the epigenetic level. Methods and Results Here we identify the nucleolar protein Myb-binding protein 1a (Mybbp1a as a novel negative regulator of rRNA expression. Suppression of rDNA transcription by Mybbp1a was linked to promoter regulation as illustrated by its binding to the chromatin around the hypermethylated, inactive rDNA gene promoters. Our data further showed that downregulation of Mybbp1a abrogated the local DNA methylation levels and histone marks associated with gene silencing, and altered the promoter occupancy of various factors such UBF and HDACs, consequently leading to elevated rRNA expression. Mechanistically, we propose that Mybbp1a maintains rDNA repeats in a silenced state while in association with the negative epigenetic modifiers HDAC1/2. Conclusions Results from our present work reveal a previously unrecognized co-repressor role of Mybbp1a in rRNA expression. They are further consistent with the scenario that Mybbp1a is an integral constituent of the rDNA epigenetic regulation that underlies the balanced state of rDNA clusters.

  15. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics.

    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G

    2005-09-01

    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  16. Crystal structure of the Escherichia coli 23S rRNA:m5C methyltransferase RlmI (YccW) reveals evolutionary links between RNA modification enzymes

    Sunita, S; Tkaczuk, Karolina L; Purta, Elzbieta;

    2008-01-01

    Methylation is the most common RNA modification in the three domains of life. Transfer of the methyl group from S-adenosyl-l-methionine (AdoMet) to specific atoms of RNA nucleotides is catalyzed by methyltransferase (MTase) enzymes. The rRNA MTase RlmI (rRNA large subunit methyltransferase gene I......; previously known as YccW) specifically modifies Escherichia coli 23S rRNA at nucleotide C1962 to form 5-methylcytosine. Here, we report the crystal structure of RlmI refined at 2 A to a final R-factor of 0.194 (R(free)=0.242). The RlmI molecule comprises three domains: the N-terminal PUA domain; the central...

  17. The effect of trichloroethylene and acrylonitrile on RNA and ribosome synthesis and ribosome content in Saccharomyces cells.

    Lochmann, E R; Ehrlich, W; Mangir, M

    1984-04-01

    The effects of trichloroethylene (TCE) and acrylonitrile (ACN) on growth, RNA synthesis, ribosome synthesis, and ribosome content were tested in yeast cells. TCE causes a delay of the growth of a cell culture (prolongation of the lag phase), but does not cause inhibition. Cells exposed to increasing concentrations of ACN show increasing damage, so that, at a certain point of the growth curve, cell division stops altogether. Similar results were obtained when RNA synthesis was investigated: After treatment with TCE, the maximum RNA synthesis of the cell culture was retarded, but subsequently reached the same level as the untreated control cells. In the presence of ACN, however, the rate of RNA synthesis was lowered with increasing ACN concentrations. The same effect was observed upon investigation of ribosome synthesis: Whereas TCE produces only a slight effect, treatment with increasing concentrations of ACN leads to a substantial decrease in ribosome synthesis, and finally to total inhibition. Parallel to this, the content of free and membrane-bound ribosomes is diminished. Obviously, the decrease in ribosome content is caused not only by an inhibition of ribosome synthesis, but also by a degradation of existing ribosomes, as well as by induction of a ribosome-associated RNase. PMID:6714140

  18. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan

    Martínez, Allyson K.; GORDON, EMILY; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M.; Benedik, Michael J.; Yanofsky, Charles; Mankin, Alexander S.; Vazquez-Laslop, Nora; Sachs, Matthew S.; Cruz-Vera, Luis R.

    2013-01-01

    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome’s ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the con...

  19. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan.

    Martínez, Allyson K; Gordon, Emily; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M; Benedik, Michael J; Yanofsky, Charles; Mankin, Alexander S; Vazquez-Laslop, Nora; Sachs, Matthew S; Cruz-Vera, Luis R

    2014-01-01

    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome's ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the concentration dependence of L-Trp-mediated tna operon induction, whereas the TnaC I19L change suppresses this phenotype, restoring the sensitivity of the translating A2058U mutant ribosome to free L-Trp. These findings suggest that interactions between TnaC residue I19 and 23S rRNA nucleotide A2058 contribute to the creation of a regulatory L-Trp binding site within the translating ribosome. PMID:24137004

  20. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    He, Kaiyu [Department of Microbiology and Molecular Genetics (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Zhou, Hui-Ren [Food Science and Human Nutrition (United States); Pestka, James J., E-mail: pestka@msu.edu [Department of Microbiology and Molecular Genetics (United States); Food Science and Human Nutrition (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States)

    2012-11-15

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  1. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  2. 奇异变形杆菌分离株23S rRNA序列分析%Sequence analysis of 23S rRNA genes of Proteus mirabilis

    王慧; 朱瑞良; 朱明华; 谭燕玲; 孙振红; 魏凯; 盛鹏程; 王新建

    2011-01-01

    通过PCR反应扩增7株鸡奇异变形杆菌和1株兔奇异变形杆菌的23SrRNA基因片段(1 045bp),经克隆测序,用DNAStar分析软件将所获得的序列与GenBank中收录的奇异变形杆菌、普通变形杆菌以及其他相近属的23S rRNA基因序列进行同源性比较,并由此构建奇异变形杆菌系统进化发生树.结果表示,本实验室保存的7株鸡奇异变形杆菌核苷酸序列与GenBank中收录的奇异变形杆菌核苷酸序列同源性为99.4%~99.8%,与兔奇异变形杆菌核苷酸序列同源性为98.8%~99.3%,与普通变形杆茵的核苷酸序列同源性为95.4%~96.2%,而与其他相近属同源性只有92.9%~93.4%.结果表明,23S rRNA基因序列分析可以作为鉴定奇异变形杆茵的一种快速、简便的方法.%To assess the evolution of Proteus mirabilis by 23S rRNA genes,To establish the sequence analysis of 23S rRNA of Proteus mirabilis was analyzed. The fragments (1 045 bp) of 23S rRNA genes of seven chicken Proteus mirabilis strains and one rabbit Proteus mirabilis strain were amplified by PCR and were sequenced. The sequences obtained in this paper were compared with the Proteus mirabilis 23S rRNA sequence reported in GenBank and other similar generas by the software of DNAStar analyses. The phylogenetic tree of Proteus mirabilis strains was established. Results showed the homologies between seven chicken Proteus mirabilis strains and the reported one strain in GenBank were 99.4%-99.8% ,and were 98.8%-99.3% identical to the rabbit Proteus mirabilis strains,were 95.4 %-96.2% identical to Proteus vulgaris, were 92. 9%-93.4 % identical to other similar generas. The result shown that 23S rRNA sequence analyses may be a reliable and rapid way for identification of Proteus mirabilis.

  3. Prevalence of A2143G mutation of H. pylori-23S rRNA in Chinese subjects with and without clarithromycin use history

    Ma Junling; Feng Guoshuang; Gu Liankun; Zhou Jing; Zhang Baozhen; Li Qiang; Shen Lin; Zhang Lian; Shen Jing; Liu Zhuoqi; You Wei-Cheng; Deng Dajun

    2008-01-01

    Abstract Background A2143G mutation of 23S rRNA gene of H. pylori results in clarithromycin (CLR) resistance. To investigate the prevalence of the CLR resistance-related A2143G mutation of the H. pylori-specific 23S rRNA gene in Chinese subjects with and without CLR use history, 307 subjects received the treatment with amoxicillin and omeprazole (OA) and 310 subjects received a placebo in 1995, and 153 subjects received a triple therapy with OA and CLR (OAC) in 2000. DNA was extracted from fa...

  4. Structures of the Bacterial Ribosome in Classical and Hybrid States of tRNA Binding

    Dunkle, Jack A.; Wang, Leyi; Feldman, Michael B.; Pulk, Arto; Chen, Vincent B.; Kapral, Gary J.; Noeske, Jonas; Richardson, Jane S.; Blanchard, Scott C.; Cate, Jamie H. Doudna (Cornell); (UCB); (Duke)

    2011-09-06

    During protein synthesis, the ribosome controls the movement of tRNA and mRNA by means of large-scale structural rearrangements. We describe structures of the intact bacterial ribosome from Escherichia coli that reveal how the ribosome binds tRNA in two functionally distinct states, determined to a resolution of {approx}3.2 angstroms by means of x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit site. The structures help to explain how the ratchet-like motion of the two ribosomal subunits contributes to the mechanisms of translocation, termination, and ribosome recycling.

  5. Heritability and Variability in Ribosomal RNA Genes of Vicia faba

    Rogers, Scott O; Bendich, Arnold J.

    1987-01-01

    We have compared the restriction patterns and copy numbers of ribosomal RNA genes (rDNA) between and within individuals of Vicia faba . While the EcoRI blot-hybridization patterns changed only after one to two generations, copy number changes were found among different tissues of the same plant. Copy number differences among individuals in the population were as great as 95-fold, whereas as much as a 12-fold variation was seen among tissues of the same plant. Among individual F1 progeny from ...

  6. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    Poulsen, S M; Karlsson, M; Johansson, L B;

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are...... strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...

  7. Acquired macrolide resistance in the human intestinal strain Lactobacillus rhamnosus E41 associated with a transition mutation in 23S rRNA genes

    Flórez García, Ana Belén; Ladero Losada, Víctor Manuel; Álvarez Martín, Pablo; Ammor, Mohammed Salim; Álvarez González, Miguel Ángel; Mayo Pérez, Baltasar

    2007-01-01

    Restriction fragment length polymorphism and DNA sequencing of polymerase chain reaction (PCR) products showed that a Lactobacillus rhamnosus strain of human origin resistant to macrolides, from which no resistance determinants have been detected by specific PCR and microarray screening, contained a heterozygous A → G transition mutation at position 2058 (Escherichia coli numbering) of its 23S rRNA genes.

  8. Prevalence of A2143G mutation of H. pylori-23S rRNA in Chinese subjects with and without clarithromycin use history

    Ma Junling

    2008-05-01

    Full Text Available Abstract Background A2143G mutation of 23S rRNA gene of H. pylori results in clarithromycin (CLR resistance. To investigate the prevalence of the CLR resistance-related A2143G mutation of the H. pylori-specific 23S rRNA gene in Chinese subjects with and without CLR use history, 307 subjects received the treatment with amoxicillin and omeprazole (OA and 310 subjects received a placebo in 1995, and 153 subjects received a triple therapy with OA and CLR (OAC in 2000. DNA was extracted from fasting gastric juice at the end of the intervention trial in 2003. H. pylori infection was determined by H. pylori-specific 23S rRNA PCR, ELISA, and13C-urea breath test assays. Mutations of the 23S rRNA gene were detected by RFLP assays. Results The presence of 23S rRNA due to H. pylori infection in the OA group remained lower than that in the placebo group 7.3 yrs after OA-therapy [51.1% (157/307 vs. 83.9% (260/310, p = 0.0000]. In the OAC group, the 23S rRNA detection rate was 26.8% (41/153 three yrs after OAC-treatment. The A2143G mutation rate among the 23S rRNA-positive subjects in the OAC group [31.7% (13/41] was significantly higher than that in the OA group [10.2% (16/157] and the placebo group [13.8% (36/260]. The frequency of the AAGGG → CTTCA (2222–2226 and AACC → GAAG (2081–2084 sequence alterations in the OAC group was also significantly higher than those in the OA group and the placebo group. Conclusion Primary prevalence of the A2143G mutation was 10~14% among Chinese population without history of CLR therapy. Administration of CLR to eliminate H. pylori infection increased the prevalence of the A2143G mutation in Chinese subjects (32% significantly.

  9. Footprinting of ribosomal RNA genes by transcription initiation factor and RNA polymerase I.

    Bateman, E.; Iida, C T; Kownin, P; Paule, M R

    1985-01-01

    The binding of a species-specific transcription initiation factor (TIF) and purified RNA polymerase I to the promoter region of the 39S ribosomal RNA gene from Acanthamoeba were studied by using DNase I "footprinting." Conditions were chosen such that the footprints obtained could be correlated with the transcriptional activity of the TIF-containing fractions used and that the labeled DNA present would itself serve as a template for transcription. The transcription factor binds upstream from ...

  10. 16S ribosomal RNA methylation: emerging resistance mechanism against aminoglycosides.

    Doi, Yohei; Arakawa, Yoshichika

    2007-07-01

    Methylation of 16S ribosomal RNA (rRNA) has recently emerged as a new mechanism of resistance against aminoglycosides among gram-negative pathogens belonging to the family Enterobacteriaceae and glucose-nonfermentative microbes, including Pseudomonas aeruginosa and Acinetobacter species. This event is mediated by a newly recognized group of 16S rRNA methylases, which share modest similarity to those produced by aminoglycoside-producing actinomycetes. Their presence confers a high level of resistance to all parenterally administered aminoglycosides that are currently in clinical use. The responsible genes are mostly located on transposons within transferable plasmids, which provides them with the potential to spread horizontally and may in part explain the already worldwide distribution of this novel resistance mechanism. Some of these organisms have been found to coproduce extended-spectrum beta-lactamases or metallo-beta-lactamases, contributing to their multidrug-resistant phenotypes. A 2-tiered approach, consisting of disk diffusion tests followed by confirmation with polymerase chain reaction, is recommended for detection of 16S rRNA methylase-mediated resistance. PMID:17554708

  11. Mimicking Ribosomal Unfolding of RNA Pseudoknot in a Protein Channel.

    Zhang, Xinyue; Xu, Xiaojun; Yang, Zhiyu; Burcke, Andrew J; Gates, Kent S; Chen, Shi-Jie; Gu, Li-Qun

    2015-12-23

    Pseudoknots are a fundamental RNA tertiary structure with important roles in regulation of mRNA translation. Molecular force spectroscopic approaches such as optical tweezers can track the pseudoknot's unfolding intermediate states by pulling the RNA chain from both ends, but the kinetic unfolding pathway induced by this method may be different from that in vivo, which occurs during translation and proceeds from the 5' to 3' end. Here we developed a ribosome-mimicking, nanopore pulling assay for dissecting the vectorial unfolding mechanism of pseudoknots. The pseudoknot unfolding pathway in the nanopore, either from the 5' to 3' end or in the reverse direction, can be controlled by a DNA leader that is attached to the pseudoknot at the 5' or 3' ends. The different nanopore conductance between DNA and RNA translocation serves as a marker for the position and structure of the unfolding RNA in the pore. With this design, we provided evidence that the pseudoknot unfolding is a two-step, multistate, metal ion-regulated process depending on the pulling direction. Most notably, unfolding in both directions is rate-limited by the unzipping of the first helix domain (first step), which is Helix-1 in the 5' → 3' direction and Helix-2 in the 3' → 5' direction, suggesting that the initial unfolding step in either pulling direction needs to overcome an energy barrier contributed by the noncanonical triplex base-pairs and coaxial stacking interactions for the tertiary structure stabilization. These findings provide new insights into RNA vectorial unfolding mechanisms, which play an important role in biological functions including frameshifting. PMID:26595106

  12. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  13. Visualization of ribosomal RNA operon copy number distribution

    DasGupta Indrani

    2009-09-01

    Full Text Available Abstract Background Results of microbial ecology studies using 16S rRNA sequence information can be deceiving due to differences in rRNA operon copy number and genome size of the detected organisms. It therefore will be useful for investigators to have a better understanding of how these two parameters differ in various organism types. In this study, the number of ribosomal operons and genome size were separately mapped onto a Bacterial phylogenetic tree. Results A representative Bacterial tree was constructed using 31 marker genes found in 578 bacterial genome sequences. Organism names are displayed on the trees using graduations of color such that similar colors indicate similar numbers of operons or genome size. The resulting images provide an intuitive understanding of how copy number and genome size vary in different Bacterial phyla. Conclusion Once the phylogenetic position of a novel organism is known the number of rRNA operons, and to a lesser extent the genome size, can be estimated by examination of the colored maps. Further detail can then be obtained for members of relevant taxa from the rrnDB database.

  14. Mechanism of translocation: relative arrangement of tRNA and mRNA on the ribosome.

    Matzke, A J; Barta, A; Kuechler, E

    1980-01-01

    AcPhe-tRNAPhe from yeast can be photocross-linked to poly(U) on Escherichia coli ribosomes. The photoreaction occurs at the wybutine base situated next to the 3' side of the anticodon. The kinetics and efficiency of crosslinking of AcPhe-Phe-tRNA are the same at both the acceptor site and the peptidyl site. Therefore, the orientation of wybutine with respect to the mRNA is similar in both the pretranslocational and posttranslocational states. AcPhe-Phe-tRNA crosslinked at the acceptor site ca...

  15. Use of 16S-23S rRNA Intergenic Spacer Region PCR and Repetitive Extragenic Palindromic PCR Analyses of Escherichia coli Isolates To Identify Nonpoint Fecal Sources

    Seurinck, Sylvie; Verstraete, Willy; Siciliano, Steven D.

    2003-01-01

    Despite efforts to minimize fecal input into waterways, this kind of pollution continues to be a problem due to an inability to reliably identify nonpoint sources. Our objective was to find candidate source-specific Escherichia coli fingerprints as potential genotypic markers for raw sewage, horses, dogs, gulls, and cows. We evaluated 16S-23S rRNA intergenic spacer region (ISR)-PCR and repetitive extragenic palindromic (rep)-PCR analyses of E. coli isolates as tools to identify nonpoint fecal...

  16. First Report of the 23S rRNA Gene A2058G Point Mutation Associated With Macrolide Resistance in Treponema pallidum From Syphilis Patients in Cuba.

    Noda, Angel A; Matos, Nelvis; Blanco, Orestes; Rodríguez, Islay; Stamm, Lola Virginia

    2016-05-01

    This study aimed to assess the presence of macrolide-resistant Treponema pallidum subtypes in Havana, Cuba. Samples from 41 syphilis patients were tested for T. pallidum 23S rRNA gene mutations. Twenty-five patients (61%) harbored T. pallidum with the A2058G mutation, which was present in all 8 subtypes that were identified. The A2059G mutation was not detected. PMID:27100771

  17. Identification to the species level of Lactobacillus isolated in probiotic prospecting studies of human, animal or food origin by 16S-23S rRNA restriction profiling

    Neumann Elisabeth; Teixeira Santuza MR; Horta Maria F; Mota Rodrigo M; Moreira João; Nicoli Jacques R.; Nunes Álvaro C

    2005-01-01

    Abstract Background The accurate identification of Lactobacillus and other co-isolated bacteria during microbial ecological studies of ecosystems such as the human or animal intestinal tracts and food products is a hard task by phenotypic methods requiring additional tests such as protein and/or lipids profiling. Results Bacteria isolated in different probiotic prospecting studies, using de Man, Rogosa and Sharpe medium (MRS), were typed at species level by PCR amplification of 16S-23S rRNA i...

  18. Controlling translation elongation efficiency: tRNA regulation of ribosome flux on the mRNA.

    Gorgoni, Barbara; Marshall, Elizabeth; McFarland, Matthew R; Romano, M Carmen; Stansfield, Ian

    2014-02-01

    Gene expression can be regulated by a wide variety of mechanisms. One example concerns the growing body of evidence that the protein-production rate can be regulated at the level of translation elongation by controlling ribosome flux across the mRNA. Variations in the abundance of tRNA molecules cause different rates of translation of their counterpart codons. This, in turn, produces a variable landscape of translational rate across each and every mRNA, with the dynamic formation and deformation of ribosomal queues being regulated by both tRNA availability and the rates of translation initiation and termination. In the present article, a range of examples of tRNA control of gene expression are reviewed, and the use of mathematical modelling to develop a predictive understanding of the consequences of that regulation is discussed and explained. These findings encourage a view that predicting the protein-synthesis rate of each mRNA requires a holistic understanding of how each stage of translation, including elongation, contributes to the overall protein-production rate. PMID:24450645

  19. Direct ribosome isolation from soil to extract bacterial rRNA for community analysis.

    Felske, A; B. Engelen; Nübel, U; Backhaus, H

    1996-01-01

    A simple method that combines an adapted ribosome isolation method and a common RNA extraction step has been developed for selective recovery of intact rRNA from natural microbial communities in soil. After mechanical cell lysis, ribosomes are separated by centrifugation steps, avoiding massive humic acid contamination and RNA degradation. The protocol accommodates the complex composition of soils by blocking adsorbing surfaces and humic acids with polyvinylpyrrolidone and bovine serum albumi...

  20. Structural Basis for Ribosome Recruitment and Manipulation by a Viral IRES RNA

    Pfingsten, Jennifer S; Costantino, David A.; Kieft, Jeffrey S.

    2006-01-01

    Canonical cap-dependent translation initiation requires a large number of protein factors that act in a stepwise assembly process. In contrast, internal ribosomal entry sites (IRESs) are cis-acting RNAs that in some cases completely supplant these factors by recruiting and activating the ribosome using a single structured RNA. Here we present the crystal structures of the ribosome-binding domain from a Dicistroviridae intergenic region IRES at 3.1 angstrom resolution, providing a view of the ...

  1. Translation by polysome: theory of ribosome profile on a single mRNA transcript

    Sharma, Ajeet K

    2011-01-01

    The process of polymerizing a protein by a ribosome, using a messenger RNA (mRNA) as the corresponding template, is called {\\it translation}. Ribosome may be regarded as a molecular motor for which the mRNA template serves also as the track. Often several ribosomes may translate the same (mRNA) simultaneously. The ribosomes bound simultaneously to a single mRNA transcript are the members of a polyribosome (or, simply, {\\it polysome}). Experimentally measured {\\it polysome profile} gives the distribution of polysome {\\it sizes}. Recently a breakthrough in determining the instantaneous {\\it positions} of the ribosomes on a given mRNA track has been achieved and the technique is called {\\it ribosome profiling} \\cite{ingolia10,guo10}. Motivated by the success of these techniques, we have studied the spatio-temporal organization of ribosomes by extending a theoretical model that we have reported elsewhere \\cite{sharma11}. This extended version of our model incorporates not only (i) mechano-chemical cycle of indivi...

  2. “Silencing the ribosomal locus of Saccharomyces cerevisiae: role of RNA polymerase I transcription and chromatin acetylation”

    Cesarini, Elisa

    2011-01-01

    During my PhD I investigated the transcriptional silencing occurring at the ribosomal DNA of Saccharomyces cerevisiae. In yeast the ribosomal locus (rDNA) is transcribed with high efficiency by RNA polymerase I (Pol I) and III to synthetize ribosomal RNAs. It has been discovered that RNA polymerase Pol II (Pol II) can also transcribe the ribosomal locus, at low level, starting from cryptic promoters and generating non coding RNAs (ncRNAs). ncRNA transcription leads to genome...

  3. Modeling of ribosome dynamics on a ds-mRNA under an external load

    Shakiba, Bahareh; Dayeri, Maryam; Mohammad-Rafiee, Farshid

    2016-07-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to the recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force and the translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  4. Modeling of Ribosome Dynamics on a ds-mRNA under an External Load

    Shakiba, Bahareh; Mohammad-Rafiee, Farshid

    2016-01-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force, and translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  5. Translation Initiation is Controlled by RNA Folding Kinetics via a Ribosome Drafting Mechanism.

    Espah Borujeni, Amin; Salis, Howard M

    2016-06-01

    RNA folding plays an important role in controlling protein synthesis as well as other cellular processes. Existing models have focused on how RNA folding energetics control translation initiation rate under equilibrium conditions but have largely ignored the effects of nonequilibrium RNA folding. We introduce a new mechanism, called "ribosome drafting", that explains how a mRNA's folding kinetics and the ribosome's binding rate collectively control its translation initiation rate. During cycles of translation, ribosome drafting emerges whenever successive ribosomes bind to a mRNA faster than the mRNA can refold, maintaining it in a nonequilibrium state with an acceleration of protein synthesis. Using computational design, time-correlated single photon counting, and expression measurements, we demonstrate that slow-folding and fast-folding RNA structures with equivalent folding energetics can vary protein synthesis rates by 1000-fold. We determine the necessary conditions for ribosome drafting by characterizing mRNAs with rationally designed ribosome binding rates, folding kinetics, and folding energetics, confirming the predictions of a nonequilibrium Markov model of translation. Our results have widespread implications, illustrating how competitive folding and assembly kinetics can shape the gene expression machinery's sequence-structure-function relationship inside cells. PMID:27199273

  6. A molecular biological study on identification of common septicemia bacteria using 16s-23s rRNA gene spacer regions

    傅君芬; 虞和永; 尚世强; 洪文澜; 陆淼泉; 李建平

    2002-01-01

    In the search for a rapid and reliable method for identification of bacteria in blood and cerebrospinal fluid , we developed a unified set of primers and used them under polymerase chain reaction(PCR) to amplify the spacer regions between the 16s and 23s genes in the prokaryotic rRNA genetic loci . Spacer regions within these loci showed a significant level of length and sequence polymorphism across most of the species lines. A generic pair of priming sequences was selected from highly conserved sequences in the 16s and 23s genes occurring adjacent to these polymorphic regions. This single set of primers and reaction conditions were used for the amplification of the 16s-23s spacer regions for 61 strains of standard bacteria and corresponding clinical isolates belonging to 20 genera and 27 species, including Listeria, Staphylococcus and Salmonella species, et al. When the spacer amplification products were resolved by electrophoresis, the resulting patterns could be used to distinguish most of the bacteria species within the test group, and the amplification products of the clinical isolates clustered at the standard species level. Some species presenting similar pattern were further analyzed by HinfI or AluI digestion or DNA clone and sequences analysis in order to establish the specific 16s-23s rRNA gene spacer regions map. Analysis of 42 blood specimens from septicemic neonates and 6 CSF specimens from suspected purulent meningitis patients by bacterial culture and PCR-RFLP(Restriction Fregament Length Polymorphism) showed that 15 specimens of blood culture were positive(35.7%) in the 42 septicemic neonates; 27 specimens were positive(64.2%) by PCR, and that the positive rate by PCR was significantly higher than that by blood culture(P<0.01). Among the 6 CSF specimens, one specimen found positive by blood culture was also positive by PCR, two found negative by blood culture showed positive by PCR; all three were S.epidermidis according to the DNA map. One C

  7. Ribosome collisions and Translation efficiency: Optimization by codon usage and mRNA destabilization

    Mitarai, Namiko; Sneppen, Kim; Pedersen, Steen

    2008-01-01

    collisions and queues are inevitable consequences of a stochastic translation mechanism that reduce the translation efficiency substantially on natural mRNAs. The cells minimize collisions by having its mRNAs being unstable and by a highly selected codon usage in the start of the mRNA. The cost of m......Individual mRNAs are translated by multiple ribosomes that initiate translation with an interval of a few seconds. The ribosome speed is codon dependent, and ribosome queuing has been suggested to explain specific data for translation of some mRNAs in vivo. By modeling the stochastic translation...... process as a traffic problem, we here analyze conditions and consequences of collisions and queuing. The model allowed us to determine the on-rate (0.8 to 1.1 initiations/s) and the time (1 s) the preceding ribosome occludes initiation for Escherichia coli lacZ mRNA in vivo. We find that ribosome...

  8. Purification, crystallization and preliminary X-ray crystallographic analysis of 23S RNA m2G2445 methyltransferase RlmL from Escherichia coli

    RlmL, a 23S rRNA m2G2445 methyltransferase from Escherichia coli, was expressed, purified and crystallized, and crystals diffracted to 2.2 Å. The RlmL (YcbY) protein in Escherichia coli is an rRNA methyltransferase that is specific for m2G2445 modification of 23S RNA. The rlmL gene was cloned into the expression vector pET28a and expressed in the host E. coli strain BL21 (DE3). Recombinant protein with a six-histidine tag was purified by Ni2+-affinity chromatography followed by gel filtration. Crystals were grown using the hanging-drop vapour-diffusion method and a detergent was used as an additive to improve diffraction quality. The final crystals diffracted to 2.2 Å resolution. The crystals belonged to space group P21, with unit-cell parameters a = 73.6, b = 140.8, c = 102.9 Å, β = 102.3°. The crystal has a most probable solvent content of 62.8% with two molecules in the asymmetric unit

  9. Discrimination of bacillus anthracis and closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microarray.

    Bavykin, S. G.; Mikhailovich, V. M.; Zakharyev, V. M.; Lysov, Y. P.; Kelly, J. J.; Alferov, O. S.; Jackman, J.; Stahl, D. A.; Mirzabekov, A. D.; Gavin, I. M.; Kukhtin, A. V.; Chandler, D. (Biochip Technology Center); (Engelhardt Inst. of Molecular Biology); (Northwestern Univ.); (Georgetown Univ.)

    2008-01-30

    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 min. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead reflect

  10. Hyperaccurate and error-prone ribosomes exploit distinct mechanisms during tRNA selection

    Zaher, Hani S.; Green, Rachel

    2010-01-01

    Escherichia coli strains displaying hyper-accurate (restrictive) and ribosomal ambiguity (ram) phenotypes have long been associated with alterations in rpsL and rpsD/rpsE, respectively. Crystallographic evidence shows the ribosomal proteins S12 and S4/S5 (corresponding to these genes) to be located in separate regions of the small ribosomal subunit that are important for domain-closure thought to take place during tRNA selection. Mechanistically, the process of tRNA selection is separated int...

  11. Transcription-independent role for human mitochondrial RNA polymerase in mitochondrial ribosome biogenesis

    Surovtseva, Yulia V; Shadel, Gerald S.

    2013-01-01

    Human mitochondrial RNA polymerase, POLRMT, is required for mitochondrial DNA (mtDNA) transcription and forms initiation complexes with human mitochondrial transcription factor B2 (h-mtTFB2). However, POLRMT also interacts with the paralogue of h-mtTFB2, h-mtTFB1, which is a 12S ribosomal RNA methyltransferase required for small (28S) mitochondrial ribosome subunit assembly. Herein, we show that POLRMT associates with h-mtTFB1 in 28S mitochondrial ribosome complexes that are stable in the abs...

  12. YccW is the m5C methyltransferase specific for 23S rRNA nucleotide 1962

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M;

    2008-01-01

    . However, YccW does not methylate assembled 50S subunits, and this is somewhat surprising as the published crystal structures show nucleotide C1962 to be fully accessible at the subunit interface. YccW-directed methylation at nucleotide C1962 is conserved in bacteria, and loss of this methylation in E....... coli marginally reduces its growth rate. YccW had previously eluded identification because it displays only limited sequence similarity to the m(5)C methyltransferases RsmB and RsmF and is in fact more similar to known m(5)U (5-methyluridine) RNA methyltransferases. In keeping with the previously...... proposed nomenclature system for bacterial rRNA methyltransferases, yccW is now designated as the rRNA large subunit methyltransferase gene rlmI....

  13. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  14. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  15. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    Bavykin, Sergei G.; Mirzabekov, Andrei D.

    2007-10-30

    The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  16. RNA-DNA differences in human mitochondria restore ancestral form of 16S ribosomal RNA.

    Bar-Yaacov, Dan; Avital, Gal; Levin, Liron; Richards, Allison L; Hachen, Naomi; Rebolledo Jaramillo, Boris; Nekrutenko, Anton; Zarivach, Raz; Mishmar, Dan

    2013-11-01

    RNA transcripts are generally identical to the underlying DNA sequences. Nevertheless, RNA-DNA differences (RDDs) were found in the nuclear human genome and in plants and animals but not in human mitochondria. Here, by deep sequencing of human mitochondrial DNA (mtDNA) and RNA, we identified three RDD sites at mtDNA positions 295 (C-to-U), 13710 (A-to-U, A-to-G), and 2617 (A-to-U, A-to-G). Position 2617, within the 16S rRNA, harbored the most prevalent RDDs (>30% A-to-U and ∼15% A-to-G of the reads in all tested samples). The 2617 RDDs appeared already at the precursor polycistrone mitochondrial transcript. By using traditional Sanger sequencing, we identified the A-to-U RDD in six different cell lines and representative primates (Gorilla gorilla, Pongo pigmaeus, and Macaca mulatta), suggesting conservation of the mechanism generating such RDD. Phylogenetic analysis of more than 1700 vertebrate mtDNA sequences supported a thymine as the primate ancestral allele at position 2617, suggesting that the 2617 RDD recapitulates the ancestral 16S rRNA. Modeling U or G (the RDDs) at position 2617 stabilized the large ribosomal subunit structure in contrast to destabilization by an A (the pre-RDDs). Hence, these mitochondrial RDDs are likely functional. PMID:23913925

  17. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A; Gwerder, Myriam; Gutsche, Katrin; Altmeyer, Matthias; Jungmichel, Stephanie; Toledo Lazaro, Luis Ignacio; Fink, Daniel; Rask, Maj-Britt; Grøfte, Merete; Lukas, Claudia; Nielsen, Michael L; Smerdon, Stephen J; Lukas, Jiri; Stucki, Manuel

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient recrui...

  18. Ribosome-associated Asc1/RACK1 is required for endonucleolytic cleavage induced by stalled ribosome at the 3′ end of nonstop mRNA

    Ikeuchi, Ken; Inada, Toshifumi

    2016-01-01

    Dom34-Hbs1 stimulates degradation of aberrant mRNAs lacking termination codons by dissociating ribosomes stalled at the 3′ ends, and plays crucial roles in Nonstop Decay (NSD) and No-Go Decay (NGD). In the dom34Δ mutant, nonstop mRNA is degraded by sequential endonucleolytic cleavages induced by a stalled ribosome at the 3′ end. Here, we report that ribosome-associated Asc1/RACK1 is required for the endonucleolytic cleavage of nonstop mRNA by stalled ribosome at the 3′ end of mRNA in dom34Δ mutant cells. Asc1/RACK1 facilitates degradation of truncated GFP-Rz mRNA in the absence of Dom34 and exosome-dependent decay. Asc1/RACK1 is required for the sequential endonucleolytic cleavages by the stalled ribosome in the dom34Δ mutant, depending on its ribosome-binding activity. The levels of peptidyl-tRNA derived from nonstop mRNA were elevated in dom34Δasc1Δ mutant cells, and overproduction of nonstop mRNA inhibited growth of mutant cells. E3 ubiquitin ligase Ltn1 degrades the arrest products from truncated GFP-Rz mRNA in dom34Δ and dom34Δasc1Δ mutant cells, and Asc1/RACK1 represses the levels of substrates for Ltn1-dependent degradation. These indicate that ribosome-associated Asc1/RACK1 facilitates endonucleolytic cleavage of nonstop mRNA by stalled ribosomes and represses the levels of aberrant products even in the absence of Dom34. We propose that Asc1/RACK1 acts as a fail-safe in quality control for nonstop mRNA. PMID:27312062

  19. Disruption of ribosome assembly in yeast blocks cotranscriptional pre-rRNA processing and affects the global hierarchy of ribosome biogenesis.

    Talkish, Jason; Biedka, Stephanie; Jakovljevic, Jelena; Zhang, Jingyu; Tang, Lan; Strahler, John R; Andrews, Philip C; Maddock, Janine R; Woolford, John L

    2016-06-01

    In higher eukaryotes, pre-rRNA processing occurs almost exclusively post-transcriptionally. This is not the case in rapidly dividing yeast, as the majority of nascent pre-rRNAs are processed cotranscriptionally, with cleavage at the A2 site first releasing a pre-40S ribosomal subunit followed by release of a pre-60S ribosomal subunit upon transcription termination. Ribosome assembly is driven in part by hierarchical association of assembly factors and r-proteins. Groups of proteins are thought to associate with pre-ribosomes cotranscriptionally during early assembly steps, whereas others associate later, after transcription is completed. Here we describe a previously uncharacterized phenotype observed upon disruption of ribosome assembly, in which normally late-binding proteins associate earlier, with pre-ribosomes containing 35S pre-rRNA. As previously observed by many other groups, we show that disruption of 60S subunit biogenesis results in increased amounts of 35S pre-rRNA, suggesting that a greater fraction of pre-rRNAs are processed post-transcriptionally. Surprisingly, we found that early pre-ribosomes containing 35S pre-rRNA also contain proteins previously thought to only associate with pre-ribosomes after early pre-rRNA processing steps have separated maturation of the two subunits. We believe the shift to post-transcriptional processing is ultimately due to decreased cellular division upon disruption of ribosome assembly. When cells are grown under stress or to high density, a greater fraction of pre-rRNAs are processed post-transcriptionally and follow an alternative processing pathway. Together, these results affirm the principle that ribosome assembly occurs through different, parallel assembly pathways and suggest that there is a kinetic foot-race between the formation of protein binding sites and pre-rRNA processing events. PMID:27036125

  20. Accommodation of tmRNA-SmpB into stalled ribosomes: a cryo-EM study.

    Weis, Felix; Bron, Patrick; Rolland, Jean-Paul; Thomas, Daniel; Felden, Brice; Gillet, Reynald

    2010-02-01

    In eubacteria, translation of defective messenger RNAs (mRNAs) produces truncated polypeptides that stall on the ribosome. A quality control mechanism referred to as trans-translation is performed by transfer-messenger RNA (tmRNA), a specialized RNA acting as both a tRNA and an mRNA, associated with small protein B (SmpB). So far, a clear view of the structural movements of both the protein and RNA necessary to perform accommodation is still lacking. By using a construct containing the tRNA-like domain as well as the extended helix H2 of tmRNA, we present a cryo-electron microscopy study of the process of accommodation. The structure suggests how tmRNA and SmpB move into the ribosome decoding site after the release of EF-Tu.GDP. While two SmpB molecules are bound per ribosome in a preaccommodated state, our results show that during accommodation the SmpB protein interacting with the small subunit decoding site stays in place while the one interacting with the large subunit moves away. Relative to canonical translation, an additional movement is observed due to the rotation of H2. This suggests that the larger movement required to resume translation on a tmRNA internal open reading frame starts during accommodation. PMID:20038631

  1. Cyanobacterial ecotypes in different optical microenvironments of a 68 C hot spring mat community revealed by 16S-23S rRNA internal transcribed spacer region variation

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea;

    2003-01-01

    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynth......We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic...... distinct populations over the vertical interval. We were unable to identify patterns in genetic variation in Synechococcus 16S rRNA sequences that correlate with different vertically distributed populations. However, patterns of variation at the internal transcribed spacer locus separating 16S and 23S r...

  2. Research Techniques Made Simple: Bacterial 16S Ribosomal RNA Gene Sequencing in Cutaneous Research.

    Jo, Jay-Hyun; Kennedy, Elizabeth A; Kong, Heidi H

    2016-03-01

    Skin serves as a protective barrier and also harbors numerous microorganisms collectively comprising the skin microbiome. As a result of recent advances in sequencing (next-generation sequencing), our understanding of microbial communities on skin has advanced substantially. In particular, the 16S ribosomal RNA gene sequencing technique has played an important role in efforts to identify the global communities of bacteria in healthy individuals and patients with various disorders in multiple topographical regions over the skin surface. Here, we describe basic principles, study design, and a workflow of 16S ribosomal RNA gene sequencing methodology, primarily for investigators who are not familiar with this approach. This article will also discuss some applications and challenges of 16S ribosomal RNA sequencing as well as directions for future development. PMID:26902128

  3. Mutations in the leader region of ribosomal RNA operons cause structurally defective 30 S ribosomes as revealed by in vivo structural probing.

    Balzer, M; Wagner, R

    1998-02-27

    The biogenesis of functional ribosomes is regulated in a very complex manner, involving different proteins and RNA molecules. RNAs are not only essential components of both ribosomal subunits but also transiently interacting factors during particle formation. In eukaryotes snoRNAs act as molecular chaperones to assist maturation, modification and assembly. In a very similar way highly conserved leader sequences of bacterial rRNA operons are involved in the correct formation of 30 S ribosomal subunits. Certain mutations in the rRNA leader region cause severe growth defects due to malfunction of ribosomes which are assembled from such transcription units. To understand how the leader sequences act to facilitate the formation of the correct 30 S subunits we performed in vivo chemical probing to assess structural differences between ribosomes assembled either from rRNA transcribed from wild-type operons or from operons which contain mutations in the rRNA leader region. Cells transformed with plasmids containing the respective rRNA operons were reacted with dimethylsulphate (DMS). Ribosomes were isolated by sucrose gradient centrifugation and modified nucleotides within the 16 S rRNA were identified by primer extension reaction. Structural differences between ribosomes from wild-type and mutant rRNA operons occur in several clusters within the 16 S rRNA secondary structure. The most prominent differences are located in the central domain including the universally conserved pseudoknot structure which connects the 5', the central and the 3' domain of 16 S rRNA. Two other clusters with structural differences fall in the 5' domain where the leader had been shown to interact with mature 16 S rRNA and within the ribosomal protein S4 binding site. The other differences in structure are located in sites which are also known as sites for the action of several antibiotics. The data explain the functional defects of ribosomes from rRNA operons with leader mutations and help to

  4. A Long Noncoding RNA on the Ribosome Is Required for Lifespan Extension

    Paul B. Essers

    2015-01-01

    Full Text Available The biogenesis of ribosomes and their coordination of protein translation consume an enormous amount of cellular energy. As such, it has been established that the inhibition of either process can extend eukaryotic lifespan. Here, we used next-generation sequencing to compare ribosome-associated RNAs from normal strains of Caenorhabditis elegans to those carrying the life-extending daf-2 mutation. We found a long noncoding RNA (lncRNA, transcribed telomeric sequence 1 (tts-1, on ribosomes of the daf-2 mutant. Depleting tts-1 in daf-2 mutants increases ribosome levels and significantly shortens their extended lifespan. We find tts-1 is also required for the longer lifespan of the mitochondrial clk-1 mutants but not the feeding-defective eat-2 mutants. In line with this, the clk-1 mutants express more tts-1 and fewer ribosomes than the eat-2 mutants. Our results suggest that the expression of tts-1 functions in different longevity pathways to reduce ribosome levels in a way that promotes life extension.

  5. Early life stress inhibits expression of ribosomal RNA in the developing hippocampus.

    Lan Wei

    Full Text Available Children that are exposed to abuse or neglect show abnormal hippocampal function. However, the developmental mechanisms by which early life stress (ELS impairs normal hippocampal development have not been elucidated. Here we propose that exposure to ELS blunts normal hippocampal growth by inhibiting the availability of ribosomal RNA (rRNA. In support of this hypothesis, we show that the normal mouse hippocampus undergoes a growth-spurt during the second week of life, followed by a gradual decrease in DNA and RNA content that persists into adulthood. This developmental pattern is associated with accelerated ribosomal RNA (rRNA synthesis during the second week of life, followed by a gradual decline in rRNA levels that continue into adulthood. Levels of DNA methylation at the ribosomal DNA (rDNA promoter are lower during the second week of life compared to earlier development or adulthood. Exposure to brief daily separation (BDS, a mouse model of early life stress, increased DNA methylation at the ribosomal DNA promoter, decreased rRNA levels, and blunted hippocampal growth during the second week of life. Exposure to acute (3 hrs maternal separation decreased rRNA and increased DNA methylation at the rDNA proximal promoter, suggesting that exposure to stress early in life can rapidly regulate the availability of rRNA levels in the developing hippocampus. Given the critical role that rRNA plays in supporting normal growth and development, these findings suggest a novel molecular mechanism to explain how stress early in life impairs hippocampus development in the mouse.

  6. Ribosome collisions and translation efficiency: optimization by codon usage and mRNA destabilization.

    Mitarai, Namiko; Sneppen, Kim; Pedersen, Steen

    2008-09-26

    Individual mRNAs are translated by multiple ribosomes that initiate translation with an interval of a few seconds. The ribosome speed is codon dependent, and ribosome queuing has been suggested to explain specific data for translation of some mRNAs in vivo. By modeling the stochastic translation process as a traffic problem, we here analyze conditions and consequences of collisions and queuing. The model allowed us to determine the on-rate (0.8 to 1.1 initiations/s) and the time (1 s) the preceding ribosome occludes initiation for Escherichia coli lacZ mRNA in vivo. We find that ribosome collisions and queues are inevitable consequences of a stochastic translation mechanism that reduce the translation efficiency substantially on natural mRNAs. The cells minimize collisions by having its mRNAs being unstable and by a highly selected codon usage in the start of the mRNA. The cost of mRNA breakdown is offset by the concomitant increase in translation efficiency. PMID:18619977

  7. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Michelle S Lewis

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  8. YbeA is the m3Psi methyltransferase RlmH that targets nucleotide 1915 in 23S rRNA

    Purta, Elzbieta; Kaminska, Katarzyna H; Kasprzak, Joanna M;

    2008-01-01

    Pseudouridines in the stable RNAs of Bacteria are seldom subjected to further modification. There are 11 pseudouridine (Psi) sites in Escherichia coli rRNA, and further modification is found only at Psi1915 in 23S rRNA, where the N-3 position of the base becomes methylated. Here, we report the...... identity of the E. coli methyltransferase that specifically catalyzes methyl group addition to form m(3)Psi1915. Analyses of E. coli rRNAs using MALDI mass spectrometry showed that inactivation of the ybeA gene leads to loss of methylation at nucleotide Psi1915. Methylation is restored by complementing the...... knockout strain with a plasmid-encoded copy of ybeA. Homologs of the ybeA gene, and thus presumably the ensuing methylation at nucleotide m(3)Psi1915, are present in most bacterial lineages but are essentially absent in the Archaea and Eukaryota. Loss of ybeA function in E. coli causes a slight slowing of...

  9. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  10. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling

    Jones, Joshua D.; Chung, Betty Y.-W.; Siddell, Stuart G.; Brierley, Ian

    2016-01-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global “snap-shot” of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  11. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  12. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Hori, H.; Osawa, S; Murao, K.; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.

  13. An unusual mechanism for EF-Tu activation during tmRNA-mediated ribosome rescue

    Miller, Mickey R; Buskirk, Allen R.

    2014-01-01

    When ribosomes are stalled on truncated mRNAs in prokaryotes, they are rescued by the tmRNA/SmpB complex. It has been unclear how EF-Tu is activated by this complex. This manuscript analyzes this problem, and the results indicate that the normal EF-Tu GTPase cycle does not appear to apply in this specialized situation.

  14. Competing pathways control host resistance to virus via tRNA modification and programmed ribosomal frameshifting

    Maynard, Nathaniel D.; Macklin, Derek N.; Kirkegaard, Karla; Covert, Markus W

    2012-01-01

    Viral infection depends on a complex interplay between host and viral factors. Here, we link host susceptibility to viral infection to a network encompassing sulfur metabolism, tRNA modification, competitive binding, and programmed ribosomal frameshifting (PRF). We first demonstrate that the iron-sulfur cluster biosynthesis pathway in Escherichia coli exerts a protective effect during lambda phage infection, while a tRNA thiolation pathway enhances viral infection. We show that tRNALys uridin...

  15. The human insulin receptor mRNA contains a functional internal ribosome entry segment

    Spriggs, Keith A.; Cobbold, Laura C.; Ridley, Simon H.; Coldwell, Mark; Bottley, Andrew; Bushell, Martin; Willis, Anne E.; Siddle, Kenneth

    2009-01-01

    Regulation of mRNA translation is an important mechanism determining the level of expression of proteins in eukaryotic cells. Translation is most commonly initiated by cap-dependent scanning, but many eukaryotic mRNAs contain internal ribosome entry segments (IRESs), providing an alternative means of initiation capable of independent regulation. Here, we show by using dicistronic luciferase reporter vectors that the 5'-UTR of the mRNA encoding human insulin receptor (hIR) contains a functiona...

  16. RNA structure-based ribosome recruitment: Lessons from the Dicistroviridae intergenic region IRESes

    Pfingsten, Jennifer S; Kieft, Jeffrey S.

    2008-01-01

    In eukaryotes, the canonical process of initiating protein synthesis on an mRNA depends on many large protein factors and the modified nucleotide cap on the 5′ end of the mRNA. However, certain RNA sequences can bypass the need for these proteins and cap, using an RNA structure-based mechanism called internal initiation of translation. These RNAs are called internal ribosome entry sites (IRESes), and the cap-independent initiation pathway they support is critical for successful infection by m...

  17. RNA structure-based ribosome recruitment: lessons from the Dicistroviridae intergenic region IRESes.

    Pfingsten, Jennifer S; Kieft, Jeffrey S

    2008-07-01

    In eukaryotes, the canonical process of initiating protein synthesis on an mRNA depends on many large protein factors and the modified nucleotide cap on the 5' end of the mRNA. However, certain RNA sequences can bypass the need for these proteins and cap, using an RNA structure-based mechanism called internal initiation of translation. These RNAs are called internal ribosome entry sites (IRESes), and the cap-independent initiation pathway they support is critical for successful infection by many viruses of medical and economic importance. In this review, we briefly describe and compare mechanistic and structural groups of viral IRES RNAs, focusing on those IRESes that are capable of direct ribosome recruitment using specific RNA structures. We then discuss in greater detail some recent advances in our understanding of the intergenic region IRESes of the Dicistroviridae, which use the most streamlined ribosome-recruitment mechanism yet discovered. By combining these findings with knowledge of canonical translation and the behavior of other IRESes, mechanistic models of this RNA structure-based process are emerging. PMID:18515544

  18. Can we estimate bacterial growth rates from ribosomal RNA content?

    Kemp, P.F.

    1995-12-31

    Several studies have demonstrated a strong relationship between the quantity of RNA in bacterial cells and their growth rate under laboratory conditions. It may be possible to use this relationship to provide information on the activity of natural bacterial communities, and in particular on growth rate. However, if this approach is to provide reliably interpretable information, the relationship between RNA content and growth rate must be well-understood. In particular, a requisite of such applications is that the relationship must be universal among bacteria, or alternately that the relationship can be determined and measured for specific bacterial taxa. The RNA-growth rate relationship has not been used to evaluate bacterial growth in field studies, although RNA content has been measured in single cells and in bulk extracts of field samples taken from coastal environments. These measurements have been treated as probable indicators of bacterial activity, but have not yet been interpreted as estimators of growth rate. The primary obstacle to such interpretations is a lack of information on biological and environmental factors that affect the RNA-growth rate relationship. In this paper, the available data on the RNA-growth rate relationship in bacteria will be reviewed, including hypotheses regarding the regulation of RNA synthesis and degradation as a function of growth rate and environmental factors; i.e. the basic mechanisms for maintaining RNA content in proportion to growth rate. An assessment of the published laboratory and field data, the current status of this research area, and some of the remaining questions will be presented.

  19. Identification and phyletic evolution analysis of Proteus mirabilis strains by PCR and restriction fragment length polymorphism of 16S-23S rRNA gene intergenic spacer region%16S-23S rRNA基因间隔序列PCR及RFLP对奇异变形杆菌分离株的鉴别与系统发育分析

    崔国林; 朱瑞良; 左雪梅; 钟世勋; 杨世发; 梁漫飞; 孙婧; 刘静静

    2013-01-01

    根据临床常见致病菌16S-23S rRNA基因间隔序列(ISR)两端的16S及23S rRNA保守序列设计PCR扩增的通用引物,对9株奇异变形杆菌和6株相近菌株应用通用引物PCR扩增16S-23S rRNA ISR序列.通过PCR长度多态性比较、RFLP分析以及部分序列测序比较,分析鉴别奇异变形杆菌.结果显示,PCR长度多态性可以将奇异变形杆菌同其余菌种进行区分;RFLP分析可以将所有试验菌种进行区分;部分序列测序可以对奇异变形杆菌进行分型.由此表明,16S 23S rRNA ISR序列PCR及RFLP分析可以简单、快速、准确的鉴定奇异变形杆菌.%To establish a new method to identify Proteus mirabilis strains, according to the conserved sequences of 16S and 23S which located on both ends of the clinical common pathogenic bacteria 16S-23S rRNA gene intergenic spacer region (ISR),a pair of universal primers was designed. Nine Proteus mirabilis strains and six similar bacteria strains were amplified by PCR and identified by the PCR length polymorphism comparison,restriction fragment length polymorphism (RFLP) analysis and partial sequences sequencing. The result showed that Proteus mirabilis strains could be discriminated from other similar bacteria strains by PCR length polymorphism comparison,all of test organism could be discriminated by RFLP and Proteus mirabilis strains could be typed by partial sequences sequencing. The result indicated that the identification method based on the 16S-23S rRNA ISR, using PCR and PCR-RFLP,is very suitable for the rapid low-cost identification and discrimination of Proteus mirabilis strains from other phylogenetically related bacteria strains.

  20. RNase II is important for A-site mRNA cleavage during ribosome pausing

    Garza-Sánchez, Fernando; Shoji, Shinichiro; Fredrick, Kurt; Hayes, Christopher S.

    2009-01-01

    In Escherichia coli, translational arrest can elicit cleavage of codons within the ribosomal A site. This A-site mRNA cleavage is independent of RelE, and has been proposed to be an endonucleolytic activity of the ribosome. Here, we show that the 3′→5′ exonuclease RNase II plays an important role in RelE-independent A-site cleavage. Instead of A-site cleavage, translational pausing in ΔRNase II cells produces transcripts that are truncated +12 and +28 nucleotides downstream of the A-site codo...

  1. Validation of two ribosomal RNA removal methods for microbial metatranscriptomics

    He, Shaomei; Wurtzel, Omri; Singh, Kanwar; Froula, Jeff L; Yilmaz, Suzan; Tringe, Susannah G; Wang, Zhong; Chen, Feng; Lindquist, Erika A; Sorek, Rotem; Hugenholtz, Philip

    2010-10-01

    The predominance of rRNAs in the transcriptome is a major technical challenge in sequence-based analysis of cDNAs from microbial isolates and communities. Several approaches have been applied to deplete rRNAs from (meta)transcriptomes, but no systematic investigation of potential biases introduced by any of these approaches has been reported. Here we validated the effectiveness and fidelity of the two most commonly used approaches, subtractive hybridization and exonuclease digestion, as well as combinations of these treatments, on two synthetic five-microorganism metatranscriptomes using massively parallel sequencing. We found that the effectiveness of rRNA removal was a function of community composition and RNA integrity for these treatments. Subtractive hybridization alone introduced the least bias in relative transcript abundance, whereas exonuclease and in particular combined treatments greatly compromised mRNA abundance fidelity. Illumina sequencing itself also can compromise quantitative data analysis by introducing a G+C bias between runs.

  2. Reconstruction of ribosomal RNA genes from metagenomic data.

    Lu Fan

    Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.

  3. Nutritional and growth control of ribosomal protein mRNA and rRNA in Neurospora crassa.

    Cujec, T P; Tyler, B M

    1996-01-01

    The effects of changing growth rates on the levels of 40S pre-rRNA and two r-protein mRNAs were examined to gain insight into the coordinate transcriptional regulation of ribosomal genes in the ascomycete fungus Neurospora crassa. Growth rates were varied either by altering carbon nutritional conditions, or by subjecting the isolates to inositol-limiting conditions. During carbon up- or down-shifts, r-protein mRNA levels were stoichiometrically coordinated. Changes in 40S pre-rRNA levels para...

  4. [Precursors of ribosomal RNA in freely suspended callus cells of parsley (Petroselinum sativum)].

    Richter, G

    1973-03-01

    Six high molecular weight, rapidly labelled RNA species were detected in freely suspended callus cells of Petroselinum sativum by means of isotope labelling and electrophoretic separation in agarose-polyacrylamide gels. On the basis of their migration in the latter the RNA species were calculated to have the following molecular weights: 2.9×10(6), 2,4×10(6), 1.9×10(6), 1.4×10(6), 1.0×10(6) and 0.75×10(6) daltons. Thus they can clearly be distinguished from the two ribosomal RNA species (1.3×10(6) and 0.7×10(6) daltons). During incubation of the cells with [(3)H]methyl-methionine as a methyl donator all six components incorporated radioactivity rapidly. With [(3)H]nucleosides or [(3)H]orotic acid as precursors the 2.9×10(6) and the 2.4×10(6) daltons RNA were labelled within 10 min, while the other high molecular weight species appeared after about 20 min of labelling.Prolongation to 45-120 min resulted in accumulation of radioactivity preferentially in the 1.4×10(6) and 0.75×10(6) daltons RNA and in the ribosomal RNA species. The results of cell fractionation experiments provide evidence that these rapidly labelled high molecular weight RNA species are synthesized in the cell nucleus. The kinetics of their synthesis together with the other data obtained strongly support the suggestion that these RNA species function as precursors in the processing of ribosomal RNA. The possible mechanism of this process is discussed. PMID:24468848

  5. Unusual transcription termination of the ribosomal RNA genes in Ascaris lumbricoides.

    Müller, E; Neuhaus, H; Tobler, H; Müller, F.

    1990-01-01

    We studied termination of transcription of the ribosomal RNA genes in Ascaris lumbricoides, the first representative in the phylum of nemathelminthes analysed so far. RNase protection experiments in vivo reveal that the 3' end of the precursor rRNA coincides with the end of mature 26S rRNA. Promoter-containing miniplasmids are able to direct unique 3' end formation in vitro at a site identical to that observed in vivo, whereas deletion of these sequences abolishes 3' end formation throughout ...

  6. Ribosomal RNA gene sequences confirm that protistan endoparasite of larval cod Gadus morhua is Ichthyodinium sp

    Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne; Støttrup, Josianne; Buchmann, Kurt

    2010-01-01

    An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested to be...... related to Ichthyodinium chabelardi, a dinoflagellate-like protist that parasitizes yolk sacs of embryos and larvae of a variety of fish species. Comparison of a 1535 bp long fragment of the SSU rRNA gene of the cod endoparasite showed absolute identify with I. chabelardi, demonstrating that the 2...

  7. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Milbury Coren A

    2010-09-01

    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  8. An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

    Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

    1993-01-01

    The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

  9. Structure and Function of the Ribosomal Frameshifting Pseudoknot RNA from Beet Western Yellow Virus

    Egli, M.; Sarkhel, S.; Minasov, G.; Rich, A.

    2010-03-05

    Many viruses reprogram ribosomes to produce two different proteins from two different reading frames. So-called -1 frameshifting often involves pairwise alignment of two adjacent tRNAs at a 'slippery' sequence in the ribosomal A and P sites such that an overlapping codon is shifted upstream by one base relative to the zero frame. In the majority of cases, an RNA pseudoknot located downstream stimulates this type of frameshift. Crystal structures of the frameshifting RNA pseudoknot from Beet Western Yellow Virus (BWYV) have provided a detailed picture of the tertiary interactions stabilizing this folding motif, including a minor-groove triplex and quadruple-base interactions. The structure determined at atomic resolution revealed the locations of several magnesium ions and provided insights into the role of structured water stabilizing the RNA. Systematic in vitro and in vivo mutational analyses based on the structural results revealed specific tertiary interactions and regions in the pseudoknot that drastically change frameshifting efficiency. Here, we summarize recent advances in our understanding of pseudoknot-mediated ribosomal frameshifting on the basis of the insights gained from structural and functional studies of the RNA pseudoknot from BWYV.

  10. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    Recht, M I; Douthwaite, S; Dahlquist, K D;

    1999-01-01

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  11. Reduced expression of ribosomal proteins relieves microRNA-mediated repression.

    Janas, Maja M; Wang, Eric; Love, Tara; Harris, Abigail S; Stevenson, Kristen; Semmelmann, Karlheinz; Shaffer, Jonathan M; Chen, Po-Hao; Doench, John G; Yerramilli, Subrahmanyam V B K; Neuberg, Donna S; Iliopoulos, Dimitrios; Housman, David E; Burge, Christopher B; Novina, Carl D

    2012-04-27

    MicroRNAs (miRNAs) regulate physiological and pathological processes by inducing posttranscriptional repression of target messenger RNAs (mRNAs) via incompletely understood mechanisms. To discover factors required for human miRNA activity, we performed an RNAi screen using a reporter cell line of miRNA-mediated repression of translation initiation. We report that reduced expression of ribosomal protein genes (RPGs) dissociated miRNA complexes from target mRNAs, leading to increased polysome association, translation, and stability of miRNA-targeted mRNAs relative to untargeted mRNAs. RNA sequencing of polysomes indicated substantial overlap in sets of genes exhibiting increased or decreased polysomal association after Argonaute or RPG knockdowns, suggesting similarity in affected pathways. miRNA profiling of monosomes and polysomes demonstrated that miRNAs cosediment with ribosomes. RPG knockdowns decreased miRNAs in monosomes and increased their target mRNAs in polysomes. Our data show that most miRNAs repress translation and that the levels of RPGs modulate miRNA-mediated repression of translation initiation. PMID:22541556

  12. Protein-RNA cross-linking in the ribosomes of yeast under oxidative stress.

    Mirzaei, Hamid; Regnier, Fred

    2006-12-01

    Living systems have efficient degradative pathways for dealing with the fact that reactive oxygen species (ROS) derived from cellular metabolism and the environment oxidatively damage proteins and DNA. But aggregation and cross-linking can occur as well, leading to a series of problems including disruption of cellular regulation, mutations, and even cell death. The mechanism(s) by which protein aggregation occurs and the macromolecular species involved are poorly understood. In the study reported here, evidence is provided for a new type of aggregate between proteins and RNA in ribosomes. While studying the effect of oxidative stress induced in the yeast proteome it was noted that ribosomal proteins were widely oxidized. Eighty six percent of the proteins in yeast ribosomes were found to be carbonylated after stressing yeast cell cultures with hydrogen peroxide. Moreover, many of these proteins appeared to be cross-linked based on their coelution patterns during RPC separation. Since they were not in direct contact, it was not clear how this could occur unless it was through the RNA separating them in the ribosome. This was confirmed in a multiple-step process, the first being derivatization of all carbonylated proteins in cell lysates with biotin hydrazide through Schiff base formation. Following reduction of Schiff bases with sodium cyanoborohydride, biotinylated proteins were selected from cell lysates with avidin affinity chromatography. Oxidized proteins thus captured were then selected again using boronate affinity chromatography to capture vicinal diol-containing proteins. This would include proteins cross-linked to an RNA fragment containing a ribose residue with 2',3'-hydroxyl groups. Some glycoproteins would also be selected by this process. LC/MS/MS analyses of tryptic peptides derived from proteins captured by this process along with MASCOT searches resulted in the identification of 37 ribosomal proteins that appear to be cross-linked to RNA

  13. Relationships between 16S-23S rRNA gene internal transcribed spacer DNA and genomic DNA similarities in the taxonomy of phototrophic bacteria

    Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.

  14. A pathogenic non-coding RNA induces changes in dynamic DNA methylation of ribosomal RNA genes in host plants.

    Martinez, German; Castellano, Mayte; Tortosa, Maria; Pallas, Vicente; Gomez, Gustavo

    2014-02-01

    Viroids are plant-pathogenic non-coding RNAs able to interfere with as yet poorly known host-regulatory pathways and to cause alterations recognized as diseases. The way in which these RNAs coerce the host to express symptoms remains to be totally deciphered. In recent years, diverse studies have proposed a close interplay between viroid-induced pathogenesis and RNA silencing, supporting the belief that viroid-derived small RNAs mediate the post-transcriptional cleavage of endogenous mRNAs by acting as elicitors of symptoms expression. Although the evidence supporting the role of viroid-derived small RNAs in pathogenesis is robust, the possibility that this phenomenon can be a more complex process, also involving viroid-induced alterations in plant gene expression at transcriptional levels, has been considered. Here we show that plants infected with the 'Hop stunt viroid' accumulate high levels of sRNAs derived from ribosomal transcripts. This effect was correlated with an increase in the transcription of ribosomal RNA (rRNA) precursors during infection. We observed that the transcriptional reactivation of rRNA genes correlates with a modification of DNA methylation in their promoter region and revealed that some rRNA genes are demethylated and transcriptionally reactivated during infection. This study reports a previously unknown mechanism associated with viroid (or any other pathogenic RNA) infection in plants providing new insights into aspects of host alterations induced by the viroid infectious cycle. PMID:24178032

  15. Quantitative studies of mRNA recruitment to the eukaryotic ribosome.

    Fraser, Christopher S

    2015-07-01

    The process of peptide bond synthesis by ribosomes is conserved between species, but the initiation step differs greatly between the three kingdoms of life. This is illustrated by the evolution of roughly an order of magnitude more initiation factor mass found in humans compared with bacteria. Eukaryotic initiation of translation is comprised of a number of sub-steps: (i) recruitment of an mRNA and initiator methionyl-tRNA to the 40S ribosomal subunit; (ii) migration of the 40S subunit along the 5' UTR to locate the initiation codon; and (iii) recruitment of the 60S subunit to form the 80S initiation complex. Although the mechanism and regulation of initiation has been studied for decades, many aspects of the pathway remain unclear. In this review, I will focus discussion on what is known about the mechanism of mRNA selection and its recruitment to the 40S subunit. I will summarize how the 43S preinitiation complex (PIC) is formed and stabilized by interactions between its components. I will discuss what is known about the mechanism of mRNA selection by the eukaryotic initiation factor 4F (eIF4F) complex and how the selected mRNA is recruited to the 43S PIC. The regulation of this process by secondary structure located in the 5' UTR of an mRNA will also be discussed. Finally, I present a possible kinetic model with which to explain the process of mRNA selection and recruitment to the eukaryotic ribosome. PMID:25742741

  16. Possible genetic consequences of epigenetic interactions between ribosomal RNA loci in Nicotiana allopolyploids

    Kovařík, Aleš; Nešpor Dadejová, Martina; Lim, K.Y.; Součková Skalická, Kamila; Matyášek, Roman; Grandbastien, M.-A.; Leitch, A.

    Clermont-Ferrand, 2007. s. 1-1. [Réunion du Groupe de travail Cytogénétique & Polyploidie du DGAP. 18.04.2007-20.04.2007, Clermont-Ferrand] R&D Projects: GA ČR(CZ) GA521/07/0116; GA ČR(CZ) GA204/05/0687 Institutional research plan: CEZ:AV0Z50040507 Keywords : allopolyploidy * epigenetic silencing * ribosomal RNA gene Subject RIV: BO - Biophysics

  17. Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

    Patrick O McGowan

    Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.

  18. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region.

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko; Lo Svenningsen, Sine; Sneppen, Kim; Pedersen, Steen

    2011-03-18

    Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described. Here, we characterize a determinant of the functional stability of an mRNA, which is located in the early coding region. Using literature values for the mRNA half-lives of variant lacZ mRNAs in Escherichia coli, we modeled how the ribosome spacing is affected by the translation rate of the individual codons. When comparing the ribosome spacing at various segments of the mRNA to its functional half-life, we found a clear correlation between the functional mRNA half-life and the ribosome spacing in the mRNA region approximately between codon 20 and codon 45. From this finding, we predicted that inserts of slowly translated codons before codon 20 or after codon 45 should shorten or prolong, respectively, the functional mRNA half-life by altering the ribosome density in the important region. These predictions were tested on eight new lacZ variants, and their experimentally determined mRNA half-lives all supported the model. We thus suggest that translation-rate-mediated differences in the spacing between ribosomes in this early coding region is a parameter that determines the mRNAs functional half-life. We present a model that is in accordance with many earlier observations and that allows a prediction of the functional half-life of a given mRNA sequence. PMID:21255584

  19. Phylogenetic relationships of the green alga Volvox carteri deduced from small-subunit ribosomal RNA comparisons.

    Rausch, H; Larsen, N; Schmitt, R

    1989-09-01

    The 1788-nucleotide sequence of the small-subunit ribosomal RNA (srRNA) coding region from the chlorophyte Volvox carteri was determined. The secondary structure bears features typical of the universal model of srRNA, including about 40 helices and a division into four domains. Phylogenetic relationships to 17 other eukaryotes, including two other chlorophytes, were explored by comparing srRNA sequences. Similarity values and the inspection of phylogenetic trees derived by distance matrix methods revealed a close relationship between V. carteri and Chlamydomonas reinhardtii. The results are consistent with the view that these Volvocales, and the third green alga, Nanochlorum eucaryotum, are more closely related to higher plants than to any other major eukaryotic group, but constitute a distinct lineage that has long been separated from the line leading to the higher plants. PMID:2506359

  20. Ribosomal pausing at a frameshifter RNA pseudoknot is sensitive to reading phase but shows little correlation with frameshift efficiency.

    Kontos, H; Napthine, S; Brierley, I

    2001-12-01

    Here we investigated ribosomal pausing at sites of programmed -1 ribosomal frameshifting, using translational elongation and ribosome heelprint assays. The site of pausing at the frameshift signal of infectious bronchitis virus (IBV) was determined and was consistent with an RNA pseudoknot-induced pause that placed the ribosomal P- and A-sites over the slippery sequence. Similarly, pausing at the simian retrovirus 1 gag/pol signal, which contains a different kind of frameshifter pseudoknot, also placed the ribosome over the slippery sequence, supporting a role for pausing in frameshifting. However, a simple correlation between pausing and frameshifting was lacking. Firstly, a stem-loop structure closely related to the IBV pseudoknot, although unable to stimulate efficient frameshifting, paused ribosomes to a similar extent and at the same place on the mRNA as a parental pseudoknot. Secondly, an identical pausing pattern was induced by two pseudoknots differing only by a single loop 2 nucleotide yet with different functionalities in frameshifting. The final observation arose from an assessment of the impact of reading phase on pausing. Given that ribosomes advance in triplet fashion, we tested whether the reading frame in which ribosomes encounter an RNA structure (the reading phase) would influence pausing. We found that the reading phase did influence pausing but unexpectedly, the mRNA with the pseudoknot in the phase which gave the least pausing was found to promote frameshifting more efficiently than the other variants. Overall, these experiments support the view that pausing alone is insufficient to mediate frameshifting and additional events are required. The phase dependence of pausing may be indicative of an activity in the ribosome that requires an optimal contact with mRNA secondary structures for efficient unwinding. PMID:11713298

  1. Long PCR-RFLP of 16S-ITS-23S rRNA genes: a high-resolution molecular tool for bacterial genotyping

    Zeng, Yonghui; Koblížek, Michal; Li, Y. X.; Liu, Y. P.; Feng, F. Y.; Ji, J. D.; Jian, J. C.; Wu, Z. H.

    2013-01-01

    Roč. 114, č. 2 (2013), s. 433-447. ISSN 1364-5072 R&D Projects: GA MŠk(CZ) ED2.1.00/03.0110 Institutional support: RVO:61388971 Keywords : 16S-ITS-23S * bacterial genome * computer simulation Subject RIV: EE - Microbiology, Virology Impact factor: 2.386, year: 2013

  2. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko;

    2011-01-01

    codons. When comparing the ribosome spacing at various segments of the mRNA to its functional half-life, we found a clear correlation between the functional mRNA half-life and the ribosome spacing in the mRNA region approximately between codon 20 and codon 45. From this finding, we predicted that inserts......Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described....... Here, we characterize a determinant of the functional stability of an mRNA, which is located in the early coding region. Using literature values for the mRNA half-lives of variant lacZ mRNAs in Escherichia coli, we modeled how the ribosome spacing is affected by the translation rate of the individual...

  3. Human Ribosomal RNA-Derived Resident MicroRNAs as the Transmitter of Information upon the Cytoplasmic Cancer Stress

    2016-01-01

    Dysfunction of ribosome biogenesis induces divergent ribosome-related diseases including ribosomopathy and occasionally results in carcinogenesis. Although many defects in ribosome-related genes have been investigated, little is known about contribution of ribosomal RNA (rRNA) in ribosome-related disorders. Meanwhile, microRNA (miRNA), an important regulator of gene expression, is derived from both coding and noncoding region of the genome and is implicated in various diseases. Therefore, we performed in silico analyses using M-fold, TargetScan, GeneCoDia3, and so forth to investigate RNA relationships between rRNA and miRNA against cellular stresses. We have previously shown that miRNA synergism is significantly correlated with disease and the miRNA package is implicated in memory for diseases; therefore, quantum Dynamic Nexus Score (DNS) was also calculated using MESer program. As a result, seventeen RNA sequences identical with known miRNAs were detected in the human rRNA and termed as rRNA-hosted miRNA analogs (rmiRNAs). Eleven of them were predicted to form stem-loop structures as pre-miRNAs, and especially one stem-loop was completely identical with hsa-pre-miR-3678 located in the non-rDNA region. Thus, these rmiRNAs showed significantly high DNS values, participation in regulation of cancer-related pathways, and interaction with nucleolar RNAs, suggesting that rmiRNAs may be stress-responsible resident miRNAs which transmit stress-tuning information in multiple levels.

  4. Human Ribosomal RNA-Derived Resident MicroRNAs as the Transmitter of Information upon the Cytoplasmic Cancer Stress.

    Yoshikawa, Masaru; Fujii, Yoichi Robertus

    2016-01-01

    Dysfunction of ribosome biogenesis induces divergent ribosome-related diseases including ribosomopathy and occasionally results in carcinogenesis. Although many defects in ribosome-related genes have been investigated, little is known about contribution of ribosomal RNA (rRNA) in ribosome-related disorders. Meanwhile, microRNA (miRNA), an important regulator of gene expression, is derived from both coding and noncoding region of the genome and is implicated in various diseases. Therefore, we performed in silico analyses using M-fold, TargetScan, GeneCoDia3, and so forth to investigate RNA relationships between rRNA and miRNA against cellular stresses. We have previously shown that miRNA synergism is significantly correlated with disease and the miRNA package is implicated in memory for diseases; therefore, quantum Dynamic Nexus Score (DNS) was also calculated using MESer program. As a result, seventeen RNA sequences identical with known miRNAs were detected in the human rRNA and termed as rRNA-hosted miRNA analogs (rmiRNAs). Eleven of them were predicted to form stem-loop structures as pre-miRNAs, and especially one stem-loop was completely identical with hsa-pre-miR-3678 located in the non-rDNA region. Thus, these rmiRNAs showed significantly high DNS values, participation in regulation of cancer-related pathways, and interaction with nucleolar RNAs, suggesting that rmiRNAs may be stress-responsible resident miRNAs which transmit stress-tuning information in multiple levels. PMID:27517048

  5. Sequence and organization of 5S ribosomal RNA-encoding genes of Arabidopsis thaliana.

    Campell, B R; Song, Y; Posch, T E; Cullis, C A; Town, C D

    1992-03-15

    We have isolated a genomic clone containing Arabidopsis thaliana 5S ribosomal RNA (rRNA)-encoding genes (rDNA) by screening an A. thaliana library with a 5S rDNA probe from flax. The clone isolated contains seven repeat units of 497 bp, plus 11 kb of flanking genomic sequence at one border. Sequencing of individual subcloned repeat units shows that the sequence of the 5S rRNA coding region is very similar to that reported for other flowering plants. Four A. thaliana ecotypes were found to contain approx. 1000 copies of 5S rDNA per haploid genome. Southern-blot analysis of genomic DNA indicates that 5S rDNA occurs in long tandem arrays, and shows the presence of numerous restriction-site polymorphisms among the six ecotypes studied. PMID:1348233

  6. A rapid and simple pipeline for synthesis of mRNA-ribosome-V(H)H complexes used in single-domain antibody ribosome display.

    Bencurova, Elena; Pulzova, Lucia; Flachbartova, Zuzana; Bhide, Mangesh

    2015-06-01

    The single-domain antibody (VHH) is a promising building block for a number of antibody-based applications. Ribosome display can successfully be used in the production of VHH. However, the construction of the expression cassette, confirmation of the translation and proper folding of the nascent chain, and the purification of the ribosome complexes, remain cumbersome tasks. Additionally, selection of the most suitable expression system can be challenging. We have designed primers that will amplify virtually all Camelidae VHH. With the help of a double-overlap extension (OE) polymerase chain reaction (PCR) we have fused VHH with the F1 fragment (T7 promoter and species-independent translation sequence) and the F2 fragment (mCherry, Myc-tag, tether, SecM arrest sequence and 3' stem loop) to generate a full-length DNA cassette. OE-PCR generated fragments were incubated directly with cell-free lysates (Leishmania torentolae, rabbit reticulocyte or E. coli) for the synthesis of mRNA-VHH-mCherry-ribosome complexes in vitro. Alternatively, the cassette was ligated in pQE-30 vector and transformed into E. coli to produce ribosome complexes in vivo. The results showed that the same expression cassette could be used to synthesize ribosome complexes with different expression systems. mCherry reporter served to confirm the synthesis and proper folding of the nascent chain, Myc-tag was useful in the rapid purification of ribosome complexes, and combination of the SecM sequence and 3' stem loop made the cassette universal, both for cells-free and E. coli in vivo. This rapid and universal pipeline can effectively be used in antibody ribosome display and VHH production. PMID:25902394

  7. Mutations in conserved helix 69 of 23S rRNA of Thermus thermophilus that affect capreomycin resistance but not posttranscriptional modifications

    Monshupanee, Tanakarn; Gregory, Steven T; Douthwaite, Stephen; Chungjatupornchai, Wipa; Dahlberg, Albert E

    2008-01-01

    Translocation during the elongation phase of protein synthesis involves the relative movement of the 30S and 50S ribosomal subunits. This movement is the target of tuberactinomycin antibiotics. Here, we describe the isolation and characterization of mutants of Thermus thermophilus selected for...

  8. Epigenetic repression of ribosomal RNA transcription by ROCK-dependent aberrant cytoskeletal organization

    Wu, Tse-Hsiang; Kuo, Yuan-Yeh; Lee, Hsiao-Hui; Kuo, Jean-Cheng; Ou, Meng-Hsin; Chang, Zee-Fen

    2016-01-01

    It is known that ribosomal RNA (rRNA) synthesis is regulated by cellular energy and proliferation status. In this study, we investigated rRNA gene transcription in response to cytoskeletal stress. Our data revealed that the cell shape constrained by isotropic but not elongated micropatterns in HeLa cells led to a significant reduction in rRNA transcription dependent on ROCK. Expression of a dominant-active form of ROCK also repressed rRNA transcription. Isotropic constraint and ROCK over-activation led to different types of aberrant F-actin organization, but their suppression effects on rRNA transcription were similarly reversed by inhibition of histone deacetylase (HDAC) or overexpression of a dominant negative form of Nesprin, which shields the signal transmitted from actin filament to the nuclear interior. We further showed that the binding of HDAC1 to the active fraction of rDNA genes is increased by ROCK over-activation, thus reducing H3K9/14 acetylation and suppressing transcription. Our results demonstrate an epigenetic control of active rDNA genes that represses rRNA transcription in response to the cytoskeletal stress. PMID:27350000

  9. The unusual 23S rRNA gene of Coxiella burnetii: two self-splicing group I introns flank a 34-base-pair exon, and one element lacks the canonical omegaG.

    Raghavan, Rahul; Miller, Scott R; Hicks, Linda D; Minnick, Michael F

    2007-09-01

    We describe the presence and characteristics of two self-splicing group I introns in the sole 23S rRNA gene of Coxiella burnetii. The two group I introns, Cbu.L1917 and Cbu.L1951, are inserted at sites 1917 and 1951 (Escherichia coli numbering), respectively, in the 23S rRNA gene of C. burnetii. Both introns were found to be self-splicing in vivo and in vitro even though the terminal nucleotide of Cbu.L1917 is adenine and not the canonical conserved guanine, termed OmegaG, found in Cbu.L1951 and all other group I introns described to date. Predicted secondary structures for both introns were constructed and revealed that Cbu.L1917 and Cbu.L1951 were group IB2 and group IA3 introns, respectively. We analyzed strains belonging to eight genomic groups of C. burnetii to determine sequence variation and the presence or absence of the elements and found both introns to be highly conserved (>/=99%) among them. Although phylogenetic analysis did not identify the specific identities of donors, it indicates that the introns were likely acquired independently; Cbu.L1917 was acquired from other bacteria like Thermotoga subterranea and Cbu.L1951 from lower eukaryotes like Acanthamoeba castellanii. We also confirmed the fragmented nature of mature 23S rRNA in C. burnetii due to the presence of an intervening sequence. The presence of three selfish elements in C. burnetii's 23S rRNA gene is very unusual for an obligate intracellular bacterium and suggests a recent shift to its current lifestyle from a previous niche with greater opportunities for lateral gene transfer. PMID:17644584

  10. An approach to analyse the specific impact of rapamycin on mRNA-ribosome association

    Jaquier-Gubler Pascale

    2008-08-01

    Full Text Available Abstract Background Recent work, using both cell culture model systems and tumour derived cell lines, suggests that the differential recruitment into polysomes of mRNA populations may be sufficient to initiate and maintain tumour formation. Consequently, a major effort is underway to use high density microarray profiles to establish molecular fingerprints for cells exposed to defined drug regimes. The aim of these pharmacogenomic approaches is to provide new information on how drugs can impact on the translational read-out within a defined cellular background. Methods We describe an approach that permits the analysis of de-novo mRNA-ribosome association in-vivo during short drug exposures. It combines hypertonic shock, polysome fractionation and high-throughput analysis to provide a molecular phenotype of translationally responsive transcripts. Compared to previous translational profiling studies, the procedure offers increased specificity due to the elimination of the drugs secondary effects (e.g. on the transcriptional read-out. For this pilot "proof-of-principle" assay we selected the drug rapamycin because of its extensively studied impact on translation initiation. Results High throughput analysis on both the light and heavy polysomal fractions has identified mRNAs whose re-recruitment onto free ribosomes responded to short exposure to the drug rapamycin. The results of the microarray have been confirmed using real-time RT-PCR. The selective down-regulation of TOP transcripts is also consistent with previous translational profiling studies using this drug. Conclusion The technical advance outlined in this manuscript offers the possibility of new insights into mRNA features that impact on translation initiation and provides a molecular fingerprint for transcript-ribosome association in any cell type and in the presence of a range of drugs of interest. Such molecular phenotypes defined pre-clinically may ultimately impact on the evaluation of

  11. Mechanical insights into ribosomal progression overcoming RNA G-quadruplex from periodical translation suppression in cells

    Endoh, Tamaki; Sugimoto, Naoki

    2016-03-01

    G-quadruplexes formed on DNA and RNA can be roadblocks to movement of polymerases and ribosome on template nucleotides. Although folding and unfolding processes of the G-quadruplexes are deliberately studied in vitro, how the mechanical and physical properties of the G-quadruplexes affect intracellular biological systems is still unclear. In this study, mRNAs with G-quadruplex forming sequences located either in the 5‧ untranslated region (UTR) or in the open reading frame (ORF) were constructed to evaluate positional effects of the G-quadruplex on translation suppression in cells. Periodic fluctuation of translation suppression was observed at every three nucleotides within the ORF but not within the 5‧ UTR. The results suggested that difference in motion of ribosome at the 5‧ UTR and the ORF determined the ability of the G-quadruplex structure to act as a roadblock to translation in cells and provided mechanical insights into ribosomal progression to overcome the roadblock.

  12. The trypanosome Pumilio-domain protein PUF7 associates with a nuclear cyclophilin and is involved in ribosomal RNA maturation.

    Droll, Dorothea; Archer, Stuart; Fenn, Katelyn; Delhi, Praveen; Matthews, Keith; Clayton, Christine

    2010-03-19

    Proteins with Pumilio RNA binding domains (Puf proteins) are ubiquitous in eukaryotes. Some Puf proteins bind to the 3'-untranslated regions of mRNAs, acting to repress translation and promote degradation; others are involved in ribosomal RNA maturation. The genome of Trypanosoma brucei encodes eleven Puf proteins whose function cannot be predicted by sequence analysis. We show here that epitope-tagged TbPUF7 is located in the nucleolus, and associated with a nuclear cyclophilin-like protein, TbNCP1. RNAi targeting PUF7 reduced trypanosome growth and inhibited two steps in ribosomal RNA processing. PMID:20153321

  13. The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

    Takaiwa, F; Sugiura, M

    1980-01-01

    The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

  14. Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

    The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library

  15. Label- and amplification-free electrochemical detection of bacterial ribosomal RNA.

    Henihan, Grace; Schulze, Holger; Corrigan, Damion K; Giraud, Gerard; Terry, Jonathan G; Hardie, Alison; Campbell, Colin J; Walton, Anthony J; Crain, Jason; Pethig, Ronald; Templeton, Kate E; Mount, Andrew R; Bachmann, Till T

    2016-07-15

    Current approaches to molecular diagnostics rely heavily on PCR amplification and optical detection methods which have restrictions when applied to point of care (POC) applications. Herein we describe the development of a label-free and amplification-free method of pathogen detection applied to Escherichia coli which overcomes the bottleneck of complex sample preparation and has the potential to be implemented as a rapid, cost effective test suitable for point of care use. Ribosomal RNA is naturally amplified in bacterial cells, which makes it a promising target for sensitive detection without the necessity for prior in vitro amplification. Using fluorescent microarray methods with rRNA targets from a range of pathogens, an optimal probe was selected from a pool of probe candidates identified in silico. The specificity of probes was investigated on DNA microarray using fluorescently labeled 16S rRNA target. The probe yielding highest specificity performance was evaluated in terms of sensitivity and a LOD of 20 pM was achieved on fluorescent glass microarray. This probe was transferred to an EIS end point format and specificity which correlated to microarray data was demonstrated. Excellent sensitivity was facilitated by the use of uncharged PNA probes and large 16S rRNA target and investigations resulted in an LOD of 50 pM. An alternative kinetic EIS assay format was demonstrated with which rRNA could be detected in a species specific manner within 10-40min at room temperature without wash steps. PMID:27016627

  16. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Hyouta eHimeno

    2014-04-01

    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  17. The ribosome triggers the stringent response by RelA via a highly distorted tRNA.

    Agirrezabala, Xabier; Fernández, Israel S; Kelley, Ann C; Cartón, David Gil; Ramakrishnan, Venki; Valle, Mikel

    2013-09-01

    The bacterial stringent response links nutrient starvation with the transcriptional control of genes. This process is initiated by the stringent factor RelA, which senses the presence of deacylated tRNA in the ribosome as a symptom of amino-acid starvation to synthesize the alarmone (p)ppGpp. Here we report a cryo-EM study of RelA bound to ribosomes bearing cognate, deacylated tRNA in the A-site. The data show that RelA on the ribosome stabilizes an unusual distorted form of the tRNA, with the acceptor arm making contact with RelA and far from its normal location in the peptidyl transferase centre. PMID:23877429

  18. 山羊奇异变形杆菌分离鉴定及其16S-23S rRNA ISR序列RFLP分析%Isolation and Identification of Proteus mirabilis from Goat and the Analysis of Its 16S-23S rRNA ISR Sequence by RFLP

    崔国林; 钟世勋; 杨世发; 左雪梅; 朱瑞良

    2013-01-01

    2012年初,山东菏泽某羊场的羊群发病,从发病羊器官分离到2株病原细菌.对病原细菌进行鉴定,并对其与已知同种异源菌株相似性差异进行分析.从患病山羊内脏器官分离细菌,经形态特征、培养特性、生化试验、血清学试验及致病性试验进行鉴定;再通过设计通用引物扩增16S-23S rRNA ISR (intergenie spacer region)序列,将PCR产物经HinfⅠ单酶切获得3条可视条带,同时对扩增条带中的主带测序并进行系统发育分析.结果表明,分离菌株为奇异变形杆菌;分离菌株同本实验室保存的兔源与鸡源奇异变形杆菌PCR-RFLP结果一致;分离菌株PCR产物同GenBank收录的HI4320株奇异变形杆菌及本实验室保存的兔源与鸡源奇异变形杆菌进行序列比较,分离羊源菌株与兔源菌株相似性为94.8%、与鸡源菌株相似性为96.0%~98.2%,与人源HI4320株相似性为96.9%.研究证实发病羊致病病原为奇异变形杆菌,其与鸡源、兔源和人源奇异变形杆菌的亲缘关系较近.%At the beginning of 2012,a disease occurred in a goat farm in Heze City and two strains of pathogen were isolated from the infected goats.In order to identify the infected bacteria and analyze the homology between isolated strains and heterologous strains,bacteria were isolated from infected goats internal organs and were identified by morphologic characteristics,cultural characteristic,biochemistry test,serologic test and pathogenicity test; A pair of universal primers was designed to amplify 16S-23S rRNA ISR (intergenic spacer region) gene.and three visible straps were observed when PCR products were cut by Hinf Ⅰ,at the same time the main strap of PCR straps was sequenced and analyzed by phyletic evolution.The results showed that isolated strains were Proteus mirabilis ; the result of PCR-RFLP of isolated strains and Proteus mirabilis from rabbit and chicken was the same; The homology was 94.8% between

  19. The antibiotic thiostrepton inhibits a functional transition within protein L11 at the ribosomal GTPase centre

    Porse, B T; Leviev, I; Mankin, A S;

    1998-01-01

    reduced for the mutant L11-rRNA complexes. These results indicate that although, as shown earlier, thiostrepton binds primarily to 23 S rRNA, the drug probably inhibits peptide elongation by impeding a conformational change within protein L11 that is important for the function of the ribosomal GTPase...

  20. Phylogenetic evidence for the acquisition of ribosomal RNA introns subsequent to the divergence of some of the major Tetrahymena groups

    Sogin, M L; Ingold, A; Karlok, M;

    1986-01-01

    Previous work has demonstrated the presence of a self-splicing intron in the large subunit ribosomal RNA coding region in some strains of the ciliate protozoan Tetrahymena. Sequence comparisons of the intron regions from six Tetrahymena species showed these to fall into three homology groups. In an...... attempt to evaluate the evolutionary origins of the intervening sequences, we have now determined complete small subunit ribosomal RNA gene sequences from 13 species of Tetrahymena and the absolute number of nucleotide differences between the sequences was used to construct a phylogenetic tree. This...

  1. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.

    2011-01-01

    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stab...

  2. EmtA, a rRNA methyltransferase conferring high-level evernimicin resistance

    Mann, P. A.; Xiong, L.; Mankin, A. S.; Chau, A. S.; Najarian, D. J.; Mendrick, C. A.; Cramer, C. A.; Aarestrup, Frank Møller; Hare, R. S.; Black, T. A.; McNicholas, P. M.

    2001-01-01

    unique to the 23S rRNA extracted from resistant ribosomes. The pause corresponded to methylation of residue G2470 (Escherichia coli numbering). RNA footprinting revealed that G2470 is located within the evernimicin-binding site on the ribosome, thus providing an explanation for the reduced binding of the...

  3. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  4. Model of EF4-induced ribosomal state transitions and mRNA translocation

    EF4, a highly conserved protein present in bacteria, mitochondria and chloroplasts, can bind to both the posttranslocation and pretranslocation ribosomal complexes. When binding to the posttranslocation state, it catalyzes backward translocation to a pretranslocation state. When binding to the pretranslocation state, it catalyzes transition to another pretranslocation state that is similar and possibly identical to that resulting from the posttranslocation state bound by EF4, and competes with EF-G to regulate the elongation cycle. However, the molecular mechanism on how EF4 induces state transitions and mRNA translocation remains unclear. Here, we present both the model for state transitions induced by EF4 binding to the posttranslocation state and that by EF4 binding to the pretranslocation state, based on which we study the kinetics of EF4-induced state transitions and mRNA translocation, giving quantitative explanations of the available experimental data. Moreover, we present some predicted results on state transitions and mRNA translocation induced by EF4 binding to the pretranslocation state complexed with the mRNA containing a duplex region. (paper)

  5. The human insulin receptor mRNA contains a functional internal ribosome entry segment

    Spriggs, Keith A.; Cobbold, Laura C.; Ridley, Simon H.; Coldwell, Mark; Bottley, Andrew; Bushell, Martin; Willis, Anne E.; Siddle, Kenneth

    2009-01-01

    Regulation of mRNA translation is an important mechanism determining the level of expression of proteins in eukaryotic cells. Translation is most commonly initiated by cap-dependent scanning, but many eukaryotic mRNAs contain internal ribosome entry segments (IRESs), providing an alternative means of initiation capable of independent regulation. Here, we show by using dicistronic luciferase reporter vectors that the 5′-UTR of the mRNA encoding human insulin receptor (hIR) contains a functional IRES. RNAi-mediated knockdown showed that the protein PTB was required for maximum IRES activity. Electrophoretic mobility shift assays confirmed that PTB1, PTB2 and nPTB, but not unr or PTB4, bound to hIR mRNA, and deletion mapping implicated a CCU motif 448 nt upstream of the initiator AUG in PTB binding. The IR-IRES was functional in a number of cell lines, and most active in cells of neuronal origin, as assessed by luciferase reporter assays. The IRES was more active in confluent than sub-confluent cells, but activity did not change during differentiation of 3T3-L1 fibroblasts to adipocytes. IRES activity was stimulated by insulin in sub-confluent cells. The IRES may function to maintain expression of IR protein in tissues such as the brain where mRNA translation by cap-dependent scanning is less effective. PMID:19654240

  6. One step engineering of the small-subunit ribosomal RNA using CRISPR/Cas9.

    Kannan, Krishna; Tsvetanova, Billyana; Chuang, Ray-Yuan; Noskov, Vladimir N; Assad-Garcia, Nacyra; Ma, Li; Hutchison Iii, Clyde A; Smith, Hamilton O; Glass, John I; Merryman, Chuck; Venter, J Craig; Gibson, Daniel G

    2016-01-01

    Bacteria are indispensable for the study of fundamental molecular biology processes due to their relatively simple gene and genome architecture. The ability to engineer bacterial chromosomes is quintessential for understanding gene functions. Here we demonstrate the engineering of the small-ribosomal subunit (16S) RNA of Mycoplasma mycoides, by combining the CRISPR/Cas9 system and the yeast recombination machinery. We cloned the entire genome of M. mycoides in yeast and used constitutively expressed Cas9 together with in vitro transcribed guide-RNAs to introduce engineered 16S rRNA genes. By testing the function of the engineered 16S rRNA genes through genome transplantation, we observed surprising resilience of this gene to addition of genetic elements or helix substitutions with phylogenetically-distant bacteria. While this system could be further used to study the function of the 16S rRNA, one could envision the "simple" M. mycoides genome being used in this setting to study other genetic structures and functions to answer fundamental questions of life. PMID:27489041

  7. One step engineering of the small-subunit ribosomal RNA using CRISPR/Cas9

    Kannan, Krishna; Tsvetanova, Billyana; Chuang, Ray-Yuan; Noskov, Vladimir N.; Assad-Garcia, Nacyra; Ma, Li; Hutchison III, Clyde A.; Smith, Hamilton O.; Glass, John I.; Merryman, Chuck; Venter, J. Craig; Gibson, Daniel G.

    2016-01-01

    Bacteria are indispensable for the study of fundamental molecular biology processes due to their relatively simple gene and genome architecture. The ability to engineer bacterial chromosomes is quintessential for understanding gene functions. Here we demonstrate the engineering of the small-ribosomal subunit (16S) RNA of Mycoplasma mycoides, by combining the CRISPR/Cas9 system and the yeast recombination machinery. We cloned the entire genome of M. mycoides in yeast and used constitutively expressed Cas9 together with in vitro transcribed guide-RNAs to introduce engineered 16S rRNA genes. By testing the function of the engineered 16S rRNA genes through genome transplantation, we observed surprising resilience of this gene to addition of genetic elements or helix substitutions with phylogenetically-distant bacteria. While this system could be further used to study the function of the 16S rRNA, one could envision the “simple” M. mycoides genome being used in this setting to study other genetic structures and functions to answer fundamental questions of life. PMID:27489041

  8. Regulation of ribosomal RNA expression across the lifespan is fine-tuned by maternal diet before implantation.

    Denisenko, Oleg; Lucas, Emma S; Sun, Congshan; Watkins, Adam J; Mar, Daniel; Bomsztyk, Karol; Fleming, Tom P

    2016-07-01

    Cells and organisms respond to nutrient deprivation by decreasing global rates of transcription, translation and DNA replication. To what extent such changes can be reversed is largely unknown. We examined the effect of maternal dietary restriction on RNA synthesis in the offspring. Low protein diet fed either throughout gestation or for the preimplantation period alone reduced cellular RNA content across fetal somatic tissues during challenge and increased it beyond controls in fetal and adult tissues after challenge release. Changes in transcription of ribosomal RNA, the major component of cellular RNA, were responsible for this phenotype as evidenced by matching alterations in RNA polymerase I density and DNA methylation at ribosomal DNA loci. Cellular levels of the ribosomal transcription factor Rrn3 mirrored the rRNA expression pattern. In cell culture experiments, Rrn3 overexpression reduced rDNA methylation and increased rRNA expression; the converse occurred after inhibition of Rrn3 activity. These observations define novel mechanism where poor nutrition before implantation irreversibly alters basal rates of rRNA transcription thereafter in a process mediated by rDNA methylation and Rrn3 factor. PMID:27060415

  9. Low levels of ribosomal RNA partly account for the very high photosynthetic phosphorus-use efficiency of Proteaceae species.

    Sulpice, Ronan; Ishihara, Hirofumi; Schlereth, Armin; Cawthray, Gregory R; Encke, Beatrice; Giavalisco, Patrick; Ivakov, Alexander; Arrivault, Stéphanie; Jost, Ricarda; Krohn, Nicole; Kuo, John; Laliberté, Etienne; Pearse, Stuart J; Raven, John A; Scheible, Wolf-Rüdiger; Teste, François; Veneklaas, Erik J; Stitt, Mark; Lambers, Hans

    2014-06-01

    Proteaceae species in south-western Australia occur on phosphorus- (P) impoverished soils. Their leaves contain very low P levels, but have relatively high rates of photosynthesis. We measured ribosomal RNA (rRNA) abundance, soluble protein, activities of several enzymes and glucose 6-phosphate (Glc6P) levels in expanding and mature leaves of six Proteaceae species in their natural habitat. The results were compared with those for Arabidopsis thaliana. Compared with A. thaliana, immature leaves of Proteaceae species contained very low levels of rRNA, especially plastidic rRNA. Proteaceae species showed slow development of the photosynthetic apparatus (‘delayed greening’), with young leaves having very low levels of chlorophyll and Calvin-Benson cycle enzymes. In mature leaves, soluble protein and Calvin-Benson cycle enzyme activities were low, but Glc6P levels were similar to those in A. thaliana. We propose that low ribosome abundance contributes to the high P efficiency of these Proteaceae species in three ways: (1) less P is invested in ribosomes; (2) the rate of growth and, hence, demand for P is low; and (3) the especially low plastidic ribosome abundance in young leaves delays formation of the photosynthetic machinery, spreading investment of P in rRNA. Although Calvin-Benson cycle enzyme activities are low, Glc6P levels are maintained, allowing their effective use. PMID:24895754

  10. Purification and properties of new ribosome-inactivating proteins with RNA N-glycosidase activity.

    Bolognesi, A; Barbieri, L; Abbondanza, A; Falasca, A I; Carnicelli, D; Battelli, M G; Stirpe, F

    1990-11-30

    Ribosome-inactivating proteins (RIPs) similar to those already known (Stirpe & Barbieri (1986) FEBS Lett. 195, 1-8) were purified from the seeds of Asparagus officinalis (two proteins, asparin 1 and 2), of Citrullus colocynthis (two proteins, colocin 1 and 2), of Lychnis chalcedonica (lychnin) and of Manihot palmata (mapalmin), from the roots of Phytolacca americana (pokeweed antiviral protein from roots, PAP-R) and from the leaves of Bryonia dioica (bryodin-L). The two latter proteins can be considered as isoforms, respectively, of previously purified PAP, from the leaves of P. americana, and of bryodin-R, from the roots of B. dioica. All proteins have an Mr at approx, 30,000, and an alkaline isoelectric point. Bryodin-L, colocins, lychnin and mapalmin are glycoproteins. All RIPs inhibit protein synthesis by a rabbit reticulocyte lysate and phenylalanine polymerization by isolated ribosomes and alter rRNA in a similar manner as the A-chain of ricin and related toxins (Endo et al. (1987) J. Biol. Chem. 262, 5908-5912). PMID:2248976

  11. Biodiversity characterization of cellulolytic bacteria present on native Chaco soil by comparison of ribosomal RNA genes.

    Talia, Paola; Sede, Silvana M; Campos, Eleonora; Rorig, Marcela; Principi, Dario; Tosto, Daniela; Hopp, H Esteban; Grasso, Daniel; Cataldi, Angel

    2012-04-01

    Sequence analysis of the 16S ribosomal RNA gene was used to study bacterial diversity of a pristine forest soil and of two cultures of the same soil enriched with cellulolytic bacteria. Our analysis revealed high bacterial diversity in the native soil sample, evidencing at least 10 phyla, in which Actinobacteria, Proteobacteria and Acidobacteria accounted for more than 76% of all sequences. In both enriched samples, members of Proteobacteria were the most frequently represented. The majority of bacterial genera in both enriched samples were identified as Brevundimonas and Caulobacter, but members of Devosia, Sphingomonas, Variovorax, Acidovorax, Pseudomonas, Xanthomonas, Stenotrophomonas, Achromobacter and Delftia were also found. In addition, it was possible to identify cellulolytic taxa such as Acidothermus, Micromonospora, Streptomyces, Paenibacillus and Pseudomonas, which indicates that this ecosystem could be an attractive source for study of novel enzymes for cellulose degradation. PMID:22202170

  12. Competing pathways control host resistance to virus via tRNA modification and programmed ribosomal frameshifting.

    Maynard, Nathaniel D; Macklin, Derek N; Kirkegaard, Karla; Covert, Markus W

    2012-01-01

    Viral infection depends on a complex interplay between host and viral factors. Here, we link host susceptibility to viral infection to a network encompassing sulfur metabolism, tRNA modification, competitive binding, and programmed ribosomal frameshifting (PRF). We first demonstrate that the iron-sulfur cluster biosynthesis pathway in Escherichia coli exerts a protective effect during lambda phage infection, while a tRNA thiolation pathway enhances viral infection. We show that tRNA(Lys) uridine 34 modification inhibits PRF to influence the ratio of lambda phage proteins gpG and gpGT. Computational modeling and experiments suggest that the role of the iron-sulfur cluster biosynthesis pathway in infection is indirect, via competitive binding of the shared sulfur donor IscS. Based on the universality of many key components of this network, in both the host and the virus, we anticipate that these findings may have broad relevance to understanding other infections, including viral infection of humans. PMID:22294093

  13. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

    Ortega, Maya

    2010-01-01

    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  14. The ribosome triggers the stringent response by RelA via a highly distorted tRNA

    Agirrezabala, Xabier; Fernández, Israel S.; Kelley, Ann C.; Cartón, David Gil; Ramakrishnan, Venki; Valle, Mikel

    2013-01-01

    The bacterial stringent response is initiated by RelA and links nutrient starvation with the transcriptional control of genes. Cryo-EM now shows that RelA on the ribosome stabilizes an unusual distorted form of cognate, deacylated tRNA.

  15. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  16. The trypanosome Pumilio-domain protein PUF7 associates with a nuclear cyclophilin and is involved in ribosomal RNA maturation

    Droll, Dorothea; Archer, Stuart; Fenn, Katelyn; Delhi, Praveen; Matthews, Keith; Clayton, Christine

    2010-01-01

    Proteins with Pumilio RNA binding domains (Puf proteins) are ubiquitous in eukaryotes. Some Puf proteins bind to the 3′-untranslated regions of mRNAs, acting to repress translation and promote degradation; others are involved in ribosomal RNA maturation. The genome of Trypanosoma brucei encodes eleven Puf proteins whose function cannot be predicted by sequence analysis. We show here that epitope-tagged TbPUF7 is located in the nucleolus, and associated with a nuclear cyclophilin-like protein,...

  17. Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection

    Au, Hilda H.; Cornilescu, Gabriel; Mouzakis, Kathryn D.; Ren, Qian; Burke, Jordan E.; Lee, Seonghoon; Butcher, Samuel E.; Jan, Eric

    2015-01-01

    Viruses use alternate mechanisms to increase the coding capacity of their viral genomes. The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts an RNA structure that can direct translation in 0 and +1 reading frames to produce the viral structural proteins and an overlapping ORFx product. Here we provide structural and biochemical evidence that the PKI domain of the IRES mimics a complete tRNA-like structure to facilitate reading frame selection and allows the viral IR...

  18. Direct relationship between the level of p53 stabilization induced by rRNA synthesis-inhibiting drugs and the cell ribosome biogenesis rate.

    Scala, F; Brighenti, E; Govoni, M; Imbrogno, E; Fornari, F; Treré, D; Montanaro, L; Derenzini, M

    2016-02-25

    Many drugs currently used in chemotherapy work by hindering the process of ribosome biogenesis. In tumors with functional p53, the inhibition of ribosome biogenesis may contribute to the efficacy of this treatment by inducing p53 stabilization. As the level of stabilized p53 is critical for the induction of cytotoxic effects, it seems useful to highlight those cancer cell characteristics that can predict the degree of p53 stabilization following the treatment with inhibitors of ribosome biogenesis. In the present study we exposed a series of p53 wild-type human cancer cell lines to drugs such as actinomycin D (ActD), doxorubicin, 5-fluorouracil and CX-5461, which hinder ribosomal RNA (rRNA) synthesis. We found that the amount of stabilized p53 was directly related to the level of ribosome biogenesis in cells before the drug treatment. This was due to different levels of inactivation of the ribosomal proteins-MDM2 pathway of p53 digestion. Inhibition of rRNA synthesis always caused cell cycle arrest, independent of the ribosome biogenesis rate of the cells, whereas apoptosis occurred only in cells with a high rDNA transcription rate. The level of p53 stabilization induced by drugs acting in different ways from the inhibition of ribosome biogenesis, such as hydroxyurea (HU) and nutlin-3, was independent of the level of ribosome biogenesis in cells and always lower than that occurring after the inhibition of rRNA synthesis. Interestingly, in cells with a low ribosome biogenesis rate, the combined treatment with ActD and HU exerted an additive effect on p53 stabilization. These results indicated that (i) drugs inhibiting ribosome biogenesis may be highly effective in p53 wild-type cancers with a high ribosome biogenesis rate, as they induce apoptotic cell death, and (ii) the combination of drugs capable of stabilizing p53 through different mechanisms may be useful for treating cancers with a low ribosome biogenesis rate. PMID:25961931

  19. A mutation in the 530 loop of Escherichia coli 16S ribosomal RNA causes resistance to streptomycin.

    Melançon, P; Lemieux, C; Brakier-Gingras, L

    1988-01-01

    Oligonucleotide-directed mutagenesis was used to introduce an A to C transversion at position 523 in the 16S ribosomal RNA gene of Escherichia coli rrnB operon cloned in plasmid pKK3535. E. coli cells transformed with the mutated plasmid were resistant to streptomycin. The mutated ribosomes isolated from these cells were not stimulated by streptomycin to misread the message in a poly(U)-directed assay. They were also restrictive to the stimulation of misreading by other error-promoting relate...

  20. Chromosomal organization of the ribosomal RNA genes in the genus Chironomus (Diptera, Chironomidae

    Larisa Gunderina

    2015-05-01

    Full Text Available Chromosomal localization of ribosomal RNA coding genes has been studied by using FISH (fluorescence in situ hybridization in 21 species from the genus Chironomus Meigen, 1803. Analysis of the data has shown intra- and interspecific variation in number and location of 5.8S rDNA hybridization sites in 17 species from the subgenus Chironomus and 4 species from the subgenus Camptochironomus Kieffer, 1914. In the majority of studied species the location of rDNA sites coincided with the sites where active NORs (nucleolus organizer regions were found. The number of hybridization sites in karyotypes of studied chironomids varied from 1 to 6. More than half of the species possessed only one NOR (12 out of 21. Two rDNA hybridization sites were found in karyotypes of five species, three – in two species, and five and six sites – in one species each. NORs were found in all chromosomal arms of species from the subgenus Chironomus with one of them always located on arm G. On the other hand, no hybridization sites were found on arm G in four studied species from the subgenus Camptochironomus. Two species from the subgenus Chironomus – Ch. balatonicus Devai, Wuelker & Scholl, 1983 and Ch. “annularius” sensu Strenzke, 1959 – showed intraspecific variability in the number of hybridization signals. Possible mechanisms of origin of variability in number and location of rRNA genes in the karyotypes of species from the genus Chironomus are discussed.

  1. 8-Methoxypsoralen DNA interstrand cross-linking of the ribosomal RNA genes in Tetrahymena thermophila. Distribution, repair and effect on rRNA synthesis

    Fengquin, X; Nielsen, Henrik; Zhen, W;

    1993-01-01

    The distribution and repair of 8-methoxypsoralen-DNA interstrand cross-links in the ribosomal RNA genes (rDNA) in Tetrahymena thermophila have been studied in vivo by Southern blot analysis. It is found that the cross-links at a density of < or = 1/2 x 10(4) base pairs (bp) are distributed equall...

  2. Designed Regular Tetragon-Shaped RNA-Protein Complexes with Ribosomal Protein L1 for Bionanotechnology and Synthetic Biology.

    Ohno, Hirohisa; Inoue, Tan

    2015-05-26

    RNA nanotechnology has been established by employing the molecular architecture of RNA structural motifs. Here, we report two designed RNA-protein complexes (RNPs) composed of ribosomal protein L1 (RPL1) and its RNA-binding motif that are square-shaped nano-objects. The formation and the shape of the objects were confirmed by gel electrophoresis analysis and atomic force microscopy, respectively. Any protein can be attached to the RNA via a fusion protein with RPL1, indicating that it can be used as a scaffold for loading a variety of functional proteins or for building higher-order structures. In summary, the RNP object will serve as a useful tool in the fields of bionanotechnology and synthetic biology. Moreover, the RNP interaction enhances the RNA stability against nucleases, rendering these complexes stable in cells. PMID:25933202

  3. Engineering the rRNA decoding site of eukaryotic cytosolic ribosomes in bacteria

    Hobbie, S N; Kalapala, S K; Akshay, S.; Bruell, C M; S. Schmidt; Dabow, S; Vasella, A; Sander, P; Böttger, E C

    2007-01-01

    Structural and genetic studies on prokaryotic ribosomes have provided important insights into fundamental aspects of protein synthesis and translational control and its interaction with ribosomal drugs. Comparable mechanistic studies in eukaryotes are mainly hampered by the absence of both high-resolution crystal structures and efficient genetic models. To study the interaction of aminoglycoside antibiotics with selected eukaryotic ribosomes, we replaced the bacterial drug binding site in 16S...

  4. A phylogeny of the Passerida (Aves:Passeriformes) based on mitochondrial 12S ribosomal RNA gene

    Lina Wu; Yanfeng Sun; Juyong Li; Yaqing Li; Yuefeng Wu; and Dongming Li

    2015-01-01

    Background:Passerida is the largest avian radiation within the order Passeriformes. Current understanding of the high-level relationships within Passerida is based on DNA–DNA hybridizations;however, the phylogenetic relationships within this assemblage have been the subject of many debates. Methods:We analyzed the 12S ribosomal RNA gene from 49 species of Passerida, representing 14 currently recognized families, to outline the phylogenetic relationships within this group. Results:Our results identified the monophyly of the three superfamilies in Passerida:Sylvioidea, Muscicapoidea and Passeroidea. However, current delimitation of some species is at variance with our phylogeny estimate. First, the Parus major, which had been placed as a distinct clade sister to Sylvioidea was identified as a member of the super family;second, the genus Regulus was united with the Sturnidae and nested in the Muscicapoidea clade instead of being a clade of Passerida. Conclusion:Our results were consistent with Johansson’s study of the three superfamilies except for the al ocation of two families, Paridae and Regulidae.

  5. Evaluation of a fluorescence-labelled oligonucleotide tide probe targeting 23S rRNA for in situ detection of Salmonella serovars in paraffin-embedded tissue sections and their rapid identification in bacterial smears

    Nordentoft, Steen; Christensen, H.; Wegener, Henrik Caspar

    1997-01-01

    A method for the detection of Salmonella based on fluorescence in situ hybridization (FISH) has been developed and applied for the direct detection of Salmonella in pure cultures and in formalin-fixed, paraffin-embedded tissue sections. On the basis of the 23S rRNA gene sequences representing all...... with the probe. The probe did not hybridize to serovars from subspecies IIIa (S. arizonae) or to S. bongori. No cross-reaction to 64 other strains of the family Enterobacteriaceae or 18 other bacterial strains outside this family was observed. The probe was tested with sections of formalin-fixed......, paraffin-embedded tissue from experimentally infected mice or from animals with a history of clinical salmonellosis. In these tissue sections the probe hybridized specifically to Salmonella serovars, allowing for the detection of single bacterial cells. The development of a fluorescence-labelled specific...

  6. Cyanobacterial ribosomal RNA genes with multiple, endonuclease-encoding group I introns

    Turner Seán

    2007-09-01

    Full Text Available Abstract Background Group I introns are one of the four major classes of introns as defined by their distinct splicing mechanisms. Because they catalyze their own removal from precursor transcripts, group I introns are referred to as autocatalytic introns. Group I introns are common in fungal and protist nuclear ribosomal RNA genes and in organellar genomes. In contrast, they are rare in all other organisms and genomes, including bacteria. Results Here we report five group I introns, each containing a LAGLIDADG homing endonuclease gene (HEG, in large subunit (LSU rRNA genes of cyanobacteria. Three of the introns are located in the LSU gene of Synechococcus sp. C9, and the other two are in the LSU gene of Synechococcus lividus strain C1. Phylogenetic analyses show that these introns and their HEGs are closely related to introns and HEGs located at homologous insertion sites in organellar and bacterial rDNA genes. We also present a compilation of group I introns with homing endonuclease genes in bacteria. Conclusion We have discovered multiple HEG-containing group I introns in a single bacterial gene. To our knowledge, these are the first cases of multiple group I introns in the same bacterial gene (multiple group I introns have been reported in at least one phage gene and one prophage gene. The HEGs each contain one copy of the LAGLIDADG motif and presumably function as homodimers. Phylogenetic analysis, in conjunction with their patchy taxonomic distribution, suggests that these intron-HEG elements have been transferred horizontally among organelles and bacteria. However, the mode of transfer and the nature of the biological connections among the intron-containing organisms are unknown.

  7. Multicentre surveillance of prevalence of the 23S rRNA A2058G and A2059G point mutations and molecular subtypes of Treponema pallidum in Taiwan, 2009-2013.

    Wu, B-R; Yang, C-J; Tsai, M-S; Lee, K-Y; Lee, N-Y; Huang, W-C; Wu, H; Lee, C-H; Chen, T-C; Ko, W-C; Lin, H-H; Lu, P-L; Chen, Y-H; Liu, W-C; Yang, S-P; Wu, P-Y; Su, Y-C; Hung, C-C; Chang, S-Y

    2014-08-01

    Resistance mutations A2058G and A2059G, within the 23S rRNA gene of Treponema pallidum, have been reported to cause treatment failures in patients receiving azithromycin for syphilis. Genotyping of T. pallidum strains sequentially isolated from patients with recurrent syphilis is rarely performed. From September 2009 to August 2013, we collected 658 clinical specimens from 375 patients who presented with syphilis for genotyping to examine the number of 60-bp repeats in the acidic repeat protein (arp) gene, T. pallidum repeat (tpr) polymorphism, and tp0548 gene, and to detect A2058G and A2059G point mutations by restriction fragment length polymorphism. Treponemal DNA was identified in 45.2% (n = 298) of the specimens that were collected from 216 (57.6%) patients; 268 (40.7%) specimens tested positive for the 23S rRNA gene, and were examined for macrolide resistance. Two isolates (0.7%) harboured the A2058G mutation, and no A2059G mutation was identified. A total of 14 strains of T. pallidum were identified, with 14f/f (57.5%) and 14b/c (10.0%) being the two predominant strains. Forty patients who presented with recurrent episodes of syphilis had T. pallidum DNA identified from the initial and subsequent episodes, with five cases showing strain discrepancies. One patient had two strains identified from different clinical specimens collected in the same episode. Our findings show that 14f/f is the most common T. pallidum strain in Taiwan, where the prevalence of T. pallidum strains that show A2058G or A2059G mutation remains low. Different genotypes of T. pallidum can be identified in patients with recurrent episodes of syphilis. PMID:24438059

  8. High frequency of the 23S rRNA A2058G mutation of Treponema pallidum in Shanghai is associated with a current strategy for the treatment of syphilis.

    Lu, Haikong; Li, Kang; Gong, Weimin; Yan, Limeng; Gu, Xin; Chai, Ze; Guan, Zhifang; Zhou, Pingyu

    2015-02-01

    The preferred drugs for the treatment of syphilis, benzathine and procaine penicillin, have not been available in Shanghai for many years, and currently, the incidence of syphilis is increasing. Alternative antibiotics for patients with syphilis during the benzathine and procaine penicillin shortage include macrolides. The failure of macrolide treatment in syphilis patients has been reported in Shanghai, but the reason for this treatment failure remains unclear. We used polymerase chain reaction technology to detect a 23S rRNA A2058G mutation in Treponema pallidum in 109 specimens from syphilis patients. The use of azithromycin/erythromycin in the syphilis patients and the physicians' prescription habits were also assessed based on two questionnaires regarding the use of macrolides. A total of 104 specimens (95.4%) were positive for the A2058G mutation in both copies of the 23S rRNA gene, indicating macrolide resistance. A questionnaire provided to 122 dermatologists showed that during the penicillin shortage, they prescribed erythromycin and azithromycin for 8.24±13.95% and 3.21±6.37% of their patients, respectively, and in the case of penicillin allergy, erythromycin and azithromycin were prescribed 15.24±22.89% and 7.23±16.60% of the time, respectively. A second questionnaire provided to the syphilis patients showed that 150 (33.7%), 106 (23.8%) and 34 (7.6%) individuals had used azithromycin, erythromycin or both, respectively, although the majority did not use the drugs for syphilis treatment. Our findings suggest that macrolide resistance in Treponema pallidum is widespread in Shanghai. More than half of the syphilis patients had a history of macrolide use for other treatment purposes, which may have led to the high prevalence of macrolide resistance. Physicians in China are advised to not use azithromycin for early syphilis. PMID:26038763

  9. Casein Kinase 2 Associates with Initiation-Competent RNA Polymerase I and Has Multiple Roles in Ribosomal DNA Transcription

    Panova, Tatiana B; Panov, Kostya I.; Russell, Jackie; Zomerdijk, Joost C. B. M.

    2006-01-01

    Mammalian RNA polymerase I (Pol I) complexes contain a number of associated factors, some with undefined regulatory roles in transcription. We demonstrate that casein kinase 2 (CK2) in human cells is associated specifically only with the initiation-competent Pol Iβ isoform and not with Pol Iα. Chromatin immunoprecipitation analysis places CK2 at the ribosomal DNA (rDNA) promoter in vivo. Pol Iβ-associated CK2 can phosphorylate topoisomerase IIα in Pol Iβ, activator upstream binding factor (UB...

  10. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repeti...

  11. The complete nucleotide sequence of a 16S ribosomal RNA gene from a blue-green alga, Anacystis nidulans.

    Tomioka, N; Sugiura, M

    1983-01-01

    The complete nucleotide sequence of a 16S ribosomal RNA gene from a blue-green alga, Anacystis nidulans, has been determined. Its coding region is estimated to be 1,487 base pairs long, which is nearly identical to those reported for chloroplast 16S rRNA genes and is about 4% shorter than that of the Escherichia coli gene. The 16S rRNA sequence of A. nidulans has 83% homology with that of tobacco chloroplast and 74% homology with that of E. coli. Possible stem and loop structures of A. nidulans 16S rRNA sequences resemble more closely those of chloroplast 16S rRNAs than those of E. coli 16S rRNA. These observations support the endosymbiotic theory of chloroplast origin. PMID:6412038

  12. Molecular phylogeny of silk-producing insects based on 16S ribosomal RNA and cytochrome oxidase subunit I genes

    B. Mahendran; S. K. Ghosh; S. C. Kundu

    2006-04-01

    We have examined the molecular-phylogenetic relationships between nonmulberry and mulberry silkwormspecies that belong to the families Saturniidae, Bombycidae and Lasiocampidae using 16S ribosomal RNA (16S rRNA) and cytochrome oxidase subunit I (coxI) gene sequences. Aligned nucleotide sequences of 16S rRNA and coxI from 14 silk-producing species were used for construction of phylogenetic trees by maximum likelihood and maximum parsimony methods. The tree topology on the basis of 16S rRNA supports monophyly for members of Saturniidae and Bombycidae. Weighted parsimony analysis weighted towards transversions relative to transitions (ts, tv4) for coxI resulted in more robust bootstrap support over unweighted parsimony and favours the 16S rRNA tree topology. Combined analysis reflected clear biogeographic pattern, and agrees with morphological and cytological data.

  13. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. PMID:22510214

  14. A Long Noncoding RNA on the Ribosome Is Required for Lifespan Extension

    Essers, Paul B; Nonnekens, Julie; Goos, Yvonne J; Betist, Marco C; Viester, Marjon D; Mossink, Britt; Lansu, Nico; Korswagen, Hendrik C; Jelier, Rob; Brenkman, Arjan B; MacInnes, Alyson W

    2015-01-01

    The biogenesis of ribosomes and their coordination of protein translation consume an enormous amount of cellular energy. As such, it has been established that the inhibition of either process can extend eukaryotic lifespan. Here, we used next-generation sequencing to compare ribosome-associated RNAs

  15. A transgenic mouse line for collecting ribosome-bound mRNA using the tetracycline transactivator system

    Laurel Drane

    2014-10-01

    Full Text Available Acquiring the gene expression profiles of specific neuronal cell-types is important for understanding their molecular identities. Genome-wide gene expression profiles of genetically defined cell-types can be acquired by collecting and sequencing mRNA that is bound to epitope-tagged ribosomes (TRAP; Translating Ribosome Affinity Purification. Here, we introduce a transgenic mouse model that combines the TRAP technique with the tetracycline transactivator (tTA system by expressing EGFP-tagged ribosomal protein L10a (EGFP-L10a under control of the tetracycline response element (tetO-TRAP. This allows both spatial control of EGFP-L10a expression through cell-type specific tTA expression, as well as temporal regulation by inhibiting transgene expression through the administration of doxycycline. We show that crossing tetO-TRAP mice with transgenic mice expressing tTA under the Camk2a promoter (Camk2a-tTA results in offspring with cell-type specific expression of EGFP-L10a in CA1 pyramidal neurons and medium spiny neurons in the striatum. Co-immunoprecipitation confirmed that EGFP-L10a integrates into a functional ribosomal complex. In addition, collection of ribosome-bound mRNA from the hippocampus yielded the expected enrichment of genes expressed in CA1 pyramidal neurons, as well as a depletion of genes expressed in other hippocampal cell-types. Finally, we show that crossing tetO-TRAP mice with transgenic Fos-tTA mice enables the expression of EGFP-L10a in CA1 pyramidal neurons that are activated during a fear conditioning trial. The tetO-TRAP mouse can be combined with other tTA mouse lines to enable gene expression profiling of a variety of different cell-types.

  16. ColE1 cloning of a ribosomal RNA promoter region from lambdarifsup(d)18 by selection for lambda integration and excision functions

    The expression of the ribosomal RNA gene carried by the lambda transducing phage lambdarifsup(d)18 is shown to be subject to stringent amino acid control. lambdarifsup(d)18 DNA was digested with endonuclease EcoRI and ligated to similarly restricted ColE1 plasmid DNA. Selection for expression of lambda integration and excision gene activity carried by the same DNA fragment results in cloning of the promoter proximal portion of the 16S ribosomal RNA gene. The resulting chimera expresses lambda integration and excision functions as well as encoding the promoter proximal half of a 16S ribosomal RNA gene. The effect of ultraviolet dose on stringent control of phage lambdarifsup(d)18 dependent ribosomal RNA synthesis is included in the investigation. (Auth.)

  17. The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis

    Cole, J. R.; Chai, B.; Farris, R. J.; Wang, Q; Kulam, S. A.; McGarrell, D. M.; Garrity, G M; Tiedje, J M

    2004-01-01

    The Ribosomal Database Project (RDP-II) provides the research community with aligned and annotated rRNA gene sequences, along with analysis services and a phylogenetically consistent taxonomic framework for these data. Updated monthly, these services are made available through the RDP-II website (http://rdp.cme.msu.edu/). RDP-II release 9.21 (August 2004) contains 101 632 bacterial small subunit rRNA gene sequences in aligned and annotated format. High-throughput tools for initial taxonomic p...

  18. NMR structure of the A. aeolicus tmRNA pseudoknot PK1: new insights into the recoding event of the ribosomal trans-translation.

    Nonin-Lecomte, Sylvie; Felden, Brice; Dardel, Frédéric

    2006-01-01

    The transfer-messenger RNA (tmRNA) pseudoknot PK1 is essential for bacterial trans-translation, a ribosomal rescue mechanism. We report the solution structure of PK1 from Aquifex aeolicus, which despite an unprecedented small number of nucleotides and thus an unprecented compact size, displays a very high thermal stability. Several unusual structural features account for these properties and indicate that PK1 belongs to the class of ribosomal frameshift pseudoknots. This suggests a similarity...

  19. Seasonal succession leads to habitat-dependent differentiation in ribosomal RNA:DNA ratios among freshwater lake bacteria

    Vincent J Denef

    2016-04-01

    Full Text Available Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP. Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA gene sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. However, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.

  20. Seasonal Succession Leads to Habitat-Dependent Differentiation in Ribosomal RNA:DNA Ratios among Freshwater Lake Bacteria

    Denef, Vincent J.; Fujimoto, Masanori; Berry, Michelle A.; Schmidt, Marian L.

    2016-01-01

    Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP). Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA gene sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate) water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. However, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors. PMID:27199936

  1. Elongation in translation as a dynamic interaction among the ribosome, tRNA, and elongation factors EF-G and EF-Tu

    Agirrezabala, Xabier; Frank, Joachim

    2009-01-01

    The ribosome is a complex macromolecular machine that translates the message encoded in the messenger RNA and synthesizes polypeptides by linking the individual amino acids carried by the cognate transfer RNAs (tRNAs). The protein elongation cycle, during which the tRNAs traverse the ribosome in a coordinated manner along a path of more than 100 Å, is facilitated by large-scale rearrangements of the ribosome. These rearrangements go hand in hand with conformational changes of tRNA as well as ...

  2. De novo Synthesis and Assembly of rRNA into Ribosomal Subunits during Cold Acclimation in Escherichia coli.

    Piersimoni, Lolita; Giangrossi, Mara; Marchi, Paolo; Brandi, Anna; Gualerzi, Claudio O; Pon, Cynthia L

    2016-04-24

    During the cold adaptation that follows a cold stress, bacterial cells undergo many physiological changes and extensive reprogramming of their gene expression pattern. Bulk gene expression is drastically reduced, while a set of cold shock genes is selectively and transiently expressed. The initial stage of cold acclimation is characterized by the establishment of a stoichiometric imbalance of the translation initiation factors (IFs)/ribosomes ratio that contributes to the preferential translation of cold shock transcripts. Whereas de novo synthesis of the IFs following cold stress has been documented, nothing was known concerning the activity of the rrn operons during the cold acclimation period. In this work, we focus on the expression of the rrn operons and the fate of rRNA after temperature downshift. We demonstrate that in Escherichia coli, rRNA synthesis does not stop during the cold acclimation phase, but continues with greater contribution of the P2 compared to the P1 promoter and all seven rrn operons are active, although their expression levels change with respect to pre-stress conditions. Eight hours after the 37°→10°C temperature downshift, the newly transcribed rRNA represents up to 20% of total rRNA and is preferentially found in the polysomes. However, with respect to the de novo synthesis of the IFs, both rRNA transcription and maturation are slowed down drastically by cold stress, thereby accounting in part for the stoichiometric imbalance of the IFs/ribosomes. Overall, our data indicate that new ribosomes, which are possibly suitable to function at low temperature, are slowly assembled during cold acclimation. PMID:26953262

  3. Activation of ribosomal RNA genes in porcine embryos produced in vitro or by somatic cell nuclear transfer

    Bjerregaard, Bolette; Pedersen, Hanne Gervi; Jakobsen, Anne Sørig;

    2007-01-01

    The onset of ribosomal RNA (rRNA) synthesis occurs during the second half of the third cell cycle, that is, at the four-cell stage, in porcine embryos developed in vivo. In the present study the onset of rRNA synthesis was investigated in porcine embryos produced in vitro (IVP) or by somatic cell...... were equal proportions of transcriptionally active and inactive embryos and essentially all embryos that developed to the 16-cell stage (n = 21) and further to the blastocyst stage (n = 19) contained only transcriptionally active cells. In conclusion, porcine embryos produced in vitro had an......-cell stage (n = 45), 38% of the embryos contained 1-3 nuclei with signs of rRNA transcription, indicating an asynchronous transcription initiation. This pattern continued in the following stages, as 78% (n = 47), 47% (n = 42) and 83% (n = 37) of the embryos revealed a mixture of transcriptionally inactive...

  4. Recovery from ultraviolet light-induced depression of ribosomal RNA synthesis in normal human, xeroderma pigmentosum and cockayne syndrome cells

    The rate of ribosomal RNA (rRNA) synthesis was analyzed at different times after ultraviolet light (UV) irradiation in normal human, xeroderma pigmentosum (XP) and Cockayne syndrome (CS) cells. In normal cells, the rate of rRNA synthesis, as measured by the incorporation of 3H-uridine into 18S and 28S rRNAs, decreased immediately after UV irradiation to about half of that of unirradiated cells, and then recovered significantly at 24h after UV. However, the rate of synthesis continued to decrease during post-UV incubation in XP cells belonging to groups A, D, E, F and G, as well as in CS cells of groups A and B. In contrast, group C XP cells showed a slight recovery at 24h after UV, suggesting that they have the capacity to repair UV lesions in rRNA genes. (author)

  5. Elongation in translation as a dynamic interaction among the ribosome, tRNA, and elongation factors EF-G and EF-Tu.

    Agirrezabala, Xabier; Frank, Joachim

    2009-08-01

    The ribosome is a complex macromolecular machine that translates the message encoded in the messenger RNA and synthesizes polypeptides by linking the individual amino acids carried by the cognate transfer RNAs (tRNAs). The protein elongation cycle, during which the tRNAs traverse the ribosome in a coordinated manner along a path of more than 100 A, is facilitated by large-scale rearrangements of the ribosome. These rearrangements go hand in hand with conformational changes of tRNA as well as elongation factors EF-Tu and EF-G - GTPases that catalyze tRNA delivery and translocation, respectively. This review focuses on the structural data related to the dynamics of the ribosomal machinery, which are the basis, in conjunction with existing biochemical, kinetic, and fluorescence resonance energy transfer data, of our knowledge of the decoding and translocation steps of protein elongation. PMID:20025795

  6. Effect of ultraviolet irradiation on 30-S ribosomal subunits. Identification of the RNA region crosslinked to protein S7

    The effects of ultraviolet irradiation on Escherichia coli 30-S ribosomal subunits were studied. At the doses of radiation used in this work (0-4.5 x 105 quanta/30-S subunit), only protein S7 was found to be significantly crosslinked to the 16-S RNA. In conditions where 25% of the protein was covalently crosslinked, the ability of the irradiated 30-S subunits to reassociate with 50-S subunits and their activity in polyphenylalanine synthesis decreased strongly. Similar results were obtained by irradiation with a germicide lamp (254 nm) or with a monochromatic ultraviolet light at 248 nm. No additional proteins were crosslinked to the 16-S RNA by irradiating 30-S subunits depleted in protein S1 or 70-S ribosomes. The covalent complex of 16-S RNA and protein S7 was isolated and digested by T1 ribonuclease. The oligonucleotide remaining attached to the crosslinked protein was characterised as A-C-C-U-C-G (position 1261-1266, see the sequence published by Carbon et al. (1979) Eur. J. Biochem. 160, 399-410). Analysis of this fragment suggests that protein S7 was linked to the cytosine at position 1265 in the RNA sequence. (orig.)

  7. Slow formation of stable complexes during coincubation of minimal rRNA and ribosomal protein S4.

    Mayerle, Megan; Bellur, Deepti L; Woodson, Sarah A

    2011-09-23

    Ribosomal protein S4 binds and stabilizes a five-helix junction or five-way junction (5WJ) in the 5' domain of 16S ribosomal RNA (rRNA) and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and 5WJ reorganize their structures. We show that labile S4 complexes rearrange into stable complexes within a few minutes at 42 °C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show that this structural change depends only on 16S residues within the S4 binding site. SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension) chemical probing experiments showed that S4 strongly stabilizes 5WJ and the helix (H) 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in H16 that makes specific contacts with the S4 N-terminal extension, as well as a right-angle motif between H3, H4, and H18, requires a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of H3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  8. Crucial elements that maintain the interactions between the regulatory TnaC peptide and the ribosome exit tunnel responsible for Trp inhibition of ribosome function.

    Martínez, Allyson K; Shirole, Nitin H; Murakami, Shino; Benedik, Michael J; Sachs, Matthew S; Cruz-Vera, Luis R

    2012-03-01

    Translation of the TnaC nascent peptide inhibits ribosomal activity in the presence of l-tryptophan, inducing expression of the tnaCAB operon in Escherichia coli. Using chemical methylation, this work reveals how interactions between TnaC and the ribosome are affected by mutations in both molecules. The presence of the TnaC-tRNA(Pro) peptidyl-tRNA within the ribosome protects the 23S rRNA nucleotide U2609 against chemical methylation. Such protection was not observed in mutant ribosomes containing changes in 23S rRNA nucleotides of the A748-A752 region. Nucleotides A752 and U2609 establish a base-pair interaction. Most replacements of either A752 or U2609 affected Trp induction of a TnaC-regulated LacZ reporter. However, the single change A752G, or the dual replacements A752G and U2609C, maintained Trp induction. Replacements at the conserved TnaC residues W12 and D16 also abolished the protection of U2609 by TnaC-tRNA(Pro) against chemical methylation. These data indicate that the TnaC nascent peptide in the ribosome exit tunnel interacts with the U2609 nucleotide when the ribosome is Trp responsive. This interaction is affected by mutational changes in exit tunnel nucleotides of 23S rRNA, as well as in conserved TnaC residues, suggesting that they affect the structure of the exit tunnel and/or the nascent peptide configuration in the tunnel. PMID:22110039

  9. An RNA-binding complex involved in ribosome biogenesis contains a protein with homology to tRNA CCA-adding enzyme.

    Jinzhong Lin

    2013-10-01

    Full Text Available A multitude of proteins and small nucleolar RNAs transiently associate with eukaryotic ribosomal RNAs to direct their modification and processing and the assembly of ribosomal proteins. Utp22 and Rrp7, two interacting proteins with no recognizable domain, are components of the 90S preribosome or the small subunit processome that conducts early processing of 18S rRNA. Here, we determine the cocrystal structure of Utp22 and Rrp7 complex at 1.97 Å resolution and the NMR structure of a C-terminal fragment of Rrp7, which is not visible in the crystal structure. The structure reveals that Utp22 surprisingly resembles a dimeric class I tRNA CCA-adding enzyme yet with degenerate active sites, raising an interesting evolutionary connection between tRNA and rRNA processing machineries. Rrp7 binds extensively to Utp22 using a deviant RNA recognition motif and an extended linker. Functional sites on the two proteins were identified by structure-based mutagenesis in yeast. We show that Rrp7 contains a flexible RNA-binding C-terminal tail that is essential for association with preribosomes. RNA-protein crosslinking shows that Rrp7 binds at the central domain of 18S rRNA and shares a neighborhood with two processing H/ACA snoRNAs snR30 and snR10. Depletion of snR30 prevents the stable assembly of Rrp7 into preribosomes. Our results provide insight into the evolutionary origin and functional context of Utp22 and Rrp7.

  10. Conservation and loss of ribosomal RNA gene sites in diploid and polyploid Fragaria (Rosaceae

    Liu Bo

    2011-11-01

    Full Text Available Abstract Background The genus Fragaria comprises species at ploidy levels ranging from diploid (2n = 2x = 14 to decaploid (2n = 10x = 70. Fluorescence in situ hybridization with 5S and 25S rDNA probes was performed to gather cytogenetic information that illuminates genomic divergence among different taxa at multiple ploidy levels, as well as to explore the evolution of ribosomal RNA genes during polyploidization in Fragaria. Results Root tip cells of diploid taxa were typified by two 5S and six 25S rDNA hybridization signals of varying intensities, providing a baseline for comparisons within the genus. In three exceptional diploid genotypes, F. nilgerrensis (CFRA 1358 and CFRA 1825 and F. vesca 'Yellow Wonder', two 5S but only four 25S rDNA sites were found but with differing site losses. The numbers of 5S and 25S rDNA signals, respectively were three and nine in a triploid F. ×bifera accession, and were four and twelve in three tetraploids, thus occurring in proportional 1.5× and 2× multiples of the typical diploid pattern. In hexaploid F. moschata, a proportional multiple of six 5S rDNA sites was observed, but the number of 25S rDNA sites was one or two less than the proportionate prediction of eighteen. This apparent tendency toward rDNA site loss at higher ploidy was markedly expanded in octoploids, which displayed only two 5S and ten 25S rDNA sites. In the two decaploids examined, the numbers of 5S and 25S rDNA signals, respectively, were four and fifteen in F. virginiana subsp. platypetala, and six and twelve in F. iturupensis. Conclusions Among diploid Fragaria species, a general consistency of rDNA site numbers implies conserved genomic organization, but highly variable 25S signal sizes and intensities and two instances of site loss suggest concurrent high dynamics of rDNA copy numbers among both homologs and non-homologs. General conservation of rDNA site numbers in lower ploidy, but marked site number reductions at higher ploidy

  11. Detection of Aspergillus fumigatus pulmonary fungal infections in mice with 99mTc-labeled MORF oligomers targeting ribosomal RNA

    Purpose: Invasive aspergillosis is a major cause of infectious morbidity and mortality in immunocompromised patients. The fungus Aspergillus fumigatus (A. fumigatus) is the primary causative agent of invasive aspergillosis. However, A. fumigatus infections remain difficult to diagnose particularly in the early stages due to the lack of a rapid, sensitive and specific diagnostic approach. In this study, we investigated 99mTc labeled MORF oligomers targeting fungal ribosomal RNA (rRNA) for the imaging detection of fungal infections. Procedures: Three phosphorodiamidate morpholino (MORF) oligomer (a DNA analogue) probes were designed: AGEN, complementary to a sequence of the fungal 28S ribosomal RNA (rRNA) of Aspergillus, as a genus-specific probe; AFUM, complementary to the 28S rRNA sequence of A. fumigatus, as a fungus species-specific probe; and cMORF, irrelevant to all fungal species, as a control probe. The probes were conjugated with Alexa Fluor 633 carboxylic acid succinimidyl ester (AF633) for fluorescence imaging or with NHS-mercaptoacetyl triglycine (NHS-MAG3) for nuclear imaging with 99mTc and then evaluated in vitro and in vivo. Results: The specific binding of AGEN and AFUM to fungal total RNA was confirmed by dot blot hybridization while specific binding of AGEN and AFUM in fixed and live A. fumigatus was demonstrated by both fluorescent in situ hybridization (FISH) analysis and accumulation in live cells. SPECT imaging of BALB/c mice with pulmonary A. fumigatus infections and administered 99mTc labeled AGEN and AFUM showed immediate and obvious accumulation in the infected lungs, while no significant accumulation of the control 99mTc-cMORF in the infected lung was observed. Compared to non-infected mice, with sacrifice at 1 h, the accumulation of 99mTc-AGEN and 99mTc-AFUM in the lungs of mice infected with A. fumigatus was 2 and 2.7 fold higher respectively. Conclusions: In vivo targeting fungal ribosomal RNA with 99mTc labeled MORF probes AGEN and AFUM

  12. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.

    2011-01-01

    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show this structural change depends only on 16S residues within the S4 binding site. SHAPE chemical-probing experiments showed that S4 strongly stabilizes the five-helix junction and helix 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in helix 16 that makes specific contacts with the S4 N-terminal extension, and a right angle motif between helices 3, 4 and 18, require a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of helix 3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  13. Quinacrine impairs enterovirus 71 RNA replication by preventing binding of polypyrimidine-tract binding protein with internal ribosome entry sites.

    Jianmin Wang

    Full Text Available Since the 1980s, epidemics of enterovirus 71 (EV71 and other enteroviruses have occurred in Asian countries and regions, causing a wide range of human diseases. No effective therapy is available for the treatment of these infections. Internal ribosome entry sites (IRESs are indispensable for the initiation of translation in enteroviruses. Several cellular factors, as well as the ribosome, are recruited to the conserved IRES during this process. Quinacrine intercalates into the RNA architecture and inhibits RNA transcription and protein synthesis, and a recent study showed that quinacrine inhibited encephalomyocarditis virus and poliovirus IRES-mediated translation in vitro without disrupting internal cellular IRES. Here, we report that quinacrine was highly active against EV71, protecting cells from EV71 infection. Replication of viral RNA, expression of viral capsid protein, and production of virus were all strongly inhibited by quinacrine. Interaction of the polypyrimidine tract-binding protein (PTB with the conserved IRES was prevented by quinacrine. Coxsackieviruses and echovirus were also inhibited by quinacrine in cultured cells. These results indicate that quinacrine may serve as a potential protective agent for use in the treatment of patients with chronic enterovirus infection.

  14. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O139 outbreak based on the intergenomic heterogeneity of the 16S-23S rRNA intergenic spacer regions

    Atreyi Ghatak; Anasuya Majumdar; Ranajit K Ghosh

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O139 outbreak. ISR classes ‘a’ and ‘g’ were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O139 serogroup and post-O139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  15. Evaluation of a fluorescence-labelled oligonucleotide tide probe targeting 23S rRNA for in situ detection of Salmonella serovars in paraffin-embedded tissue sections and their rapid identification in bacterial smears

    Nordentoft, Steen; Christensen, H.; Wegener, Henrik Caspar

    1997-01-01

    A method for the detection of Salmonella based on fluorescence in situ hybridization (FISH) has been developed and applied for the direct detection of Salmonella in pure cultures and in formalin-fixed, paraffin-embedded tissue sections. On the basis of the 23S rRNA gene sequences representing all...... oligonucleotide probe makes the FISH technique a promising tool for the rapid identification of S. enterica in bacterial smears, as well as for the detection of S. enterica in histological tissue sections....... of the S. enterica subspecies and S. bongori, an 18-mer oligonucleotide probe was selected. The specificity of the probe was tested by in situ hybridization to bacterial cell smears of pur cultures. Forty-nine of 55 tested Salmonella serovars belonging to subspecies I, II, IIIb, IV, and VI hybridized...... with the probe. The probe did not hybridize to serovars from subspecies IIIa (S. arizonae) or to S. bongori. No cross-reaction to 64 other strains of the family Enterobacteriaceae or 18 other bacterial strains outside this family was observed. The probe was tested with sections of formalin...

  16. Physical Mapping of the 5S Ribosomal RNA Gene in Citreae of Aurantioideae Species using Fluorescence in situ Hybridization

    Yamamoto, Masashi; Asad Asadi Abkenar; Matsumoto, Ryoji; KUBO, Tatsuya; TOMINAGA, Shigeto; ヤマモト, マサシ; マツモト, リョウジ; クボ, タツヤ; トミナガ, シゲト; 山本, 雅史; 松本, 亮司; 久保, 達也; 冨永, 茂人

    2009-01-01

    The location of the 5S ribosomal RNA gene (rDNA) in species from six genera of the Citreae of Aurantioideae was determined using fluorescence in situ hybridization (FISH). A 5S rDNA probe was labeled with biotin-16-dUTP. The probe was detected using a fluorescein isothiocyanate (FITC)-avidin conjugate with chromosomes counterstained with propidium iodide (PI). When the chromosomes were observed under a G filter, PI-stained chromosomes were classified into the following five types based on the...

  17. Translation by ribosome shunting on adenovirus and hsp70 mRNAs facilitated by complementarity to 18S rRNA

    Yueh, Andrew; Schneider, Robert J.

    2000-01-01

    Translation initiation on eukaryotic mRNAs involves 40S ribosome association with mRNA caps (m7GpppN), mediated by initiation factor eIF4F. 40S eukaryotic ribosomes and initiation factors undergo 5′ scanning to the initiation codon, with no known role for complementarity between eukaryotic 18S rRNA and the 5′ noncoding region of mRNAs. We demonstrate that the 5′ noncoding region of human adenovirus late mRNAs, known as the tripartite leader, utilizes a striking complementarity to 18S rRNA to ...

  18. Genetic Analysis of the Invariant Residue G791 in Escherichia coli 16S rRNA Implicates RelA in Ribosome Function▿

    Kim, Hong-Man; Ryou, Sang-Mi; Song, Woo-Seok; Sim, Se-Hoon; Cha, Chang-Jun; Han, Seung Hyun; Ha, Nam-Chul; Kim, Jae-Hong; BAE, Jeehyeon; Cunningham, Philip R.; Lee, Kangseok

    2009-01-01

    Previous studies identified G791 in Escherichia coli 16S rRNA as an invariant residue for ribosome function. In order to establish the functional role of this residue in protein synthesis, we searched for multicopy suppressors of the mutant ribosomes that bear a G-to-U substitution at position 791. We identified relA, a gene whose product has been known to interact with ribosomes and trigger a stringent response. Overexpression of RelA resulted in the synthesis of approximately 1.5 times more...

  19. Dysfunction in Ribosomal Gene Expression in the Hypothalamus and Hippocampus following Chronic Social Defeat Stress in Male Mice as Revealed by RNA-Seq

    Smagin, Dmitry A.; Kovalenko, Irina L.; Galyamina, Anna G.; Bragin, Anatoly O.; Orlov, Yuriy L.; Natalia N. Kudryavtseva

    2016-01-01

    Chronic social defeat stress leads to the development of anxiety- and depression-like states in male mice and is accompanied by numerous molecular changes in brain. The influence of 21-day period of social stress on ribosomal gene expression in five brain regions was studied using the RNA-Seq database. Most Rps, Rpl, Mprs, and Mprl genes were upregulated in the hypothalamus and downregulated in the hippocampus, which may indicate ribosomal dysfunction following chronic social defeat stress. T...

  20. Slip of grip of a molecular motor on a crowded track: Modeling shift of reading frame of ribosome on RNA template

    Mishra, Bhavya; Chowdhury, Debashish

    2016-01-01

    We develop a stochastic model for the programmed frameshift of ribosomes synthesizing a protein while moving along a mRNA template. Normally the reading frame of a ribosome decodes successive triplets of nucleotides on the mRNA in a step-by-step manner. We focus on the programmed shift of the ribosomal reading frame, forward or backward, by only one nucleotide which results in a fusion protein; it occurs when a ribosome temporarily loses its grip to its mRNA track. Special "slippery" sequences of nucleotides and also downstream secondary structures of the mRNA strand are believed to play key roles in programmed frameshift. Here we explore the role of an hitherto neglected parameter in regulating -1 programmed frameshift. Specifically, we demonstrate that the frameshift frequency can be strongly regulated also by the density of the ribosomes, all of which are engaged in simultaneous translation of the same mRNA, at and around the slippery sequence. Monte Carlo simulations support the analytical predictions obt...

  1. Diversity of the marine picocyanobacteria Prochlorococcus and Synechococcus assessed by terminal restriction fragment length polymorphisms of 16S-23S rRNA internal transcribed spacer sequences Diversidad de las picocianobacterias marinas Prochlorococcus y Synechococcus por medio de polimorfismos de longitud de fragmentos de restricción terminal en secuencias del espaciador transcrito interno del ARNr 16S - 23S

    PARIS LAVIN

    2008-12-01

    Full Text Available In order to assess the appropriateness of the use of internal transcribed spacer (ITS sequences for the study of population genetics of marine cyanobacteria, we amplified and cloned the 16S rRNA gene plus the 16S-23S ITS regions of six strains of Prochlorococcus and Synechococcus. We analyzed them by denaturing gradient gel electrophoresis (DGGE and terminal restriction fragment length polymorphisms (T-RFLP. When using the standard application of these techniques, we obtained more than one band or terminal restriction fragment (T-RF per strain or cloned sequence. Reports in literature have suggested that these anomalies can result from the formation of secondary structures. Secondary structures of the ITS sequences of Prochlorococcus and Synechococcus strains were computationally modelled at the different temperatures that were used during the polymerase chain reaction (PCR. Modelling results predicted the existence of hairpin loops that would still be present at the extensión temperature; it is likely that these loops produced incomplete and single stranded PCR products. We modified the standard T-RFLP procedure by adding the labelled ITS primer in the last two cycles of the PCR reaction; this resulted, in most cases, in only one T-RF per ribotype. Application of this technique to a natural picoplankton community in marine waters off northern Chile, showed that it was possible to identify the presence, and determine the relative abundance, of several phylogenetic lineages within the genera Prochlorococcus and Synechococcus inhabiting the euphotic zone. Phylogenetic analysis of ITS sequences obtained by cloning and sequencing DNA from the same sample confirmed the presence of the different genotypes. With the proposed modification, T-RFLP profiles should therefore be suitable for studying the diversity of natural populations of cyanobacteria, and should become an important tool to study the factors influencing the genetic structure and

  2. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    Long, Katherine S.; Vester, Birte

    2012-01-01

    linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design...

  3. Ribosome recycling induces optimal translation rate at low ribosomal availability

    Marshall, E.; Stansfield, I; Romano, M. C.

    2014-01-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3′ end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called ‘closed-loop’ model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces ...

  4. A pseudouridylation switch in rRNA is implicated in ribosome function during the life cycle of Trypanosoma brucei.

    Chikne, Vaibhav; Doniger, Tirza; Rajan, K Shanmugha; Bartok, Osnat; Eliaz, Dror; Cohen-Chalamish, Smadar; Tschudi, Christian; Unger, Ron; Hashem, Yaser; Kadener, Sebastian; Michaeli, Shulamit

    2016-01-01

    The protozoan parasite Trypanosoma brucei, which causes devastating diseases in humans and animals in sub-Saharan Africa, undergoes a complex life cycle between the mammalian host and the blood-feeding tsetse fly vector. However, little is known about how the parasite performs most molecular functions in such different environments. Here, we provide evidence for the intriguing possibility that pseudouridylation of rRNA plays an important role in the capacity of the parasite to transit between the insect midgut and the mammalian bloodstream. Briefly, we mapped pseudouridines (Ψ) on rRNA by Ψ-seq in procyclic form (PCF) and bloodstream form (BSF) trypanosomes. We detected 68 Ψs on rRNA, which are guided by H/ACA small nucleolar RNAs (snoRNA). The small RNome of both life cycle stages was determined by HiSeq and 83 H/ACAs were identified. We observed an elevation of 21 Ψs modifications in BSF as a result of increased levels of the guiding snoRNAs. Overexpression of snoRNAs guiding modification on H69 provided a slight growth advantage to PCF parasites at 30 °C. Interestingly, these modifications are predicted to significantly alter the secondary structure of the large subunit (LSU) rRNA suggesting that hypermodified positions may contribute to the adaption of ribosome function during cycling between the two hosts. PMID:27142987

  5. Detection of the A2058G and A2059G 23S rRNA Gene Point Mutations Associated with Azithromycin Resistance in Treponema pallidum by Use of a TaqMan Real-Time Multiplex PCR Assay

    Chi, Kai-Hua; Pillay, Allan; Nachamkin, Eli; Su, John R.; Ballard, Ronald C.

    2013-01-01

    Macrolide treatment failure in syphilis patients is associated with a single point mutation (either A2058G or A2059G) in both copies of the 23S rRNA gene in Treponema pallidum strains. The conventional method for the detection of both point mutations uses nested PCR combined with restriction enzyme digestions, which is laborious and time-consuming. We initially developed a TaqMan-based real-time duplex PCR assay for detection of the A2058G mutation, and upon discovery of the A2059G mutation, we modified the assay into a triplex format to simultaneously detect both mutations. The point mutations detected by the real-time triplex PCR were confirmed by pyrosequencing. A total of 129 specimens PCR positive for T. pallidum that were obtained from an azithromycin resistance surveillance study conducted in the United States were analyzed. Sixty-six (51.2%) of the 129 samples with the A2058G mutation were identified by both real-time PCR assays. Of the remaining 63 samples that were identified as having a macrolide-susceptible genotype by the duplex PCR assay, 17 (27%) were found to contain the A2059G mutation by the triplex PCR. The proportions of macrolide-susceptible versus -resistant genotypes harboring either the A2058G or the A2059G mutation among the T. pallidum strains were 35.6, 51.2, and 13.2%, respectively. None of the T. pallidum strains examined had both point mutations. The TaqMan-based real-time triplex PCR assay offers an alternative to conventional nested PCR and restriction fragment length polymorphism analyses for the rapid detection of both point mutations associated with macrolide resistance in T. pallidum. PMID:23284026

  6. Comparison of multiple genes and 16S-23S rRNA intergenic space region for their capacity in high resolution melt curve analysis to differentiate Mycoplasma gallisepticum vaccine strain ts-11 from field strains.

    Ghorashi, Seyed A; Bradbury, Janet M; Ferguson-Noel, Naola M; Noormohammadi, Amir H

    2013-12-27

    Mycoplasma gallisepticum (MG) is an important avian pathogen causing significant economic losses in the global poultry industry. In an attempt to compare and evaluate existing genotyping methods for differentiation of MG strains/isolates, high resolution melt (HRM) curve analysis was applied to 5 different PCR methods targeting vlhA, pvpA, gapA, mgc2 genes and 16S-23S rRNA intergenic space region (IGSR). To assess the discriminatory power of PCR-HRM of examined genes and IGSR, MG strains ts-11, F, 6/85 and S6, and, initially, 8 field isolates were tested. All MG strains/isolates were differentiated using PCR-HRM curve analysis and genotype confidence percentage (GCP) values of vlhA and pvpA genes, while only 0, 3 and 4 out of 12 MG strains/isolates were differentiated using gapA, mgc2 genes and IGSR, respectively. The HRM curve analysis of vlhA and pvpA genes was found to be highly correlated with the genetic diversity of the targeted genes confirmed by sequence analysis of amplicons generated from MG strains. The potential of the vlhA and pvpA genes was also demonstrated for genotyping of 12 additional MG strains from Europe and the USA. Results from this study provide a direct comparison between genes previously used in sequencing-based genotyping methods for MG strain identification and highlight the usefulness of vlhA and pvpA HRM curve analyses as rapid and reliable tools specially for diagnosis and differentiation of MG strains used here. PMID:24238667

  7. Stem–loop structures can effectively substitute for an RNA pseudoknot in −1 ribosomal frameshifting

    Yu, Chien-Hung; Noteborn, Mathieu H.; Pleij, Cornelis W. A.; Olsthoorn, René C. L.

    2011-01-01

    −1 Programmed ribosomal frameshifting (PRF) in synthesizing the gag-pro precursor polyprotein of Simian retrovirus type-1 (SRV-1) is stimulated by a classical H-type pseudoknot which forms an extended triple helix involving base–base and base–sugar interactions between loop and stem nucleotides. Recently, we showed that mutation of bases involved in triple helix formation affected frameshifting, again emphasizing the role of the triple helix in −1 PRF. Here, we investigated the efficiency of ...

  8. An automated procedure for covariation-based detection of RNA structure

    Winker, S.; Overbeek, R.; Woese, C.R.; Olsen, G.J.; Pfluger, N.

    1989-12-01

    This paper summarizes our investigations into the computational detection of secondary and tertiary structure of ribosomal RNA. We have developed a new automated procedure that not only identifies potential bondings of secondary and tertiary structure, but also provides the covariation evidence that supports the proposed bondings, and any counter-evidence that can be detected in the known sequences. A small number of previously unknown bondings have been detected in individual RNA molecules (16S rRNA and 7S RNA) through the use of our automated procedure. Currently, we are systematically studying mitochondrial rRNA. Our goal is to detect tertiary structure within 16S rRNA and quaternary structure between 16S and 23S rRNA. Our ultimate hope is that automated covariation analysis will contribute significantly to a refined picture of ribosome structure. Our colleagues in biology have begun experiments to test certain hypotheses suggested by an examination of our program's output. These experiments involve sequencing key portions of the 23S ribosomal RNA for species in which the known 16S ribosomal RNA exhibits variation (from the dominant pattern) at the site of a proposed bonding. The hope is that the 23S ribosomal RNA of these species will exhibit corresponding complementary variation or generalized covariation. 24 refs.

  9. An automated procedure for covariation-based detection of RNA structure

    This paper summarizes our investigations into the computational detection of secondary and tertiary structure of ribosomal RNA. We have developed a new automated procedure that not only identifies potential bondings of secondary and tertiary structure, but also provides the covariation evidence that supports the proposed bondings, and any counter-evidence that can be detected in the known sequences. A small number of previously unknown bondings have been detected in individual RNA molecules (16S rRNA and 7S RNA) through the use of our automated procedure. Currently, we are systematically studying mitochondrial rRNA. Our goal is to detect tertiary structure within 16S rRNA and quaternary structure between 16S and 23S rRNA. Our ultimate hope is that automated covariation analysis will contribute significantly to a refined picture of ribosome structure. Our colleagues in biology have begun experiments to test certain hypotheses suggested by an examination of our program's output. These experiments involve sequencing key portions of the 23S ribosomal RNA for species in which the known 16S ribosomal RNA exhibits variation (from the dominant pattern) at the site of a proposed bonding. The hope is that the 23S ribosomal RNA of these species will exhibit corresponding complementary variation or generalized covariation. 24 refs

  10. The majority of total nuclear-encoded non-ribosomal RNA in a human cell is 'dark matter' un-annotated RNA

    Milos Patrice

    2010-12-01

    Full Text Available Abstract Background Discovery that the transcriptional output of the human genome is far more complex than predicted by the current set of protein-coding annotations and that most RNAs produced do not appear to encode proteins has transformed our understanding of genome complexity and suggests new paradigms of genome regulation. However, the fraction of all cellular RNA whose function we do not understand and the fraction of the genome that is utilized to produce that RNA remain controversial. This is not simply a bookkeeping issue because the degree to which this un-annotated transcription is present has important implications with respect to its biologic function and to the general architecture of genome regulation. For example, efforts to elucidate how non-coding RNAs (ncRNAs regulate genome function will be compromised if that class of RNAs is dismissed as simply 'transcriptional noise'. Results We show that the relative mass of RNA whose function and/or structure we do not understand (the so called 'dark matter' RNAs, as a proportion of all non-ribosomal, non-mitochondrial human RNA (mt-RNA, can be greater than that of protein-encoding transcripts. This observation is obscured in studies that focus only on polyA-selected RNA, a method that enriches for protein coding RNAs and at the same time discards the vast majority of RNA prior to analysis. We further show the presence of a large number of very long, abundantly-transcribed regions (100's of kb in intergenic space and further show that expression of these regions is associated with neoplastic transformation. These overlap some regions found previously in normal human embryonic tissues and raises an interesting hypothesis as to the function of these ncRNAs in both early development and neoplastic transformation. Conclusions We conclude that 'dark matter' RNA can constitute the majority of non-ribosomal, non-mitochondrial-RNA and a significant fraction arises from numerous very long