WorldWideScience

Sample records for 19f nuclear magnetic

  1. Tracking Transitions in Spider Wrapping Silk Conformation and Dynamics by (19)F Nuclear Magnetic Resonance Spectroscopy.

    Sarker, Muzaddid; Orrell, Kathleen E; Xu, Lingling; Tremblay, Marie-Laurence; Bak, Jessi J; Liu, Xiang-Qin; Rainey, Jan K

    2016-05-31

    Aciniform silk protein (AcSp1) is the primary component of wrapping silk, the toughest of the spider silks because of a combination of high tensile strength and extensibility. Argiope trifasciata AcSp1 contains a core repetitive domain with at least 14 homogeneous 200-amino acid units ("W" units). Upon fibrillogenesis, AcSp1 converts from an α-helix-rich soluble state to a mixed α-helical/β-sheet conformation. Solution-state nuclear magnetic resonance (NMR) spectroscopy allowed demonstration of variable local stability within the W unit, but comprehensive characterization was confounded by spectral overlap, which was exacerbated by decreased chemical shift dispersion upon denaturation. Here, (19)F NMR spectroscopy, in the context of a single W unit (W1), is applied to track changes in structure and dynamics. Four strategic positions in the W unit were mutated to tryptophan and biosynthetically labeled with 5-fluorotryptophan (5F-Trp). Simulated annealing-based structure calculations implied that these substitutions should be tolerated, while circular dichroism (CD) spectroscopy and (1)H-(15)N chemical shift displacements indicated minimal structural perturbation in W1 mutants. Fiber formation by W2 concatemers containing 5F-Trp substitutions in both W units demonstrated retention of functionality, a somewhat surprising finding in light of sequence conservation between species. Each 5F-Trp-labeled W1 exhibited a unique (19)F chemical shift, line width, longitudinal relaxation time constant (T1), and solvent isotope shift. Perturbation to (19)F chemical shift and nuclear spin relaxation parameters reflected changes in the conformation and dynamics at each 5F-Trp site upon addition of urea and dodecylphosphocholine (DPC). (19)F NMR spectroscopy allowed unambiguous localized tracking throughout titration with each perturbant, demonstrating distinct behavior for each perturbant not previously revealed by heteronuclear NMR experiments. PMID:27153372

  2. Study of fluorine in silicate glass with 19F nuclear magnetic resonance spectroscopy

    Duncan, T. M.; Douglass, D. C.; Csencsits, R.; Walker, K. L.

    1986-07-01

    We report an application of nuclear magnetic resonance (NMR) spectroscopy to the study of fluorine-doped silicate glass prepared by the modified chemical vapor deposition process, prior to drawing the rod into fibers. The silica contains 1.03-wt. % fluorine, as determined by the calibrated intensity of the 19F NMR spectrum. The isotropic chemical shift of the 19F spectrum shows that fluorine bonds only to silicon; there is no evidence of oxyfluorides. Analysis of the distribution of nuclear dipolar couplings between fluorine nuclei reveals that the relative populations of silicon monofluoride sites [Si(O-)3F] and species having near-neighbor fluorines, such as silicon difluoride sites [Si(O-)2F2], are nearly statistically random. That is, to a good approximation, the fluorine substitutes randomly into the oxygen sites of the silica network. There is no evidence of local clusters of fluorine sites, silicon trifluoride sites [Si(O-)F3], or silicon tetrafluoride (SiF4).

  3. Study of the metabolism of flucytosine in Aspergillus species by 19F nuclear magnetic resonance spectroscopy

    The metabolism of flucytosine (5FC) in two Aspergillus species (Aspergillus fumigatus and A. niger) was investigated by 19F nuclear magnetic resonance spectroscopy. In intact mycelia, 5FC was found to be deaminated to 5-fluorouracil and then transformed into fluoronucleotides; the catabolite alpha-fluoro-beta-alanine was also detected in A. fumigatus. Neither 5-fluoroorotic acid nor 5-fluoro-2'-deoxyuridine-5'-monophosphate was detected in perchloric acid extracts after any incubation with 5FC. 5FC, 5-fluorouracil, and the classical fluoronucleotides 5-fluorouridine-5'-mono-, di-, and triphosphates were identified in the acid-soluble pool. Two hydrolysis products of 5-fluorouracil incorporated into RNA, 5-fluorouridine-2'-monophosphate and 5-fluorouridine-3'-monophosphate, were found in the acid-insoluble pool. No significant differences in the metabolic transformation of 5FC were noted in the two species of Aspergillus. The main pathway of 5FC metabolism in the two species of Aspergillus studied is thus the biotransformation into ribofluoronucleotides and the subsequent incorporation of 5-fluorouridine-5'-triphosphate into RNA

  4. 1H and 19F nuclear magnetic resonance microimaging of water and chemical distribution in soil columns.

    Simpson, Myrna J; Simpson, André J; Gross, Dieter; Spraul, Manfred; Kingery, William L

    2007-07-01

    Nuclear magnetic resonance (NMR) microimaging is a noninvasive and nondestructive technique that has great potential for the study of soil processes. Hydrogen-1 NMR microimaging techniques were used to examine the distribution of water in four different soil cores. Fluorine-19 NMR microimaging is also used to study the transport of three model contaminants (hexafluorobenzene, sodium fluoride, and trifluralin) in soil columns. The 1H water distribution studies demonstrate that NMR microimaging can provide unique detail regarding the nature and location of water in soils. Image distortion (magnetic susceptibility) was observed for soil samples low in water (20-28% by weight) and that contained an iron content of 0.73 to 0.99%. Highly resolved images were obtained for the organic-rich soil (Croatan sample) and also facilitated the analysis of bound and unbound soil water through varying spin echo times. The contaminant studies with 19F NMR demonstrated that preferential flow processes can be observed in soil cores in as little as 16 h. Studies with hexafluorobenzene produced the highest quality images whereas the definition decreased over time with both trifluralin and sodium fluoride as the compounds penetrated the soil. Nonetheless, both 1H and 19F NMR microimaging techniques demonstrate great promise for studying soil processes. PMID:17665672

  5. Evidence for the importance of 5'-deoxy-5-fluorouridine catabolism in humans from 19F nuclear magnetic resonance spectrometry.

    Malet-Martino, M C; Armand, J P; Lopez, A; Bernadou, J; Béteille, J P; Bon, M; Martino, R

    1986-04-01

    The use of a new methodology, 19F nuclear magnetic resonance, has allowed detection of all the fluorinated metabolites in the biofluids of patients treated with 5'-deoxy-5-fluorouridine (5'-dFUrd) injected i.v. at a dose of 10 g/m2 over 6 h. This technique, which requires no labeled drug, allows a direct study of the biological sample with no need for extraction or derivatization and a simultaneous identification and quantitation of all the different fluorinated metabolites. As well as the already known metabolites, unmetabolized 5'-dFUrd, 5-fluorouracil, and 5,6-dihydro-5-fluorouracil, the presence of alpha-fluoro-beta-ureidopropionic acid, alpha-fluoro-beta-alanine (FBAL), N-carboxy-alpha-fluoro-beta-alanine, and the fluoride anion F- is reported. The catabolic pathway proposed for 5'-dFUrd is analogous to that of 5-fluorouracil, completed with FBAL----F- step, and the plasmatic equilibrium of FBAL with N-carboxy-alpha-fluoro-beta-alanine, its N-carboxy derivative. The quantitative analysis of the different metabolites found in plasma and urine emphasizes the significance of the catabolic pathway. High concentrations of alpha-fluoro-beta ureidopropionic acid and FBAL are recovered in plasma from 3 h after the beginning of the perfusion to 1 h after its end. The global urinary excretion results show that there is a high excretion of 5'-dFUrd and metabolites. Unchanged 5'-dFUrd and FBAL are by far the major excretory products and are at nearly equal rates. The protocol followed in this study produces relatively low but persistent plasmatic concentrations of 5-fluorouracil throughout the perfusion. PMID:2936452

  6. Alternate strategies to obtain mass balance without the use of radiolabeled compounds: application of quantitative fluorine (19F) nuclear magnetic resonance (NMR) spectroscopy in metabolism studies.

    Mutlib, Abdul; Espina, Robert; Atherton, James; Wang, Jianyao; Talaat, Rasmy; Scatina, JoAnn; Chandrasekaran, Appavu

    2012-03-19

    Nuclear magnetic resonance (NMR) spectroscopy is playing an increasingly important role in the quantitation of small and large molecules. Recently, we demonstrated that (1)H NMR could be used to quantitate drug metabolites isolated in submilligram quantities from biological sources. It was shown that these metabolites, once quantitated by NMR, were suitable to be used as reference standards in quantitative LC/MS-based assays, hence circumventing the need for radiolabeled material or synthetic standards to obtain plasma exposure estimates in humans and preclinical species. The quantitative capabilities of high-field NMR is further demonstrated in the current study by obtaining the mass balance of fluorinated compounds using (19)F-NMR. Two fluorinated compounds which were radio-labeled with carbon-14 on metabolically stable positions were dosed in rats and urine and feces collected. The mass balance of the compounds was obtained initially by counting the radioactivity present in each sample. Subsequently, the same sets of samples were analyzed by (19)F-NMR, and the concentrations determined by this method were compared with data obtained using radioactivity counting. It was shown that the two methods produced comparable values. To demonstrate the value of this analytical technique in drug discovery, a fluorinated compound was dosed intravenously in dogs and feces and urine collected. Initial profiling of samples showed that this compound was excreted mainly unchanged in feces, and hence, an estimate of mass balance was obtained using (19)F-NMR. The data obtained by this method was confirmed by additional quantitative studies using mass spectrometry. Hence cross-validations of the quantitative (19)F-NMR method by radioactivity counting and mass spectrometric analysis were demonstrated in this study. A strategy outlining the use of fluorinated compounds in conjunction with (19)F-NMR to understand their routes of excretion or mass balance in animals is proposed. These

  7. 19F nuclear magnetic resonance spectroscopy as a probe of macromolecular interactions: Observations of the bacteriophage λ cro repressor with specific and nonspecific DNA

    The approach taken for these investigations involves the biosynthetic incorporation of the 19F nucleus on fluoroamino acid analogues into cro repressor. The effect of the fluoroanalogues on the overall structure of the protein was investigated using two dimensional proton nuclear magnetic resonance (NMR) spectroscopy. The effect of the fluoroanalogues on the activity of the protein was investigated using a steady state fluorescence assay. 19F NMR studies of the interaction of cro repressor with DNA include the assignment of the fluorotyrosyl residues implicated in the interaction with DNA, a comparison of the interaction of cro repressor with OR3 and nonspecific DNA fragments, and a comparison of the binding of cro repressor with OR3 fragments of various sizes. It has been demonstrated that the incorporation of 3-fluorotyrosin into cro repressor does not effect the overall structure of the protein as detected by nuclear Overhauser enhancement 1H NHR spectroscopy. The results of the fluorescence assay demonstrate that the 3-fluorotyrosyl cro repressor binds to DNA. The incorporation of 3-fluorotyrosine into cro repressor does not alter the binding of the cro repressor to OR3, as measured by the concentration of KCl needed to dissociate the complexes

  8. Injectable hyaluronic acid hydrogel for 19F magnetic resonance imaging

    Yang, X.; Sun, Y.; Kootala, S.; Hilborn, J.; Heerschap, A.; Ossipov, D.

    2014-01-01

    We report on a 19F labeled injectable hyaluronic acid (HA) hydrogel that can be monitored by both 1H and 19F MR imaging. The HA based hydrogel formed via carbazone reaction can be obtained within a minute by simple mixing of HA-carbazate and HA-aldehyde derivatized polymers. 19F contrast agent was l

  9. In vivo tracking of human neural stem cells with 19F magnetic resonance imaging.

    Philipp Boehm-Sturm

    Full Text Available BACKGROUND: Magnetic resonance imaging (MRI is a promising tool for monitoring stem cell-based therapy. Conventionally, cells loaded with ironoxide nanoparticles appear hypointense on MR images. However, the contrast generated by ironoxide labeled cells is neither specific due to ambiguous background nor quantitative. A strategy to overcome these drawbacks is (19F MRI of cells labeled with perfluorocarbons. We show here for the first time that human neural stem cells (NSCs, a promising candidate for clinical translation of stem cell-based therapy of the brain, can be labeled with (19F as well as detected and quantified in vitro and after brain implantation. METHODOLOGY/PRINCIPAL FINDINGS: Human NSCs were labeled with perfluoropolyether (PFPE. Labeling efficacy was assessed with (19F MR spectroscopy, influence of the label on cell phenotypes studied by immunocytochemistry. For in vitro MRI, NSCs were suspended in gelatin at varying densities. For in vivo experiments, labeled NSCs were implanted into the striatum of mice. A decrease of cell viability was observed directly after incubation with PFPE, which re-normalized after 7 days in culture of the replated cells. No label-related changes in the numbers of Ki67, nestin, GFAP, or βIII-tubulin+ cells were detected, both in vitro and on histological sections. We found that 1,000 NSCs were needed to accumulate in one image voxel to generate significant signal-to-noise ratio in vitro. A detection limit of ∼10,000 cells was found in vivo. The location and density of human cells (hunu+ on histological sections correlated well with observations in the (19F MR images. CONCLUSION/SIGNIFICANCE: Our results show that NSCs can be efficiently labeled with (19F with little effects on viability or proliferation and differentiation capacity. We show for the first time that (19F MRI can be utilized for tracking human NSCs in brain implantation studies, which ultimately aim for restoring loss of function after

  10. Magnetic properties and hyperfine interactions in Cr8, Cr7Cd, and Cr7Ni molecular rings from 19F-NMR

    Bordonali, L.; Garlatti, E.; Casadei, C. M.; Furukawa, Y.; Lascialfari, A.; Carretta, S.; Troiani, F.; Timco, G.; Winpenny, R. E. P.; Borsa, F.

    2014-04-01

    A detailed experimental investigation of the 19F nuclear magnetic resonance is made on single crystals of the homometallic Cr8 antiferromagnetic molecular ring and heterometallic Cr7Cd and Cr7Ni rings in the low temperature ground state. Since the F- ion is located midway between neighboring magnetic metal ions in the ring, the 19F-NMR spectra yield information about the local electronic spin density and 19F hyperfine interactions. In Cr8, where the ground state is a singlet with total spin ST = 0, the 19F-NMR spectra at 1.7 K and low external magnetic field display a single narrow line, while when the magnetic field is increased towards the first level crossing field, satellite lines appear in the 19F-NMR spectrum, indicating a progressive increase in the Boltzmann population of the first excited state ST = 1. In the heterometallic rings, Cr7Cd and Cr7Ni, whose ground state is magnetic with ST = 3/2 and ST = 1/2, respectively, the 19F-NMR spectrum has a complicated structure which depends on the strength and orientation of the magnetic field, due to both isotropic and anisotropic transferred hyperfine interactions and classical dipolar interactions. From the 19F-NMR spectra in single crystals we estimated the transferred hyperfine constants for both the F--Ni2+ and the F--Cd2+ bonds. The values of the hyperfine constants compare well to the ones known for F--Ni2+ in KNiF3 and NiF2 and for F--Cr3+ in K2NaCrF6. The results are discussed in terms of hybridization of the 2s, 2p orbitals of the F- ion and the d orbitals of the magnetic ion. Finally, we discuss the implications of our results for the electron-spin decoherence.

  11. A General and Facile Strategy to Fabricate Multifunctional Nanoprobes for Simultaneous (19)F Magnetic Resonance Imaging, Optical/Thermal Imaging, and Photothermal Therapy.

    Hu, Gaofei; Li, Nannan; Tang, Juan; Xu, Suying; Wang, Leyu

    2016-09-01

    (19)F magnetic resonance imaging (MRI), due to its high sensitivity and negligible background, is anticipated to be a powerful noninvasive, sensitive, and accurate molecular imaging technique. However, the major challenge of (19)F MRI is to increase the number of (19)F atoms while maintaining the solubility and molecular mobility of the probe. Here, we successfully developed a facile and general strategy to synthesize the multifunctional (19)F MRI nanoprobes by encapsulating the hydrophobic inorganic nanoparticles (NPs) into a hybrid polymer micelle consisting of hydrolysates of 1H,1H,2H,2H-perfluorodecyltriethoxysilane (PDTES) and oleylamine-functionalized poly(succinimide) (PSIOAm). Due to their good water dispersibility, excellent molecular mobility resulting from the ultrathin coating, and high (19)F atom numbers, these nanoprobes generate a separate sharp singlet of (19)F nuclear magnetic resonance (NMR) signal (at -82.8 ppm) with half peak width of ∼28 Hz, which is highly applicable for (19)F MRI. Significantly, by varying the inorganic core from metals (Au), oxides (Fe3O4), fluorides (NaYF4:Yb(3+)/Er(3+)), and phosphates (YPO4) to semiconductors (Cu7S4 and Ag2S, ZnS:Mn(2+)) NPs, which renders the nanoprobes' multifunctional properties such as photothermal ability (Au, Cu7S4), magnetism (Fe3O4), fluorescence (ZnS:Mn(2+)), near-infrared (NIR) fluorescence (Ag2S), and upconversion (UC) luminescence. Meanwhile, the as-prepared nanoprobes possess relatively small sizes (about 50 nm), which is beneficial for long-time circulation. The proof-of-concept in vitro (19)F NMR and photothermal ablation of ZnS:Mn(2+)@PDTES/PSIOAm and Cu7S4@PDTES/PSIOAm nanoprobes further suggest that these nanoprobes hold wide potentials for multifunctional applications in biomedical fields. PMID:27534896

  12. Tumour oxygenation measurements by 19F magnetic resonance imaging of perfluorocarbons

    Solid tumours are well known to be heterogeneous and contain a significant fraction of hypoxic cells, which are protected against the effects of radiotherapy. A non-invasive method for measuring tissue oxygenation would therefore be useful. The 19F magnetic resonance signals from perfluorocarbons are sensitive to oxygen concentration. We have used this property to measure tumour oxygenation of the GH3 prolactinoma, RIF-1 fibrosarcoma and SaF sarcoma in mice by fluorine magnetic resonance imaging (MRI) of intravenously injected perfluorocarbons which are taken up by macrophages in the tumour. We have also studied the injection of perfluorocarbons directly into the tumour, which allows less of the tumour to be studied but has a higher success rate and gives values more consistent with Eppendorf polarographic electrode measurements. (author)

  13. 19F Spin-lattice Relaxation of Perfluoropolyethers: Dependence on Temperature and Magnetic Field Strength (7.0-14.1T)

    Kadayakkara, Deepak K.; Damodaran, Krishnan; Hitchens, T. Kevin; Bulte, Jeff W.M.; Ahrens, Eric T.

    2014-01-01

    Fluorine (19F) MRI of perfluorocarbon labeled cells has become a powerful technique to track the migration and accumulation of cells in living organisms. It is common to label cells for 19F MRI with nanoemulsions of perfluoropolyethers that contain a large number of chemically equivalent fluorine atoms. Understanding the mechanisms of 19F nuclear relaxation, and in particular the spin-lattice relaxation of these molecules, is critical to improving experimental sensitivity. To date, the temperature and magnetic field strength dependence of spin-lattice relaxation rate constant (R1) for perfluoropolyethers has not been described in detail. In this study, we evaluated R1 of linear perfluoropolyether (PFPE) and cyclic perfluoro-15-crown-5 ether (PCE) at three magnetic field strengths (7.0, 9.4, and 14.1 T) and at temperatures ranging from 256-323K. Our results show that R1 of perfluoropolyethers is dominated by dipole-dipole interactions and chemical shift anisotropy. R1 increased with magnetic field strength for both PCE and PFPE. In the temperature range studied, PCE was in the fast motion regime (ωτc < 1) at all field strengths, but for PFPE, R1 passed through a maximum, from which the rotational correlation time was estimated. The importance of these measurements for the rational design of new 19F MRI agents and methods is discussed. PMID:24594752

  14. (19)F spin-lattice relaxation of perfluoropolyethers: Dependence on temperature and magnetic field strength (7.0-14.1T).

    Kadayakkara, Deepak K; Damodaran, Krishnan; Hitchens, T Kevin; Bulte, Jeff W M; Ahrens, Eric T

    2014-05-01

    Fluorine ((19)F) MRI of perfluorocarbon-labeled cells has become a powerful technique to track the migration and accumulation of cells in living organisms. It is common to label cells for (19)F MRI with nanoemulsions of perfluoropolyethers that contain a large number of chemically equivalent fluorine atoms. Understanding the mechanisms of (19)F nuclear relaxation, and in particular the spin-lattice relaxation of these molecules, is critical to improving experimental sensitivity. To date, the temperature and magnetic field strength dependence of spin-lattice relaxation rate constant (R1) for perfluoropolyethers has not been described in detail. In this study, we evaluated the R1 of linear perfluoropolyether (PFPE) and cyclic perfluoro-15-crown-5 ether (PCE) at three magnetic field strengths (7.0, 9.4, and 14.1T) and at temperatures ranging from 256-323K. Our results show that R1 of perfluoropolyethers is dominated by dipole-dipole interactions and chemical shift anisotropy. R1 increased with magnetic field strength for both PCE and PFPE. In the temperature range studied, PCE was in the fast motion regime (ωτc<1) at all field strengths, but for PFPE, R1 passed through a maximum, from which the rotational correlation time was estimated. The importance of these measurements for the rational design of new (19)F MRI agents and methods is discussed. PMID:24594752

  15. 19F nuclear magnetic resonance analysis of the carbamate reaction of alpha-fluoro-beta-alanine (FBAL), the major catabolite of fluoropyrimidines. Application to FBAL carbamate determination in body fluids of patients treated with 5'-deoxy-5-fluorouridine

    alpha-Fluoro-beta-alanine (FBAL), the major catabolite of the antineoplastic fluoropyrimidines, is an amino acid which is in equilibrium with its carbamate derivative in weakly alkaline aqueous solutions containing carbonate. In both water and control biological fluids (urine, plasma) spiked with FBAL (and sodium bicarbonate, in some cases), 19F NMR was used: (i) to determine the pH range over which FBAL carbamate is present (pH greater than or equal to 7), the maximum concentration formed occurring around pH 9, (ii) to show that the amino group of FBAL interacts very slowly with a non-protein plasma component to form a compound X, unstable in acid medium. The presumed structure of X is RCONHCH2CHFCOOH, with R different from an alkyl group but still unidentified. The behavior of FBAL in urine and plasma of rats treated with FBAL or 5'-deoxy-5-fluorouridine (5'-dFUrd), a prodrug of 5-fluorouracil, and from patients treated with 5'-dFUrd was investigated. FBAL carbamate was not present in acid medium and was therefore absent in acidic human urine. However, it was found in alkaline rat urine. FBAL carbamate was found in plasma along with the compound X. The 19F NMR spectra of FBAL and derivatives are complex since alpha-fluoro-beta-ureido-propionic acid, the precursor of FBAL in the catabolic pathway of antineoplastic fluoropyrimidines, produces a signal overlapping that of FBAL carbamate, and very close to that of compound X

  16. Visualizing arthritic inflammation and therapeutic response by fluorine-19 magnetic resonance imaging (19F MRI

    Balducci Anthony

    2012-06-01

    Full Text Available Abstract Background Non-invasive imaging of inflammation to measure the progression of autoimmune diseases, such as rheumatoid arthritis (RA, and to monitor responses to therapy is critically needed. V-Sense, a perfluorocarbon (PFC contrast agent that preferentially labels inflammatory cells, which are then recruited out of systemic circulation to sites of inflammation, enables detection by 19F MRI. With no 19F background in the host, detection is highly-specific and can act as a proxy biomarker of the degree of inflammation present. Methods Collagen-induced arthritis in rats, a model with many similarities to human RA, was used to study the ability of the PFC contrast agent to reveal the accumulation of inflammation over time using 19F MRI. Disease progression in the rat hind limbs was monitored by caliper measurements and 19F MRI on days 15, 22 and 29, including the height of clinically symptomatic disease. Naïve rats served as controls. The capacity of the PFC contrast agent and 19F MRI to assess the effectiveness of therapy was studied in a cohort of rats administered oral prednisolone on days 14 to 28. Results Quantification of 19F signal measured by MRI in affected limbs was linearly correlated with disease severity. In animals with progressive disease, increases in 19F signal reflected the ongoing recruitment of inflammatory cells to the site, while no increase in 19F signal was observed in animals receiving treatment which resulted in clinical resolution of disease. Conclusion These results indicate that 19F MRI may be used to quantitatively and qualitatively evaluate longitudinal responses to a therapeutic regimen, while additionally revealing the recruitment of monocytic cells involved in the inflammatory process to the anatomical site. This study may support the use of 19F MRI to clinically quantify and monitor the severity of inflammation, and to assess the effectiveness of treatments in RA and other diseases with an inflammatory

  17. Nuclear and astrophysical aspects of 18O(p,γ)19F

    The capture reaction 18O(p,γ)19F has been investigated in the energy range Esub(p) = 80-2200 keV. The seven known resonances have been studied in detail and twelve new resonances have been found. The resonances at Esub(R) = 680, 977 and 1670 keV correspond to new states in 19F. The known resonance at Esub(R) = 631 keV is observed to consist of a doublet (ΔEsub(p) = 7 keV). Information on resonance energies, total and partial widths, branching and mixing ratios and ωγ values is reported. Transition strength arguments as well as analyses of γ-ray angular distribution data combined with results from previous work resulted in Jsup(π) assignments for some of the resonances and low-lying states in 19F. The assignment of several states in 19F as T = 3/2 analogue states of 19O is discussed. A direct capture process to several final states in 19F up to Esub(x) = 8.8 MeV has been observed revealing information on the orbital momenta of the captured protons in the final states, their spectroscopic factors and Jsup(π) assignments for interfering resonances. Special efforts were made to detect this process to states near the proton threshold, which are of importance to stellar hydrogen burning of 18O. The results are compared with corresponding information from other reactions. The investigated energy range of the 18O(p,γ)19F reaction corresponds to the important stellar temperature range of T = 0.01 to 5 X 109 K. The energy-averaged astrophysical reaction rates determined from the present data are compared with previous estimates for this reaction. The data permit reliable conclusions to be drawn concerning the final termination of the CNO tri-cycle. (orig.)

  18. 19F magnetic resonance imaging for stem/progenitor cell tracking with multiple unique perfluorocarbon nanobeacons.

    Partlow, Kathryn C; Chen, Junjie; Brant, Jason A; Neubauer, Anne M; Meyerrose, Todd E; Creer, Michael H; Nolta, Jan A; Caruthers, Shelton D; Lanza, Gregory M; Wickline, Samuel A

    2007-06-01

    MRI has been employed to elucidate the migratory behavior of stem/progenitor cells noninvasively in vivo with traditional proton (1H) imaging of iron oxide nanoparticle-labeled cells. Alternatively, we demonstrate that fluorine (19F) MRI of cells labeled with different types of liquid perfluorocarbon (PFC) nanoparticles produces unique and sensitive cell markers distinct from any tissue background signal. To define the utility for cell tracking, mononuclear cells harvested from human umbilical cord blood were grown under proendothelial conditions and labeled with nanoparticles composed of two distinct PFC cores (perfluorooctylbromide and perfluoro-15-crown-5 ether). The sensitivity for detecting and imaging labeled cells was defined on 11.7T (research) and 1.5T (clinical) scanners. Stem/progenitor cells (CD34+ CD133+ CD31+) readily internalized PFC nanoparticles without aid of adjunctive labeling techniques, and cells remained functional in vivo. PFC-labeled cells exhibited distinct 19F signals and were readily detected after both local and intravenous injection. PFC nanoparticles provide an unequivocal and unique signature for stem/progenitor cells, enable spatial cell localization with 19F MRI, and permit quantification and detection of multiple fluorine signatures via 19F MR spectroscopy. This method should facilitate longitudinal investigation of cellular events in vivo for multiple cell types simultaneously. PMID:17284484

  19. 19F magnetic resonance imaging for stem/progenitor cell tracking with multiple unique perfluorocarbon nanobeacons.

    Partlow KC; Chen J; Brant JA; Neubauer AM; Meyerrose TE; Creer MH; Nolta JA; Caruthers SD; Lanza GM; Wickline SA

    2007-06-01

    MRI has been employed to elucidate the migratory behavior of stem/progenitor cells noninvasively in vivo with traditional proton (1H) imaging of iron oxide nanoparticle-labeled cells. Alternatively, we demonstrate that fluorine (19F) MRI of cells labeled with different types of liquid perfluorocarbon (PFC) nanoparticles produces unique and sensitive cell markers distinct from any tissue background signal. To define the utility for cell tracking, mononuclear cells harvested from human umbilical cord blood were grown under proendothelial conditions and labeled with nanoparticles composed of two distinct PFC cores (perfluorooctylbromide and perfluoro-15-crown-5 ether). The sensitivity for detecting and imaging labeled cells was defined on 11.7T (research) and 1.5T (clinical) scanners. Stem/progenitor cells (CD34+ CD133+ CD31+) readily internalized PFC nanoparticles without aid of adjunctive labeling techniques, and cells remained functional in vivo. PFC-labeled cells exhibited distinct 19F signals and were readily detected after both local and intravenous injection. PFC nanoparticles provide an unequivocal and unique signature for stem/progenitor cells, enable spatial cell localization with 19F MRI, and permit quantification and detection of multiple fluorine signatures via 19F MR spectroscopy. This method should facilitate longitudinal investigation of cellular events in vivo for multiple cell types simultaneously.

  20. Transverse excitations of 19F

    In this thesis aspects of the structure of the nucleus 19F are discussed as a result of transverse electron-scattering experiments, with emphasis on the ground state. The magnetization distribution of this state has been obtained from the measurement of electrons scattered from 19F at backward angles. An introduction to the electron-scattering formalism is presented briefly together with the interpretation of electron-scattering results in terms of the nuclear shell model. The experimental apparatus for the measurement of electron scattering through an angle of 1800 is described. This instrumentation has been installed in the low-energy facility (LEF) at NIKHEF-K. Simultaneously with the study of the magnetic ground state distribution of 19F, also excited states of this nucleus up to an energy of 4.4 MeV have been investigated, mainly from data obtained in the EMIN station. Also for these states, the shell-model calculations have been the guide to determine their structure. (Auth.)

  1. Magnetism, optical absorbance, and 19F NMR spectra of nafion films with self-assembling paramagnetic networks

    Levin, E. M.; Chen, Q.; Bud' ko, S. L.

    2012-01-15

    Magnetization, optical absorbance, and {sup 19}F NMR spectra of Nafion transparent films as received and doped with Mn{sup 2+}, Co{sup 2+}, Fe{sup 2+}, and Fe{sup 3+} ions with and without treatment in 1H-1,2,4-triazole (trz) have been studied. Doping of Nafion with Fe{sup 2+} and Co{sup 2+} and their bridging to nitrogen of triazole yields a hybrid self-assembling paramagnetic system that exhibits interesting magnetic and optical properties. These include spin crossover phenomena between high-spin (HS) and low-spin (LS) states in Nafion-Fe{sup 2+}-trz and Nafion-Co{sup 2+}-trz accompanied by thermochromic effects in the visible range induced by temperature. A large shift of the magnetization curve induced by a magnetic field in the vicinity of the HS {leftrightarrow} LS, {approx}220 K, observed for Nafion-Fe{sup 2+}-trz has a rate of {approx}6 K/kOe, which is about three orders of magnitude larger than that in bulk spin crossover Fe{sup 2+} materials. Selective response of {sup 19}F NMR signals on doping with paramagnetic ions demonstrates that NMR can be used as spatially resolved method to study Nafion film with paramagnetic network. Both chemical shift and width of {sup 19}F NMR signals show that SO groups of Nafion, Fe or Co ions, and nitrogen of triazole are bonded whereas they form a spin crossover system. Based on a model of nanosize cylinders proposed for Nafion [K. Schmidt-Rohr and Q. Chen, Nat Mater (2008), 75], we suggest that paramagnetic ions are located inside these cylinders, forming self-assembling magnetically and optically active nanoscale networks.

  2. Binary reaction channels in the 12C+19F and 16O+15N nuclear collisions

    The 19F on 12C and 15N on 16O reactions are studied not only in order to search for resonances but furthermore to perform a comparative study of binary reaction channels in two collisions leading to the same excitation energies of the composite system. The main feature of the experimental procedure is an exclusive detection of the two fragments in the exit channel using the kinematical coincidence method. Angular distributions and excitation functions of the main binary channels are presented and discussed

  3. Tumour oxygen dynamics measured simultaneously by near-infrared spectroscopy and 19F magnetic resonance imaging in rats

    Simultaneous near-infrared spectroscopy (NIRS) and magnetic resonance imaging (MRI) were used to investigate the correlation between tumour vascular oxygenation and tissue oxygen tension dynamics in rat breast 13762NF tumours with respect to hyperoxic gas breathing. NIRS directly detected global variations in the oxygenated haemoglobin concentration (Δ[HbO2]) within tumours and oxygen tension (pO2) maps were achieved using 19F MRI of the reporter molecule hexafluorobenzene. Multiple correlations were examined between rates and magnitudes of vascular (Δ[HbO2]) and tissue (pO2) responses. Significant correlations were found between response to oxygen and carbogen breathing using either modality. Comparison of results for the two methods showed a correlation between the vascular perfusion rate ratio and the mean pO2 values (R2 > 0.7). The initial rates of increase of Δ[HbO2] and the slope of dynamic pO2 response, d(pO2)/dt, of well-oxygenated voxels in response to hyperoxic challenge were also correlated. These results demonstrate the feasibility of simultaneous measurements using NIRS and MRI. As expected, the rate of pO2 response to oxygen is primarily dependent upon the well perfused rather than poorly perfused vasculature

  4. Theranostic Tumor Targeted Nanoparticles Combining Drug Delivery with Dual Near Infrared and (19)F Magnetic Resonance Imaging Modalities

    Vu-Quang, Hieu; Vinding, Mads Sloth; Nielsen, Thomas;

    2016-01-01

    enhanced uptake of nanoparticles via folate receptors expressed on human nasopharyngeal epidermal carcinoma (KB) cells. In vivo, higher MRI and fluorescence signals were obtained from tumors with (19)F MRI and NIR, respectively, using folate-receptor-targeted nanoparticles compared with non-targeted...

  5. Intratumoral pharmacokinetic analysis by 19F-magnetic resonance spectroscopy and cytostatic in vivo activity of gemcitabine (dFdC) in two small cell lung cancer xenografts

    Kristjansen, P E; Quistorff, B; Spang-Thomsen, M;

    1993-01-01

    small cell lung cancer (SCLC) tumor xenografts CPH SCCL 54A and 54B in nude mice. Non-invasive monitoring of the uptake and elimination of fluorine in the individual tumors was performed by in vivo 19F-magnetic resonance spectroscopy, using a 2.9 T magnet. Five dose levels in the range 5-80 mg/kg i...... therapy than 54A. This difference in sensitivity seems to be related to different delivery or uptake of the compound in the two tumor lines, since the 19F-MRS demonstrated a significantly higher antitumor accumulation of fluorine in 54B tumors compared with 54A (p < 0.05, Wilcoxons 2-sided test) following...

  6. 19F magnetic resonance imaging of perfluorocarbons for the evaluation of response to antibiotic therapy in a Staphylococcus aureus infection model.

    Tobias Hertlein

    Full Text Available BACKGROUND: The emergence of antibiotic resistant bacteria in recent decades has highlighted the importance of developing new drugs to treat infections. However, in addition to the design of new drugs, the development of accurate preclinical testing methods is essential. In vivo imaging technologies such as bioluminescence imaging (BLI or magnetic resonance imaging (MRI are promising approaches. In a previous study, we showed the effectiveness of (19F MRI using perfluorocarbon (PFC emulsions for detecting the site of Staphylococcus aureus infection. In the present follow-up study, we investigated the use of this method for in vivo visualization of the effects of antibiotic therapy. METHODS/PRINCIPAL FINDINGS: Mice were infected with S. aureus Xen29 and treated with 0.9% NaCl solution, vancomycin or linezolid. Mock treatment led to the highest bioluminescence values during infection followed by vancomycin treatment. Counting the number of colony-forming units (cfu at 7 days post-infection (p.i. showed the highest bacterial burden for the mock group and the lowest for the linezolid group. Administration of PFCs at day 2 p.i. led to the accumulation of (19F at the rim of the abscess in all mice (in the shape of a hollow sphere, and antibiotic treatment decreased the (19F signal intensity and volume. Linezolid showed the strongest effect. The BLI, cfu, and MRI results were comparable. CONCLUSIONS: (19F-MRI with PFCs is an effective non-invasive method for assessing the effects of antibiotic therapy in vivo. This method does not depend on pathogen specific markers and can therefore be used to estimate the efficacy of antibacterial therapy against a broad range of clinically relevant pathogens, and to localize sites of infection.

  7. Rotating frame nuclear double resonance of 95Mo and 183W with 19F in polycrystalline MoF6 and WF6

    A series of rotating-frame nuclear-double-resonance experiments was performed in which the NMR of the isotopes 95Mo (I=5/2, natural abundance 16%) and 183W (I=1/2, natural abundance 14%) in MoF6 and WF6 respectively were detected via the strong resonance signal of the abundant 19F nuclei. Resonance peaks of two-quanta transitions were observed for 183W-NMR (I=1/2) in WF6, a nonlinear behavior was discussed 95Mo

  8. Fluorine concentrations in teeth studied by /sup 19/F(p,α/sub o/)/sup 16/O nuclear reaction

    The fluorine concentrations has been determined in the enamel, dentine and cementum of a significative set of dental samples (healthy, fluorotic and decayed), by using /sup 19/F(rho,α/sub o/) /sup 16/O reaction, in the resonant region around 1350 KeV proton beam, and by recording the alpha particles emitted at 6.9 MeV. CrF/sub 3/ samples, as standard thin and thick films, has been used for quantitative analysis. In these films protons (0.5 / 1.5 MeV) and helium (4.0 / 7.0 MeV) stopping powers are very similar to those in dental tissue, supposed as hydroxyapatite (Ca/sub 10/(PO/sub 4/)/sub 6/(OH)/sub 2/). Fluorine depth profiles show an accumulation in the first superficial layers (1 / 2 μm) and about a factor two reduction at 4 / 5 μm. Results show an average concentration of surface fluorine in the healthy enamel of the order of 10/sup -3/ g/g (for 1 g of hydroxyapatite), concentration about ten times higher in fluorotic enamel and very low concentration, close to the minimum detectable limit (MDL = 0.3 mg/g), in the carried zones

  9. Using "On/Off" (19)F NMR/Magnetic Resonance Imaging Signals to Sense Tyrosine Kinase/Phosphatase Activity in Vitro and in Cell Lysates.

    Zheng, Zhen; Sun, Hongbin; Hu, Chen; Li, Gongyu; Liu, Xiaomei; Chen, Peiyao; Cui, Yusi; Liu, Jing; Wang, Junfeng; Liang, Gaolin

    2016-03-15

    Tyrosine kinase and phosphatase are two important, antagonistic enzymes in organisms. Development of noninvasive approach for sensing their activity with high spatial and temporal resolution remains challenging. Herein, we rationally designed a hydrogelator Nap-Phe-Phe(CF3)-Glu-Tyr-Ile-OH (1a) whose supramolecular hydrogel (i.e., Gel 1a) can be subjected to tyrosine kinase-directed disassembly, and its phosphate precursor Nap-Phe-Phe(CF3)-Glu-Tyr(H2PO3)-Ile-OH (1b), which can be subjected to alkaline phosphatase (ALP)-instructed self-assembly to form supramolecular hydrogel Gel 1b, respectively. Mechanic properties and internal fibrous networks of the hydrogels were characterized with rheology and cryo transmission electron microscopy (cryo-TEM). Disassembly/self-assembly of their corresponding supramolecular hydrogels conferring respective "On/Off" (19)F NMR/MRI signals were employed to sense the activity of these two important enzymes in vitro and in cell lysates for the first time. We anticipate that our new (19)F NMR/magnetic resonance imaging (MRI) method would facilitate pharmaceutical researchers to screen new inhibitors for these two enzymes without steric hindrance. PMID:26901415

  10. Absolute NMR shielding scales and nuclear spin–rotation constants in 175LuX and 197AuX (X = 19F, 35Cl, 79Br and 127I)

    We present nuclear spin–rotation constants, absolute nuclear magnetic resonance (NMR) shielding constants, and shielding spans of all the nuclei in 175LuX and 197AuX (X = 19F, 35Cl, 79Br, 127I), calculated using coupled-cluster singles-and-doubles with a perturbative triples (CCSD(T)) correction theory, four-component relativistic density functional theory (relativistic DFT), and non-relativistic DFT. The total nuclear spin–rotation constants determined by adding the relativistic corrections obtained from DFT calculations to the CCSD(T) values are in general in agreement with available experimental data, indicating that the computational approach followed in this study allows us to predict reliable results for the unknown spin–rotation constants in these molecules. The total NMR absolute shielding constants are determined for all the nuclei following the same approach as that applied for the nuclear spin–rotation constants. In most of the molecules, relativistic effects significantly change the computed shielding constants, demonstrating that straightforward application of the non-relativistic formula relating the electronic contribution to the nuclear spin–rotation constants and the paramagnetic contribution to the shielding constants does not yield correct results. We also analyze the origin of the unusually large absolute shielding constant and its relativistic correction of gold in AuF compared to the other gold monohalides

  11. Characterization of the ground X1 state of 204Pb19F, 206Pb19F, 207Pb19F, and 208Pb19F

    Pure rotational spectra of the ground electronic-vibrational X1 state of 204Pb19F, 206Pb19F, 207Pb19F, and 208Pb19F are measured with a resonator pulsed supersonic jet Fourier-transform microwave spectrometer. Also reported is a new measurement of the Stark effect on the optical spectra of A(leftarrow)X1 transitions. These spectra are combined with published high-resolution infrared spectra of X2↔X1 transitions in order to create a complete picture of the ground state of lead monofluoride. For the microwave data, molecules are prepared by laser ablation of lead target rods and stabilized in a supersonic jet of neon mixed with sulfur hexafluoride. For the optical Stark spectra, a continuous source of molecules is created in a nozzle heated to 1000 deg. C. The microwave spectra confirm, improve, and extend previously reported constants that describe the rotational, spin-orbit, and hyperfine interactions of the ground electronic state of the PbF molecule. A discrepancy concerning the sign of the hyperfine constant describing the 207Pb nucleus is discussed. Magnetic-field-dependent microwave spectra are used to characterize the Zeeman interaction in terms of two g factors of the body-fixed electronic wave function. The optical Stark spectra are used to characterize the electric dipole moment of the X1 and A states.

  12. High-resolution three-dimensional 19F-magnetic resonance imaging of rat lung in situ: evaluation of airway strain in the perfluorocarbon-filled lung

    Perfluorocarbons (PFC) are biologically and chemically inert fluids with high oxygen and CO2 carrying capacities. Their use as liquid intrapulmonary gas carriers during liquid ventilation has been investigated. We established a method of high resolution 3D-19F-MRI of the totally PFC-filled lung. The goal of this study was to investigate longitudinal and circumferential airway strain in the setting of increasing airway pressures on 3D-19F-MR images of the PFC-filled lung. Sixteen female Wistar rats were euthanized and the liquid perfluorocarbon FC-84 instilled into their lungs. 3D-19F-MRI was performed at various intrapulmonary pressures. Measurements of bronchial length and cross-sectional area were obtained from transversal 2D images for each pressure range. Changes in bronchial area were used to determine circumferential strain, while longitudinal strain was calculated from changes in bronchial length. Our method of 3D-19F-MRI allowed clear visualization of the great bronchi. Longitudinal strain increased significantly up to 31.1 cmH2O. The greatest strain could be found in the range of low airway pressures. Circumferential strain increased strongly with the initial pressure rise, but showed no significant changes above 10.4 cmH2O. Longitudinal strain was generally higher in distal airways, while circumferential strain showed no difference. Analysis of mechanical characteristics showed that longitudinal and circumferential airway expansion occurred in an anisotropic fashion. Whereas longitudinal strain still increased with higher pressures, circumferential strain quickly reached a 'strain limit'. Longitudinal strain was higher in distal bronchi, as dense PFCs gravitate to dependent, in this case to dorso-basal parts of the lung, acting as liquid positive end expiratory pressure

  13. Different distribution of fluorinated anesthetics and nonanesthetics in model membrane: a 19F NMR study.

    P. Tang; Yan, B.; Xu, Y

    1997-01-01

    Despite their structural resemblance, a pair of cyclic halogenated compounds, 1-chloro-1,2,2-trifluorocyclobutane (F3) and 1,2-dichlorohexafluorocyclobutane (F6), exhibit completely different anesthetic properties. Whereas the former is a potent general anesthetic, the latter produces no anesthesia. Two linear compounds, isoflurane and 2,3-dichlorooctofluorobutane (F8), although not a structural pair, also show the same anesthetic discrepancy. Using 19F nuclear magnetic spectroscopy, we inves...

  14. 19-Fluorine nuclear magnetic resonance chemical shift variability in trifluoroacetyl species

    Sloop, Joseph

    2013-01-01

    Joseph C SloopSchool of Science and Technology, Georgia Gwinnett College, Lawrenceville, GA, USAAbstract: This review examines the variability of chemical shifts observed in 19-fluorine (19F) nuclear magnetic resonance spectra for the trifluoroacetyl (TFA) functional group. The range of 19F chemical shifts reported spectra for the TFA group varies generally from −85 to −67 ppm relative to CFCl3. The literature revealed several factors that impact chemical shifts of the TFA...

  15. Contribution to studies of magnetic nuclear dipolar order

    The magnetic nuclear dipolar order concept is first introduced. Two original studies on the 19F spin system of CaF2 are then presented; the first deals with the behavior of a dipolar nuclear antiferromagnetic material in the presence of an effective nonnull field and leads to the determination of the ''field-entropy'' phase diagram of the system; the second study reveals the existence of rotating transverse structures

  16. Parity Nonconservation in 18F, 19F, and 21Ne

    Haxton, W. C.; Gibson, B. F.; Henley, E. M.

    1980-11-01

    Parity nonconservation has been studied in 18F, 19F, and 21Ne for the Weinberg-Salam model. After careful treatment of nuclear structures aspects, values are predicted for the γ-ray asymmetry and circular polarizations in good agreement with experiment provided one employs meson-nucleon coupling constants somewhat weaker than the "best values" recently suggested by Desplanques, Donoghue, and Holstein.

  17. CHARACTERIZATION OF TANK 19F SAMPLES

    Oji, L.; Diprete, D.; Click, D.

    2009-12-17

    The Savannah River National Laboratory (SRNL) was asked by Liquid Waste Operations to characterize Tank 19F closure samples. Tank 19F slurry samples analyzed included the liquid and solid fractions derived from the slurry materials along with the floor scrape bottom Tank 19F wet solids. These samples were taken from Tank 19F in April 2009 and made available to SRNL in the same month. Because of limited amounts of solids observed in Tank 19F samples, the samples from the north quadrants of the tank were combined into one Tank 19F North Hemisphere sample and similarly the south quadrant samples were combined into one Tank 19F South Hemisphere sample. These samples were delivered to the SRNL shielded cell. The Tank 19F samples were analyzed for radiological, chemical and elemental components. Where analytical methods yielded additional contaminants other than those requested by the customer, these results were also reported. The target detection limits for isotopes analyzed were based on detection values of 1E-04 {micro}Ci/g for most radionuclides and customer desired detection values of 1E-05 {micro}Ci/g for I-129, Pa-231, Np-237, and Ra-226. While many of the target detection limits, as specified in the technical task request and task technical and quality assurance plans were met for the species characterized for Tank 19F, some were not met. In a number of cases, the relatively high levels of radioactive species of the same element or a chemically similar element precluded the ability to measure some isotopes to low levels. SRNL, in conjunction with the plant customer, reviewed all these cases and determined that the impacts were negligible.

  18. Characterization Of Tank 19F Samples

    The Savannah River National Laboratory (SRNL) was asked by Liquid Waste Operations to characterize Tank 19F closure samples. Tank 19F slurry samples analyzed included the liquid and solid fractions derived from the slurry materials along with the floor scrape bottom Tank 19F wet solids. These samples were taken from Tank 19F in April 2009 and made available to SRNL in the same month. Because of limited amounts of solids observed in Tank 19F samples, the samples from the north quadrants of the tank were combined into one Tank 19F North Hemisphere sample and similarly the south quadrant samples were combined into one Tank 19F South Hemisphere sample. These samples were delivered to the SRNL shielded cell. The Tank 19F samples were analyzed for radiological, chemical and elemental components. Where analytical methods yielded additional contaminants other than those requested by the customer, these results were also reported. The target detection limits for isotopes analyzed were based on detection values of 1E-04 (micro)Ci/g for most radionuclides and customer desired detection values of 1E-05 (micro)Ci/g for I-129, Pa-231, Np-237, and Ra-226. While many of the target detection limits, as specified in the technical task request and task technical and quality assurance plans were met for the species characterized for Tank 19F, some were not met. In a number of cases, the relatively high levels of radioactive species of the same element or a chemically similar element precluded the ability to measure some isotopes to low levels. SRNL, in conjunction with the plant customer, reviewed all these cases and determined that the impacts were negligible.

  19. PAD investigation of 19F in fullerites

    Perturbed angular distribution experiments on 19F implanted into fullerites revealed a large fraction of fluorine atoms which are not subject to static quadrupole interactions in contrast to other allotropic forms of carbon. (orig.)

  20. (19)F-MRI for monitoring human NK cells in vivo.

    Bouchlaka, Myriam N; Ludwig, Kai D; Gordon, Jeremy W; Kutz, Matthew P; Bednarz, Bryan P; Fain, Sean B; Capitini, Christian M

    2016-05-01

    The availability of clinical-grade cytokines and artificial antigen-presenting cells has accelerated interest in using natural killer (NK) cells as adoptive cellular therapy (ACT) for cancer. One of the technological shortcomings of translating therapies from animal models to clinical application is the inability to effectively and non-invasively track these cells after infusion in patients. We have optimized the nonradioactive isotope fluorine-19 ((19)F) as a means to label and track NK cells in preclinical models using magnetic resonance imaging (MRI). Human NK cells were expanded with interleukin (IL)-2 and labeled in vitro with increasing concentrations of (19)F. Doses as low as 2 mg/mL (19)F were detected by MRI. NK cell viability was only decreased at 8 mg/mL (19)F. No effects on NK cell cytotoxicity against K562 leukemia cells were observed with 2, 4 or 8 mg/mL (19)F. Higher doses of (19)F, 4 mg/mL and 8 mg/mL, led to an improved (19)F signal by MRI with 3 × 10(11) (19)F atoms per NK cell. The 4 mg/mL (19)F labeling had no effect on NK cell function via secretion of granzyme B or interferon gamma (IFNγ), compared to NK cells exposed to vehicle alone. (19)F-labeled NK cells were detectable immediately by MRI after intratumoral injection in NSG mice and up to day 8. When (19)F-labeled NK cells were injected subcutaneously, we observed a loss of signal through time at the site of injection suggesting NK cell migration to distant organs. The (19)F perfluorocarbon is a safe and effective reagent for monitoring the persistence and trafficking of NK cell infusions in vivo, and may have potential for developing novel imaging techniques to monitor ACT for cancer. PMID:27467963

  1. Detection of site-specific binding and co-binding of ligands to macromolecules using 19F NMR

    Study of ligand-macromolecular interactions by 19F nuclear magnetic resonance (NMR) spectroscopy affords many opportunities for obtaining molecular biochemical and pharmaceutical information. This is due to the absence of a background fluorine signal, as well as the relatively high sensitivity of 19F NMR. Use of fluorine-labeled ligands enables one to probe not only binding and co-binding phenomena to macromolecules, but also can provide data on binding constants, stoichiometries, kinetics, and conformational properties of these complexes. Under conditions of slow exchange and macromolecule-induced chemical shifts, multiple 19F NMR resonances can be observed for free and bound ligands. These shifted resonances are a direct correlate of the concentration of ligand bound in a specific state rather than the global concentrations of bound or free ligand which are usually determined using other techniques such as absorption spectroscopy or equilibrium dialysis. Examples of these interactions are demonstrated both from the literature and from interactions of 5-fluorotryptophan, 5-fluorosalicylic acid, flurbiprofen, and sulindac sulfide with human serum albumin. Other applications of 19F NMR to study of these interactions in vivo, as well for receptor binding and metabolic tracing of fluorinated drugs and proteins are discussed

  2. Characterization of the ground X{sub 1} state of {sup 204}Pb{sup 19}F, {sup 206}Pb{sup 19}F, {sup 207}Pb{sup 19}F, and {sup 208}Pb{sup 19}F

    Mawhorter, Richard J.; Murphy, Benjamin S.; Baum, Alexander L.; Sears, Trevor J.; Yang, T.; Rupasinghe, P. M; McRaven, C. P.; Shafer-Ray, N. E.; Alphei, Lukas D.; Grabow, Jens-Uwe [Department of Physics and Astronomy, Pomona College, Claremont, California 91711-6327 (United States); Chemistry Department, Brookhaven National Laboratory, Upton, New York 11973-5000 (United States); Homer L. Dodge Department of Physics and Astronomy, University of Oklahoma, Norman, Oklahoma (United States); Gottfried-Wilhelm-Leibniz-Universitaet, Institut fuer Physikalische Chemie and Elektrochemie, Lehrgebiet A, D-30167 Hannover (Germany)

    2011-08-15

    Pure rotational spectra of the ground electronic-vibrational X{sub 1} state of {sup 204}Pb{sup 19}F, {sup 206}Pb{sup 19}F, {sup 207}Pb{sup 19}F, and {sup 208}Pb{sup 19}F are measured with a resonator pulsed supersonic jet Fourier-transform microwave spectrometer. Also reported is a new measurement of the Stark effect on the optical spectra of A(leftarrow)X{sub 1} transitions. These spectra are combined with published high-resolution infrared spectra of X{sub 2}{r_reversible}X{sub 1} transitions in order to create a complete picture of the ground state of lead monofluoride. For the microwave data, molecules are prepared by laser ablation of lead target rods and stabilized in a supersonic jet of neon mixed with sulfur hexafluoride. For the optical Stark spectra, a continuous source of molecules is created in a nozzle heated to 1000 deg. C. The microwave spectra confirm, improve, and extend previously reported constants that describe the rotational, spin-orbit, and hyperfine interactions of the ground electronic state of the PbF molecule. A discrepancy concerning the sign of the hyperfine constant describing the {sup 207}Pb nucleus is discussed. Magnetic-field-dependent microwave spectra are used to characterize the Zeeman interaction in terms of two g factors of the body-fixed electronic wave function. The optical Stark spectra are used to characterize the electric dipole moment of the X{sub 1} and A states.

  3. Probing Organometallic Reactions With 19F NMR

    Hawrelak, Eric James

    2002-01-01

    This dissertation explores fundamental aspects of the reaction of group 4 metallocenes with methylaluminoxane (MAO) that lead to active Ziegler-Natta olefin polymerization catalysts. A novel experimental approach is described, in which a unique spectroscopic probe (a fluorinated substituent) is attached to the metallocene ancillary ligands and the metallocene/MAO mixtures are analyzed using 19F NMR spectroscopy. Group 4 metallocene dimethides bearing pentafluorophenyl (C6F5) substituents ...

  4. Conformational Plasticity of the NNRTI-Binding Pocket in HIV-1 Reverse Transcriptase: A Fluorine Nuclear Magnetic Resonance Study.

    Sharaf, Naima G; Ishima, Rieko; Gronenborn, Angela M

    2016-07-19

    HIV-1 reverse transcriptase (RT) is a major drug target in the treatment of HIV-1 infection. RT inhibitors currently in use include non-nucleoside, allosteric RT inhibitors (NNRTIs), which bind to a hydrophobic pocket, distinct from the enzyme's active site. We investigated RT-NNRTI interactions by solution (19)F nuclear magnetic resonance (NMR), using singly (19)F-labeled RT proteins. Comparison of (19)F chemical shifts of fluorinated RT and drug-resistant variants revealed that the fluorine resonance is a sensitive probe for identifying mutation-induced changes in the enzyme. Our data show that in the unliganded enzyme, the NNRTI-binding pocket is highly plastic and not locked into a single conformation. Upon inhibitor binding, the binding pocket becomes rigidified. In the inhibitor-bound state, the (19)F signal of RT is similar to that of drug-resistant mutant enzymes, distinct from what is observed for the free state. Our results demonstrate the power of (19)F NMR spectroscopy to characterize conformational properties using selectively (19)F-labeled protein. PMID:27163463

  5. The $^{15}$N($\\bm\\alpha$,$\\bm\\gamma$)$^{19}$F reaction and nucleosynthesis of $^{19}$F

    Wilmes, S.; Wilmes, V.; Staudt, G.; Mohr, P; Hammer, J. W.

    2002-01-01

    Several resonances in the $^{15}$N($\\alpha$,$\\gamma$)$^{19}$F reaction have been investigated in the energy range between 0.6 MeV and 2.7 MeV. Resonance strengths and branching ratios have been determined. High sensitivity could be obtained by the combination of the {\\sc{dynamitron}} high current accelerator, the windowless gas target system {\\sc{rhinoceros}}, and actively shielded germanium detectors. Two levels of $^{19}$F could be observed for the first time in the ($\\alpha$,$\\gamma$) chan...

  6. Metabolism of 5-fluorouracil in human liver: an in vivo 19F NMR study

    In vivo fluorine-19 nuclear magnetic resonance (19F NMR) spectroscopy was used to study the metabolism and pharmacokinetics of 5-fluorouracil (5-FU) in human liver. Nine patients received 5-FU, and additional chemotherapeutic agents (methotrexate, leucovorin, or levamisole) either prophylactically after breast cancer surgery or for colorectal cancer. The time constant for the disappearance of 5-FU from the liver in vivo varied from 5 to 17 min, while the time constant for the appearance of α-fluoro-β-alanine (the major catabolite of 5 FU) varied from 7 to 86 min. The modulators of 5-FU metabolism did not appear to affect the time constant for the disappearance of 5-FU from the liver or for the appearance of α-fluoro-β-alanine. Results obtained indicate that the pharmacokinetics of 5-FU and α-fluoro-β-alanine may vary substantially at different times in a given individual. (author)

  7. 1H and 19F spin-lattice relaxation and CH3 or CF3 reorientation in molecular solids containing both H and F atoms

    Beckmann, Peter A.; Rheingold, Arnold L.

    2016-04-01

    The dynamics of methyl (CH3) and fluoromethyl (CF3) groups in organic molecular (van der Waals) solids can be exploited to survey their local environments. We report solid state 1H and 19F spin-lattice relaxation experiments in polycrystalline 3-trifluoromethoxycinnamic acid, along with an X-ray diffraction determination of the molecular and crystal structure, to investigate the intramolecular and intermolecular interactions that determine the properties that characterize the CF3 reorientation. The molecule is of no particular interest; it simply provides a motionless backbone (on the nuclear magnetic resonance (NMR) time scale) to investigate CF3 reorientation occurring on the NMR time scale. The effects of 19F-19F and 19F-1H spin-spin dipolar interactions on the complicated nonexponential NMR relaxation provide independent inputs into determining a model for CF3 reorientation. As such, these experiments provide much more information than when only one spin species (usually 1H) is present. In Sec. IV, which can be read immediately after the Introduction without reading the rest of the paper, we compare the barrier to CH3 and CF3 reorientation in seven organic solids and separate this barrier into intramolecular and intermolecular components.

  8. Sequestration of a fluorinated analog of 2,4-dichlorophenol and metabolic products by L. minor as evidenced by 19F NMR

    Fate of halogenated phenols in plants was investigated using nuclear magnetic resonance (NMR) to identify and quantify contaminants and their metabolites. Metabolites of 4-chloro-2-fluorophenol (4-Cl-2-FP), as well as the parent compound, were detected in acetonitrile extracts using 19F NMR after various exposure periods. Several fluorinated metabolites with chemical shifts ∼3.5 ppm from the parent compound were present in plant extracts. Metabolites isolated in extracts were tentatively identified as fluorinated-chlorophenol conjugates through examination of signal-splitting patterns and relative chemical shifts. Signal intensity was used to quantify contaminant and metabolite accumulation within plant tissues. The quantity of 4-Cl-2-F metabolites increased with time and mass balance closures of 90-110% were achieved. In addition, solid phase 19F NMR was used to identify 4-Cl-2-FP which was chemically bound to plant material. This work used 19F NMR for developing a time series description of contaminant accumulation and transformation in aquatic plant systems. - The aquatic plant L. minor accumulates, sequesters and binds 4-chloro-2-fluorophenol and its metabolites, as was demonstrated using 19F-NMR

  9. Nuclear magnetic resonance force microscopy with a microwire rf source

    The authors use a 1.0 μm wide patterned Cu wire with an integrated nanomagnetic tip to measure the statistical nuclear polarization of 19F in CaF2 by magnetic resonance force microscopy. With less than 350 μW of dissipated power, the authors achieve rf magnetic fields over 4 mT at 115 MHz for a sample positioned within 100 nm of the 'microwire' rf source. A 200 nm diameter FeCo tip integrated onto the wire produces field gradients greater than 105 T/m at the same position. The large rf fields from the broadband microwire enable long rotating-frame spin lifetimes of up to 15 s at 4 K

  10. Magnetic catalysis in nuclear matter

    Haber, Alexander; Preis, Florian; Schmitt, Andreas

    2014-01-01

    A strong magnetic field enhances the chiral condensate at low temperatures. This so-called magnetic catalysis thus seeks to increase the vacuum mass of nucleons. We employ two relativistic field-theoretical models for nuclear matter, the Walecka model and an extended linear sigma model, to discuss the resulting effect on the transition between vacuum and nuclear matter at zero temperature. In both models we find that the creation of nuclear matter in a sufficiently strong magnetic field becom...

  11. Detection sensitivity of fluorine in dental enamel through the 19F(p,psup(')γ)19F reaction

    The total cross sections for production of 109 and 197 keV gamma rays in the reaction 19F(p,psup(')γ)19F have been measured, over a range of energies up to 4.3 MeV. From these cross sections, the thick detection sensitivities for a uniform distribution of fluorine in dental enamel have been calculated

  12. DFT-GIAO calculation of properties of {sup 19}F NMR and stability study of environmentally relevant perfluoroalkylsulfonamides (PFASAmide)

    Mejia-Urueta, Rafael; Mestre-Quintero, Kleyber; Vivas-Reyes, Ricardo, E-mail: rvivasr@unicartagena.edu.co [Grupo de Quimica Cuantica y Teorica, Facultad de Ciencias Exactas y Naturales, Universidad de Cartagena, Cartagena (Colombia)

    2011-09-15

    Perfluorinated organic compounds (POCs), such as perfluorooctanesulfonate (PFOS) and perfluoroalkylsulfonamide (PFASA) are compounds that have recently attracted considerable attention worldwide because of its high persistence and wide distribution in the environment. Among the spectroscopic methods used to study the PFASA, {sup 19}F nuclear magnetic resonance (NMR {sup 19}F) is very effective, due to its ability to determine concentrations of PFASA in biological samples and measure pollution in water samples. For this reason, a theoretical study of the properties of {sup 19}F NMR was performed. In this study we have determined the shielding constant ({sigma}) for different fluorine nucleus of the 18 molecules under study, using density functional theory (DFT) and GIAO method with the B3PW91/6-31+G(d,p) level of calculation. The {sigma} calculations were made at vacuum and in presence of a solvent. The values of chemical shifts ({delta}), were also calculated in a different level of theory. The best results were obtained with the level of calculation DFT-GIAO/B3PW91/6-31+G(d,p) by considering the solvent such as dimethylsulfoxide (DMSO), chloroform (CHCl{sub 3}), acetone (CH{sub 3}COCH{sub 3}) and methanol (CH{sup 3}OH). The results were interpreted in terms of calculated hardness at DFT/B3PW91/6-31+G(d, p) level. The behaviour of the hardness was higher in the molecules of four carbons PFASA than eight carbons. This explain theoretically resistance of four carbons PFAS to be transformed into perfluorobutanesulfonate (PFBS). (author)

  13. Nuclear-spin lattice relaxation and magnetic-ion spin fluctuations in Heisenberg antiferromagnets below TN

    Engelsberg, M.; Albino O. de Aguiar, J.

    1985-04-01

    The results of measurements on the magnetic field and temperature dependences of the 19F nuclear-spin lattice relaxation time T1 in KNiF3 for TKNiF3. Some similarities in the behavior of both systems suggest that a common mechanism may be responsible for spin-lattice relaxation in either case. We discuss the possibility that this mechanism may involve a diffusive mode below TN with a central peak in the relevant magnetic-ion spin correlation function.

  14. In vivo imaging of stepwise vessel occlusion in cerebral photothrombosis of mice by 19F MRI.

    Gesa Weise

    Full Text Available BACKGROUND: (19F magnetic resonance imaging (MRI was recently introduced as a promising technique for in vivo cell tracking. In the present study we compared (19F MRI with iron-enhanced MRI in mice with photothrombosis (PT at 7 Tesla. PT represents a model of focal cerebral ischemia exhibiting acute vessel occlusion and delayed neuroinflammation. METHODS/PRINCIPAL FINDINGS: Perfluorocarbons (PFC or superparamagnetic iron oxide particles (SPIO were injected intravenously at different time points after photothrombotic infarction. While administration of PFC directly after PT induction led to a strong (19F signal throughout the entire lesion, two hours delayed application resulted in a rim-like (19F signal at the outer edge of the lesion. These findings closely resembled the distribution of signal loss on T2-weighted MRI seen after SPIO injection reflecting intravascular accumulation of iron particles trapped in vessel thrombi as confirmed histologically. By sequential administration of two chemically shifted PFC compounds 0 and 2 hours after illumination the different spatial distribution of the (19F markers (infarct core/rim could be visualized in the same animal. When PFC were applied at day 6 the fluorine marker was only detected after long acquisition times ex vivo. SPIO-enhanced MRI showed slight signal loss in vivo which was much more prominent ex vivo indicative for neuroinflammation at this late lesion stage. CONCLUSION: Our study shows that vessel occlusion can be followed in vivo by (19F and SPIO-enhanced high-field MRI while in vivo imaging of neuroinflammation remains challenging. The timing of contrast agent application was the major determinant of the underlying processes depicted by both imaging techniques. Importantly, sequential application of different PFC compounds allowed depiction of ongoing vessel occlusion from the core to the margin of the ischemic lesions in a single MRI measurement.

  15. NMR shielding and spin–rotation constants of 175LuX (X = 19F, 35Cl, 79Br, 127I) molecules

    This presentation demonstrates the relativistic effects on the spin-rotation constants, absolute nuclear magnetic resonance (NMR) shielding constants and shielding spans of 175LuX (X = 19F, 35Cl, 79Br, 127I) molecules. The results are obtained from calculations performed using density functional theory (non-relativistic and four-component relativistic) and coupled-cluster calculations. The spin-rotation constants are compared with available experimental values. In most of the molecules studied, relativistic effects make an order of magnitude difference on the NMR absolute shielding constants

  16. NMR shielding and spin–rotation constants of {sup 175}LuX (X = {sup 19}F, {sup 35}Cl, {sup 79}Br, {sup 127}I) molecules

    Demissie, Taye B. [Centre for Theoretical and Computational Chemistry Department of Chemistry, UiT – The Arctic University of Norway, N-9037 Tromsø (Norway)

    2015-12-31

    This presentation demonstrates the relativistic effects on the spin-rotation constants, absolute nuclear magnetic resonance (NMR) shielding constants and shielding spans of {sup 175}LuX (X = {sup 19}F, {sup 35}Cl, {sup 79}Br, {sup 127}I) molecules. The results are obtained from calculations performed using density functional theory (non-relativistic and four-component relativistic) and coupled-cluster calculations. The spin-rotation constants are compared with available experimental values. In most of the molecules studied, relativistic effects make an order of magnitude difference on the NMR absolute shielding constants.

  17. Nuclear Current and Magnetic Rotation

    PENG Jing; XING Li-Feng

    2009-01-01

    The magnetic rotational bands based on the configuration πh211/2 ⊕Vh-211/2 in 142 Gd are investigated with the newly developed tilted axis cranking relativistic mean field (RMF) theory with and without nuclear current.The effect of the nuclear current is discussed by comparing the total Routhians,single particle levels,electromagnetic transition probabilities B(M1) and B(E2) in self-consistent tilted axis cranking RMF calculation with those obtained without the nuclear current.The nuclear currents are found to play an important role in the magnetic rotation of nuclei.

  18. Yield Stress and Physical Data Results for the Tank 19F Radioactive Mound Sample and Tank 19F Simulant Samples

    The purpose of this work was to characterize and compare the settling behavior of the radioactive Tank 19F mound sample and non-radioactive Pacific Northwest Nation Laboratory simulants at 6, 11, and 16 weight percent total solids

  19. Nuclear Bag Model and Nuclear Magnetic Moments

    Liu, Liang-Gang

    1999-01-01

    In 1991, we proposed a model in which nucleus is treated as a spherical symmetric MIT bag and nucleon satisfies the MIT bag model boundary condition. The model was employed to calculate nuclear magnetic moments. The results are in good agreement with experiment data. Now, we found this model is still interesting and illuminating.

  20. Binding of 5-fluorotryptamine to polynucleotides as a model for protein-nucleic acid interactions: fluorine-19 nuclear magnetic resonance, absorption, and fluorescence studies

    Fluorine-19 nuclear magnetic resonance (19F NMR), optical absorption, and fluorescence spectroscopy have been used to study the interaction of 5-fluorotryptamine (5FTA) with polynucleotides as a model for protein-nucleic acid interactions. In the presence of DNA, denatured DNA, poly(A), and poly(A)-poly(U), the 19F resonance of 5FTA shifted 0.3-0.6 ppm upfield while the presence of poly(I)-poly(C) had little effect on the chemical shift. Differences in the 19F chemical shift induced upon changing from H2O to 2H2O indicate difference in the solvent accesibility of 5FTA bound to the various polynucleotides. 19F NMR relaxation experiments were carried out for free 5FTA and in its nucleic acid complexes, and the results were interpreted by using a two correlation time model that included contributions to relaxation from dipolar coupling and chemical shift anisotropy. Values for the internal motion correlation time and the overall motion correlation time are reported. The effect of 5FTA on the melting transition of the double-stranded polynucleotides and on the quenching of 5FTA fluorescence was also studied. The 19F NMR results support the model of partial intercalation of the 5FTA chromophore into the polynucleotides, and the implications for protein-nucleic acid interactions are discussed

  1. GHz nuclear magnetic resonance

    Cross, T.A.; Drobny, G.; Trewhella, J.

    1994-12-01

    For the past dozen years, 500- and 600-MHz spectrometers have become available in many laboratories. The first 600-MHz NMR spectrometer (at Carnegie Mellon University) was commissioned more than 15 years ago and, until 1994, represented the highest field available for high-resolution NMR. This year, we have witnessed unprecedented progress in the development of very high field magnets for NMR spectroscopy, including the delivery of the first commercial 750-MHz NMR spectrometers. In addition, NMR signals have been obtained from 20-Tesla magnets (850 MHz for {sup 1}H`s) at both Los Alamos National Laboratory and Florida State University in the NHMFL (National High Magnetic Field Laboratory). These preliminary experiments have been performed in magnets with 100-ppm homogeneity, but a 20-Tesla magnet developed for the NHMFL will be brought to field this year with a projected homogeneity of 0.1 ppm over a 1-cm-diam spherical volume.

  2. 19F NMR study of LiTbF4 single crystals

    The angular dependences of 19F NMR spectra have been measured in the external magnetic field of 0.5 T oriented in the basis plane of LiTbF4 at the room temperature. We have obtained the constants of transferred hyperfine interaction and the corrected set of crystal field parameters for the Tb3+ ions in LiTbF4. The results of simulations of the magnetization in high pulsed magnetic fields with taking into account magnetoelastic interactions agree satisfactorily with experimental data presented in the literature.

  3. Nuclear magnetic and electric dipole moments of neon-19

    This thesis presents a detailed discussion of a series of experiments designed to measure the magnetic and electric dipole moments of the β-emitting nucleus 19Ne. The 19Ne is generated in the reaction 19F(p,n)19Ne and is polarized by a ''stern-Gerlach'' magnet in a rare gas atomic beams machine. The atoms are stored in a cell for many seconds without depolarizing. The parity violating asymmetry in the β angular distribution is used to monitor the nuclear polarization. The polarized atoms are stored in a cell in a uniform magnetic field. The β-asymmetry is monitored by a pair of β-detectors located on either side of the cell. Transitions between the M/sub J/ = +1/2 and M/sub J/ = -1/2 spin states are induced by an rf field generated by a small Helmholtz coil pair surrounding the cell. Nuclear magnetic resonance lines are observed and the magnetic moment of 19Ne measured to be μ(19Ne) = -1.88542(8)μ/sub N/. A new magnet, cell and detectors were designed to give narrow resonance lines. The equipment is described in detail and several resonance line shapes are discussed. The narrowest resonance line achieved with this system was 0.043 Hz FWHM. This width is primarily due to the 19Ne lifetime. Pulsed NMR lineshapes were also observed. The narrow NMR lines observed in the previous experiment were then used as a probe to look for an electric dipole moment (EDM) in 19Ne. Any shift in the resonance frequency correlated with changes in an externally applied electric field would be evidence for an EDM. The EDM of the 19Ne atom was measured to (7.2 +/- 6.2 X 10-22 e-cm. This experiment and possible improvements are discussed in detail

  4. Nuclear magnetic gamma double resonance

    A number of problems corresponding to different variants of experiments using nuclear magnetic-gamma double resonance (NMGDR) are theoretically investigated. Calculation is carried out and its results are compared to experimental ones concerning NMGDR for tantalum. Time dynamics of the source or scatterer nucleus sublevel populations under double resonance conditions with non-uniform initial population of this nucleus sublevels is studied

  5. Characterization of 19A-like 19F pneumococcal isolates from Papua New Guinea and Fiji.

    Dunne, E M; Tikkanen, L; Balloch, A; Gould, K; Yoannes, M; Phuanukoonnon, S; Licciardi, P V; Russell, F M; Mulholland, E K; Satzke, C; Hinds, J

    2015-09-01

    Molecular identification of Streptococcus pneumoniae serotype 19F is routinely performed by PCR targeting the wzy gene of the capsular biosynthetic locus. However, 19F isolates with genetic similarity to 19A have been reported in the United States and Brazil. We screened 78 pneumococcal carriage isolates and found six 19F wzy variants that originated from children in Papua New Guinea and Fiji. Isolates were characterized using multilocus sequence typing and opsonophagocytic assays. The 19F wzy variants displayed similar susceptibility to anti-19F IgG antibodies compared to standard 19F isolates. Our findings indicate that these 19F variants may be more common than previously believed. PMID:26339490

  6. Magnetometer of nuclear magnetic resonance

    We present a nuclear magnetic resonance magnetometer that measures magnetic fields, between 2,500 gauss and 5,000 gauss, with an accuracy of a few parts per million. The circuit of the magnetometer, based on a marginal oscillator, permits a continuous tunning in the frequency range comprised between 10.0 MHz, with a signal to noise ratio of about 20. The radiofrequency amplifier is of the cascode type in integrated circuit and it operates with two 9V batteries. The modulation is at 35 Hz and it is provided by an external oscillator. The instrument is compact, inexpensive and easy to operate; it can also be used for didactic purposes to show the phenomenon of magnetic nuclear resonance and its main characteristics. (author)

  7. Mapping In Vivo Tumor Oxygenation within Viable Tumor by 19F-MRI and Multispectral Analysis

    Yunzhou Shi

    2013-11-01

    Full Text Available Quantifying oxygenation in viable tumor remains a major obstacle toward a better understanding of the tumor microenvironment and improving treatment strategies. Current techniques are often complicated by tumor heterogeneity. Herein, a novel in vivo approach that combines 19F magnetic resonance imaging (19F-MRIR1 mapping with diffusionbased multispectral (MS analysis is introduced. This approach restricts the partial pressure of oxygen (pO2 measurements to viable tumor, the tissue of therapeutic interest. The technique exhibited sufficient sensitivity to detect a breathing gas challenge in a xenograft tumor model, and the hypoxic region measured by MS 19F-MRI was strongly correlated with histologic estimates of hypoxia. This approach was then applied to address the effects of antivascular agents on tumor oxygenation, which is a research question that is still under debate. The technique was used to monitor longitudinal pO2 changes in response to an antibody to vascular endothelial growth factor (B20.4.1.1 and a selective dual phosphoinositide 3-kinase/mammalian target of rapamycin inhibitor (GDC-0980. GDC-0980 reduced viable tumor pO2 during a 3-day treatment period, and a significant reduction was also produced by B20.4.1.1. Overall, this method provides an unprecedented view of viable tumor pO2 and contributes to a greater understanding of the effects of antivascular therapies on the tumor's microenvironment.

  8. Intracellular pH of perfused single frog skin: combined 19F- and 31P-NMR analysis.

    Civan, M M; Lin, L E; Peterson-Yantorno, K; Taylor, J; Deutsch, C

    1984-11-01

    Intracellular pH (pHc) has been determined in frog skin by applying two different methods of pH measurement, 19F and 31P nuclear magnetic resonance (NMR) analysis, to the same tissues. Results from both NMR approaches confirm an observation by Lin, Shporer, and Civan [Am. J. Physiol. 248 (Cell Physiol. 17): 1985] that acidification of the extracellular medium reverses the sign of the pH gradient present under baseline conditions. The fluorinated probe, alpha-(difluoromethyl)-alanine methyl ester, was introduced into the epithelial cells by preincubating skins for 4.7-10.4 h at room temperature in Ringer solutions containing 1 mM ester. The free amino acid was subsequently released by intracellular esterase activity, thus providing a high enough probe concentration for NMR analysis to be practicable. From measurements of short-circuit current and transepithelial resistance under base-line and experimental conditions and the appearance of phosphocreatine (PCr) in the 31P spectrum of preloaded tissues, the fluorinated probe appears to be nontoxic to frog skin. Measurement of the chemical shift of methylphosphonate relative to PCr permitted calculation of extracellular pH. Estimation of the intracellular pH was performed both by measurement of the chemical shift of inorganic phosphate (Pi) relative to PCr and by measurement of the central peak spacing of the 19F spectrum. From four direct comparisons of the two techniques in two experiments, the difference in the estimated pH was only 0.03 +/- 0.07 pH units, supporting the concept that 31P-NMR analysis is a valid method of measuring pH in this tissue. PMID:6496729

  9. Evanescent Waves Nuclear Magnetic Resonance

    Halidi, El Mohamed; Nativel, Eric; Akel, Mohamad;

    2016-01-01

    Nuclear Magnetic Resonance spectroscopy and imaging can be classified as inductive techniques working in the near- to far-field regimes. We investigate an alternative capacitive detection with the use of micrometer sized probes positioned at sub wavelength distances of the sample in order to char...... a new road to a better understanding of the evanescent waves component in NMR with the opportunity to perform localized spectroscopy and imaging....

  10. Tomography by nuclear magnetic resonance

    Imaging methods based on nuclear magnetic resonance allow the production of sectional images of the human body without ionizing radiation. It is possible to measure the density and relaxation times of the water protons in body fluids or tissue. This allows not only to obtain morphological information but also to get some insight into the spatial distribution of physiological data. Starting with a review of the principles of nuclear magnetic resonance it is explained how the measured signal can be associated with an image point; it is also explained what type of apparatus is necessary and what the physical limitations are. Possible risks the patient may be exposed to in an examination using nuclear magnetic resonance are discussed. The present state of the technical development enables the production of whole-body sectional images of a living person within about one minute. By means of some typical examples the nature and properties of these images are explained. Although extensive clinical studies will be necessary before a more general assessment can be made of this method, an outlook is provided on expected further developments and possible future fields of application. (orig.)

  11. Evaporation residue excitation function measurement for 19F + 194,198Pt reactions

    Nuclear dissipation is one of the active fields in the present day nuclear physics research. Experimental signatures for dissipation are observed through large excess in pre-fission neutrons, γ-ray multiplicities from the compound nucleus, giant dipole resonance (GDR) γ-rays, light charged particles and evaporation residues in comparison to standard statistical model, for the heavy-ion induced fusion-fission or fusion-evaporation reactions (ERs). From the analysis of a large set of experimental data, it is well established that there exists a large dissipation at nuclear temperature above 1 MeV. But most of these probes are not sensitive to the dissipation within saddle. The ER cross-section is a probe which is sensitive to dissipation within the saddle point. Hence, the study of ER cross-section can be helpful in estimating the dissipation effects inside the saddle point. Also the other motivation for these measurements is to see the effect of shell closure on dissipation. With this motivation the evaporation cross-sections for 19F + 194,198Pt are measured at beam energy of 101 to 137.3 MeV. Of the above systems 19F + 194Pt populates 213Fr (N = 126) shell closed compound nucleus (CN) whereas, other system populate 217Fr (N = 130) non-shell closed CN

  12. Wide-range nuclear magnetic resonance detector

    Sturman, J. C.; Jirberg, R. J.

    1972-01-01

    Compact and easy to use solid state nuclear magnetic resonance detector is designed for measuring field strength to 20 teslas in cryogenically cooled magnets. Extremely low noise and high sensitivity make detector applicable to nearly all types of analytical nuclear magnetic resonance measurements and can be used in high temperature and radiation environments.

  13. Binding mechanism of the tyrosine-kinase inhibitor nilotinib to human serum albumin determined by (1)H STD NMR, (19)F NMR, and molecular modeling.

    Yan, Jin; Wu, Di; Sun, Pingchuan; Ma, Xiaoli; Wang, Lili; Li, Shanshan; Xu, Kailin; Li, Hui

    2016-05-30

    Drug interaction with albumins significantly affects in vivo drug transport and biological metabolism. To gain insight into the binding mechanisms of tyrosine-kinase inhibitor nilotinib (NIL) to human serum albumin (HSA), an approach combining (1)H saturation-transfer difference (STD) nuclear magnetic resonance (NMR) spectroscopy, (19)F NMR spectroscopy, steady-state fluorescence quenching, and molecular modeling was adopted. (19)F NMR was used to determine the binding constant, and a value of 4.12×10(3)M(-1) was obtained. Fluorescence spectroscopy was also used to determine the binding constant, and the value obtained was within the same order of magnitude. The binding process was mainly driven by hydrogen bonds and van der Waals forces. Displacement experiments further showed that NIL mainly bound to the hydrophobic cavity of HSA's subdomain IIA, also called Sudlow's site I. Molecular docking simulation was also used to establish a molecular binding model, and findings were consistent with those of displacement and the (1)H STD NMR experiments. PMID:26922576

  14. Evanescent Waves Nuclear Magnetic Resonance.

    Halidi, El Mohamed; Nativel, Eric; Akel, Mohamad; Kenouche, Samir; Coillot, Christophe; Alibert, Eric; Jabakhanji, Bilal; Schimpf, Remy; Zanca, Michel; Stein, Paul; Goze-Bac, Christophe

    2016-01-01

    Nuclear Magnetic Resonance spectroscopy and imaging can be classified as inductive techniques working in the near- to far-field regimes. We investigate an alternative capacitive detection with the use of micrometer sized probes positioned at sub wavelength distances of the sample in order to characterize and model evanescent electromagnetic fields originating from NMR phenomenon. We report that in this experimental configuration the available NMR signal is one order of magnitude larger and follows an exponential decay inversely proportional to the size of the emitters. Those investigations open a new road to a better understanding of the evanescent waves component in NMR with the opportunity to perform localized spectroscopy and imaging. PMID:26751800

  15. Nuclear magnetic ordering in silver

    Nuclear antiferromagnetic ordering has been observed by neutron diffraction in a single crystal of 109Ag. The critical temperature is found to 700 pK, and the critical field is 100 μT. From the paramagnetic phase a second order phase transition leads into a type-I 1-k structure with long range order. The experiments have taken place at the Hahn-Meitner Institut in Berlin in collaboration with the low Temperature Laboratory in Helsinki, the Niels Bohr Institute in Copenhagen, and Risoe National Laboratory, Roskilde. The present report is a Ph.D. thesis which has been successfully defended at the Niels Bohr Institute. Besides the results of the nuclear ordering experiments the thesis contains a description of the theoretical background for nuclear magnetism and a review of earlier nuclear ordering experiments as well as theoretical work. The principles for studying polarized nuclei with use of polarized and unpolarized neutrons are presented, as well as the results of such experiments. (au) 11 tabs., 59 ills., 143 refs

  16. Nuclear magnetic ordering in silver

    Lefmann, K.

    1995-12-01

    Nuclear antiferromagnetic ordering has been observed by neutron diffraction in a single crystal of {sup 109}Ag. The critical temperature is found to 700 pK, and the critical field is 100 {mu}T. From the paramagnetic phase a second order phase transition leads into a type-I 1-k structure with long range order. The experiments have taken place at the Hahn-Meitner Institut in Berlin in collaboration with the low Temperature Laboratory in Helsinki, the Niels Bohr Institute in Copenhagen, and Risoe National Laboratory, Roskilde. The present report is a Ph.D. thesis which has been successfully defended at the Niels Bohr Institute. Besides the results of the nuclear ordering experiments the thesis contains a description of the theoretical background for nuclear magnetism and a review of earlier nuclear ordering experiments as well as theoretical work. The principles for studying polarized nuclei with use of polarized and unpolarized neutrons are presented, as well as the results of such experiments. (au) 11 tabs., 59 ills., 143 refs.

  17. Detection of psychoactive drugs using 19F MR spectroscopy

    In vivo 19F resonance spectroscopy measurements of tri fluorinated neuroleptics (flu phenazine and tri fluoperazine) and later tri fluorinated antidepressants (fluoxetine and fluvoxamine) began with animal experiments in 1983. Using rats which have been treated with high oral doses of flu phenazine over a period of three weeks at the beginning of these experiments the measurement time was very long (up to 10 h). The application of better techniques using surface coils led to a marked improvement of the signal noise ratio and measurement times in animal experiments could be reduced to minutes. These results encouraged us and other groups to perform experiments in humans to detect and try to estimate brain levels of tri fluorinated neuroleptics and antidepressants. The present data of several research groups demonstrate that 19F MR spectroscopy has the potential of becoming a valuable tool for monitoring drug levels at the site of action. The extension of the animal studies to humans might facilitate a better treatment of schizophrenic and depressive patients. (author)

  18. Mass distribution in 19F induced fission of 232Th

    Formation cross sections of several fission products have been determined using the recoil catcher technique followed by γ-ray spectrometry in 19F induced fission of 232Th at Elab=95 and 112 MeV. The data show significant admixture of fission from compound nuclei formed by complete fusion as well as targetlike nuclei formed by transfer reactions. Mass distributions for both the fissioning systems have been obtained using the systematics of charge distribution in low and medium energy fission. Mass distribution for complete fusion fission is broad Gaussian whereas it is asymmetric for transfer induced fission. At 95 MeV the transfer fission constitutes about 28% of total fission cross section while at 112 MeV it is about 14%, showing that the transfer fission fraction decreases with increasing projectile energy across the barrier. The evaporation residue cross sections of the targetlike nucleus formed in the 232Th (19F, 18O) 233Pa reaction were also measured. The evaporation residue cross sections and the calculated decay probabilities of the targetlike nucleus 233Pa by PACE2 have been used to estimate the fraction of proton and α transfer fission in the total transfer fission cross section. copyright 1996 The American Physical Society

  19. Protein dynamics from nuclear magnetic relaxation.

    Charlier, Cyril; Cousin, Samuel F; Ferrage, Fabien

    2016-05-01

    Nuclear magnetic resonance is a ubiquitous spectroscopic tool to explore molecules with atomic resolution. Nuclear magnetic relaxation is intimately connected to molecular motions. Many methods and models have been developed to measure and interpret the characteristic rates of nuclear magnetic relaxation in proteins. These approaches shed light on a rich and diverse range of motions covering timescales from picoseconds to seconds. Here, we introduce some of the basic concepts upon which these approaches are built and provide a series of illustrations. PMID:26932314

  20. Statistical Analysis Of Tank 19F Floor Sample Results

    Representative sampling has been completed for characterization of the residual material on the floor of Tank 19F as per the statistical sampling plan developed by Harris and Shine. Samples from eight locations have been obtained from the tank floor and two of the samples were archived as a contingency. Six samples, referred to in this report as the current scrape samples, have been submitted to and analyzed by SRNL. This report contains the statistical analysis of the floor sample analytical results to determine if further data are needed to reduce uncertainty. Included are comparisons with the prior Mantis samples results to determine if they can be pooled with the current scrape samples to estimate the upper 95% confidence limits (UCL95%) for concentration. Statistical analysis revealed that the Mantis and current scrape sample results are not compatible. Therefore, the Mantis sample results were not used to support the quantification of analytes in the residual material. Significant spatial variability among the current scrape sample results was not found. Constituent concentrations were similar between the North and South hemispheres as well as between the inner and outer regions of the tank floor. The current scrape sample results from all six samples fall within their 3-sigma limits. In view of the results from numerous statistical tests, the data were pooled from all six current scrape samples. As such, an adequate sample size was provided for quantification of the residual material on the floor of Tank 19F. The uncertainty is quantified in this report by an UCL95% on each analyte concentration. The uncertainty in analyte concentration was calculated as a function of the number of samples, the average, and the standard deviation of the analytical results. The UCL95% was based entirely on the six current scrape sample results (each averaged across three analytical determinations).

  1. Theoretical Analysis of Neutron Double-Differential Cross Section of n + 19F at 14.2 MeV

    DUAN Jun-Feng; YAN Yu-Liang; SUN Xiao-Jun; ZHANG Yue; ZHANG Jing-Shang

    2007-01-01

    A new light nuclear reaction model has been developed and the double-differential measurements of 1p shell nuclei have been analyzed successfully. Now, the application of this model is expanded to 19F of the 2s-1d shell nucleus. The double-differential cross section of total outgoing neutron for n + 19F reactions at En = 14.2 MeV has been calculated and analyzed, which agrees fairly well with the experimental measurements. In this paper, the contributions from different reaction channels to the double-differential cross sections have been analyzed in detail. The calculations indicate that this light nuclear reaction model is also able to be used for the 2s-1d shell nucleus so long as the related level scheme could be provided sufficiently.

  2. Characterization of 19A-like 19F pneumococcal isolates from Papua New Guinea and Fiji

    E.M. Dunne

    2015-09-01

    Full Text Available Molecular identification of Streptococcus pneumoniae serotype 19F is routinely performed by PCR targeting the wzy gene of the capsular biosynthetic locus. However, 19F isolates with genetic similarity to 19A have been reported in the United States and Brazil. We screened 78 pneumococcal carriage isolates and found six 19F wzy variants that originated from children in Papua New Guinea and Fiji. Isolates were characterized using multilocus sequence typing and opsonophagocytic assays. The 19F wzy variants displayed similar susceptibility to anti-19F IgG antibodies compared to standard 19F isolates. Our findings indicate that these 19F variants may be more common than previously believed.

  3. Determining diffusion coefficients of ionic liquids by means of field cycling nuclear magnetic resonance relaxometry

    Field Cycling Nuclear Magnetic Resonance (FC NMR) relaxation studies are reported for three ionic liquids: 1-ethyl-3- methylimidazolium thiocyanate (EMIM-SCN, 220–258 K), 1-butyl-3-methylimidazolium tetrafluoroborate (BMIM-BF4, 243–318 K), and 1-butyl-3-methylimidazolium hexafluorophosphate (BMIM-PF6, 258–323 K). The dispersion of 1H spin-lattice relaxation rate R1(ω) is measured in the frequency range of 10 kHz–20 MHz, and the studies are complemented by 19F spin-lattice relaxation measurements on BMIM-PF6 in the corresponding frequency range. From the 1H relaxation results self-diffusion coefficients for the cation in EMIM-SCN, BMIM-BF4, and BMIM-PF6 are determined. This is done by performing an analysis considering all relevant intra- and intermolecular relaxation contributions to the 1H spin-lattice relaxation as well as by benefiting from the universal low-frequency dispersion law characteristic of Fickian diffusion which yields, at low frequencies, a linear dependence of R1 on square root of frequency. From the 19F relaxation both anion and cation diffusion coefficients are determined for BMIM-PF6. The diffusion coefficients obtained from FC NMR relaxometry are in good agreement with results reported from pulsed- field-gradient NMR. This shows that NMR relaxometry can be considered as an alternative route of determining diffusion coefficients of both cations and anions in ionic liquids

  4. Nuclear magnetic resonance studies of erythrocyte membranes

    Chapman, D.; Kamat, V.B.; Gier, J. de; Penkett, S.A.

    1968-01-01

    The use of nuclear magnetic resonance spectroscopy for studying molecular interactions in biological membranes has been investigated using erythrocyte membrane fragments. Sonic dispersion of these fragments produces a sharp and well-defined high-resolution nuclear magnetic resonance spectrum. The sp

  5. Contribution to nuclear magnetic resonance imager using permanent magnets

    After some recalls of nuclear magnetic resonance, ways to get a stable and homogeneous magnetic field are studied with permanent magnets. Development of correction coils on integrated circuits has been particularly stressed. Gradient coil specific systems have been studied taking in account ferromagnetic material presence. Antenna system has been improved and possibility of image obtention with the prototype realized has been shown

  6. (19)F MRSI of capecitabine in the liver at 7 T using broadband transmit-receive antennas and dual-band RF pulses.

    van Gorp, Jetse S; Seevinck, Peter R; Andreychenko, Anna; Raaijmakers, Alexander J E; Luijten, Peter R; Viergever, Max A; Koopman, Miriam; Boer, Vincent O; Klomp, Dennis W J

    2015-11-01

    Capecitabine (Cap) is an often prescribed chemotherapeutic agent, successfully used to cure some patients from cancer or reduce tumor burden for palliative care. However, the efficacy of the drug is limited, it is not known in advance who will respond to the drug and it can come with severe toxicity. (19)F Magnetic Resonance Spectroscopy (MRS) and Magnetic Resonance Spectroscopic Imaging (MRSI) have been used to non-invasively study Cap metabolism in vivo to find a marker for personalized treatment. In vivo detection, however, is hampered by low concentrations and the use of radiofrequency (RF) surface coils limiting spatial coverage. In this work, the use of a 7T MR system with radiative multi-channel transmit-receive antennas was investigated with the aim of maximizing the sensitivity and spatial coverage of (19)F detection protocols. The antennas were broadband optimized to facilitate both the (1)H (298 MHz) and (19)F (280 MHz) frequencies for accurate shimming, imaging and signal combination. B1(+) simulations, phantom and noise measurements showed that more than 90% of the theoretical maximum sensitivity could be obtained when using B1(+) and B1(-) information provided at the (1)H frequency for the optimization of B1(+) and B1(-) at the (19)F frequency. Furthermore, to overcome the limits in maximum available RF power, whilst ensuring simultaneous excitation of all detectable conversion products of Cap, a dual-band RF pulse was designed and evaluated. Finally, (19)F MRS(I) measurements were performed to detect (19)F metabolites in vitro and in vivo. In two patients, at 10 h (patient 1) and 1 h (patient 2) after Cap intake, (19)F metabolites were detected in the liver and the surrounding organs, illustrating the potential of the set-up for in vivo detection of metabolic rates and drug distribution in the body. PMID:26373355

  7. Calculated cross sections for neutron induced reactions on 19F and uncertainties of parameters

    Nuclear model codes were used to calculate cross sections for neutron-induced reactions on 19F for incident energies from 2 to 20 MeV. The model parameters in the codes were adjusted to best reproduce experimental data and are given in this report. The calculated results are compared to measured data and the evaluated values of ENDF/B-V. The covariance matrix for several of the most sensitive model parameters is given based on the scatter of measured data around the theoretical curves and the long-range correlation error of measured data. The results of these calculations form the basis for the new ENDF/B-VI fluorine evaluation. 44 refs., 64 figs., 14 tabs

  8. Nuclear reactions in ultra-magnetized supernovae

    The statistical model is employed to investigate nuclear reactions in ultrastrong magnetic fields relevant for supernovae and neutron stars. For radiative capture processes the predominant mechanisms are argued to correspond to modifications of nuclear level densities, and γ-transition energies due to interactions of the field with magnetic moments of nuclei. The density of states reflects the nuclear structure and results in oscillations of reaction cross sections as a function of field strength, while magnetic interaction energy enhances radiative neutron capture process. Implications in the synthesis of r-process nuclei in supernova site are discussed. (author)

  9. Reactions (d,7Li) and (d,7Be) in 19F nuclei

    Differential cross sections have been measured for the reactions 19F(d,7Li)14N, 19F(d,7Li(/sub 0.478/)14N, 19F(d,7Be)14C, and 19F(d,7Be(/sub 0.429/)14C in a cyclotron beam of deuterons with energy 13.6 MeV. The experimental data were analyzed by the distorted-wave method with inclusion of the finite interaction range and recoil. It is shown that the reactiuns 19F(d,7Li)14N and 19F(d,7Li(/sub 0.478/)14N occur mainly by direct transfer of a 5He cluster from the 4P/sub 1/2/ state of the 19F nucleus to the 1D/sub 3/2/ state of the 7Li nucleus. The differential cross sections for the reactions 19F(d,7Be)14C and 19F(d,7Be(/sub 0.429/)14C could not be explained in terms of the theory of direct transfer of a 5Li cluster

  10. Nuclear Magnetic Resonance Imaging: Current Capabilities

    Davis, Peter L.; Crooks, Lawrence E.; Margulis, Alexander R.; Kaufman, Leon

    1982-01-01

    Nuclear magnetic resonance imaging can produce tomographic images of the body without ionizing radiation. Images of the head, chest, abdomen, pelvis and extremities have been obtained and normal structures and pathology have been identified. Soft tissue contrast with this method is superior to that with x-ray computerized tomography and its spatial resolution is approaching that of x-ray computerized tomography. In addition, nuclear magnetic resonance imaging enables us to image along the sag...

  11. Nuclear magnetic (ratio-frequency) tomography

    Physical foundations of nuclear magnetic tomography and factors limiting its spatial, contrast and time precision are considered. On the basis of analysis of literature data, it is established that using peculiarities of nuclear magnetic resonance (NMR) it is possible to detect malignant tumors and edemas, to investigate metabolic processes, to determine blood flow rate and to solve a number of other problems. The classification of methods of NMR - tomography is given

  12. Nuclear magnetic (radio-frequency) tomography

    Pavlov, A.S.; Gurvich, A.M.; Karyakina, N.F.; Revokatov, O.P.; Chikirdin, Eh.G. (Nauchno-Issledovatel' skij Inst. Rentgenologii i Radiologii, Moscow (USSR))

    Physical foundations of nuclear magnetic tomography and factors limiting its spatial, contrast and time precision are considered. On the basis of analysis of literature data, it is established that using peculiarities of nuclear magnetic resonance (NMR) it is possible to detect malignant tumors and edemas, to investigate metabolic processes, to determine blood flow rate and to solve a number of other problems. The classification of methods of NMR - tomography is given.

  13. 19F molecular MR imaging for detection of brain tumor angiogenesis: in vivo validation using targeted PFOB nanoparticles

    Molecular imaging with magnetic resonance imaging (MRI) targeted contrast agents has emerged as a promising diagnostic approach in cancer research to detect associated bio-markers. In this work, the potential of 19F MRI was investigated to detect angiogenesis with αvβ3-targeted perfluoro-octylbromide nanoparticles (PFOB NP) in a U87 glioblastoma mouse model at 7 Tesla. Mice were injected intravenously with targeted or non-targeted NP and 19F images were immediately acquired for 90 min using a PFOB-dedicated MRI sequence. Mice infused with targeted NP exhibited higher concentrations in tumors than mice of the control group, despite the presence of nonspecific signal originating from the blood. Imaging results were corroborated by histology and fluorescence imaging, suggesting specific binding of targeted NP to αvβ3 integrin. Two other groups of mice were injected 24 h before imaging to allow blood clearance but no significant differences were found between both groups, probably due to a loss of specificity of PFOB NP. This is the first demonstration of the ability of 19F MRI to detect αvβ3 -integrin endothelial expression in brain tumors in vivo. (authors)

  14. Automated data evaluation and modelling of simultaneous (19) F-(1) H medium-resolution NMR spectra for online reaction monitoring.

    Zientek, Nicolai; Laurain, Clément; Meyer, Klas; Paul, Andrea; Engel, Dirk; Guthausen, Gisela; Kraume, Matthias; Maiwald, Michael

    2016-06-01

    Medium-resolution nuclear magnetic resonance spectroscopy (MR-NMR) currently develops to an important analytical tool for both quality control and process monitoring. In contrast to high-resolution online NMR (HR-NMR), MR-NMR can be operated under rough environmental conditions. A continuous re-circulating stream of reaction mixture from the reaction vessel to the NMR spectrometer enables a non-invasive, volume integrating online analysis of reactants and products. Here, we investigate the esterification of 2,2,2-trifluoroethanol with acetic acid to 2,2,2-trifluoroethyl acetate both by (1) H HR-NMR (500 MHz) and (1) H and (19) F MR-NMR (43 MHz) as a model system. The parallel online measurement is realised by splitting the flow, which allows the adjustment of quantitative and independent flow rates, both in the HR-NMR probe as well as in the MR-NMR probe, in addition to a fast bypass line back to the reactor. One of the fundamental acceptance criteria for online MR-MNR spectroscopy is a robust data treatment and evaluation strategy with the potential for automation. The MR-NMR spectra are treated by an automated baseline and phase correction using the minimum entropy method. The evaluation strategies comprise (i) direct integration, (ii) automated line fitting, (iii) indirect hard modelling (IHM) and (iv) partial least squares regression (PLS-R). To assess the potential of these evaluation strategies for MR-NMR, prediction results are compared with the line fitting data derived from the quantitative HR-NMR spectroscopy. Although, superior results are obtained from both IHM and PLS-R for (1) H MR-NMR, especially the latter demands for elaborate data pretreatment, whereas IHM models needed no previous alignment. Copyright © 2015 John Wiley & Sons, Ltd. PMID:25854892

  15. Generation of nuclear magnetic resonance images

    Two generation techniques of nuclear magnetic resonance images, the retro-projection and the direct transformation method are studied these techniques are based on the acquisition of NMR signals which phases and frequency components are codified in space by application of magnetic field gradients. The construction of magnet coils is discussed, in particular a suitable magnet geometry with polar pieces and air gap. The obtention of image contrast by T1 and T2 relaxation times reconstructed from generated signals using sequences such as spin-echo, inversion-recovery and stimulated echo, is discussed. The mathematical formalism of matrix solution for Bloch equations is also presented. (M.C.K.)

  16. Analyses of d+16O and p+19F reaction

    The nuclear data of d+16O reaction at incident energies spanning 0.1 to 35.0 MeV were obtained by calculation with optical model, distorted wave Born approximation, preequilibrium nuclear reaction and Hauser-Feshbach theory. The cross sections of d+17F and p + 17F reaction were predicted

  17. Nuclear magnetic resonance (NMR): principles and applications

    The basis for the phenomenon of nuclear magnetic resonance (NMR) is the ability of certain nuclei possessing both intrinsic angular momentum or ''spin'' I and magnetic moment to absorb electromagnetic energy in the radio frequency range. In principle, there are approximately 200 nuclei which may be investigated using the NMR technique. The NMR spectrum consists of intensity peaks along an axis calibrated in terms of the steady magnetic field or the frequency of the radiofrequency electromagnetic radiation. Analysis of the number, spacing, position and intensity of the lines in an NMR spectrum consists of intensity peaks along an axis calibrated in terms of the steady magnetic field or the frequency of the radiofrequency electromagnetic radiation. Analysis of the number, spacing, position and intensity of the lines in an NMR spectrum provides a variety of qualitative and quantitative analytical applications. The most obvious applications consist of the measurements of nuclear properties, such as spin number and nuclear magnetic moment. In liquids, the fine structure of resonance spectra provides a tool for chemical identification and molecular structure analysis. Other applications include the measurements of self-diffusion coefficients, magnetic fields and field homogeneity, inter-nuclear distances, and, in some cases, the water content of biological materials. (author)

  18. Theory of nuclear magnetic moments - LT-35

    The purpose of these notes is to give an account of some attempts at interpreting the observed values of nuclear magnetic moments. There is no attempt at a complete summary of the field as that would take much more space than is used here. In many cases the arguments are only outlined and references are given for those interested in further details. A discussion of the theory of nuclear magnetic moments necessitates many excursions into the details of the nuclear models because the magnetic moments have a direct bearing on the validity of these models. However the main emphasis here is on those features which tend to explain the magnetic moments and other evidence is not discussed unless it has a direct bearing on the problem. In the first part of the discussion the Shell Model of the nucleus is used, as this model seems to correlate a large body of data relating to the heavier nuclei. Included here are the modifications proposed to explain the fact that the experimental magnetic moments do not fit quantitatively with the exact predictions of the Shell Model. The next sections deal with some of the more drastic modifications introduced to explain the large nuclear quadrupole moments and the effect of these modifications on the magnetic moments. Finally we turn to more detailed investigations of the light nuclei, in particular the - Conjugate nuclei. (author)

  19. Pulsed nuclear-electronic magnetic resonance

    Morley, Gavin W; Mohammady, M Hamed; Aeppli, Gabriel; Kay, Christopher W M; Jeschke, Gunnar; Monteiro, Tania S

    2011-01-01

    Pulsed magnetic resonance is a wide-reaching technology allowing the quantum state of electronic and nuclear spins to be controlled on the timescale of nanoseconds and microseconds respectively. The time required to flip either dilute electronic or nuclear spins is orders of magnitude shorter than their decoherence times, leading to several schemes for quantum information processing with spin qubits. We investigate instead the novel regime where the eigenstates approximate 50:50 superpositions of the electronic and nuclear spin states forming "nuclear-electronic" qubits. Here we demonstrate quantum control of these states, using bismuth-doped silicon, in just 32 ns: orders of magnitude shorter than previous experiments where pure nuclear states were used. The coherence times of our states are over four orders of magnitude longer, being 1 ms or more at 8 K, and are limited by the naturally-occurring 29Si nuclear spin impurities. There is quantitative agreement between our experiments and no-free-parameter anal...

  20. Progress in nuclear magnetic resonance spectroscopy

    Emsley, J W; Sutcliffe, L H

    2013-01-01

    Progress in Nuclear Magnetic Resonance Spectroscopy, Part 1 is a two-chapter text that reviews significant developments in nuclear magnetic resonance (NMR) applications.The first chapter discusses NMR studies of molecules physisorbed on homogeneous surfaces. This chapter also describes the phase changes in the adsorbed layer detected by following the variation in the NMR parameters. The second chapter examines the process to obtain a plotted, data reduced Fourier transform NMR spectrum. This chapter highlights the pitfalls that can cause a decrease in information content in a NMR spectrum. The

  1. Nuclear magnetic resonance of thermally oriented nuclei

    The more recent developments in the spectroscopy of Nuclear Magnetic Resonance on Oriented Nuclei (NMRON) are reviewed; both theoretical and experimental advances are summarised with applications to On-Line and Off-Line determination of magnetic dipole and electric quadrupole hyperfine parameters. Some emphasis is provided on solid state considerations with indications of where likely enhancements in technique will lead in conventional hyperfine studies. (orig.)

  2. Nuclear magnetic resonance in Kondo lattice systems

    Curro, Nicholas J.

    2016-06-01

    Nuclear magnetic resonance has emerged as a vital tool to explore the fundamental physics of Kondo lattice systems. Because nuclear spins experience two different hyperfine couplings to the itinerant conduction electrons and to the local f moments, the Knight shift can probe multiple types of spin correlations that are not accessible via other techniques. The Knight shift provides direct information about the onset of heavy electron coherence and the emergence of the heavy electron fluid.

  3. Determining diffusion coefficients of ionic liquids by means of field cycling nuclear magnetic resonance relaxometry

    Kruk, D. [Faculty of Mathematics and Computer Science, University of Warmia and Mazury in Olsztyn, Słoneczna 54, PL-10710 Olsztyn (Poland); Universität Bayreuth, Experimentalphysik II, 95440 Bayreuth (Germany); Meier, R.; Rössler, E. A. [Universität Bayreuth, Experimentalphysik II, 95440 Bayreuth (Germany); Rachocki, A. [Institute of Molecular Physics, Polish Academy of Sciences, Smoluchowskiego 17, 60-179 Poznań (Poland); Korpała, A. [Department of Biophysics, Jagiellonian University Medical College, Łazarza 16, 31-530 Kraków, Poland and Institute of Physics, Jagiellonian University, Reymonta 4, 30-059 Kraków (Poland); Singh, R. K. [Ionic Liquid and Solid State Ionics Laboratory, Department of Physics, Banaras Hindu University, Varanasi 221 005 (India)

    2014-06-28

    Field Cycling Nuclear Magnetic Resonance (FC NMR) relaxation studies are reported for three ionic liquids: 1-ethyl-3- methylimidazolium thiocyanate (EMIM-SCN, 220–258 K), 1-butyl-3-methylimidazolium tetrafluoroborate (BMIM-BF{sub 4}, 243–318 K), and 1-butyl-3-methylimidazolium hexafluorophosphate (BMIM-PF{sub 6}, 258–323 K). The dispersion of {sup 1}H spin-lattice relaxation rate R{sub 1}(ω) is measured in the frequency range of 10 kHz–20 MHz, and the studies are complemented by {sup 19}F spin-lattice relaxation measurements on BMIM-PF{sub 6} in the corresponding frequency range. From the {sup 1}H relaxation results self-diffusion coefficients for the cation in EMIM-SCN, BMIM-BF{sub 4}, and BMIM-PF{sub 6} are determined. This is done by performing an analysis considering all relevant intra- and intermolecular relaxation contributions to the {sup 1}H spin-lattice relaxation as well as by benefiting from the universal low-frequency dispersion law characteristic of Fickian diffusion which yields, at low frequencies, a linear dependence of R{sub 1} on square root of frequency. From the {sup 19}F relaxation both anion and cation diffusion coefficients are determined for BMIM-PF{sub 6}. The diffusion coefficients obtained from FC NMR relaxometry are in good agreement with results reported from pulsed- field-gradient NMR. This shows that NMR relaxometry can be considered as an alternative route of determining diffusion coefficients of both cations and anions in ionic liquids.

  4. magnetic order studied by nuclear methods

    Reichl, C

    2001-01-01

    investigated within the frame of this work. The studies on the highly concentrated deuterides revealed a gradual loss in local field due to a distribution of 'local Curie temperatures' depending on the number of Fe neighbours and their distances from the Moessbauer nucleus. On rising the temperature, during a magnetic transition, an increasing number of Fe sites with different local environment loose their hyperfine fields, whereas bulk measurements showed a relatively sharp, however, incomplete transition. By using a combination of neutron diffraction- and muon spin relaxation studies the complex magnetic phase diagram of the system Ce(Rh,Ru) sub 3 B sub 2 , where weak magnetic moments exist, could be studied. There, transitions from para- to ferromagnetism, and more complicated magnetic structures could be observed. Due to the existence of several isotopes of B and Ru, each carrying different nuclear spins and magnetic moment, particularly complicated second moment simulations for interpreting the muon data...

  5. Phosphonate Based High Nuclearity Magnetic Cages.

    Sheikh, Javeed Ahmad; Jena, Himanshu Sekhar; Clearfield, Abraham; Konar, Sanjit

    2016-06-21

    Transition metal based high nuclearity molecular magnetic cages are a very important class of compounds owing to their potential applications in fabricating new generation molecular magnets such as single molecular magnets, magnetic refrigerants, etc. Most of the reported polynuclear cages contain carboxylates or alkoxides as ligands. However, the binding ability of phosphonates with transition metal ions is stronger than the carboxylates or alkoxides. The presence of three oxygen donor sites enables phosphonates to bridge up to nine metal centers simultaneously. But very few phosphonate based transition metal cages were reported in the literature until recently, mainly because of synthetic difficulties, propensity to result in layered compounds, and also their poor crystalline properties. Accordingly, various synthetic strategies have been followed by several groups in order to overcome such synthetic difficulties. These strategies mainly include use of small preformed metal precursors, proper choice of coligands along with the phosphonate ligands, and use of sterically hindered bulky phosphonate ligands. Currently, the phosphonate system offers a library of high nuclearity transition metal and mixed metal (3d-4f) cages with aesthetically pleasing structures and interesting magnetic properties. This Account is in the form of a research landscape on our efforts to synthesize and characterize new types of phosphonate based high nuclearity paramagnetic transition metal cages. We quite often experienced synthetic difficulties with such versatile systems in assembling high nuclearity metal cages. Few methods have been emphasized for the self-assembly of phosphonate systems with suitable transition metal ions in achieving high nuclearity. We highlighted our journey from 2005 until today for phosphonate based high nuclearity transition metal cages with V(IV/V), Mn(II/III), Fe(III), Co(II), Ni(II), and Cu(II) metal ions and their magnetic properties. We observed that

  6. A comparison of chemical shift sensitivity of trifluoromethyl tags: optimizing resolution in {sup 19}F NMR studies of proteins

    Ye, Libin; Larda, Sacha Thierry; Frank Li, Yi Feng [University of Toronto, UTM, Department of Chemistry (Canada); Manglik, Aashish [Stanford University School of Medicine, Department of Molecular and Cellular Physiology (United States); Prosser, R. Scott, E-mail: scott.prosser@utoronto.ca [University of Toronto, UTM, Department of Chemistry (Canada)

    2015-05-15

    The elucidation of distinct protein conformers or states by fluorine ({sup 19}F) NMR requires fluorinated moieties whose chemical shifts are most sensitive to subtle changes in the local dielectric and magnetic shielding environment. In this study we evaluate the effective chemical shift dispersion of a number of thiol-reactive trifluoromethyl probes [i.e. 2-bromo-N-(4-(trifluoromethyl)phenyl)acetamide (BTFMA), N-(4-bromo-3-(trifluoromethyl)phenyl)acetamide (3-BTFMA), 3-bromo-1,1,1-trifluoropropan-2-ol (BTFP), 1-bromo-3,3,4,4,4-pentafluorobutan-2-one (BPFB), 3-bromo-1,1,1-trifluoropropan-2-one (BTFA), and 2,2,2-trifluoroethyl-1-thiol (TFET)] under conditions of varying polarity. In considering the sensitivity of the {sup 19}F NMR chemical shift to the local environment, a series of methanol/water mixtures were prepared, ranging from relatively non-polar (MeOH:H{sub 2}O = 4) to polar (MeOH:H{sub 2}O = 0.25). {sup 19}F NMR spectra of the tripeptide, glutathione ((2S)-2-amino-4-{[(1R)-1-[(carboxymethyl)carbamoyl] -2-sulfanylethyl]carbamoyl}butanoic acid), conjugated to each of the above trifluoromethyl probes, revealed that the BTFMA tag exhibited a significantly greater range of chemical shift as a function of solvent polarity than did either BTFA or TFET. DFT calculations using the B3LYP hybrid functional and the 6-31G(d,p) basis set, confirmed the observed trend in chemical shift dispersion with solvent polarity.

  7. Nuclear magnetic resonance as a petrophysical measurement

    Nuclear magnetic resonance (NMR) of hydrogen nuclei in fluids which saturate porous rocks is important in oil exploration and production, since NMR logs can provide good estimates of permeability and fluid flow. This paper reviews developments which connect the NMR properties of rocks with petrophysical properties, and particularly those relating to fluid flow. The recent advances in the use of NMR in boreholes which have spurred these developments are also discussed. The relevance of other NMR measurements on geological samples, including magnetic resonance imaging, is briefly referred to. (author)

  8. Nuclear magnetic ordering ''avant toute chose''

    We give an overview of the research initiated at Saclay to study cooperative phenomena between nuclear spins in the presence of a high magnetic field. These systems exhibit a wealth of different orderings including antiferromagnetism, ferromagnetism with domains and transverse structures rotating about the static magnetic field. These states have been characterized by NMR of the ordered nuclei, NMR of dilute probe nuclei, double resonance methods and neutron diffraction. Some related phenomena involving the coupling of spins with the lattice are reported. Finally we outline future experiments which will benefit of the insight brought by the study of dipolar ordering. (authors). 30 refs., 11 figs

  9. Thin layer and nuclear magnetic resonance magnetometers

    In the first part of this text, magnetometers with sensitive elements in the form of thin cylindrical ferromagnetic layers are described. These layers are anisotropic, uniaxial, C orientated and single domains. In the second part of the text, the principles of the nuclear magnetic resonance magnetometer realized at the LETI are presented. This instrument is accurate, of high efficiency, and isotropic. Very small variations in magnetic field intensity (10-7 oersteds) can be detected with a 1Hz pass band at zero frequency

  10. Experimental test of nuclear magnetization distribution and nuclear structure models

    Models exist that ascribe the nuclear magnetic fields to the presence of a single nucleon whose spin is not neutralized by pairing it up with that of another nucleon; other models assume that the generation of the magnetic field is shared among some or all nucleons throughout the nucleus. All models predict the same magnetic field external to the nucleus since this is an anchor provided by experiments. The models differ, however, in their predictions of the magnetic field arrangement within the nucleus for which no data exist. The only way to distinguish which model gives the correct description of the nucleus would be to use a probe inserted into the nucleus. The goal of our project was to develop exactly such a probe and to use it to measure fundamental nuclear quantities that have eluded experimental scrutiny. The need for accurately knowing such quantities extends far beyond nuclear physics and has ramifications in parity violation experiments on atomic traps and the testing of the standard model in elementary particle physics. Unlike scattering experiments that employ streams of free particles, our technique to probe the internal magnetic field distribution of the nucleus rests on using a single bound electron. Quantum mechanics shows that an electron in the innermost orbital surrounding the nucleus constantly dives into the nucleus and thus samples the fields that exist inside. This sampling of the nucleus usually results in only minute shifts in the electron s average orbital, which would be difficult to detect. By studying two particular energy states of the electron, we can, however, dramatically enhance the effects of the distribution of the magnetic fields in the nucleus. In fact about 2% of the energy difference between the two states, dubbed the hyperfine splitting, is determined by the effects related to the distribution of magnetic fields in the nucleus, A precise measurement of this energy difference (better than 0.01%) would then allow us to place

  11. Nuclear magnetic moments measured by nuclear magnetic resonance on oriented nuclei

    The configurations of nuclei near the shell closures N=40 and Z=40 were studied. The nuclear magnetic moments have been measured by nuclear magnetic resonance on oriented nuclei (NMR/ON). We have determined the ground state spin of 73Se and magnetic moments of isotopes 73Se(9/2+), 77Br3/2-) and 74Brm(4). The 9/2+ spin and parity assignment to the parent state of 73Se is perfectly compatible with the systematics of N + 39 and N = 41 isotones. The bromine moments around the shell closure N = 40, show a change in protonic configuration. In the second part of this work a precise hyperfine field value of zinc in iron has been determined. The relaxation constant of Zn in iron is established. The new hyperfine field value of zinc in iron allows a more precise reevaluation of the magnetic moments of 69Znm and 71Znm measured with NMR/ON

  12. Neutron emission in 19F+181Ta reaction at 150 MeV

    In this work we concentrate on the HMS Model and the ALICE 2014 code. In fact one of the aims of the present study is to produce new data that will provide stringent test of the code. Neutron emission and light charged particle emission are useful tools for such a study. In the experiment we measured both neutron and charged particle spectra for a range of targets, and at three 19F beam energies. In this contribution we present the angle-dependent neutron spectra for 19F + 181Ta at beam energy of 150 MeV

  13. Magnetic properties and hyperfine interactions in Cr₈, Cr₇Cd, and Cr₇Ni molecular rings from ¹⁹F-NMR.

    Bordonali, L; Garlatti, E; Casadei, C M; Furukawa, Y; Lascialfari, A; Carretta, S; Troiani, F; Timco, G; Winpenny, R E P; Borsa, F

    2014-04-14

    A detailed experimental investigation of the (19)F nuclear magnetic resonance is made on single crystals of the homometallic Cr8 antiferromagnetic molecular ring and heterometallic Cr7Cd and Cr7Ni rings in the low temperature ground state. Since the F(-) ion is located midway between neighboring magnetic metal ions in the ring, the (19)F-NMR spectra yield information about the local electronic spin density and (19)F hyperfine interactions. In Cr8, where the ground state is a singlet with total spin S(T) = 0, the (19)F-NMR spectra at 1.7 K and low external magnetic field display a single narrow line, while when the magnetic field is increased towards the first level crossing field, satellite lines appear in the (19)F-NMR spectrum, indicating a progressive increase in the Boltzmann population of the first excited state S(T) = 1. In the heterometallic rings, Cr7Cd and Cr7Ni, whose ground state is magnetic with S(T) = 3/2 and S(T) = 1/2, respectively, the (19)F-NMR spectrum has a complicated structure which depends on the strength and orientation of the magnetic field, due to both isotropic and anisotropic transferred hyperfine interactions and classical dipolar interactions. From the (19)F-NMR spectra in single crystals we estimated the transferred hyperfine constants for both the F(-)-Ni(2+) and the F(-)-Cd(2+) bonds. The values of the hyperfine constants compare well to the ones known for F(-)-Ni(2+) in KNiF3 and NiF2 and for F(-)-Cr(3+) in K2NaCrF6. The results are discussed in terms of hybridization of the 2s, 2p orbitals of the F(-) ion and the d orbitals of the magnetic ion. Finally, we discuss the implications of our results for the electron-spin decoherence. PMID:24735298

  14. Nuclear magnetic resonance common laboratory, quadrennial report

    This quadrennial report of the nuclear magnetic resonance common laboratory gives an overview of the main activities. Among the different described activities, only one is interesting for the INIS database: it concerns the Solid NMR of cements used for radioactive wastes storage. In this case, the NMR is used to characterize the structure of the material and the composition, structure and kinetics of formation of the alteration layer which is formed at the surface of concrete during water leaching conditions. The NMR methodology is given. (O.M.)

  15. Nuclear Magnetic Resonance in Liquids and Solids

    The paper outlines the basic principles of nuclear magnetic resonance, trying wherever possible to compare and contrast the method with that of slow neutron scattering as a technique for studying the properties of condensed phases and especially of molecular and atomic motions. It is emphasized that this is not a review of nmr for an expert audience but has a pedagogical aim. It is hoped to give persons with a main interest in neutron scattering some appreciation of the scope and limitations of the nmr method. This is illustrated by recent results on one substance which covers many but by no means all of the important points. (author)

  16. 19F spin-lattice relaxation in the cubic antiferromagnet KNiF3

    Engelsberg, M.

    1980-06-01

    The temperature dependence of the 19F spin-lattice relaxation in the cubic quasi-isotropic antiferromagnet KNiF3 is studied experimentally and theoretically. Quantitative agreement with measured relaxation rates is obtained over a considerable temperature range by assuming a two-magnon relaxation process in the "domain-flopped" state.

  17. Ab Initio Calculation of 19F NMR Chemical Shielding for Alkaline-earth-metal Fluorides

    CAI,Shu-Hui(蔡淑惠); CHEN,Zhong,(陈忠); LU,Xin(吕鑫); CHEN,Zhi-Wei(陈志伟); WAN,Hui-Lin(万惠霖)

    2001-01-01

    Gauge-independent atomic orbital (GIAO) method atHartree-Fock (HF) and density functional theory (DFr) lev-els,respectively,was employed to calculate 19F NMR chemi-cal shieldings of solid state alkaline-earth-metal fluorides MF2 (M = Mg,Ca,Sr,Ba).The results show that,although thecalculated19F chemical shieldings tend to be larger than the experinental values,they have a fairly good linear relation-ship with the observed ones.The calculated results based on different combinations of basis sets show that the B3LYP (ahybrid of DFT with HF) predictions are greatly superior tothe I-IF predictions.When a basis set of metal atom with ef- fecfive core potential (ECP) has well representation of valencewavefunction,especially wavefuncfion of d component,andproper definition of core electron nmnher,it can be applied toobtain 19F chemical shielding which is dose to that of all-elec-tron calculation.Tne variation of 19F chemical shielding of al-kaline-earth-metal fluorides correlates well with the latticefactor A/R2.``

  18. Study of fusion-fission dynamics in 19F+238U reaction

    Dubey, R.; Sugathan, P.; Jhingan, A.; Kaur, Gurpreet; Mukul, Ish; Siwal, Davinder; Saneesh, N.; Banerjee, Tathagata; Yadav, Abhishek; Thakur, Meenu; Mahajan, Ruchi; Chaterjee, M. B.

    2016-05-01

    Mass angle distribution measurements for 19F+238U reaction were carried out around the sub barrier energies. Mass angle correlation has not been observed at above and below the fusion barrier in present reaction. This infer the minimal presence of non compound like events at these bombarding energies range.

  19. A 19F NMR study of C-I....pi- halogen bonding

    Hauchecorne, Dieter; vand er Veken, Benjamin J.; Herrebout, Wouter A.; Hansen, Poul Erik

    The formation of halogen bonded complexes between toluene-d8 and the perfluoroiodopropanes 1-C3F7I and 2-C3F7I has been investigated using 19F NMR spectroscopy. For both Lewis acids, evidence was found for the formation of a C–I⋯π halogen bonded complex. The complex formed is a 1:1 type. Using...

  20. Connection of nuclear magnetic and infiltration parameters of porous rocks

    The infiltration parameters of porous rocks are determined among others by the specific pore surface. In the case of the sandostones the nuclear magnetic behaviour of the water influx is also influenced by the specific surface of the pores. On this basis the nuclear magnetic and the infiltration parameters of the rocks can be brought into connection with each other. The paper deals with the rock-physics of the nuclear magnetic logging. (author)

  1. Nuclear magnetic resonance in hexaferrite/maghemite composite nanoparticles

    Kříšťan, P.; Hondlík, O.; Štěpánková, H.; Chlan, V.; Kouřil, K.; Řezníček, R.; Pollert, Emil; Veverka, Pavel

    Warszawa: Polish Academy of Sciences, 2015, s. 514-516. ISSN 0587-4246. [The European Conference PHYSICS OF MAGNETISM 2014/PM'14/. Poznań (PL), 23.06.2014-27.06.2014] Institutional support: RVO:68378271 Keywords : nuclear magnetic resonance and relaxation * ferrimagnetics * fine-particle systems * nanocrystalline materials * magnetic oxides * inorganic compounds Subject RIV: BM - Solid Matter Physics ; Magnetism

  2. Budding yeast cDNA sequencing project: Y102_K19_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y102_K19_F.ab1 Y102_K19_F.ab1 - - Show Y102_K19_F.ab1 Seqid Y102_K19_F.ab1 Link to SGD Y102_K19_ ... GAGTGTAAACGACGGCCAGCACGTATTTAATACGA CTCACTATAGGGAATTCC TTAAGATTTATCAAGAACTTGGTTTGATATTT CACCAACACACACAAAAA ... T TGAGATTGGCTTTGCAAAGAAAAGACATTGAGGTTGTTGCTGTCAACGAT CC ATTTATCTCTAACGATTATGCTGCTTACATGGTCAAGTACGATTCTAC T ... CATGGTAGATACAAGGGTACTGTTTCC CATGACGACAAGCACATCATCA TTGATGGTGTCAAGATCGCTACCTACCA ... ACCCAGCTAACTTG CCATGGGGTTCTCTAAAGATCGATGTCGCTGTTGACTCC ACTGGTGTTTT CAAGGAATTGGACACCGCTCAAAAGCACATTGACGCTGG ...

  3. Recommendations concerning magnetic resonance spectroscopy

    In medicine the technique of nuclear magnetic resonance (NMR) is applied in the form of in vivo nuclear magnetic resonance spectroscopy (MRS). In vivo MRS can be carried out non-invasively. The committee of the Dutch Health Council briefly discusses the qualities and potentialities of the nuclei that will probably be used in future clinical spectroscopy: 31P, 13C, 1H (and possibly 19F and 23Na). The committee discusses several possibilities of combining imaging and spectroscopy. The imaging of nuclei other than protons is also possible with MRS. Potential applications are considered in oncology, cardiology, neurology and hepatology. (Auth.)

  4. Nuclear magnetic resonance spectrometer and method

    A nuclear magnetic resonance techniis described that allows simultaneous temperature determination and spectral acquisition. The technique employs a modification of the lock circuit of a varian xl-100 spectrometer which permits accurate measurement of the difference in resonance frequency between a primary lock nucleus and another , secondary, nucleus. The field stabilization function of the main lock circuit is not compromised. A feedback signal having a frequency equal to the frequency difference is substituted for the normal power supply in the spectrometer's existing radio frequency transmitter to modulate that transmitter. Thus, the transmitter's radio frequency signal is enhanced in a frequency corresponding to the resonance peak of the secondary nucleus. Determination of the frequency difference allows the determination of temperature without interference with the observed spectrum. The feedback character of the circuit and the presence of noise make the circuit self-activating

  5. Two-dimensional nuclear magnetic resonance petrophysics.

    Sun, Boqin; Dunn, Keh-Jim

    2005-02-01

    Two-dimensional nuclear magnetic resonance (2D NMR) opens a wide area for exploration in petrophysics and has significant impact to petroleum logging technology. When there are multiple fluids with different diffusion coefficients saturated in a porous medium, this information can be extracted and clearly delineated from CPMG measurements of such a system either using regular pulsing sequences or modified two window sequences. The 2D NMR plot with independent variables of T2 relaxation time and diffusion coefficient allows clear separation of oil and water signals in the rocks. This 2D concept can be extended to general studies of fluid-saturated porous media involving other combinations of two or more independent variables, such as chemical shift and T1/T2 relaxation time (reflecting pore size), proton population and diffusion contrast, etc. PMID:15833623

  6. Phosphorus 31 nuclear magnetic resonance examination of female reproductive tissues

    Nuclear magnetic resonance spectroscopy is a powerful method of investigating the relationship between metabolism and function in living tissues. We present evidence that the phosphorus 31 spectra of myometrium and placenta are functions of physiologic state and gestational age. Specific spectroscopic abnormalities are observed in association with disorders of pregnancy and gynecologic diseases. Our results suggest that noninvasive nuclear magnetic resonance spectroscopy examinations may sometimes be a useful addition to magnetic resonance imaging examinations, and that nuclear magnetic resonance spectroscopy of biopsy specimens could become a cost-effective method of evaluating certain biochemical abnormalities

  7. 19F NMR measurements of NO production in hypertensive ISIAH and OXYS rats

    Recently we demonstrated the principal possibility of application of 19F NMR spin-trapping technique for in vivo ·NO detection [Free Radic. Biol. Med. 36 (2004) 248]. In the present study, we employed this method to elucidate the significance of ·NO availability in animal models of hypertension. In vivo ·NO-induced conversion of the hydroxylamine of the fluorinated nitronyl nitroxide (HNN) to the hydroxylamine of the iminonitroxide (HIN) in hypertensive ISIAH and OXYS rat strains and normotensive Wistar rat strain was measured. Significantly lower HIN/HNN ratios were measured in the blood of the hypertensive rats. The NMR data were found to positively correlate with the levels of nitrite/nitrate evaluated by Griess method and negatively correlate with the blood pressure. In comparison with other traditionally used methods 19F NMR spectroscopy allows in vivo evaluation of ·NO production and provides the basis for in vivo ·NO imaging

  8. Positive parity levels populated in the 17O(3He,p)19F reaction

    Positive parity levels in 19F populated in the 17O(3He,p) reaction are studied upto Esub(x) approx.=7 MeV. The angular distributions of the levels are studied in terms of the DWBA method of single-step process using two-particle spectroscopic amplitudes derived from (sd) shell model calculations. The difference in shape presented by different levels of the same Jsup(π)-value is well given by the shell model amplitudes. (author)

  9. Pionic 2p-1s X-ray transitions in 19F and 23Na

    Pi-atomic 2p-1s transitions have been studied in 19F and 23Na. The measured energies are 195.17 +-0.16 and 275.75 +- 0.26 keV, and the Lorentzian full-widths at half-maximum are 10.12 +- 0.74 and 12.0 +- 1.2 keV respectively. A comparison is made with optical model calculations. (Auth.)

  10. 19F NMR of antimony and arsenic pentafluoride-graphite derivatives

    19F NMR results are reported on first stage SbF5-graphite intercalation compounds and second stage AsF5-graphite intercalation compounds as a function of temperature. Above a cutting temperature the authors postulate the existence of two fluorine populations at least, which they have tried to identify on their spectra according to a pentafluoride oxidation reaction. The results are correlated with a charge transfer coefficient evolving with temperature, and are discussed in comparison with other experimental results. (Auth.)

  11. Accelerated nanoscale magnetic resonance imaging through phase multiplexing

    We report a method for accelerated nanoscale nuclear magnetic resonance imaging by detecting several signals in parallel. Our technique relies on phase multiplexing, where the signals from different nuclear spin ensembles are encoded in the phase of an ultrasensitive magnetic detector. We demonstrate this technique by simultaneously acquiring statistically polarized spin signals from two different nuclear species (1H, 19F) and from up to six spatial locations in a nanowire test sample using a magnetic resonance force microscope. We obtain one-dimensional imaging resolution better than 5 nm, and subnanometer positional accuracy

  12. Accelerated nanoscale magnetic resonance imaging through phase multiplexing

    Moores, B. A.; Eichler, A., E-mail: eichlera@phys.ethz.ch; Takahashi, H.; Navaretti, P.; Degen, C. L. [Department of Physics, ETH Zurich, Otto-Stern-Weg 1, 8093 Zurich (Switzerland); Tao, Y. [Department of Physics, ETH Zurich, Otto-Stern-Weg 1, 8093 Zurich (Switzerland); Department of Chemistry, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, Massachusetts 02139 (United States)

    2015-05-25

    We report a method for accelerated nanoscale nuclear magnetic resonance imaging by detecting several signals in parallel. Our technique relies on phase multiplexing, where the signals from different nuclear spin ensembles are encoded in the phase of an ultrasensitive magnetic detector. We demonstrate this technique by simultaneously acquiring statistically polarized spin signals from two different nuclear species ({sup 1}H, {sup 19}F) and from up to six spatial locations in a nanowire test sample using a magnetic resonance force microscope. We obtain one-dimensional imaging resolution better than 5 nm, and subnanometer positional accuracy.

  13. In Vivo Quantification of Inflammation in Experimental Autoimmune Encephalomyelitis Rats Using Fluorine-19 Magnetic Resonance Imaging Reveals Immune Cell Recruitment outside the Nervous System.

    Jia Zhong

    Full Text Available Progress in identifying new therapies for multiple sclerosis (MS can be accelerated by using imaging biomarkers of disease progression or abatement in model systems. In this study, we evaluate the ability to noninvasively image and quantitate disease pathology using emerging "hot-spot" 19F MRI methods in an experimental autoimmune encephalomyelitis (EAE rat, a model of MS. Rats with clinical symptoms of EAE were compared to control rats without EAE, as well as to EAE rats that received daily prophylactic treatments with cyclophosphamide. Perfluorocarbon (PFC nanoemulsion was injected intravenously, which labels predominately monocytes and macrophages in situ. Analysis of the spin-density weighted 19F MRI data enabled quantification of the apparent macrophage burden in the central nervous system and other tissues. The in vivo MRI results were confirmed by extremely high-resolution 19F/1H magnetic resonance microscopy in excised tissue samples and histopathologic analyses. Additionally, 19F nuclear magnetic resonance spectroscopy of intact tissue samples was used to assay the PFC biodistribution in EAE and control rats. In vivo hot-spot 19F signals were detected predominantly in the EAE spinal cord, consistent with the presence of inflammatory infiltrates. Surprising, prominent 19F hot-spots were observed in bone-marrow cavities adjacent to spinal cord lesions; these were not observed in control animals. Quantitative evaluation of cohorts receiving cyclophosphamide treatment displayed significant reduction in 19F signal within the spinal cord and bone marrow of EAE rats. Overall, 19F MRI can be used to quantitatively monitored EAE disease burden, discover unexpected sites of inflammatory activity, and may serve as a sensitive biomarker for the discovery and preclinical assessment of novel MS therapeutic interventions.

  14. Dark matter spin-dependent limits for WIMP interactions on {sup 19}F by PICASSO

    Archambault, S.; Aubin, F.; Auger, M. [Departement de Physique, Universite de Montreal, Montreal, H3C 3J7 (Canada); Behnke, E. [Department of Physics and Astronomy, Indiana University South Bend, South Bend, IN 46634 (United States); Beltran, B. [Department of Physics, University of Alberta, Edmonton, T6G 2G7 (Canada); Clark, K.; Dai, X.; Davour, A. [Department of Physics, Queen' s University, Kingston, K7L 3NG (Canada); Farine, J. [Department of Physics, Laurentian University, Sudbury, P3E 2C6 (Canada); Faust, R.; Genest, M.-H.; Giroux, G.; Gornea, R. [Departement de Physique, Universite de Montreal, Montreal, H3C 3J7 (Canada); Krauss, C. [Department of Physics, University of Alberta, Edmonton, T6G 2G7 (Canada); Kumaratunga, S. [Departement de Physique, Universite de Montreal, Montreal, H3C 3J7 (Canada); Lawson, I. [SNOLAB, Sudbury, P3E 2C6 (Canada); Leroy, C.; Lessard, L. [Departement de Physique, Universite de Montreal, Montreal, H3C 3J7 (Canada); Levy, C. [Department of Physics, Queen' s University, Kingston, K7L 3NG (Canada); Levine, I. [Department of Physics and Astronomy, Indiana University South Bend, South Bend, IN 46634 (United States)

    2009-11-30

    The PICASSO experiment at SNOLAB reports new results for spin-dependent WIMP interactions on {sup 19}F using the superheated droplet technique. A new generation of detectors and new features which enable background discrimination via the rejection of non-particle induced events are described. First results are presented for a subset of two detectors with target masses of {sup 19}F of 65 g and 69 g respectively and a total exposure of 13.75+-0.48 kgd. No dark matter signal was found and for WIMP masses around 24 GeV/c{sup 2} new limits have been obtained on the spin-dependent cross section on {sup 19}F of sigma{sub F}=13.9 pb (90% C.L.) which can be converted into cross section limits on protons and neutrons of sigma{sub p}=0.16 pb and sigma{sub n}=2.60 pb respectively (90% C.L.). The obtained limits on protons restrict recent interpretations of the DAMA/LIBRA annual modulations in terms of spin-dependent interactions.

  15. Dark Matter Spin-Dependent Limits for WIMP Interactions on 19-F by PICASSO

    Archambault, S; Auger, M; Behnke, E; Beltran, B; Clark, K; Dai, X; Davour, A; Farine, J; Faust, R; Genest, M-H; Giroux, G; Gornea, R; Krauss, C; Kumaratunga, S; Lawson, I; Leroy, C; Lessard, L; Levy, C; Levine, I; MacDonald, R; Martin, J -P; Nadeau, P; Noble, A; Piro, M -C; Pospísil, S; Shepherd, T; Starinski, N; Stekl, I; Storey, C; Wichoski, U; Zacek, V

    2009-01-01

    The PICASSO experiment at SNOLAB reports new results for spin-dependent WIMP interactions on $^{19}$F using the superheated droplet technique. A new generation of detectors and new features which enable background discrimination via the rejection of non-particle induced events are described. First results are presented for a subset of two detectors with target masses of $^{19}$F of 65 g and 69 g respectively and a total exposure of 13.75 $\\pm$ 0.48 kgd. No dark matter signal was found and for WIMP masses around 24 GeV/c$^2$ new limits have been obtained on the spin-dependent cross section on $^{19}$F of $\\sigma_F$ = 13.9 pb (90% C.L.) which can be converted into cross section limits on protons and neutrons of $\\sigma_p$ = 0.16 pb and $\\sigma_n$ = 2.60 pb respectively (90% C.L). The obtained limits on protons restrict recent interpretations of the DAMA/LIBRA annual modulations in terms of spin-dependent interactions.

  16. Synthesis of fluorinated maltose derivatives for monitoring protein interaction by 19F NMR

    Michaela Braitsch

    2012-03-01

    Full Text Available A novel reporter system, which is applicable to the 19F NMR investigation of protein interactions, is presented. This approach uses 2-F-labeled maltose as a spy ligand to indirectly probe protein–ligand or protein–protein interactions of proteins fused or tagged to the maltose-binding protein (MBP. The key feature is the simultaneous NMR observation of both 19F NMR signals of gluco/manno-type-2-F-maltose-isomers; one isomer (α-gluco-type binds to MBP and senses the protein interaction, and the nonbinding isomers (β-gluco- and/or α/β-manno-type are utilized as internal references. Moreover, this reporter system was used for relative affinity studies of fluorinated and nonfluorinated carbohydrates to the maltose-binding protein, which were found to be in perfect agreement with published X-ray data. The results of the NMR competition experiments together with the established correlation between 19F chemical shift data and molecular interaction patterns, suggest valuable applications for studies of protein–ligand interaction interfaces.

  17. Enhanced nuclear magnetism: some novel features and prospective experiments

    It is shown that methods used for studying nuclear magnetism and nuclear magnetic ordering can be extended to 'enhanced nuclear magnetism'. These methods include the use of r.f. fields for adiabatic demagnetization in the rotating frame (a.d.r.f) and beams of neutrons whose spins interact with the nuclear spins. The 'enhancement' of the nuclear moment arises from the electronic magnetization M1 induced through the hyperfine interaction. It is shown that the spatial distribution of M1 is the same as that of The Van Vleck magnetization induced by an external field, provided that J is a good quantum number. The spatial distributions are not in general the same in Russell-Saunders coupling, eg. in the 3d group. The Bloch equations are extended to include anisotropic nuclear moments. The 'truncated' spin Hamiltonian is derived for spin-spin interaction between enhanced moments. A general cancellation theorem for second-order processes in spin-lattice relaxation is derived. The interactions of neutrons with the true nuclear moment, the Van Vleck moment, the 'pseudonuclear' moment and the 'pseudomagnetic' nuclear moment are discussed. Ordered states of enhanced nuclear moment systems are considered, together with the conditions under which they might be produced by a.d.r.f. following dynamic nuclear polarization. (U.K.)

  18. Nuclear magnetic resonance of randomly diluted magnetic materials

    The temperature dependence of the nuclear relaxation rates and line shapes of the FO resonance in the diluted antiferromagnet Fex Zn1-x F2 and Mnx Zn1-x F2 are studied over a large temperature range TN 1) of the FO nuclei, which are not transfer hyperfine coupled to the Fe (or Mn) spins, have been measured and calculated as a function of the concentration x. Good agreement with experiment is found for the theoretical results, which have been obtained in the range 0.1 ≤ x ≤ 0.8. The temperature dependence of 1/T1 for TN1 data near TN was used to study Random Field Effects on the critical behavior of Mn.65 Zn.35 F2, for fields applied parallel and perpendicular to the easy (C) axis. It was found that the transition temperature TN depressed substantially with field only for Ho || C. The experimental results are in general accord with the theory for Random Field Effects in disordered, anisotropic antiferromagnets. The critical divergence of the inhomogeneously broadened FO NMR was studied in Fe.6 Zn.4 F2 above TN. The experimental results agree with Heller's calculation of the NMR line broadening by Random Field Effects. With Ho || C the line shape changes from Gaussian towards Lozentzian for t -2 and below TN its line width increase qualitatively following the increase in the sublattice magnetization. (author)

  19. Sensitive Magnetic Control of Ensemble Nuclear Spin Hyperpolarisation in Diamond

    Wang, Hai-Jing; Avalos, Claudia E; Seltzer, Scott J; Budker, Dmitry; Pines, Alexander; Bajaj, Vikram S

    2012-01-01

    Dynamic nuclear polarisation, which transfers the spin polarisation of electrons to nuclei, is routinely applied to enhance the sensitivity of nuclear magnetic resonance; it is also critical in spintronics, particularly when spin hyperpolarisation can be produced and controlled optically or electrically. Here we show the complete polarisation of nuclei located near the optically-polarised nitrogen-vacancy (NV) centre in diamond. When approaching the ground-state level anti-crossing condition of the NV electron spins, 13C nuclei in the first-shell are polarised in a pattern that depends sensitively and sharply upon the magnetic field. Based on the anisotropy of the hyperfine coupling and of the optical polarisation mechanism, we predict and observe a complete reversal of the nuclear spin polarisation with a few-mT change in the magnetic field. The demonstrated sensitive magnetic control of nuclear polarisation at room temperature will be useful for sensitivity-enhanced NMR, nuclear-based spintronics, and quant...

  20. Search for magnetic monopoles with nuclear track detectors

    Giorgini, M

    2000-01-01

    This paper describes an experimental search for GUT magnetic monopoles in the MACRO experiment using the nuclear track subdetector CR39. After discussing the working principle, the charge resolution and the calibration of the detector, the experimental procedure for searching for magnetic monopoles is described. Since no candidates were found, the upper flux limits obtained by the MACRO CR39 used as a "stand alone detector" for magnetic monopoles of different magnetic charges are presented.

  1. Least Squares Magnetic-Field Optimization for Portable Nuclear Magnetic Resonance Magnet Design

    Single-sided and mobile nuclear magnetic resonance (NMR) sensors have the advantages of portability, low cost, and low power consumption compared to conventional high-field NMR and magnetic resonance imaging (MRI) systems. We present fast, flexible, and easy-to-implement target field algorithms for mobile NMR and MRI magnet design. The optimization finds a global optimum in a cost function that minimizes the error in the target magnetic field in the sense of least squares. When the technique is tested on a ring array of permanent-magnet elements, the solution matches the classical dipole Halbach solution. For a single-sided handheld NMR sensor, the algorithm yields a 640 G field homogeneous to 16,100 ppm across a 1.9 cc volume located 1.5 cm above the top of the magnets and homogeneous to 32,200 ppm over a 7.6 cc volume. This regime is adequate for MRI applications. We demonstrate that the homogeneous region can be continuously moved away from the sensor by rotating magnet rod elements, opening the way for NMR sensors with adjustable 'sensitive volumes'

  2. Verification of threshold activation detection (TAD) technique in prompt fission neutron detection using scintillators containing 19F

    In the present study ⌀ 5''× 3'' and ⌀ 2''× 2'' EJ-313 liquid fluorocarbon as well as ⌀ 2'' × 3'' BaF2 scintillators were exposed to neutrons from a 252Cf neutron source and a Sodern Genie 16GT deuterium-tritium (D+T) neutron generator. The scintillators responses to β− particles with maximum endpoint energy of 10.4 MeV from the n+19F reactions were studied. Response of a ⌀ 5'' × 3'' BC-408 plastic scintillator was also studied as a reference. The β− particles are the products of interaction of fast neutrons with 19F which is a component of the EJ-313 and BaF2 scintillators. The method of fast neutron detection via fluorine activation is already known as Threshold Activation Detection (TAD) and was proposed for photofission prompt neutron detection from fissionable and Special Nuclear Materials (SNM) in the field of Homeland Security and Border Monitoring. Measurements of the number of counts between 6.0 and 10.5 MeV with a 252Cf source showed that the relative neutron detection efficiency ratio, defined as εBaF2 / εEJ−313−5'', is 32.0% ± 2.3% and 44.6% ± 3.4% for front-on and side-on orientation of the BaF2, respectively. Moreover, the ⌀ 5'' EJ-313 and side-on oriented BaF2 were also exposed to neutrons from the D+T neutron generator, and the relative efficiency εBaF2 / εEJ−313−5'' was estimated to be 39.3%. Measurements of prompt photofission neutrons with the BaF2 detector by means of data acquisition after irradiation (out-of-beam) of nuclear material and between the beam pulses (beam-off) techniques were also conducted on the 9 MeV LINAC of the SAPHIR facility

  3. Verification of threshold activation detection (TAD) technique in prompt fission neutron detection using scintillators containing 19F

    Sibczynski, P.; Kownacki, J.; Moszyński, M.; Iwanowska-Hanke, J.; Syntfeld-Każuch, A.; Gójska, A.; Gierlik, M.; Kaźmierczak, Ł.; Jakubowska, E.; Kędzierski, G.; Kujawiński, Ł.; Wojnarowicz, J.; Carrel, F.; Ledieu, M.; Lainé, F.

    2015-09-01

    In the present study ⌀ 5''× 3'' and ⌀ 2''× 2'' EJ-313 liquid fluorocarbon as well as ⌀ 2'' × 3'' BaF2 scintillators were exposed to neutrons from a 252Cf neutron source and a Sodern Genie 16GT deuterium-tritium (D+T) neutron generator. The scintillators responses to β- particles with maximum endpoint energy of 10.4 MeV from the n+19F reactions were studied. Response of a ⌀ 5'' × 3'' BC-408 plastic scintillator was also studied as a reference. The β- particles are the products of interaction of fast neutrons with 19F which is a component of the EJ-313 and BaF2 scintillators. The method of fast neutron detection via fluorine activation is already known as Threshold Activation Detection (TAD) and was proposed for photofission prompt neutron detection from fissionable and Special Nuclear Materials (SNM) in the field of Homeland Security and Border Monitoring. Measurements of the number of counts between 6.0 and 10.5 MeV with a 252Cf source showed that the relative neutron detection efficiency ratio, defined as epsilonBaF2 / epsilonEJ-313-5'', is 32.0% ± 2.3% and 44.6% ± 3.4% for front-on and side-on orientation of the BaF2, respectively. Moreover, the ⌀ 5'' EJ-313 and side-on oriented BaF2 were also exposed to neutrons from the D+T neutron generator, and the relative efficiency epsilonBaF2 / epsilonEJ-313-5'' was estimated to be 39.3%. Measurements of prompt photofission neutrons with the BaF2 detector by means of data acquisition after irradiation (out-of-beam) of nuclear material and between the beam pulses (beam-off) techniques were also conducted on the 9 MeV LINAC of the SAPHIR facility.

  4. Nuclear magnetic resonance studies of metabolic regulation

    Nuclear magnetic resonance (NMR) techniques for the detection of the metabolic transformations of biological compounds labeled with stable isotopes, particularly carbon-13 have been explored. We have studied adipose tissue in the intact rat, the exteriorized epididymal fat pad, and the isolated adipocyte. Triacylglycerol metabolism in adipose tissue is regulated by lipogenic factors (insulin, corticosterone, thyroxine, and growth hormone) and lipolytic factors (glucagon and catecholamines). The synthesis of triglyceride from 5.5 mM glucose was stimulated by about 4-fold by 10 nM insulin. Triglyceride synthesis from glucose in the presence of insulin occurred at a rate of 330 nmol/hr/106 cells. Since the NMR signals from free and esterified fatty acids and glycerol are distinct, we could directly measure the rate of hormone-stimulated lipolysis. Epinephrine (10 μM) gave a lipolytic rate of 0.30 μmol/hr/106 cells as monitored by free-glycerol appearance in the medium. 13C NMR provides a superior method for the measurement of triglyceride metabolism since it directly measures the changes in the substrates and products in situ

  5. Nuclear Composition of Magnetized GRB Jets

    Shibata, Sanshiro

    2015-01-01

    We investigate the fraction of metal nuclei in the relativistic jets of gamma-ray bursts associated with core-collapse supernovae. We simulate the fallback in jet-induced explosions with two-dimensional relativistic hydrodynamics calculations and the jet acceleration with steady, radial, relativistic magnetohydrodynamics calculations, and derive detail nuclear composition of the jet by postprocessing calculation. We found that if the temperature at the jet launch site is above $4.7\\times 10^9$K, quasi-statistical equilibrium (QSE) is established and heavy nuclei are dissociated to light particles such as $^4$He during the acceleration of the jets. The criterion for the survival of metal nuclei is written in terms of the isotropic jet luminosity as $L_{\\rm j}^{\\rm iso} \\lesssim 3.9\\times 10^{50}(R_{\\rm i}/10^7{\\rm cm})^2 (1+\\sigma_{\\rm i})~{\\rm erg~s^{-1}}$, where $R_{\\rm i}$ and $\\sigma_{\\rm i}$ are the initial radius of the jets and the initial magnetization parameter, respectively. If the jet is initially d...

  6. Nuclear magnetic resonance (NMR)-based metabolomics.

    Keun, Hector C; Athersuch, Toby J

    2011-01-01

    Biofluids are by far the most commonly studied sample type in metabolic profiling studies, encompassing blood, urine, cerebrospinal fluid, cell culture media and many others. A number of these fluids can be obtained at a high sampling frequency with minimal invasion, permitting detailed characterisation of dynamic metabolic events. One of the attractive properties of solution-state metabolomics is the ability to generate profiles from these fluids following simple preparation, allowing the analyst to gain a naturalistic, largely unbiased view of their composition that is highly representative of the in vivo situation. Solution-state samples can also be generated from the extraction of tissue or cellular samples that can be tailored to target metabolites with particular properties. Nuclear magnetic resonance (NMR) provides an excellent technique for profiling these fluids and is especially adept at characterising complex solutions. Profiling biofluid samples by NMR requires appropriate preparation and experimental conditions to overcome the demands of varied sample matrices, including those with high protein, lipid or saline content, as well as the presence of water in aqueous samples. PMID:21207299

  7. Selectivity in multiple quantum nuclear magnetic resonance

    The observation of multiple-quantum nuclear magnetic resonance transitions in isotropic or anisotropic liquids is shown to give readily interpretable information on molecular configurations, rates of motional processes, and intramolecular interactions. However, the observed intensity of high multiple-quantum transitions falls off dramatically as the number of coupled spins increases. The theory of multiple-quantum NMR is developed through the density matrix formalism, and exact intensities are derived for several cases (isotropic first-order systems and anisotropic systems with high symmetry) to shown that this intensity decrease is expected if standard multiple-quantum pulse sequences are used. New pulse sequences are developed which excite coherences and produce population inversions only between selected states, even though other transitions are simultaneously resonant. One type of selective excitation presented only allows molecules to absorb and emit photons in groups of n. Coherent averaging theory is extended to describe these selective sequences, and to design sequences which are selective to arbitrarily high order in the Magnus expansion. This theory and computer calculations both show that extremely good selectivity and large signal enhancements are possible

  8. TANKS 18 AND 19-F EQUIPMENT GROUT FILL MATERIAL EVALUATION AND RECOMMENDATIONS

    Stefanko, D.; Langton, C.

    2011-12-15

    The United States Department of Energy (US DOE) intends to remove Tanks 18-F and 19-F at the Savannah River Site (SRS) from service. The high-level waste (HLW) tanks have been isolated from the F-area Tank Farm (FTF) facilities and will be filled with cementitious grout for the purpose of: (1) physically stabilizing the empty volumes in the tanks, (2) limiting/eliminating vertical pathways from the surface to residual waste on the bottom of the tanks, (3) providing an intruder barrier, and (4) providing an alkaline, chemical reducing environment within the closure boundary to limit solubility of residual radionuclides. Bulk waste and heel waste removal equipment will remain in Tanks 18-F and 19-F when the tanks are closed. This equipment includes: mixer pumps, transfer pumps, transfer jets, equipment support masts, sampling masts and dip tube assemblies. The current Tank 18-F and 19-F closure strategy is to grout the internal void spaces in this equipment to eliminate fast vertical pathways and slow water infiltration to the residual material on the tank floor. This report documents the results of laboratory testing performed to identify a grout formulation for filling the abandoned equipment in Tanks 18-F and 19-F. The objective of this work was to formulate a flowable grout for filling internal voids of equipment that will remain in Tanks 18-F and 19-F during the final closures. This work was requested by V. A. Chander, Tank Farm Closure Engineering, in HLW-TTR-2011-008. The scope for this task is provided in the Task Technical and Quality Assurance Plan (TTQAP), SRNL-RP-2011-00587. The specific objectives of this task were to: (1) Prepare and evaluate the SRR cooling coil grout identified in WSRC-STI-2008-00298 per the TTR for this work. The cooling coil grout is a mixture of BASF MasterFlow{reg_sign} 816 cable grout (67.67 wt. %), Grade 100 ground granulated blast furnace slag (7.52 wt. %) and water (24.81 wt. %); (2) Identify equipment grout placement and

  9. Tanks 18 And 19-F Equipment Grout Fill Material Evaluation And Recommendations

    The United States Department of Energy (US DOE) intends to remove Tanks 18-F and 19-F at the Savannah River Site (SRS) from service. The high-level waste (HLW) tanks have been isolated from the F-area Tank Farm (FTF) facilities and will be filled with cementitious grout for the purpose of: (1) physically stabilizing the empty volumes in the tanks, (2) limiting/eliminating vertical pathways from the surface to residual waste on the bottom of the tanks, (3) providing an intruder barrier, and (4) providing an alkaline, chemical reducing environment within the closure boundary to limit solubility of residual radionuclides. Bulk waste and heel waste removal equipment will remain in Tanks 18-F and 19-F when the tanks are closed. This equipment includes: mixer pumps, transfer pumps, transfer jets, equipment support masts, sampling masts and dip tube assemblies. The current Tank 18-F and 19-F closure strategy is to grout the internal void spaces in this equipment to eliminate fast vertical pathways and slow water infiltration to the residual material on the tank floor. This report documents the results of laboratory testing performed to identify a grout formulation for filling the abandoned equipment in Tanks 18-F and 19-F. The objective of this work was to formulate a flowable grout for filling internal voids of equipment that will remain in Tanks 18-F and 19-F during the final closures. This work was requested by V. A. Chander, Tank Farm Closure Engineering, in HLW-TTR-2011-008. The scope for this task is provided in the Task Technical and Quality Assurance Plan (TTQAP), SRNL-RP-2011-00587. The specific objectives of this task were to: (1) Prepare and evaluate the SRR cooling coil grout identified in WSRC-STI-2008-00298 per the TTR for this work. The cooling coil grout is a mixture of BASF MasterFlow(regsign) 816 cable grout (67.67 wt. %), Grade 100 ground granulated blast furnace slag (7.52 wt. %) and water (24.81 wt. %); (2) Identify equipment grout placement and

  10. 22Na production cross sections from the 19F(α,n) reaction

    The thick-target neutron yield from the 19F(α,n) reaction has been measured in 0.25-MeV steps over the energy range 3.5 less than or equal to E/sub α/ less than or equal to 10.0 MeV. From these measurements, 22Na production cross sections have been deduced. These cross sections are compared with the results of a Hauser-Feshbach calculation and with the results of previous experimental investigations. 10 references

  11. Largely Deformed Dinuclear System Formed in 19F +27A1 Dissipative Collision

    HAN Jian-Long; WU He-Yu; LI Zhi-Chang; LU Xiu-Qin; ZHAO Kui; ZHOU Ping; LIU Jian-Cheng; XU Guo-Ji; Sergey Yu Kun; WANG Qi; DONG Yu-Chuan; LI Song-Lin; DUAN Li-Min; XU Hu-Shan; XU Hua-Gen; CHEN Ruo-Fu; BAI Zhen

    2006-01-01

    @@ Excitation functions are measured for different charge products of the 19F+27 Al reaction in the laboratory energy range 110.25-118.75MeV in steps of 250keV at θlab = 57°, 31° and -29°. The coherence rotation angular velocities of the intermediate dinuclear systems formed in the reaction are extracted from the cross section energy autocorrelation functions. Compared the angular velocity extracted from the experimental data with the ones deduced from the sticking limit, it is indicated that a larger deformation of the intermediate dinuclear system exists.

  12. Nuclear magnetic tomography in the differential diagnosis of liver disease

    Roedl, W.

    1985-05-01

    In evaluating nuclear magnetic tomography for the diagnosis of liver disease, one must differentiate between circumscribed and diffuse lesions. Nuclear magnetic tomography provides additional information for lesions which are echogenic on ultrasound and can differentiate between metastases, haemangiomas and hamartomas. In diffuse parenchymal disease measurement of relaxation time can differentiate between fatty liver, cirrhosis (alcoholic, primary biliary), haemochromatosis (cirrhotic transformation) and hepatoma. NMR spectroscopy is a method for the future.

  13. Implementation of Quantum Logic Gates by Nuclear Magnetic Resonance Spectroscopy

    DU Jiang-Feng; WU Ji-Hui; SHI Ming-Jun; HAN Liang; ZHOU Xian-Yi; YE Bang-Jiao; WENG Hui-Ming; HAN Rong-Dian

    2000-01-01

    Using nuclear magnetic resonance techniques with a solution of cytosine molecules, we show an implementation of certain quantum logic gates (including NOT gate, square-root of NOT gate and controlled-NOT gate), which have central importance in quantum computing. In addition, experimental results show that nuclear magnetic resonance spectroscopy can efficiently measure the result of quantum computing without attendant wave-function collapse.

  14. GEOCHEMICAL CONTROLS ON NUCLEAR MAGNETIC RESONANCE MEASUREMENTS

    Proton nuclear magnetic resonance (NMR) is used in the Earth Sciences as a means of obtaining information about the molecular-scale environment of fluids in porous geological materials. Laboratory experiments were conducted to advance our fundamental understanding of the link between the NMR response and the geochemical properties of geological materials. In the first part of this research project, we studied the impact of both the surface-area-to-volume ratio (S/V) of the pore space and the surface relaxivity on the NMR response of fluids in sand-clay mixtures. This study highlighted the way in which these two parameters control our ability to use NMR measurements to detect and quantify fluid saturation in multiphase saturated systems. The second part of the project was designed to explore the way in which the mineralogic form of iron, as opposed to simply the concentration of iron, affects the surface relaxation rate and, more generally, the NMR response of porous materials. We found that the magnitude of the surface relaxation rate was different for the various iron-oxide minerals because of changes in both the surface-area-to-volume ratio of the pore space, and the surface relaxivity. Of particular significance from this study was the finding of an anomalously large surface relaxivity of magnetite compared to that of the other iron minerals. Differences in the NMR response of iron minerals were seen in column experiments during the reaction of ferrihydrite-coated quartz sand with aqueous Fe(II) solutions to form goethite, lepidocrocite and magnetite; indicating the potential use of NMR as a means of monitoring geochemical reactions. The final part of the research project investigated the impact of heterogeneity, at the pore-scale, on the NMR response. This work highlighted the way in which the geochemistry, by controlling the surface relaxivity, has a significant impact on the link between NMR data and the microgeometry of the pore space.

  15. Multinucleon transfer in O,1816,19F+208Pb reactions at energies near the fusion barrier

    Rafferty, D. C.; Dasgupta, M.; Hinde, D. J.; Simenel, C.; Simpson, E. C.; Williams, E.; Carter, I. P.; Cook, K. J.; Luong, D. H.; McNeil, S. D.; Ramachandran, K.; Vo-Phuoc, K.; Wakhle, A.

    2016-08-01

    Background: Nuclear reactions are complex, involving collisions between composite systems where many-body dynamics determines outcomes. Successful models have been developed to explain particular reaction outcomes in distinct energy and mass regimes, but a unifying picture remains elusive. The irreversible transfer of kinetic energy from the relative motion of the collision partners to their internal states, as is known to occur in deep inelastic collisions, has yet to be successfully incorporated explicitly into fully quantal reaction models. The influence of these processes on fusion is not yet quantitatively understood. Purpose: To investigate the population of high excitation energies in transfer reactions at sub-barrier energies, which are precursors to deep inelastic processes, and their dependence on the internuclear separation. Methods: Transfer probabilities and excitation energy spectra have been measured in collisions of O,1816,19F+208Pb , at various energies below and around the fusion barrier, by detecting the backscattered projectile-like fragments in a Δ E -E telescope. Results: The relative yields of different transfer outcomes are strongly driven by Q values, but change with the internuclear separation. In 16O+208Pb , single nucleon transfer dominates, with a strong contribution from -2 p transfer close to the Coulomb barrier, though this channel becomes less significant in relation to the -2 p 2 n transfer channel at larger separations. For 18O+208Pb , the -2 p 2 n channel is the dominant charge transfer mode at all separations. In the reactions with 19F,-3 p 2 n transfer is significant close to the barrier, but falls off rapidly with energy. Multinucleon transfer processes are shown to lead to high excitation energies (up to ˜15 MeV), which is distinct from single nucleon transfer modes which predominantly populate states at low excitation energy. Conclusions: Kinetic energy is transferred into internal excitations following transfer, with this

  16. Tank 18-F And 19-F Tank Fill Grout Scale Up Test Summary

    High-level waste (HLW) tanks 18-F and 19-F have been isolated from FTF facilities. To complete operational closure the tanks will be filled with grout for the purpose of: (1) physically stabilizing the tanks, (2) limiting/eliminating vertical pathways to residual waste, (3) entombing waste removal equipment, (4) discouraging future intrusion, and (5) providing an alkaline, chemical reducing environment within the closure boundary to control speciation and solubility of select radionuclides. This report documents the results of a four cubic yard bulk fill scale up test on the grout formulation recommended for filling Tanks 18-F and 19-F. Details of the scale up test are provided in a Test Plan. The work was authorized under a Technical Task Request (TTR), HLE-TTR-2011-008, and was performed according to Task Technical and Quality Assurance Plan (TTQAP), SRNL-RP-2011-00587. The bulk fill scale up test described in this report was intended to demonstrate proportioning, mixing, and transportation, of material produced in a full scale ready mix concrete batch plant. In addition, the material produced for the scale up test was characterized with respect to fresh properties, thermal properties, and compressive strength as a function of curing time.

  17. Dark matter spin-dependent limits for WIMP interactions on {sup 19}F by PICASSO

    Beltran, Berta, E-mail: bbeltran@phys.ualberta.c [Department of Physics, University of Alberta, Edmonton, T6G 2G7 (Canada)

    2010-01-01

    The PICASSO experiment at SNOLAB uses super-heated C{sub 4}F{sub 10} droplets suspended in a gel as a target sensitive to WIMP-proton spin-dependent elastic scattering. The phase II setup has been improved substantially in sensitivity by using an array of 32 detectors with an active mass of {approx}65 g each and largely reduced background. First results are presented for a subset of two detectors with target masses of {sup 19}F of 65 g and 69 g respectively and a total exposure of 13.75 {+-} 0.48 kgd. No dark matter signal was found and for WIMP masses around 24 GeV/c{sup 2} new limits have been obtained on the spin-dependent cross section on {sup 19}F of {sigma}{sub F} = 13.9 pb (90% C.L.) which can be converted into cross section limits on protons and neutrons of {sigma}{sub p} = 0.15 pb and {sigma}{sub n} = 2.45 pb respectively (90% C.L). The obtained limits on protons restrict recent interpretations of the DAMA/LIBRA annual modulations in terms of spin-dependent interactions.

  18. TANK 18-F AND 19-F TANK FILL GROUT SCALE UP TEST SUMMARY

    Stefanko, D.; Langton, C.

    2012-01-03

    High-level waste (HLW) tanks 18-F and 19-F have been isolated from FTF facilities. To complete operational closure the tanks will be filled with grout for the purpose of: (1) physically stabilizing the tanks, (2) limiting/eliminating vertical pathways to residual waste, (3) entombing waste removal equipment, (4) discouraging future intrusion, and (5) providing an alkaline, chemical reducing environment within the closure boundary to control speciation and solubility of select radionuclides. This report documents the results of a four cubic yard bulk fill scale up test on the grout formulation recommended for filling Tanks 18-F and 19-F. Details of the scale up test are provided in a Test Plan. The work was authorized under a Technical Task Request (TTR), HLE-TTR-2011-008, and was performed according to Task Technical and Quality Assurance Plan (TTQAP), SRNL-RP-2011-00587. The bulk fill scale up test described in this report was intended to demonstrate proportioning, mixing, and transportation, of material produced in a full scale ready mix concrete batch plant. In addition, the material produced for the scale up test was characterized with respect to fresh properties, thermal properties, and compressive strength as a function of curing time.

  19. TANK 18 AND 19-F TIER 1A EQUIPMENT FILL MOCK UP TEST SUMMARY

    Stefanko, D.; Langton, C.

    2011-11-04

    The United States Department of Energy (US DOE) has determined that Tanks 18-F and 19-F have met the F-Tank Farm (FTF) General Closure Plan Requirements and are ready to be permanently closed. The high-level waste (HLW) tanks have been isolated from FTF facilities. To complete operational closure they will be filled with grout for the purpose of: (1) physically stabilizing the tanks, (2) limiting/eliminating vertical pathways to residual waste, (3) discouraging future intrusion, and (4) providing an alkaline, chemical reducing environment within the closure boundary to control speciation and solubility of select radionuclides. Bulk waste removal and heel removal equipment remain in Tanks 18-F and 19-F. This equipment includes the Advance Design Mixer Pump (ADMP), transfer pumps, transfer jets, standard slurry mixer pumps, equipment-support masts, sampling masts, dip tube assemblies and robotic crawlers. The present Tank 18 and 19-F closure strategy is to grout the equipment in place and eliminate vertical pathways by filling voids in the equipment to vertical fast pathways and water infiltration. The mock-up tests described in this report were intended to address placement issues identified for grouting the equipment that will be left in Tank 18-F and Tank 19-F. The Tank 18-F and 19-F closure strategy document states that one of the Performance Assessment (PA) requirements for a closed tank is that equipment remaining in the tank be filled to the extent practical and that vertical flow paths 1 inch and larger be grouted. The specific objectives of the Tier 1A equipment grout mock-up testing include: (1) Identifying the most limiting equipment configurations with respect to internal void space filling; (2) Specifying and constructing initial test geometries and forms that represent scaled boundary conditions; (3) Identifying a target grout rheology for evaluation in the scaled mock-up configurations; (4) Scaling-up production of a grout mix with the target rheology

  20. 170 Nanometer Nuclear Magnetic Resonance Imaging using Magnetic Resonance Force Microscopy

    Thurber, K R; Smith, D D; Thurber, Kent R.; Harrell, Lee E.; Smith, Doran D.

    2003-01-01

    We demonstrate one-dimensional nuclear magnetic resonance imaging of the semiconductor GaAs with 170 nanometer slice separation and resolve two regions of reduced nuclear spin polarization density separated by only 500 nanometers. This is achieved by force detection of the magnetic resonance, Magnetic Resonance Force Microscopy (MRFM), in combination with optical pumping to increase the nuclear spin polarization. Optical pumping of the GaAs creates spin polarization up to 12 times larger than the thermal nuclear spin polarization at 5 K and 4 T. The experiment is sensitive to sample volumes containing $\\sim 4 \\times 10^{11}$ $^{71}$Ga$/\\sqrt{Hz}$. These results demonstrate the ability of force-detected magnetic resonance to apply magnetic resonance imaging to semiconductor devices and other nanostructures.

  1. Budding yeast cDNA sequencing project: Y102_E19_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y102_E19_F.ab1 - - - Show Y102_E19_F.ab1 Seqid Y102_E19_F.ab1 Link to SGD - Link to dbEST - Link ... _F.ab1 753 0 753 ABI GCTCTAAGCTGCTCGAGTGTAAACGACGGCCAT TACGTATTTTATACGAC TCACTATAGGGAATTCCTTAAGATTAAATGTGG ... AAACTGGATAAAAACCTTTGAA GAATTTGGAACAACCCCCACCTAAATGGCAT GGAAAAAAAGGCTTTATTT GTAAAATTTGTGAGGCTATTGCTTTATTTGT ...

  2. Susceptibility effects in nuclear magnetic resonance imaging

    The properties of dephasing and the resulting relaxation of the magnetization are the basic principle on which all magnetic resonance imaging methods are based. The signal obtained from the gyrating spins is essentially determined by the properties of the considered tissue. Especially the susceptibility differences caused by magnetized materials (for example, deoxygenated blood, BOLD-effect) or magnetic nanoparticles are becoming more important for biomedical imaging. In the present work, the influence of such field inhomogeneities on the NMR-signal is analyzed. (orig.)

  3. Nuclear magnetic resonance spectroscopy in pancreatic disorders

    Ofer Kaplan

    1997-03-01

    Full Text Available Nuclear magnetic resonance spectroscopy (NMRS is a powerful technique that enables continuous monitoring of biochemical processes in tissues and organs in a non-invasive manner. A model of isolated perfused rat pancreas, suitable for NMRS studies, was developed. Acute pancreatitis was induced by injections of either 0.5 ml 5% sodium taurocholate (TC into the bile duets, or 1.0 ml 10% TC injections into the pancreatic parenchyma. Phosphorous (31P NMRS of experimental pancreatitis were characterized by a transient signal at -0.18±0.04 ppm which was assigned as solubilized lecithin, and can be used as an indicator of the early phases of the discase. Depletion of the high energy phosphorous compounds, phosphocreatine and ATP, were also found during acute pancreatitis, and paralleled the extension of the pathological damage. The role of NMRS in pancreatic cancer diagnosis and its treatment were assessed in three models of pancreatic neoplasms. Perfused MIA PaCa-2 human pancreatic cancer cells, subcutancously implanted pancreatic tumors in hamsters, and pancreatic tumors induced in-situ in rats by direct appiication of the carcinogen 7,12-dimethyl benzanthracene, were studied by phosphorous (31P, sodium (23Na and proton (¹H NMRS. 31P spectra of pancreatic cancer were qualitatively similar to those of intact organs. However, 31P NMRS was found to be useful for monitoring the effects of treatment. Total (infra- and extracellular sodium concentrations, measured in the solid tumors, were similar in both the normal pancreas and the pancreatic tumors (39-40 mmol/g wet weight. Proton spectra of perchloric acid extracts revealed several differences between tumors and control pancreases. The principal findings were elevated levels of the amino acid taurine, from I.17±O.39 mmol/g wet weight in healthy pancreases, to 2.79±0.71 mmol/g wet weight in pancreatic carcinoma in rats, and lactate levels which increased from 0.92±0.2 to 6.19±1.93 mmol/g wet weight

  4. Comparison of nuclear electric resonance and nuclear magnetic resonance in integer and fractional quantum Hall states

    Electric-field-induced nuclear resonance (NER: nuclear electric resonance) involving quantum Hall states (QHSs) was studied at various filling factors by exploiting changes in nuclear spins polarized at quantum Hall breakdown. Distinct from the magnetic dipole interaction in nuclear magnetic resonance, the interaction of the electric-field gradient with the electric quadrupole moment plays the dominant role in the NER mechanism. The magnitude of the NER signal strongly depends on whether electronic states are localized or extended. This indicates that NER is sensitive to the screening capability of the electric field associated with QHSs

  5. Comparison of nuclear electric resonance and nuclear magnetic resonance in integer and fractional quantum Hall states

    Tomimatsu, Toru, E-mail: tomimatsu@ils.uec.ac.jp; Shirai, Shota; Hashimoto, Katsushi, E-mail: hashi@m.tohoku.ac.jp; Sato, Ken [Department of Physics, Tohoku University, Sendai 980-8578 (Japan); Hirayama, Yoshiro [Department of Physics, Tohoku University, Sendai 980-8578 (Japan); WPI-Advanced Institute for Materials Research, Tohoku University, Sendai 980-8577 (Japan)

    2015-08-15

    Electric-field-induced nuclear resonance (NER: nuclear electric resonance) involving quantum Hall states (QHSs) was studied at various filling factors by exploiting changes in nuclear spins polarized at quantum Hall breakdown. Distinct from the magnetic dipole interaction in nuclear magnetic resonance, the interaction of the electric-field gradient with the electric quadrupole moment plays the dominant role in the NER mechanism. The magnitude of the NER signal strongly depends on whether electronic states are localized or extended. This indicates that NER is sensitive to the screening capability of the electric field associated with QHSs.

  6. Comparison of nuclear electric resonance and nuclear magnetic resonance in integer and fractional quantum Hall states

    Toru Tomimatsu

    2015-08-01

    Full Text Available Electric-field-induced nuclear resonance (NER: nuclear electric resonance involving quantum Hall states (QHSs was studied at various filling factors by exploiting changes in nuclear spins polarized at quantum Hall breakdown. Distinct from the magnetic dipole interaction in nuclear magnetic resonance, the interaction of the electric-field gradient with the electric quadrupole moment plays the dominant role in the NER mechanism. The magnitude of the NER signal strongly depends on whether electronic states are localized or extended. This indicates that NER is sensitive to the screening capability of the electric field associated with QHSs.

  7. Effective Giromagnetic Ratios in Artifical Nuclear Magnetization Pumping of the Noble Gases Mix

    Popov E.N.

    2015-01-01

    Full Text Available Dynamic of the nuclear magnetization of the two noble gases mix was studied in this research. Nuclear magnetization pumped along the induction of external magnetic field. Vector of nuclear magnetization is given a tilt by the week rotational magnetic field, which makes NMR for noble gases. Interaction between the nuclear magnetic moments of the different noble gases adducted to shifts at the frequency of nuclear moments precession in external magnetic field. Effective gyromagnetic ratios of the nuclear of noble gases is defined and it different from the tabulated value. There is theoretical calculation of effective gyromagnetic ratios in this research.

  8. Tanks 18 And 19-F Structural Flowable Grout Fill Material Evaluation And Recommendations

    Cementitious grout will be used to close Tanks 18-F and 19-F. The functions of the grout are to: 1) physically stabilize the final landfill by filling the empty volume in the tanks with a non-compressible material; 2) provide a barrier for inadvertent intrusion into the tank; 3) reduce contaminant mobility by a) limiting the hydraulic conductivity of the closed tank and b) reducing contact between the residual waste and infiltrating water; and 4) providing an alkaline, chemically reducing environment in the closed tank to control speciation and solubility of selected radionuclides. The objective of this work was to identify a single (all-in-one) grout to stabilize and isolate the residual radionuclides in the tank, provide structural stability of the closed tank and serve as an inadvertent intruder barrier. This work was requested by V. A. Chander, High Level Waste (HLW) Tank Engineering, in HLW-TTR-2011-008. The complete task scope is provided in the Task Technical and QA Plan, SRNL-RP-2011-00587 Revision 0. The specific objectives of this task were to: 1) Identify new admixtures and dosages for formulating a zero bleed flowable tank fill material selected by HLW Tank Closure Project personnel based on earlier tank fill studies performed in 2007. The chemical admixtures used for adjusting the flow properties needed to be updated because the original admixture products are no longer available. Also, the sources of cement and fly ash have changed, and Portland cements currently available contain up to 5 wt. % limestone (calcium carbonate). 2) Prepare and evaluate the placement, compressive strength, and thermal properties of the selected formulation with new admixture dosages. 3) Identify opportunities for improving the mix selected by HLW Closure Project personnel and prepare and evaluate two potentially improved zero bleed flowable fill design concepts; one based on the reactor fill grout and the other based on a shrinkage compensating flowable fill mix design. 4

  9. Tanks 18 And 19-F Structural Flowable Grout Fill Material Evaluation And Recommendations

    Langton, C. A.; Stefanko, D. B.

    2013-04-23

    Cementitious grout will be used to close Tanks 18-F and 19-F. The functions of the grout are to: 1) physically stabilize the final landfill by filling the empty volume in the tanks with a non-compressible material; 2) provide a barrier for inadvertent intrusion into the tank; 3) reduce contaminant mobility by a) limiting the hydraulic conductivity of the closed tank and b) reducing contact between the residual waste and infiltrating water; and 4) providing an alkaline, chemically reducing environment in the closed tank to control speciation and solubility of selected radionuclides. The objective of this work was to identify a single (all-in-one) grout to stabilize and isolate the residual radionuclides in the tank, provide structural stability of the closed tank and serve as an inadvertent intruder barrier. This work was requested by V. A. Chander, High Level Waste (HLW) Tank Engineering, in HLW-TTR-2011-008. The complete task scope is provided in the Task Technical and QA Plan, SRNL-RP-2011-00587 Revision 0. The specific objectives of this task were to: 1) Identify new admixtures and dosages for formulating a zero bleed flowable tank fill material selected by HLW Tank Closure Project personnel based on earlier tank fill studies performed in 2007. The chemical admixtures used for adjusting the flow properties needed to be updated because the original admixture products are no longer available. Also, the sources of cement and fly ash have changed, and Portland cements currently available contain up to 5 wt. % limestone (calcium carbonate). 2) Prepare and evaluate the placement, compressive strength, and thermal properties of the selected formulation with new admixture dosages. 3) Identify opportunities for improving the mix selected by HLW Closure Project personnel and prepare and evaluate two potentially improved zero bleed flowable fill design concepts; one based on the reactor fill grout and the other based on a shrinkage compensating flowable fill mix design. 4

  10. Magnet Design Considerations for Fusion Nuclear Science Facility

    Zhai, Y. [Princeton Plasma Physics Lab. (PPPL), Princeton, NJ (United States); Kessel, C. [Princeton Plasma Physics Lab. (PPPL), Princeton, NJ (United States); El-Guebaly, L. [Univ. of Wisconsin, Madison, WI (United States) Fusion Technology Institute; Titus, P. [Princeton Plasma Physics Lab. (PPPL), Princeton, NJ (United States)

    2016-06-01

    The Fusion Nuclear Science Facility (FNSF) is a nuclear confinement facility that provides a fusion environment with components of the reactor integrated together to bridge the technical gaps of burning plasma and nuclear science between the International Thermonuclear Experimental Reactor (ITER) and the demonstration power plant (DEMO). Compared with ITER, the FNSF is smaller in size but generates much higher magnetic field, i.e., 30 times higher neutron fluence with three orders of magnitude longer plasma operation at higher operating temperatures for structures surrounding the plasma. Input parameters to the magnet design from system code analysis include magnetic field of 7.5 T at the plasma center with a plasma major radius of 4.8 m and a minor radius of 1.2 m and a peak field of 15.5 T on the toroidal field (TF) coils for the FNSF. Both low-temperature superconductors (LTS) and high-temperature superconductors (HTS) are considered for the FNSF magnet design based on the state-of-the-art fusion magnet technology. The higher magnetic field can be achieved by using the high-performance ternary restacked-rod process Nb3Sn strands for TF magnets. The circular cable-in-conduit conductor (CICC) design similar to ITER magnets and a high-aspect-ratio rectangular CICC design are evaluated for FNSF magnets, but low-activation-jacket materials may need to be selected. The conductor design concept and TF coil winding pack composition and dimension based on the horizontal maintenance schemes are discussed. Neutron radiation limits for the LTS and HTS superconductors and electrical insulation materials are also reviewed based on the available materials previously tested. The material radiation limits for FNSF magnets are defined as part of the conceptual design studies for FNSF magnets.

  11. Magnet design considerations for Fusion Nuclear Science Facility

    The Fusion Nuclear Science Facility (FNSF) is a nuclear confinement facility to provide a fusion environment with components of the reactor integrated together to bridge the technical gaps of burning plasma and nuclear science between ITER and the demonstration power plant (DEMO). Compared to ITER, the FNSF is smaller in size but generates much higher magnetic field, 30 times higher neutron fluence with 3 orders of magnitude longer plasma operation at higher operating temperatures for structures surrounding the plasma. Input parameters to the magnet design from system code analysis include magnetic field of 7.5 T at the plasma center with plasma major radius of 4.8 m and minor radius of 1.2 m, and a peak field of 15.5 T on the TF coils for FNSF. Both low temperature superconductor (LTS) and high temperature superconductor (HTS) are considered for the FNSF magnet design based on the state-of-the-art fusion magnet technology. The higher magnetic field can be achieved by using the high performance ternary Restack Rod Process (RRP) Nb3Sn strands for toroidal field (TF) magnets. The circular cable-in-conduit conductor (CICC) design similar to ITER magnets and a high aspect ratio rectangular CICC design are evaluated for FNSF magnets but low activation jacket materials may need to be selected. The conductor design concept and TF coil winding pack composition and dimension based on the horizontal maintenance schemes are discussed. Neutron radiation limits for the LTS and HTS superconductors and electrical insulation materials are also reviewed based on the available materials previously tested. As a result, the material radiation limits for FNSF magnets are defined as part of the conceptual design studies for FNSF magnets

  12. Nuclear Magnetic Resonance imaging; Resonance magnetique nucleaire

    Thibierge, M.; Sevestre, L.; Slupecki, P. [Centre Hospitalier de Charleville-Mezieres, 08 (France)

    1998-06-01

    After many years of low profile business in the USA, MRI is back. Improvements are focused on high field magnets and on low field magnets. The former, are dedicated to high quality imaging. The new scanners are more and more efficient because of the spreading use of real time imaging. They can do now, procedures that just could not be imagined some years ago. Vascular imaging is done routinely. Abdominal imaging in apnea of EPI, perfusion and diffusion imaging, and, last not least, all the field of functional imaging are on the verge of coming out. The new magnets unveiled in 1997 are lighter, smaller, more, user friendly, less impressive for patients subject to claustrophobia. They also need less helium to operate and less space to be sited. The latter, are dedicated to interventional procedures. The new magnets are wide opened and a lot of companies show off. Though Picker unveiled a new light superconductive 0.5 Tesla magnet, it seems that this kind of machines are about to disappear. No significant progress was noticed in the field of dedicated MRI devices. Some features can be highlighted: the new Siemens short bore and its table integrates the Panoramic Array Coil Concept. It will allow simultaneous scanning with up to four coils; the excellent homogeneity of the new Picker magnet that will allow spectroscopy at 1 Tesla; the twin gradients of the Elscint Prisma that will open the field of microscopy MRI; the Philips `floppy gradients` that could speed up 4 or 6 times, the time needed for imaging; some new sequences sensitive to temperature are studied as WIP; a lot of work is achieved on 3 or 4 Tesla scanners etc. (author)

  13. Computer Assisted Instruction (Cain) For Nuclear Magnetic Resonance Spectroscopy

    A computer assisted instruction program for nuclear magnetic resonance spectroscopy was developed by using Author ware 5.0, Adobe Image Styler 1.0, Adobe Photo shop 7.0 and Flash MX. The contents included the basic theory of 1H and 13C nuclear magnetic resonance (NMR) spectroscopy, the instrumentation of NMR spectroscopy, the two dimensional (2D) NMR spectroscopy and the interpretation of NMR spectra. The program was also provided examples, and exercises, with emphasis on NMR spectra interpretation to determine the structure of unknown compounds and solutions for self study. The questionnaire from students showed that they were very satisfied with the software

  14. Evaluation of nuclear magnetic resonance spectroscopy variability

    Barreto, Felipe Rodrigues; Salmon, Carlos Ernesto Garrido, E-mail: garrido@ffclrp.usp.br [Universidade de Sao Paulo (FFCLRP/USP), Ribeirao Preto, SP (Brazil). Fac. de Filisofia, Ciencias e Letras; Otaduy, Maria Concepcion Garcia [Universidade de Sao Paulo (FAMUS/USP), Sao Paulo, SP (Brazil). Fac. de Medicina. Departamento de Radiologia

    2014-11-01

    Introduction: the intrinsically high sensitivity of Magnetic Resonance Spectroscopy (MRS) causes considerable variability in metabolite quantification. In this study, we evaluated the variability of MRS in two research centers using the same model of magnetic resonance image scanner. Methods: two metabolic phantoms were created to simulate magnetic resonance spectra from in vivo hippocampus. The phantoms were filled with the same basic solution containing the following metabolites: N-acetyl-aspartate, creatine, choline, glutamate, glutamine and inositol. Spectra were acquired over 15 months on 26 acquisition dates, resulting in a total of 130 spectra per center. Results: the phantoms did not undergo any physical changes during the 15-month period. Temporal analysis from both centers showed mean metabolic variations of 3.7% in acquisitions on the same day and of 8.7% over the 15-month period. Conclusion: The low deviations demonstrated here, combined with the high specificity of Magnetic Resonance Spectroscopy, confirm that it is feasible to use this technique in multicenter studies in neuroscience research. (author)

  15. Evaluation of nuclear magnetic resonance spectroscopy variability

    Introduction: the intrinsically high sensitivity of Magnetic Resonance Spectroscopy (MRS) causes considerable variability in metabolite quantification. In this study, we evaluated the variability of MRS in two research centers using the same model of magnetic resonance image scanner. Methods: two metabolic phantoms were created to simulate magnetic resonance spectra from in vivo hippocampus. The phantoms were filled with the same basic solution containing the following metabolites: N-acetyl-aspartate, creatine, choline, glutamate, glutamine and inositol. Spectra were acquired over 15 months on 26 acquisition dates, resulting in a total of 130 spectra per center. Results: the phantoms did not undergo any physical changes during the 15-month period. Temporal analysis from both centers showed mean metabolic variations of 3.7% in acquisitions on the same day and of 8.7% over the 15-month period. Conclusion: The low deviations demonstrated here, combined with the high specificity of Magnetic Resonance Spectroscopy, confirm that it is feasible to use this technique in multicenter studies in neuroscience research. (author)

  16. Quantitative dosing by nuclear magnetic resonance

    The measurement of the absolute concentration of a heavy water reference containing approximately 99.8 per cent of D2O has been performed, by an original magnetic resonance method ('Adiabatic fast passage method') with a precision of 5.10-5 on the D2O concentration. (author)

  17. Solid state nuclear magnetic resonance: investigating the spins of nuclear related materials

    The author reviews his successive research works: his research thesis work on the Multiple Quantum Magic Angle Spinning (MQMAS) which is a quadric-polar nucleus multi-quanta correlation spectroscopy method, the modelling of NMR spectra of disordered materials, the application to materials of interest for the nuclear industry (notably the glasses used for nuclear waste containment). He presents the various research projects in which he is involved: storing glasses, nuclear magnetic resonance in paramagnetism, solid hydrogen storing matrices, methodological and instrument developments in high magnetic field and high resolution solid NMR, long range distance measurement by solid state Tritium NMR (observing the structure and dynamics of biological complex systems at work)

  18. TANKS 18 AND 19-F STRUCTURAL FLOWABLE GROUT FILL MATERIAL EVALUATION AND RECOMMENDATIONS

    Stefanko, D.; Langton, C.

    2011-11-01

    Cementitious grout will be used to close Tanks 18-F and 19-F. The functions of the grout are to: (1) physically stabilize the final landfill by filling the empty volume in the tanks with a non compressible material; (2) provide a barrier for inadvertent intrusion into the tank; (3) reduce contaminant mobility by (a) limiting the hydraulic conductivity of the closed tank and (b) reducing contact between the residual waste and infiltrating water; and (4) providing an alkaline, chemically reducing environment in the closed tank to control speciation and solubility of selected radionuclides. The objective of this work was to identify a single (all-in-one) grout to stabilize and isolate the residual radionuclides in the tank, provide structural stability of the closed tank and serve as an inadvertent intruder barrier. This work was requested by V. A. Chander, High Level Waste (HLW) Tank Engineering, in HLW-TTR-2011-008. The complete task scope is provided in the Task Technical and QA Plan, SRNL-RP-2011-00587 Revision 0. The specific objectives of this task were to: (1) Identify new admixtures and dosages for formulating a zero bleed flowable tank fill material selected by HLW Tank Closure Project personnel based on earlier tank fill studies performed in 2007. The chemical admixtures used for adjusting the flow properties needed to be updated because the original admixture products are no longer available. Also, the sources of cement and fly ash have changed, and Portland cements currently available contain up to 5 wt. % limestone (calcium carbonate). (2) Prepare and evaluate the placement, compressive strength, and thermal properties of the selected formulation with new admixture dosages. (3) Identify opportunities for improving the mix selected by HLW Closure Project personnel and prepare and evaluate two potentially improved zero bleed flowable fill design concepts; one based on the reactor fill grout and the other based on a shrinkage compensating flowable fill mix

  19. Tanks 18 And 19-F Structural Flowable Grout Fill Material Evaluation And Recommendations

    Cementitious grout will be used to close Tanks 18-F and 19-F. The functions of the grout are to: (1) physically stabilize the final landfill by filling the empty volume in the tanks with a non compressible material; (2) provide a barrier for inadvertent intrusion into the tank; (3) reduce contaminant mobility by (a) limiting the hydraulic conductivity of the closed tank and (b) reducing contact between the residual waste and infiltrating water; and (4) providing an alkaline, chemically reducing environment in the closed tank to control speciation and solubility of selected radionuclides. The objective of this work was to identify a single (all-in-one) grout to stabilize and isolate the residual radionuclides in the tank, provide structural stability of the closed tank and serve as an inadvertent intruder barrier. This work was requested by V. A. Chander, High Level Waste (HLW) Tank Engineering, in HLW-TTR-2011-008. The complete task scope is provided in the Task Technical and QA Plan, SRNL-RP-2011-00587 Revision 0. The specific objectives of this task were to: (1) Identify new admixtures and dosages for formulating a zero bleed flowable tank fill material selected by HLW Tank Closure Project personnel based on earlier tank fill studies performed in 2007. The chemical admixtures used for adjusting the flow properties needed to be updated because the original admixture products are no longer available. Also, the sources of cement and fly ash have changed, and Portland cements currently available contain up to 5 wt. % limestone (calcium carbonate). (2) Prepare and evaluate the placement, compressive strength, and thermal properties of the selected formulation with new admixture dosages. (3) Identify opportunities for improving the mix selected by HLW Closure Project personnel and prepare and evaluate two potentially improved zero bleed flowable fill design concepts; one based on the reactor fill grout and the other based on a shrinkage compensating flowable fill mix

  20. Electron-nuclear magnetism of praseodymium and its compounds

    A consistent theory of electron-nuclear spin ordering in singlet magnetics is developed. The results of some recent experiments with PrNi5 are exlained. The effect of a magnetic field perpendicular to the basal plane on the phase transition is investigated. Depending on the magnitude of the exchange interaction, the magnetic field may either increase or decrease the transition temperature. An increase of the transition temperature on application of the field should occur, for example, in the hexagonal modification of praseodymium

  1. High Radiation Environment Nuclear Fragment Separator Magnet

    Kahn, Stephen [Muons, Inc., Batavia, IL (United States); Gupta, Ramesh [Brookhaven National Lab. (BNL), Upton, NY (United States)

    2016-01-31

    Superconducting coils wound with HTS conductor can be used in magnets located in a high radiation environment. NbTi and Nb3Sn superconductors must operate at 4.5 K or below where removal of heat is less efficient. The HTS conductor can carry significant current at higher temperatures where the Carnot efficiency is significantly more favorable and where the coolant heat capacity is much larger. Using the HTS conductor the magnet can be operated at 40 K. This project examines the use of HTS conductor for the Michigan State University Facility For Rare Isotope Beams (FRIB) fragment separator dipole magnet which bends the beam by 30° and is located in a high radiation region that will not be easily accessible. Two of these magnets are needed to select the chosen isotope. There are a number of technical challenges to be addressed in the design of this magnet. The separator dipole is 2 m long and subtends a large angle. The magnet should keep a constant transverse field profile along its beam reference path. Winding coils with a curved inner segment is difficult as the conductor will tend to unwind during the process. In the Phase I project two approaches to winding the conductor were examined. The first was to wind the coils with curved sections on the inner and outer segments with the inner segment wound with negative curvature. The alternate approach was to use a straight segment on the inner segment to avoid negative curvature. In Phase I coils with a limited number of turns were successfully wound and tested at 77 K for both coil configurations. The Phase II program concentrated on the design, coil winding procedures, structural analysis, prototyping and testing of an HTS curved dipole coil at 40 K with a heat load representative of the radiation environment. One of the key criteria of the design of this magnet is to avoid the use of organic materials that would degrade rapidly in radiation. The Lorentz forces expected from the coils interacting with the

  2. Optimization and Construction of Single-side Nuclear Magnetic Resonance Magnet

    Ji Yongliang

    2013-10-01

    Full Text Available Single-sided NMR devices can operate under conditions inaccessible to conventional NMR while featuring portability and the ability to analyze arbitrary-sized objects. In this paper, a semi-elliptic Halbach magnet array was designed and built for single-side Nuclear Magnetic Resonance (NMR. We present an easy-to-implement target field algorithm for single-side NMR magnet design based on Gram-Schmidt Orthogonal method. The creating magnetic field of designed magnet structure could achieve best flatness in the region of interesting for NMR applications. The optimizing result shows that the best magnet structure can generate magnetic fields which flatly distributed in the horizontal direction and the gradient was distributed in the vertical direction with gradient of 2mT/mm. The field strength and gradient were measured by a three dimensions Hall probe and agreed well with the simulations.  

  3. Acoustic nuclear magnetic resonance in easy-axis antiferromagnets

    Obtained and investigated is the dispersion equation which shows that in the rouge of the tipping field at low temperatures the study of effects conditioned by the bond between the oscillations of electron and nuclear spins depends upon the fact, whethe the interaction of the sound with a nuclear spin subsystem is taken into account. The same concerns the effects conditioned by a strong bond between the oscillations of the lattice and electron spins. Shown is the effect of anisotropy of magnitostriction relative part on the nature of orientation phase transitions and the value of the coefficient of strengthening nuclear magnetic resonance

  4. Nuclear magnetic resonance imaging in brain tumors

    Full text: Magnetic resonance imaging (MRI) is a non-invasive imaging method based on the detecting signal from hydrogen nuclei of water molecules and fat. Performances of MRI are continuously increasing, and its domains of investigation of the human body are growing in both morphological and functional study. MRI also allows It also performing advanced management of tumours especially in the brain, by combining anatomical information (morphological MRI), functional (diffusion, perfusion and BOLD contrast) and metabolic (tissue composition in magnetic resonance spectroscopy (MRS)). The MRI techniques have an important role in cancerology. These techniques allow essential information for the diagnosis and answering therapist's questions before, during or after the treatment. The MR allows clarifying the localization of expanding processes, the differential diagnosis between brain tumour and a lesion confined by another structural aspect, the diagnosis of the tumoral aspect of a lesion, the histological ranking in case of glial tumour and the extension of its localization as well as the therapeutic follow-up (pre-therapeutic and post-therapeutics assessments). A better combination between the morphological, functional and metabolic studies, as well as integrating new technical developments, especially while using a multichannel bird cage coils the 3T magnet and suitable computing software, would allow significant improvements of the exploration strategies and management of brain tumors.

  5. Selection of planes in nuclear magnetic resonance tomography

    A prototype aiming to obtain images in nuclear magnetic resonance tomography was developed, by adjusting NMR spectrometer in the IFQSC Laboratory. The techniques for selecting planes were analysed by a set of computer codes, which were elaborated from Bloch equation solutions to simulate the spin system behaviour. Images were obtained using planes with thickness inferior to 1 cm. (M.C.K.)

  6. Nuclear magnetic response imaging of sap flow in plants

    Windt, C.W.

    2007-01-01

    This thesis deals with Nuclear Magnetic Resonance (NMR) imaging of long distance transport in plants. Long distance transport in plants is an enigmatic process. The theoretical framework that describes its basic properties has been in place for almost a century, yet at the same time only little is k

  7. Yeast Lipid Estimation by Enzymatic and Nuclear Magnetic Resonance Methods

    Moreton, R. S.

    1989-01-01

    Low-resolution nuclear magnetic resonance and enzymatic glycerol estimation were compared with a solvent extraction method for estimating the intracellular lipid content of lipid-accumulating yeasts. Both methods correlated well with the solvent extraction procedure and were more convenient with large numbers of samples.

  8. Observation of the uranium 235 nuclear magnetic resonance signal

    Le Bail, H.; Chachaty, C.; Rigny, P.; Bougon, R.

    1983-01-01

    The first observation of the nuclear magnetic resonance of the uranium 235 is reported. It has been performed on pure liquid uranium hexafluoride at 380 K. The measured magnetogyric ratio is | γ(235U) | = 492.6 ± 0.2 rad.s-1 G-1.

  9. Thermonuclear reaction rate of 18O(p,gamma)19F

    Buckner, M Q; Cesaratto, J M; Howard, C; Clegg, T B; Champagne, A E; Daigle, S

    2012-01-01

    For stars between 0.8-8.0 solar masses, nucleosynthesis enters its final phase during the asymptotic giant branch (AGB) stage. During this evolutionary period, grain condensation occurs in the stellar atmosphere, and the star experiences significant mass loss. The production of presolar grains can often be attributed to this unique stellar environment. A subset of presolar oxide grains features dramatic 18O depletion that cannot be explained by the standard AGB star burning stages and dredge-up models. An extra mixing process, referred to as "cool bottom processing" (CBP), was proposed for low-mass AGB stars. The 18O depletion observed within certain stellar environments and within presolar grain samples may result from the 18O+p processes during CBP. We report here on a study of the 18O(p,gamma)19F reaction at low energies. Based on our new results, we found that the resonance at Er = 95 keV (lab) has a negligible affect on the reaction rate at the temperatures associated with CBP. We also determined that th...

  10. The use of 19F NMR for new structure determination in the radiolysis of FEP

    The radiation chemistry of poly(tetrafluoroethylene-co-perfluoropropylene), FEP, with a mole fraction of tetrafluoroethylene, TFE, of 0.90 has been studied under vacuum using 60Co γ-radiation over absorbed dose ranges up to 3.0 MGy. The radiolysis temperatures were 300, 363, 423 and 523 K. New structure formation in the copolymers was analyzed by solid-state 19F NMR. The new structures formed in the copolymers have been identified and the G-values for the formation of new -CF3 groups was 2.2 at the lower temperatures and increased to 2.9 at 523 K. The G-value for the loss of original -CF3 groups was ∼1.0 at all temperatures. At the lower temperatures there was a net loss of -CF- groups on irradiation; G(CF) of -1.3, -0.9 and -0.5 at 300, 363 and 423 K, respectively, but at 523 K there was a net gain with G(CF) equal to 0.8

  11. Constraints on Low-Mass WIMP Interactions on 19F from PICASSO

    Archambault, S; Bhattacharjee, P; Bhattacharya, S; Dai, X; Das, M; Davour, A; Debris, F; Dhungana, N; Farine, J; Gagnebin, S; Giroux, G; Grace, E; Jackson, C M; Kamaha, A; Krauss, C; Kumaratunga, S; Lafrenière, M; Laurin, M; Lawson, I; Lessard, L; Levine, I; Levy, C; MacDonald, R P; Marlisov, D; Martin, J -P; Mitra, P; Noble, A J; Piro, M -C; Podviyanuk, R; Pospisil, S; Saha, S; Scallon, O; Seth, S; Starinski, N; Stekl, I; Wichoski, U; Xie, T; Zacek, V

    2012-01-01

    Recent results from the PICASSO dark matter search experiment at SNOLAB are reported. These results were obtained using a subset of 10 detectors with a total target mass of 0.72 kg of 19F and an exposure of 114 kgd. The low backgrounds in PICASSO allow recoil energy thresholds as low as 1.7 keV to be obtained which results in an increased sensitivity to interactions from Weakly Interacting Massive Particles (WIMPs) with masses below 10 GeV/c^2. No dark matter signal was found. Best exclusion limits in the spin dependent sector were obtained for WIMP masses of 20 GeV/c^2 with a cross section on protons of sigma_p^SD = 0.032 pb (90% C.L.). In the spin independent sector close to the low mass region of 7 GeV/c2 favoured by CoGeNT and DAMA/LIBRA, cross sections larger than sigma_p^SI = 1.41x10^-4 pb (90% C.L.) are excluded.

  12. Constraints on low-mass WIMP interactions on {sup 19}F from PICASSO

    Archambault, S. [Departement de Physique, Universite de Montreal, Montreal, H3C 3J7 (Canada); Behnke, E. [Department of Physics and Astronomy, Indiana University South Bend, South Bend, IN 46634 (United States); Bhattacharjee, P.; Bhattacharya, S. [Saha Institute of Nuclear Physics, Centre for AstroParticle Physics (CAPP), Kolkata 700064 (India); Dai, X. [Department of Physics, Queen' s University, Kingston, K7L 3N6 (Canada); Das, M. [Saha Institute of Nuclear Physics, Centre for AstroParticle Physics (CAPP), Kolkata 700064 (India); Davour, A. [Department of Physics, Queen' s University, Kingston, K7L 3N6 (Canada); Debris, F. [Departement de Physique, Universite de Montreal, Montreal, H3C 3J7 (Canada); Dhungana, N.; Farine, J. [Department of Physics, Laurentian University, Sudbury, P3E 2C6 (Canada); Gagnebin, S. [Department of Physics, University of Alberta, Edmonton, T6G 2G7 (Canada); Giroux, G. [Departement de Physique, Universite de Montreal, Montreal, H3C 3J7 (Canada); Grace, E. [Department of Physics and Astronomy, Indiana University South Bend, South Bend, IN 46634 (United States); Jackson, C.M. [Departement de Physique, Universite de Montreal, Montreal, H3C 3J7 (Canada); Kamaha, A. [Department of Physics, Queen' s University, Kingston, K7L 3N6 (Canada); Krauss, C. [Department of Physics, University of Alberta, Edmonton, T6G 2G7 (Canada); and others

    2012-05-03

    Recent results from the PICASSO dark matter search experiment at SNOLAB are reported. These results were obtained using a subset of 10 detectors with a total target mass of 0.72 kg of 19F and an exposure of 114 kgd. The low backgrounds in PICASSO allow recoil energy thresholds as low as 1.7 keV to be obtained which results in an increased sensitivity to interactions from Weakly Interacting Massive Particles (WIMPs) with masses below 10 GeV/c{sup 2}. No dark matter signal was found. Best exclusion limits in the spin dependent sector were obtained for WIMP masses of 20 GeV/c{sup 2} with a cross section on protons of {sigma}{sub p}{sup SD}=0.032 pb (90% C.L.). In the spin independent sector close to the low mass region of 7 GeV/c{sup 2} favoured by CoGeNT and DAMA/LIBRA, cross sections larger than {sigma}{sub p}{sup SI}=1.41 Multiplication-Sign 10{sup -4} pb (90% C.L.) are excluded.

  13. 13. Nuclear magnetic resonance users meeting. Extended abstracts book

    This annual meeting, held in Brazil from May 2 - 6, 2011 comprised seventeen lectures, given by invited speakers from Brazil and other countries, about the use of nuclear magnetic resonance for various analytical purposes; results from ninety five research works, most being carried out by scientific groups from various Brazilian R and D institutions, presented as congress panels/posters. A General Assembly meeting of AUREMN, the Brazilian Association of Nuclear Magnetic Resonance Users, also took place during the event. Main topics of the research works presented at this meeting were thus distributed: 54% in analytical chemistry (mainly organic chemistry, both experimental and theoretical works), 18% in applied life sciences (agricultural and food sciences, biological sciences and medicine), 15% in materials science (including nanostructures, petroleum and alternative fuels), 10% in mathematical methods and computing for the interpretation of NMR data, and the remaining 3% in improvements in instrumentation interfaces or magnetic field configurations.

  14. 13. Nuclear magnetic resonance users meeting. Extended abstracts book

    NONE

    2011-07-01

    This annual meeting, held in Brazil from May 2 - 6, 2011 comprised seventeen lectures, given by invited speakers from Brazil and other countries, about the use of nuclear magnetic resonance for various analytical purposes; results from ninety five research works, most being carried out by scientific groups from various Brazilian R and D institutions, presented as congress panels/posters. A General Assembly meeting of AUREMN, the Brazilian Association of Nuclear Magnetic Resonance Users, also took place during the event. Main topics of the research works presented at this meeting were thus distributed: 54% in analytical chemistry (mainly organic chemistry, both experimental and theoretical works), 18% in applied life sciences (agricultural and food sciences, biological sciences and medicine), 15% in materials science (including nanostructures, petroleum and alternative fuels), 10% in mathematical methods and computing for the interpretation of NMR data, and the remaining 3% in improvements in instrumentation interfaces or magnetic field configurations.

  15. (19)F(α,n) thick target yield from 3.5 to 10.0 MeV.

    Norman, E B; Chupp, T E; Lesko, K T; Grant, P J; Woodruff, G L

    2015-09-01

    Using a target of PbF2, the thick-target yield from the (19)F(α,n) reaction was measured from E(α)=3.5-10 MeV. From these results, we infer the thick-target neutron yields from targets of F2 and UF6 over this same alpha-particle energy range. PMID:26115205

  16. Angular Distribution and Angular Dispersion in Collision of 19F+27A1 at 114 MeV

    WANG Qi; Li Zhi-Chang; LU Xiu-Qin; ZHAO Kui; LIU Jian-Cheng; SERGEY Yu-Kun; DONG Yu-Chuan; LI Song-Lin; DUAN Li-Min; XU Hu-Shan; XU Hua-Gen; CHEN Ruo-Fu; WU He-Yu; HAN Jian-Long

    2004-01-01

    Angular distributions of fragments B, C, N, O, F, Ne, Na, Mg and Al induced by the collision of 19F+27 A1 at 114MeV have been measured. Angular dispersion parameters are extracted from the experimental data and compared with the theoretical ones. The dynamic dispersions for dissipative products depend strongly on the charge number Z of the fragments.

  17. New perspectives of 19F MAS NMR in the characterization of amorphous forms of atorvastatin in dosage formulations

    Brus, Jiří; Urbanová, Martina; Šeděnková, Ivana; Brusová, H.

    2011-01-01

    Roč. 409, 1/2 (2011), s. 62-74. ISSN 0378-5173 R&D Projects: GA MŠk 2B08021 Institutional research plan: CEZ:AV0Z40500505 Keywords : 19F MAS NMR * factor analysis * polymorphism Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 3.350, year: 2011

  18. Incomplete fusion in 19F+175Lu interactions at energies ≈ 4 – 6 MeV/A

    In the present work, our recently performed experiment for the 19F + 175Lu system and results from it are presented in the energy range ≈ 4-6 MeV/A. It may be pointed out that there is no theoretical model available to explain the ICF data satisfactorily

  19. General anesthesia for nuclear magnetic resonance imaging

    The core of the MAGNETOM diagnostic device is a liquid helium-cooled cryogenic magnet, having the shape of a hollow cylinder about 2 m long, 50 to 60 cm i.d. Its inner space is designed to accommodate a bench with the patient, whose part examined, usually the head, is enclosed in a smaller coil and is located roughly in the center of the magnet. The examination takes 4 to 20 minutes, during which the patient must be fixed to prevent any motion. Inhalation anesthesia with spontaneous ventilation using the Jackson-Rees or Bain's system and a laryngeal mask is considered the safest way where no special equipment is employed. If artificial ventilation is necessary, balanced anesthesia with either manual ventilation using Bain's system or a fluidic type ventilator seems to be the best choice. The preparation of the patient prior to the examination, the premedication, and the monitoring equipment are described. (J.B.). 1 tab., 5 figs., 11 refs

  20. Nuclear magnetic resonance imaging and prostatic cancer

    The diagnosis of prostatic cancer is histological. Apart from rectal examination, only imaging techniques allow evaluation of the extension of the cancer. Magnetic Resonance imaging (MRI) was performed with a Magniscan 5000 (Thomson C.G.R., France) apparatus. Three types of sequences were used: a short RT sequence (30/500, a multi-echo sequence with a long RT (40/2500) and echo gradient sequences (12 scans in less than 3 minutes). The MRI study of the pelvis is favoured by the abundance of fat which gives good contrast, spontaneous visualization of the vessels and the presence of the bladder with a high signal for urine in T2. This provides a very good anatomical study in three planes. In prostatic cancer, the study of the long sequence signal reveals heterogeneity of the prostatic signal on the second echo, but this is a non-specific variation. The staging of prostatic cancer is facilitated by scans in three planes. Different examples are presented in relation to various stages of the disease. Three clinical cases demonstrate that Magnetic Resonance may become an important element in the choice of treatment

  1. Characterization of solid polymer dispersions of active pharmaceutical ingredients by 19F MAS NMR and factor analysis

    Urbanova, Martina; Brus, Jiri; Sedenkova, Ivana; Policianova, Olivia; Kobera, Libor

    In this contribution the ability of 19F MAS NMR spectroscopy to probe structural variability of poorly water-soluble drugs formulated as solid dispersions in polymer matrices is discussed. The application potentiality of the proposed approach is demonstrated on a moderately sized active pharmaceutical ingredient (API, Atorvastatin) exhibiting extensive polymorphism. In this respect, a range of model systems with the API incorporated in the matrix of polvinylpyrrolidone (PVP) was prepared. The extent of mixing of both components was determined by T1(1H) and T1ρ(1H) relaxation experiments, and it was found that the API forms nanosized domains. Subsequently it was found out that the polymer matrix induces two kinds of changes in 19F MAS NMR spectra. At first, this is a high-frequency shift reaching 2-3 ppm which is independent on molecular structure of the API and which results from the long-range polarization of the electron cloud around 19F nucleus induced by electrostatic fields of the polymer matrix. At second, this is broadening of the signals and formation of shoulders reflecting changes in molecular arrangement of the API. To avoid misleading in the interpretation of the recorded 19F MAS NMR spectra, because both the contributions act simultaneously, we applied chemometric approach based on multivariate analysis. It is demonstrated that factor analysis of the recorded spectra can separate both these spectral contributions, and the subtle structural differences in the molecular arrangement of the API in the nanosized domains can be traced. In this way 19F MAS NMR spectra of both pure APIs and APIs in solid dispersions can be directly compared. The proposed strategy thus provides a powerful tool for the analysis of new formulations of fluorinated pharmaceutical substances in polymer matrices.

  2. {sup 19}F-labeling of the adenine H2-site to study large RNAs by NMR spectroscopy

    Sochor, F. [Johann Wolfgang Goethe-University Frankfurt, Institut für Organische Chemie und Chemische Biologie, Center for Biomolecular Magnetic Resonance (BMRZ) (Germany); Silvers, R. [Massachusetts Institute of Technology, Department of Chemistry, Francis Bitter Magnet Laboratory (United States); Müller, D.; Richter, C.; Fürtig, B., E-mail: fuertig@nmr.uni-frankfurt.de; Schwalbe, H., E-mail: schwalbe@nmr.uni-frankfurt.de [Johann Wolfgang Goethe-University Frankfurt, Institut für Organische Chemie und Chemische Biologie, Center for Biomolecular Magnetic Resonance (BMRZ) (Germany)

    2016-01-15

    In comparison to proteins and protein complexes, the size of RNA amenable to NMR studies is limited despite the development of new isotopic labeling strategies including deuteration and ligation of differentially labeled RNAs. Due to the restricted chemical shift dispersion in only four different nucleotides spectral resolution remains limited in larger RNAs. Labeling RNAs with the NMR-active nucleus {sup 19}F has previously been introduced for small RNAs up to 40 nucleotides (nt). In the presented work, we study the natural occurring RNA aptamer domain of the guanine-sensing riboswitch comprising 73 nucleotides from Bacillus subtilis. The work includes protocols for improved in vitro transcription of 2-fluoroadenosine-5′-triphosphat (2F-ATP) using the mutant P266L of the T7 RNA polymerase. Our NMR analysis shows that the secondary and tertiary structure of the riboswitch is fully maintained and that the specific binding of the cognate ligand hypoxanthine is not impaired by the introduction of the {sup 19}F isotope. The thermal stability of the {sup 19}F-labeled riboswitch is not altered compared to the unmodified sequence, but local base pair stabilities, as measured by hydrogen exchange experiments, are modulated. The characteristic change in the chemical shift of the imino resonances detected in a {sup 1}H,{sup 15}N-HSQC allow the identification of Watson–Crick base paired uridine signals and the {sup 19}F resonances can be used as reporters for tertiary and secondary structure transitions, confirming the potential of {sup 19}F-labeling even for sizeable RNAs in the range of 70 nucleotides.

  3. Nuclear magnetic resonance studies of biological systems

    The difference between intracellular and extracellular proton relaxation rates provides the basis for the determination of the mean hemoglobin concentration (MHC) in red blood cells. The observed water T1 relaxation data from red blood cell samples under various conditions were fit to the complete equation for the time-dependent decay of magnetization for a two-compartment system including chemical exchange. The MHC for each sample was calculated from the hematocrit and the intracellular water fraction as determined by NMR. The binding of the phosphorylcholine (PC) analogue, 2-(trimethylphosphonio)-ethylphosphate (phosphoryl-phosphocholine, PPC) to the PC binding myeloma proteins TEPC-15, McPC 603, and MOPC 167 was studied by 31P NMR

  4. Nuclear magnetic resonance imaging at microscopic resolution

    Johnson, G. Allan; Thompson, Morrow B.; Gewalt, Sally L.; Hayes, Cecil E.

    Resolution limits in NMR imaging are imposed by bandwidth considerations, available magnetic gradients for spatial encoding, and signal to noise. This work reports modification of a clinical NMR imaging device with picture elements of 500 × 500 × 5000 μm to yield picture elements of 50 × 50 × 1000 μm. Resolution has been increased by using smaller gradient coils permitting gradient fields >0.4 mT/cm. Significant improvements in signal to noise are achieved with smaller rf coils, close attention to choice of bandwidth, and signal averaging. These improvements permit visualization of anatomical structures in the rat brain with an effective diameter of 1 cm with the same definition as is seen in human imaging. The techniques and instrumentation should open a number of basic sciences such as embryology, plant sciences, and teratology to the potentials of NMR imaging.

  5. Nuclear Magnetic Resonance Study of Fluorine-Graphite Intercalation Compounds

    To study the origin of semimetal-metal and metal-insulator transformations, localization effects and C-E bonding in fluorine-intercalated graphite CxF, 13C and 19F NMR investigations have been carried out for a wide range of fluorine content, 3.8 8, are attributed to mobile fluorine acceptor species which are responsible for the increase of electric conductivity in the dilute compound. When increasing the fluorine content to x ∼ 8 corresponding to the maximum electric conductivity, covalent C-P bonds start to oc- cur. The number of these bonds grows with fluorine content resulting in the decrease in conductivity which is caused by a percolation mechanism rather than by a change in bond length. A difference in 19F chemical shift for fluorine-intercalated graphite CxF and covalent graphite fluoride (CF)n has been observed and is attributed to different C-P bonding in these compounds

  6. Enhanced Nuclear Magnetism: Some Novel Features and Prospective Experiments

    Abragam, A.; Bleaney, B.

    1983-06-01

    This review of enhanced nuclear magnetism discusses a number of features not previously considered, with special reference to new experiments that use dynamic methods to produce high nuclear polarization, followed by adiabatic demagnetization in the rotating frame (a.d.r.f.) to produce nuclear ordered states that may be investigated by the scattering of beams of neutrons. Section 2. The 'enhancement' of the nuclear moment arises from the electronic magnetization M_I induced through the hyperfine interaction. It is shown that the spatial distribution of M_I is the same as that of M_H, the Van Vleck magnetization induced by an external field, provided that J is a good quantum number. The spatial distributions are not in general the same in Russell-Saunders coupling, e.g. in the 3d group. Section 3. The Bloch equations are extended to include anisotropic nuclear moments. Section 4. The 'truncated' spin Hamiltonian is derived for spin-spin interaction between enhanced moments. Section 5. A general cancellation theorem for second-order processes in spin-lattice relaxation is derived, showing that the intrinsic direct process must be of third order. The relaxation rate obeys an equation similar to that for Kramers electronic ions, but reduced as the fifth power of the resonance frequencies. The relaxation rates observed experimentally (except in very high fields) are ascribed to paramagnetic impurities, so that these can be used to produce dynamic nuclear polarization (d.n.p.). Section 6. The interactions of neutrons with the true nuclear moment μ_I, the Van Vleck moment M_H, the 'pseudonuclear' moment M_I and the 'pseudomagnetic' nuclear moment μ *_I are discussed. It is shown that the four contributions can be observed separately by measurement of the form factor for neutron scattering as a function of temperature and direction of the applied magnetic field. Precession of the neutron spin in the 'pseudomagnetic' field H* is discussed with reference to the case of Ho

  7. Nuclear magnetic resonance studies in solid polymeric electrolyte

    Solid complexes formed between Poly (ethylene oxide) and various alkali metal salts, are generally referred to as polymer electrolytes conductivity and NMR properties were investigated in POE - Li Cl sub(7)O sub(4) and POE - Li BF sub(4) complexes. Our sup(1)H, Li and sup(19)F relaxation study suggest that cation motion is controlled by segmental motions of the polymer chain while the anion have additional mobility associated with BG sub(4) rotation. (author)

  8. Nuclear magnetic resonance in pulse radiolysis. Chemically induced dynamic nuclear polarization

    Nuclear magnetic resonance and chemically induced dynamic nuclear polarization (CIDNP) were applied to the study of pulse radiolysis. Samples were irradiated with a 3-MeV electron beam from the Argonne Van de Graaff accelerator in an EPR magnet (approximately 4000 G) which had axial holes for beam access. A fast flow system transferred the irradiated solution to the rotating 5-mm NMR sample tube. The NMR spectra of mixtures of sodium acetate and methanol were presented to demonstrate the features of the CIDNP in pulse radiolysis

  9. A proposed direct measurement of cross section at Gamow window for key reaction $^{19}$F($p$,$\\alpha$)$^{16}$O in Asymptotic Giant Branch stars with a planned accelerator in CJPL

    He, J J; Ma, S B; Hu, J; Zhang, L Y; Fu, C B; Zhang, N T; Lian, G; Su, J; Li, Y J; Yan, S Q; Shen, Y P; Hou, S Q; Jia, B L; Zhang, T; Zhang, X P; Guo, B; Kubono, S; Liu, W P

    2016-01-01

    In 2014, the National Natural Science Foundation of China (NSFC) approved the Jinping Underground Nuclear Astrophysics laboratory (JUNA) project, which aims at direct cross-section measurements of four key stellar nuclear reactions right down to the Gamow windows. In order to solve the observed fluorine overabundances in Asymptotic Giant Branch (AGB) stars, measuring the key $^{19}$F($p$,$\\alpha$)$^{16}$O reaction at effective burning energies (i.e., at Gamow window) is established as one of the scientific research sub-projects. The present paper describes this sub-project in details, including motivation, status, experimental setup, yield and background estimation, aboveground test, as well as other relevant reactions.

  10. A proposed direct measurement of cross section at Gamow window for key reaction 19F(p,α) 16O in Asymptotic Giant Branch stars with a planned accelerator in CJPL

    He, JianJun; Xu, ShiWei; Ma, ShaoBo; Hu, Jun; Zhang, LiYong; Fu, ChangBo; Zhang, NingTao; Lian, Gang; Su, Jun; Li, YunJu; Yan, ShengQuan; Shen, YangPing; Hou, SuQing; Jia, BaoLu; Zhang, Tao; Zhang, XiaoPeng; Guo, Bing; Kubono, Shigeru; Liu, WeiPing

    2016-05-01

    In 2014, the National Natural Science Foundation of China (NSFC) approved the Jinping Underground Nuclear Astrophysics laboratory (JUNA) project, which aims at direct cross-section measurements of four key stellar nuclear reactions right down to the Gamow windows. In order to solve the observed fluorine overabundances in Asymptotic Giant Branch (AGB) stars, measuring the key 19F(p,α)16O reaction at effective burning energies (i.e., at Gamow window) is established as one of the scientific research sub-projects. The present paper describes this sub-project in details, including motivation, status, experimental setup, yield and background estimation, aboveground test, as well as other relevant reactions.

  11. Nuclear magnetic resonance method for observation of ferromagnetic pulmonary contaminants

    A method is proposed for measurement of tissue concentration of asbestos and other contaminants containing magnetite. The method uses nuclear magnetic resonance (NMR) of protons as a means of detection of the magnetic particles present in the dust. Results of the study of the effect of concentration of iron particles and particle size on the NMR signal are presented. The NMR signal had linear relationship to the concentration particles. Experiments with different particle size indicated that the signal was proportional to the mass of particles rather than to their number. Quantitative detection of 7RF02 chrysotile asbestos in gel and in rat lungs was demonstrated

  12. Algorithmic cooling in liquid-state nuclear magnetic resonance

    Atia, Yosi; Elias, Yuval; Mor, Tal; Weinstein, Yossi

    2016-01-01

    Algorithmic cooling is a method that employs thermalization to increase qubit purification level; namely, it reduces the qubit system's entropy. We utilized gradient ascent pulse engineering, an optimal control algorithm, to implement algorithmic cooling in liquid-state nuclear magnetic resonance. Various cooling algorithms were applied onto the three qubits of C132-trichloroethylene, cooling the system beyond Shannon's entropy bound in several different ways. In particular, in one experiment a carbon qubit was cooled by a factor of 4.61. This work is a step towards potentially integrating tools of NMR quantum computing into in vivo magnetic-resonance spectroscopy.

  13. Nuclear magnetic resonance in environmental engineering: principles and applications.

    Lens, P N; Hemminga, M A

    1998-01-01

    This paper gives an introduction to nuclear magnetic resonance spectroscopy (NMR) and magnetic resonance imaging (MRI) in relation to applications in the field of environmental science and engineering. The underlying principles of high resolution solution and solid state NMR, relaxation time measurements and imaging are presented. Then, the use of NMR is illustrated and reviewed in studies of biodegradation and biotransformation of soluble and solid organic matter, removal of nutrients and xenobiotics, fate of heavy metal ions, and transport processes in bioreactor systems. PMID:10335581

  14. Rotation and Decay of the Dinuclear System Formed in Dissipative Reaction of 19F+27Al%19F+27Al耗散反应中双核系统的转动与衰变

    韩建龙; 白真; 李志常; 路秀琴; 赵葵; 周平; 刘建成; Sergey Yu Kun; 王琦; 董玉川; 李松林; 段利敏; 吴和宇; 徐华根; 陈若富; 徐瑚珊

    2005-01-01

    测量了19F+27Al耗散反应产物B,C,N,O,F和Ne的激发函数,入射束流的能量从110.25MeV到118.75MeV,能量步长为250keV.用能量自关联函数方法从激发函数中提取了各反应产物的平均衰变宽度,利用同时考虑反应中所形成的中间双核系统的转动特性和衰变特性而发展了的Ericson核反应统计理论,讨论了19F+27Al耗散反应中双核系统随时间的演化过程.

  15. Nuclear chiral and magnetic rotation in covariant density functional theory

    Meng, Jie; Zhao, Pengwei

    2016-05-01

    Excitations of chiral rotation observed in triaxial nuclei and magnetic and/or antimagnetic rotations (AMR) seen in near-spherical nuclei have attracted a lot of attention. Unlike conventional rotation in well-deformed or superdeformed nuclei, here the rotational axis is not necessary coinciding with any principal axis of the nuclear density distribution. Thus, tilted axis cranking (TAC) is mandatory to describe these excitations self-consistently in the framework of covariant density functional theory (CDFT). We will briefly introduce the formalism of TAC–CDFT and its application for magnetic and AMR phenomena. Configuration-fixed CDFT and its predictions for nuclear chiral configurations and for favorable triaxial deformation parameters are also presented, and the discoveries of the multiple chiral doublets in 133Ce and 103Rh are discussed.

  16. Nuclear chiral and magnetic rotation in covariant density functional theory

    Meng, Jie

    2016-01-01

    Excitations of chiral rotation observed in triaxial nuclei and magnetic and/or antimagnetic rotations seen in near-spherical nuclei have attracted a lot of attention. Unlike conventional rotation in well-deformed or superdeformed nuclei, here the rotational axis is not necessary coinciding with any principal axis of the nuclear density distribution. Thus, tilted axis cranking is mandatory to describe these excitations self-consistently in the framework of covariant density functional theory (CDFT). We will briefly introduce the formalism of tilted axis cranking CDFT and its application for magnetic and antimagnetic rotation phenomena. Configuration-fixed CDFT and its predictions for nuclear chiral configurations and for favorable triaxial deformation parameters are also presented, and the discoveries of the multiple chiral doublets (M\\c{hi}D) in 133Ce and 103Rh are discussed.

  17. Angular Distribution of Products in Deep Inelastic Collision of 19F+27Al%19F+27Al深部非弹性碰撞产物的角分布

    董玉川; 李志常; 路秀琴; 赵葵; 周平; 刘建成; Sergey Yu-Kun; 王琦; 李松林; 段利敏; 吴和宇; 徐华根; 陈若富; 徐瑚珊; 韩建龙

    2004-01-01

    完成了19F+27Al深部非弹性碰撞产物的角分布测量. 初步分析了反应产物B, C, N, O, F, Ne, Na, Mg和Al的实验室系角分布, 展现出深部非弹性反应机制的特点, 显示了反应系统随时间的演化过程.

  18. Clinical applications of nuclear magnetic resonance spectroscopy: a review

    The advantages and present limitations of the clinical applications of nuclear magnetic resonance spectroscopy are reviewed in outline, with passing references to skeletal muscular studies, in particular a group of children with advanced Duchenne dystrophy, and the applications to the study of cerebral metabolism of neonates, excised kidneys, biopsy studies of breast and axillary lymph node samples, and NMR spectroscopy performed during chemotherapy of a secondary rhabdomyosarcoma in the skin. (U.K.)

  19. Nuclear magnetic response imaging of sap flow in plants

    Windt, C.W.

    2007-01-01

    This thesis deals with Nuclear Magnetic Resonance (NMR) imaging of long distance transport in plants. Long distance transport in plants is an enigmatic process. The theoretical framework that describes its basic properties has been in place for almost a century, yet at the same time only little is known about the dynamics of long distance transport inside the living plant. The latter is caused by the fact that the two pathways in which transport takes place, the xylem and the phloem, are virt...

  20. Nuclear magnetic resonance in LaNi/sub 5/

    Rubinstein, M.; Swartzendruber, L.J.; Bennett, L.H.

    1979-03-01

    Proton and La/sup 139/ nuclear magnetic resonance measurements have been performed on LaNi/sub 5/, LaNi/sub 5/ hydrides, and LaNi/sub 5/H/sub x/ with ternary additions. With ternary additions, the activation energy for proton diffusion remained unchanged, but the motionally narrowed linewidth broadened. The quadrupole interaction on the La site has been determined in LaNi/sub 5/ and LaNi/sub 5/H/sub x/.

  1. Science and history explored by nuclear magnetic resonance

    Baias, Maria Antoaneta

    2009-01-01

    Nuclear Magnetic Resonance was chosen as the main tool for investigating different biological and chemical systems, as it is unique in providing the information details about the morphology and molecular structures and conformations by which the fundamental properties of these biological and chemical systems can be understood. Proton spin-diffusion experiments combined with 13C CPMAS spectroscopy were successfully applied to characterize the changes that occur during the thermal denaturation ...

  2. Experimental Implementation of Remote State Preparation by Nuclear Magnetic Resonance

    Peng, Xinhua; Zhu, Xiwen; Fang, Ximing; Feng, Mang; Liu, Maili; Gao, Kelin

    2002-01-01

    We have experimentally implemented remote state preparation (RSP) of a qubit from a hydrogen to a carbon nucleus in molecules of carbon-13 labeled chloroform $^{13}$CHCl$_{3}$ over interatomic distances using liquid-state nuclear magnetic resonance (NMR) technique. Full RSP of a special ensemble of qubits, i.e., a qubit chosen from equatorial and polar great circles on a Bloch sphere with Pati's scheme, was achieved with one cbit communication. Such a RSP scheme can be generalized to prepare ...

  3. Experimental implementation of remote state preparation by nuclear magnetic resonance

    Peng Xinhua; Zhu Xiwen; Fang Ximing; Feng Mang; Liu Maili; Gao Kelin

    2003-01-13

    We have experimentally implemented remote state preparation of a qubit from a hydrogen to a carbon nucleus in molecules of carbon-13 labeled chloroform {sup 13}CHCl{sub 3} over interatomic distances using liquid-state nuclear magnetic resonance techniques. Full RSP of a special ensemble of qubits, i.e., a qubit chosen from either an equatorial or a polar great circle on a Bloch sphere with Pati's scheme, was achieved with one cbit communication.

  4. PWM high frequency oscillator in Nuclear Magnetic Resonance

    In this article we propose a new architecture for pulsed oscillator, in the area of radio frequency (RF), which operates with pulses of few microseconds in spectrometers of Nuclear Magnetic Resonance Pulsed. This new topology substitutes the classic amplifying systems with valves by field effect semiconductors of the type MOS-FET channel N, allowing a larger compacting and efficiency. This oscillator possibly reaching potencies of the order of 103 Watts at a low cost. (author)

  5. Optimal grouping for a nuclear magnetic resonance (NMR) scanner

    VANDAELE, Nico; VAN NIEUWENHUYSE, Inneke; CUPERS, Sascha

    2001-01-01

    In this paper we analyze how a Nuclear Magnetic Resonance Scanner can be managed more efficiently, simultaneously improving patient comfort (in terms of total time spent in the system) and increasing availability in case of emergency calls. By means of a superposition approach, all relevant data on the arrival and service process of different patient types are transformed into a general single server, single class queueing model. The objective function consists of the weighted average patient...

  6. Nonadiabatic Geometric Angle in Nuclear Magnetic Resonance Connection

    Cherbal, Omar; Maamache, Mustapha; Drir, Mahrez

    2005-01-01

    By using the Grassmannian invariant-angle coherents states approach, the classical analogue of the Aharonov-Anandan nonadiabatic geometrical phase is found for a spin one-half in Nuclear Magnetic Resonance (NMR). In the adiabatic limit, the semi-classical relation between the adiabatic Berry’s phase and Hannay’s angle gives exactly the experimental result observed by Suter et al[12].

  7. Nuclear Magnetic Resonance Imaging of Li-ion Battery

    D. Ohno

    2010-12-01

    Full Text Available Nuclear magnetic resonance (NMR imaging has high sensitivity to proton (1H and lithium (7Li. It is a useful measurement for electrolyte in Li-ion battery. 1H NMR images of lithium ion battery which is composed of LiMn2O4 / LiClO4 + propylene carbonate (PC / Li-metal have been studied. 1H NMR images of electrolyte near cathode material (LiMn2O4 showed anomalous intensity distribution, which was quite inhomogeneous. From NMR images as a function of repetition time (TR, it was concluded that the anomalous intensity distribution was not due to change of relaxation time but an indirect (spatial para-magnetization effect from cathode material. The paramagnetization induced by high magnetic field distorts linearity of magnetic gradient field, leading to apparent intensity variance. This functional image is an easy diagnostic measurement for magnetization of cathode material, which allows the possibility to check uniformity of cathode material and change of magnetization under electrochemical process.

  8. Quasifission role in the anisotropy of fragment angular distribution of 19F+208Pb reaction

    Full text: Role of quasifission was analyzed in the angular anisotropy of the fission-like reaction fragments in the framework of the model based on the conception of dinuclear system (DNS) and used to calculate the partial capture and complete fusion cross sections [1,2,3]. This model allows us to calculate the entrance channel dynamics of the nuclei to be captured with different orientation angles of their axes. We theoretically analyzed the experimental data for mean square values 2> and the angular anisotropy A for the 19F+208Pb reaction which was studied in Ref. [4, 5]. The experimental studies of fission angular distributions in heavy ion reactions show distinct deviation from the SSM theory. Our results of the reaction cross sections showed the presence of quasifission process. Considering the quasifission as 'fission' of the dinuclear system from a non compact shape we estimated mean square values of the angular momentum and anisotropy of the angular distribution of reaction fragments. This was possible with the known angular momentum distributions of complete fusion and quasifission calculated in our model. Comparison of the results with the experimental data shows that the fission data presented in Ref. [4, 5] are in good agreement with our fusion cross sections at energies near the barrier and contain contributions of quasifission at higher energies. Our results of the mean square values of the angular momentum and anisotropy of the angular distributions of reaction fragments are in good agreement with the experimental data if we include quasifission contributions. From a fit of the experimental data for fusion-fission cross section we found which part of quasifission fragments is mixed with the fragments from the compound nucleus fission. So, we conclude that the main reason of the failure of the standard statistical model for the description of the angular anisotropy of the fission fragments at higher than Coulomb barrier is the presence of the

  9. Magnetic Flux Compression Concept for Nuclear Pulse Propulsion and Power

    Litchford, Ronald J.

    2000-01-01

    The desire for fast, efficient interplanetary transport requires propulsion systems having short acceleration times and very high specific impulse attributes. Unfortunately, most highly efficient propulsion systems which are within the capabilities of present day technologies are either very heavy or yield very low impulse such that the acceleration time to final velocity is too long to be of lasting interest, One exception, the nuclear thermal thruster, could achieve the desired acceleration but it would require inordinately large mass ratios to reach the range of desired final velocities. An alternative approach, among several competing concepts that are beyond our modern technical capabilities, is a pulsed thermonuclear device utilizing microfusion detonations. In this paper, we examine the feasibility of an innovative magnetic flux compression concept for utilizing microfusion detonations, assuming that such low yield nuclear bursts can be realized in practice. In this concept, a magnetic field is compressed between an expanding detonation driven diamagnetic plasma and a stationary structure formed from a high temperature superconductor (HTSC). In general, we are interested in accomplishing two important functions: (1) collimation of a hot diamagnetic plasma for direct thrust production; and (2) pulse power generation for dense plasma ignition. For the purposes of this research, it is assumed that rnicrofusion detonation technology may become available within a few decades, and that this approach could capitalize on recent advances in inertial confinement fusion ICF) technologies including magnetized target concepts and antimatter initiated nuclear detonations. The charged particle expansion velocity in these detonations can be on the order of 10 (exp 6)- 10 (exp 7) meters per second, and, if effectively collimated by a magnetic nozzle, can yield the Isp and the acceleration levels needed for practical interplanetary spaceflight. The ability to ignite pure

  10. Pneumococcal Serotype 19F Conjugate Vaccine Induces Cross-Protective Immunity to Serotype 19A in a Murine Pneumococcal Pneumonia Model

    Jakobsen, Håvard; Sigurdsson, Viktor D.; Sigurdardottir, Sigurveig; Schulz, Dominique; Jonsdottir, Ingileif

    2003-01-01

    Immunization with a pneumococcal conjugate vaccine (PNC) containing serotype 19F induces cross-reactive antibodies to 19A in mice and human infants. Active immunization with PNC and passive immunization with serum samples from infants vaccinated with PNC containing serotype 19F, but not serotype 19A, protected against lung infection caused by both serotypes in a murine model.

  11. Quantitative velocity distributions via nuclear magnetic resonance flow metering

    O'Neill, Keelan T.; Fridjonsson, Einar O.; Stanwix, Paul L.; Johns, Michael L.

    2016-08-01

    We demonstrate the use of Tikhonov regularisation as a data inversion technique to determine the velocity distributions of flowing liquid streams. Regularisation is applied to the signal produced by a nuclear magnetic resonance (NMR) flow measurement system consisting of a pre-polarising permanent magnet located upstream of an Earth's magnetic field NMR detection coil. A simple free induction decay (FID) NMR signal is measured for the flowing stream in what is effectively a 'time-of-flight' measurement. The FID signal is then modelled as a function of fluid velocity and acquisition time, enabling determination of the velocity probability distributions via regularisation. The mean values of these velocity distributions were successfully validated against in-line rotameters. The ability to quantify multi-modal velocity distributions was also demonstrated using a two-pipe system.

  12. Parahydrogen enhanced zero-field nuclear magnetic resonance

    Theis, Thomas; Kervern, Gwendal; Knappe, Svenja; Kitching, John; Ledbetter, Micah; Budker, Dmitry; Pines, Alex

    2011-01-01

    Nuclear magnetic resonance (NMR), conventionally detected in multi-tesla magnetic fields, is a powerful analytical tool for the determination of molecular identity, structure, and function. With the advent of prepolarization methods and alternative detection schemes using atomic magnetometers or superconducting quantum interference devices (SQUIDs), NMR in very low- (~earth's field), and even zero-field, has recently attracted considerable attention. Despite the use of SQUIDs or atomic magnetometers, low-field NMR typically suffers from low sensitivity compared to conventional high-field NMR. Here we demonstrate direct detection of zero-field NMR signals generated via parahydrogen induced polarization (PHIP), enabling high-resolution NMR without the use of any magnets. The sensitivity is sufficient to observe spectra exhibiting 13C-1H J-couplings in compounds with 13C in natural abundance in a single transient. The resulting spectra display distinct features that have straightforward interpretation and can be...

  13. Imaging using long range dipolar field effects Nuclear magnetic resonance

    Gutteridge, S

    2002-01-01

    The work in this thesis has been undertaken by the except where indicated in reference, within the Magnetic Resonance Centre, at the University of Nottingham during the period from October 1998 to March 2001. This thesis details the different characteristics of the long range dipolar field and its application to magnetic resonance imaging. The long range dipolar field is usually neglected in nuclear magnetic resonance experiments, as molecular tumbling decouples its effect at short distances. However, in highly polarised samples residual long range components have a significant effect on the evolution of the magnetisation, giving rise to multiple spin echoes and unexpected quantum coherences. Three applications utilising these dipolar field effects are documented in this thesis. The first demonstrates the spatial sensitivity of the signal generated via dipolar field effects in structured liquid state samples. The second utilises the signal produced by the dipolar field to create proton spin density maps. Thes...

  14. Design and construction of a nuclear magnetic resonator circuit

    It is described the operation of a feedback circuit that it using the nuclear resonance phenomena and that covers a broad sweeping interval in frequency with a minimum adjustment of the circuit elements and it produces an appropriate nuclear absorption for a sign relation at reasonable noise. The circuit is an oscillator amplifier modulated that it is based its sensibility and stability in an inductive-capacitive arrangement in parallel and always operate in resonant condition, in such a way that the quality factor of Q arrangement has been very elevated. Thus when the nuclear absorption occurs it is producing a fall of Q effective. The oscillation amplitude is controllable and it maintains in a convenient value over the operation interval using control by feedback. The circuit uses a configuration 'Auto dyne Hop kin' that it suffers as a follower of inductive charge, which have the main characteristic of to cause a negative resistance that it appears through the tuning circuit. It is introduced a control for feedback via two trajectories, the first by differential pair for to maintain the amplitude level in RF and the second for to stability a band wide interval in the modulation condition. It is necessary since the RF signal value must have a value to excite the specimen nucleus without to carry to saturate it and that the permanence in the absorption region was appropriate. Between applications of the nuclear magnetic resonance phenomena we have the magnetic fields measurements, physicochemical molecular properties studies, training and medical instrumentation. (Author)

  15. Nuclear magnetic resonance study of metallic scandium chlorides

    The 45Sc nuclear magnetic resonance was studied in samples having the general composition CsSc/sub x/Cl3 (0.67 less than or equal to x less than or equal to 1.0) in the CsCl-ScCl3-Sc system. In particular the structure of CsScCl3 suggests that it may be a one-dimensional conductor, and an attempt was therefore made to detect the occurrence of a metal-insulator transition of the type characteristic of one-dimensional conductors. Conventional crossed-coil (nuclear induction) techniques were employed. The 45Sc resonance was studied over a wide frequency range (4 to 24 MHz) at 300K, these measurements yielding the Knight shift and nuclear electric quadrupole coupling parameters. No significant variation in the spectra occurred from 4.2K to 450K, indicating the absence of a metal-insulator transition in this temperature range

  16. Exploring the onset of quasifission by measurement of mass distribution in 19F+184W

    Sugathan P.

    2011-10-01

    Full Text Available Fission fragment mass distributions for 19F+184W have been measured at beam energies in the range of 85 - 125 MeV. Analysis of mass distribution width indicates that the system proceeds towards the formation of compound nucleus. No signature of quasifission is observed in this reaction. These results strengthen the conclusions of our earlier works revealing the stabilizing effect of the Z = 82 shell closure against fission.

  17. Characterization of solid polymer dispersions of active pharmaceutical ingredients by 19F MAS NMR and factor analysis

    Urbanová, Martina; Brus, Jiří; Šeděnková, Ivana; Policianová, Olivia; Kobera, Libor

    2013-01-01

    Roč. 100, 1 January (2013), s. 59-66. ISSN 1386-1425 R&D Projects: GA ČR GPP106/11/P426; GA MŠk 2B08021 Institutional research plan: CEZ:AV0Z40500505 Institutional support: RVO:61389013 Keywords : solid-state NMR * factor analysis * 19F MAS NMR Subject RIV: FR - Pharmacology ; Medidal Chemistry Impact factor: 2.129, year: 2013

  18. Preliminary study of the 19F(7Li,7Be)19O reaction at 52 MeV with MAGNEX

    Cavallaro, M; Cappuzzello, F; Carbone, D; Foti, A; Orrigo, S E A; Rodrigues, M R D; Schillaci, M; Borello-Lewin, T; Petrascu, H

    2010-01-01

    The 19F(7Li,7Be)19O charge-exchange reaction at 52 MeV incident energy has been performed at INFN-LNS in Catania using the MAGNEX spectrometer. The use of an algebraic ray-reconstruction technique has allowed to extract the 19O excitation energy spectrum and the experimental angular distributions obtained with a single angular setting of the spectrometer.

  19. Analysis of ringing due to magnetic core materials used in pulsed nuclear magnetic resonance applications

    Prabhu Gaunkar, Neelam; Nlebedim, Cajetan; Hadimani, Ravi; Bulu, Irfan; Song, Yi-Qiao; Mina, Mani; Jiles, David

    Oil-field well logging instruments employ pulsed nuclear magnetic resonance (NMR) techniques and use inductive sensors to detect and evaluate the presence of particular fluids in geological formations. Acting as both signal transmitters and receivers most inductive sensors employ magnetic cores to enhance the quality and amplitude of signals recorded during field measurements. It is observed that the magnetic core also responds to the applied input signal thereby generating a signal (`ringing') that interferes with the measurement of the signals from the target formations. This causes significant noise and receiver dead time and it is beneficial to eliminate/suppress the signals received from the magnetic core. In this work a detailed analysis of the magnetic core response and in particular loading of the sensor due to the presence of the magnetic core is presented. Pulsed NMR measurements over a frequency band of 100 kHz to 1MHz are used to determine the amplitude and linewidth of the signals acquired from different magnetic core materials. A lower signal amplitude and a higher linewidth are vital since these would correspond to minimal contributions from the magnetic core to the inductive sensor response and thus leading to minimized receiver dead time.

  20. Measurement and application of 1H-19F dipolar couplings in the structure determination of 2'-fluorolabeled RNA

    Residual dipolar couplings can provide powerful restraints for determination and refinement of the solution structure of macromolecules. The application of these couplings in nucleic acid structure elucidation can have an especially dramatic impact, since they provide long-range restraints, typically absent in NOE and J-coupling measurements. Here we describe sensitive X-filtered-E.COSY-type methods designed to measure both the sign and magnitude of long-range 1H-19F dipolar couplings in selectively fluorine labeled RNA oligonucleotides oriented in solution by a liquid crystalline medium. The techniques for measuring 1H-19F dipolar couplings are demonstrated on a 21-mer RNA hairpin, which has been specifically labeled with fluorine at the 2'-hydroxyl position of three ribose sugars. Experimentally measured 1H-19F dipolar couplings for the 2'-deoxy-2'-fluoro-sugars located in the helical region of the RNA hairpin were found to be in excellent agreement with values predicted using canonical A-form helical geometry, demonstrating that these couplings can provide accurate restraints for the refinement of RNA structures determined by NMR

  1. Theory of electronic structure and nuclear quadrupole interactions in the BF3-NH3 complex and methyl derivatives

    Pink, R. H.; Dubey, Archana; Mahato, Dip N.; Badu, S. R.; Scheicher, R. H.; Mahanti, Mahendra K.; Huang, M. B.; Saha, H. P.; Chow, Lee; Das, T. P.

    Magnetic Hyperfine and Nuclear Quadrupole Interactions (HPI and NQI) are now important tools for characterization of systems of interest in materials research and industry. Boron-Trifluoride is an inorganic compound that is very important in this respect as a catalyst in chemical physics research and industry, forming complexes in the process with compounds like ammonia, water and methyl alcohol. The present paper deals with the BP3-NH3 complex and methyl derivatives BP3NHx(CH3)3-x for which we have studied the electronic structures, binding energies, and 19F* (I=5/2) nuclear quadrupole interactions using the first-principles Hartree-Fock-Roothaan procedure combined with electron correlation effects. Our results for the 19F* nuclear quadrupole coupling constant (e 2qQ/h) in units of MHz compare well with experiment. Trends in the binding energies and NQI parameters between the complexes are discussed.

  2. Theory of electronic structure and nuclear quadrupole interactions in the BF3 NH3 complex and methyl derivatives

    Pink, R. H.; Dubey, Archana; Mahato, Dip N.; Badu, S. R.; Scheicher, R. H.; Mahanti, Mahendra K.; Huang, M. B.; Saha, H. P.; Chow, Lee; Das, T. P.

    2007-04-01

    Magnetic Hyperfine and Nuclear Quadrupole Interactions (HFI and NQI) are now important tools for characterization of systems of interest in materials research and industry. Boron-Trifluoride is an inorganic compound that is very important in this respect as a catalyst in chemical physics research and industry, forming complexes in the process with compounds like ammonia, water and methyl alcohol. The present paper deals with the BF3 NH3 complex and methyl derivatives BF3NHx(CH3)3-x for which we have studied the electronic structures, binding energies, and 19F* ( I = 5/2) nuclear quadrupole interactions using the first-principles Hartree Fock Roothaan procedure combined with electron correlation effects. Our results for the 19F* nuclear quadrupole coupling constant ( e 2 qQ/ h) in units of MHz compare well with experiment. Trends in the binding energies and NQI parameters between the complexes are discussed.

  3. Theory of electronic structure and nuclear quadrupole interactions in the BF3-NH3 complex and methyl derivatives

    Magnetic Hyperfine and Nuclear Quadrupole Interactions (HFI and NQI) are now important tools for characterization of systems of interest in materials research and industry. Boron-Trifluoride is an inorganic compound that is very important in this respect as a catalyst in chemical physics research and industry, forming complexes in the process with compounds like ammonia, water and methyl alcohol. The present paper deals with the BF3-NH3 complex and methyl derivatives BF3NHx(CH3)3-x for which we have studied the electronic structures, binding energies, and 19F* (I = 5/2) nuclear quadrupole interactions using the first-principles Hartree-Fock-Roothaan procedure combined with electron correlation effects. Our results for the 19F* nuclear quadrupole coupling constant (e2qQ/h) in units of MHz compare well with experiment. Trends in the binding energies and NQI parameters between the complexes are discussed.

  4. Transformation of Symmetrization Order to Nuclear-Spin Magnetization by Chemical Reaction and Nuclear Magnetic Resonance

    Bowers, C. Russell; Weitekamp, Daniel P.

    1986-01-01

    A method of obtaining very large nuclear-spin polarizations is proposed and illustrated by density-operator calculations. The prediction is that chemical reaction and rf irradiation can convert the scalar parahydrogen state into polarization of order unity on the nuclear spins of the products of molecular-hydrogen addition reactions. A means of extending the resultant sensitivity enhancement to other spins is proposed in which the transfer of order occurs through population differences not as...

  5. Fluctuation phenomena for dissipative processes in 19 F + 27 Al system

    Non-statistical fluctuations in the excitation functions (EF) of dissipative heavy ion collisions (DHIC) were rather unexpected, the cross sections being always obtained on a 'coarse cell' of total kinetic energy and center of mass angle (θcm). Since the experimental fluctuations in the EF for DHIC have been evidenced, the time evolution of dinuclear system (DNS) with different mass asymmetries and total mass ≤108 has been investigated only by statistical analysis. Although many theoretical interpretations of excitation function fluctuations ground their assumptions on the observed large angular correlation, the experimental angular correlation data are rather scarce. We already reported preliminary results concerning angular correlation for DHIC in the 19 F + 27 Al interaction. In the present work the angular correlation analysis was realized for Elab = 116.75 - 129.75 MeV with a 2 angle binning in the angular distributions and total kinetic energy loss (TKEL) windows of 20±2.5, 30±2.5 and 40±2.5 MeV. Pronounced oscillations in the angular distributions, at some incident energies, were observed. These oscillations are nicely evidenced in the autocorrelation angular functions (AAF) as determined for fragments with atomic number Z = 8 at an incident energy 124.75 MeV. A decreasing number of the oscillations with increasing TKEL value could be observed. The AAFs were calculated using for the average cross section the value obtained from the fit of the angular distributions with formula: sigma/dθcm ∝ [exp(-θcm/ω·τ) + exp(-(2π-θcm)/ω·τ)], where ω and τ are the angular velocity and lifetime of DNS, respectively. The moving Gaussian procedure was used for calculating the angular cross correlation coefficients C(θ,θ') for the energy averaged cross section . The results are presented. Large values for C(θ,θ') with an oscillating pattern were obtained for all studied fragments (Z = 6-8, 10). An increasing trend of C(θ,θ') values with TKEL could be

  6. Detection of molecules and cells using nuclear magnetic resonance with magnetic nanoparticles

    For the detection of small molecules, proteins or even cells in vitro, functionalised magnetic nanoparticles and nuclear magnetic resonance measurements can be applied. In this work, magnetic nanoparticles with the size of 5–7 nm were functionalised with antibodies to detect two model systems of different sizes, the protein avidin and Saccharomyces cerevisiae as the model organism. The synthesised magnetic nanoparticles showed a narrow size distribution, which was determined using transmission electron microscopy and dynamic light scattering. The magnetic nanoparticles were functionalised with the according antibodies via EDC/NHS chemistry. The binding of the antigen to magnetic nanoparticles was detected through the change in the NMR T2 relaxation time at 0.5 T (≈21.7 MHz). In case of a specific binding the particles cluster and the T2 relaxation time of the sample changes. The detection limit in buffer for FITC-avidin was determined to be 1.35 nM and 107 cells/ml for S. cerevisiae. For fluorescent microscopy the avidin molecules were labelled with FITC and for the detection of S. cerevisiae the magnetic nanoparticles were additionally functionalised with rhodamine. The binding of the particles to S. cerevisiae and the resulting clustering was also seen by transmission electron microscopy

  7. Detection of molecules and cells using nuclear magnetic resonance with magnetic nanoparticles

    Rümenapp, Christine, E-mail: ruemenapp@tum.de [Zentralinstitut für Medizintechnik (IMETUM), Technische Universität München, Garching (Germany); Gleich, Bernhard [Zentralinstitut für Medizintechnik (IMETUM), Technische Universität München, Garching (Germany); Mannherz, Hans Georg [Abteilung für Anatomie und Molekulare Embryologie, Ruhr Universität Bochum, Bochum (Germany); Haase, Axel [Zentralinstitut für Medizintechnik (IMETUM), Technische Universität München, Garching (Germany)

    2015-04-15

    For the detection of small molecules, proteins or even cells in vitro, functionalised magnetic nanoparticles and nuclear magnetic resonance measurements can be applied. In this work, magnetic nanoparticles with the size of 5–7 nm were functionalised with antibodies to detect two model systems of different sizes, the protein avidin and Saccharomyces cerevisiae as the model organism. The synthesised magnetic nanoparticles showed a narrow size distribution, which was determined using transmission electron microscopy and dynamic light scattering. The magnetic nanoparticles were functionalised with the according antibodies via EDC/NHS chemistry. The binding of the antigen to magnetic nanoparticles was detected through the change in the NMR T{sub 2} relaxation time at 0.5 T (≈21.7 MHz). In case of a specific binding the particles cluster and the T{sub 2} relaxation time of the sample changes. The detection limit in buffer for FITC-avidin was determined to be 1.35 nM and 10{sup 7} cells/ml for S. cerevisiae. For fluorescent microscopy the avidin molecules were labelled with FITC and for the detection of S. cerevisiae the magnetic nanoparticles were additionally functionalised with rhodamine. The binding of the particles to S. cerevisiae and the resulting clustering was also seen by transmission electron microscopy.

  8. Rotating-frame gradient fields for magnetic resonance imaging and nuclear magnetic resonance in low fields

    Bouchard, Louis-Serge; Pines, Alexander; Demas, Vasiliki

    2014-01-21

    A system and method for Fourier encoding a nuclear magnetic resonance (NMR) signal is disclosed. A static magnetic field B.sub.0 is provided along a first direction. An NMR signal from the sample is Fourier encoded by applying a rotating-frame gradient field B.sub.G superimposed on the B.sub.0, where the B.sub.G comprises a vector component rotating in a plane perpendicular to the first direction at an angular frequency .omega.in a laboratory frame. The Fourier-encoded NMR signal is detected.

  9. Analysis of the transient response of nuclear spins in GaAs with/without nuclear magnetic resonance

    Rasly, Mahmoud; Lin, Zhichao; Yamamoto, Masafumi; Uemura, Tetsuya

    2016-05-01

    As an alternative to studying the steady-state responses of nuclear spins in solid state systems, working within a transient-state framework can reveal interesting phenomena. The response of nuclear spins in GaAs to a changing magnetic field was analyzed based on the time evolution of nuclear spin temperature. Simulation results well reproduced our experimental results for the transient oblique Hanle signals observed in an all-electrical spin injection device. The analysis showed that the so called dynamic nuclear polarization can be treated as a cooling tool for the nuclear spins: It works as a provider to exchange spin angular momentum between polarized electron spins and nuclear spins through the hyperfine interaction, leading to an increase in the nuclear polarization. In addition, a time-delay of the nuclear spin temperature with a fast sweep of the external magnetic field produces a possible transient state for the nuclear spin polarization. On the other hand, the nuclear magnetic resonance acts as a heating tool for a nuclear spin system. This causes the nuclear spin temperature to jump to infinity: i.e., the average nuclear spins along with the nuclear field vanish at resonant fields of 75As, 69Ga and 71Ga, showing an interesting step-dip structure in the oblique Hanle signals. These analyses provide a quantitative understanding of nuclear spin dynamics in semiconductors for application in future computation processing.

  10. Nuclear spin relaxation in systems of magnetic spheres

    A new approach to the NMR relaxation theory for a system of magnetic spheres (sufficiently big spherical molecules) is presented. In this paper the NMR spin-lattice relaxation time T1 and spin-spin relaxation time T2 are calculated for nuclear spins I→j, taking into account intermolecular dipole-dipole interactions between the spins I→j, and spins S→k in the magnetic spheres. By an expansion of the dipole-dipole interaction in a series of spherical harmonics, it is possible to separate spatial variables of the interacting spins in a laboratory frame. A simultaneous effect of isotropic rotational and translation diffusion of the spins and relaxation rate of spins S→k is also taken into account

  11. Nuclear Magnetic Resonance with the Distant Dipolar Field

    Corum, C A

    2005-01-01

    Distant dipolar field (DDF)-based nuclear magnetic resonance is an active research area with many fundamental properties still not well understood. Already several intriguing applications have developed, like HOMOGENIZED and IDEAL spectroscopy, that allow high resolution spectra to be obtained in inhomogeneous fields, such as in-vivo. The theoretical and experimental research in this thesis concentrates on the fundamental signal properties of DDF-based sequences in the presence of relaxation (T1 and T2) and diffusion. A general introduction to magnetic resonance phenomenon is followed by a more in depth introduction to the DDF and its effects. A novel analytical signal equation has been developed to describe the effects of T2 relaxation and diffusing spatially modulated longitudinal spins during the signal build period of an HOMOGENIZED cross peak. Diffusion of the longitudinal spins results in a lengthening of the effective dipolar demagnetization time, delaying the re-phasing of coupled anti-phase states in...

  12. 2.3 Tomography using nuclear magnetic resonance

    The use of nuclear magnetic resonance (NMR) not only allows the tomographic imaging of tissues but also the identification of the biochemical structure of tissues. The principles of the method are described as is a NMR examination unit based on a giant magnet with a central opening in which is placed the patient. The application of the said method allows to distinguish in the skull structures 2 mm in size, in the trunk 3 mm in size. The morphological image may be obtained in 2 mins, data on chemical composition in 7 mins. The method may be applied for diagnosing edemas of the brain, hematomas, for distinguishing benign and malignant tumours, for measuring blood vessel flow and for monitoring biochemical processes. The advantage of the method is that it does not load the patient with radioactive radiation. (J.P.)

  13. A personal computer-based nuclear magnetic resonance spectrometer

    Job, Constantin; Pearson, Robert M.; Brown, Michael F.

    1994-11-01

    Nuclear magnetic resonance (NMR) spectroscopy using personal computer-based hardware has the potential of enabling the application of NMR methods to fields where conventional state of the art equipment is either impractical or too costly. With such a strategy for data acquisition and processing, disciplines including civil engineering, agriculture, geology, archaeology, and others have the possibility of utilizing magnetic resonance techniques within the laboratory or conducting applications directly in the field. Another aspect is the possibility of utilizing existing NMR magnets which may be in good condition but unused because of outdated or nonrepairable electronics. Moreover, NMR applications based on personal computer technology may open up teaching possibilities at the college or even secondary school level. The goal of developing such a personal computer (PC)-based NMR standard is facilitated by existing technologies including logic cell arrays, direct digital frequency synthesis, use of PC-based electrical engineering software tools to fabricate electronic circuits, and the use of permanent magnets based on neodymium-iron-boron alloy. Utilizing such an approach, we have been able to place essentially an entire NMR spectrometer console on two printed circuit boards, with the exception of the receiver and radio frequency power amplifier. Future upgrades to include the deuterium lock and the decoupler unit are readily envisioned. The continued development of such PC-based NMR spectrometers is expected to benefit from the fast growing, practical, and low cost personal computer market.

  14. On the quantumness of correlations in nuclear magnetic resonance

    Soares-Pinto, D O; Maziero, J; Gavini-Viana, A; Serra, R M; Céleri, L C

    2012-01-01

    Nuclear Magnetic Resonance (NMR) was successfully employed to test several protocols and ideas in Quantum Information Science. In most of these implementations the existence of entanglement was ruled out. This fact introduced concerns and questions about the quantum nature of such bench tests. In this article we address some issues related to the non-classical aspects of NMR systems. We discuss some experiments where the quantum aspects of this system are supported by quantum correlations of separable states. Such quantumness, beyond the entanglement-separability paradigm, is revealed via a departure between the quantum and the classical versions of information theory. In this scenario, the concept of quantum discord seems to play an important role. We also present an experimental implementation of an analogous of the single-photon Mach-Zehnder interferometer employing two nuclear spins to encode the interferometric paths. This experiment illustrate how non-classical correlations of separable states may be us...

  15. Applications of nuclear magnetic resonance spectroscopy to certifiable food colors

    Nuclear magnetic resonance spectroscopy was found suitable for the identification of individual colours, for distinguishing individual colours from colour mixtures, for the identification and semi-quantitative determination of the individual colours in mixtures and for proofs of the adulteration of certified colours adding noncertified colours. The method is well suited for observing the purity of colours and may also be used as the control method in the manufacture of colours and in assessing their stability and their resistance to increased temperature and light. (M.K.)

  16. Nuclear magnetic resonance imaging of the posterior fossa disorders

    Ikeda, Toshiaki; Fukaya, Takashi; Nomura, Yasuya; Yoshikawa, Kouki

    1985-03-01

    Nuclear magnetic resonance scans (NMR-CT) were performed on patients with posterior fossa disorders such as acoustic neurinoma, cerebellar tumour (gangliocytoma), epidermoid tumour and spinocerebellar degeneration, and compared with X-ray computed tomography (CT) scans. The advantages of NMR-CT include lack of bone artifact, variety of image planes, transverse, sagital and coronal imaging, and high ability to differentiate tissues. The disadvantages include prolonged data accumulation time, lack of bone detail and calcification, limited spatial resolution and suitability of patients. (author).

  17. Thermo-magnetic systems for space nuclear reactors an introduction

    Maidana, Carlos O

    2014-01-01

    Introduces the reader to engineering magnetohydrodynamics applications and presents a comprehensive guide of how to approach different problems found in this multidisciplinary field. An introduction to engineering magnetohydrodynamics, this brief focuses heavily on the design of thermo-magnetic systems for liquid metals, with emphasis on the design of electromagnetic annular linear induction pumps for space nuclear reactors. Alloy systems that are liquid at room temperature have a high degree of thermal conductivity far superior to ordinary non-metallic liquids. This results in their use for

  18. Experimental Implementation of Remote State Preparation by Nuclear Magnetic Resonance

    Peng, X; Fang, X; Feng, M; Liu, M; Gao, K; Peng, Xinhua; Zhu, Xiwen; Fang, Ximing; Feng, Mang; Liu, Maili; Gao, Kelin

    2003-01-01

    We have experimentally implemented remote state preparation (RSP) of a qubit from a hydrogen to a carbon nucleus in molecules of carbon-13 labeled chloroform $^{13}$CHCl$_{3}$ over interatomic distances using liquid-state nuclear magnetic resonance (NMR) technique. Full RSP of a special ensemble of qubits, i.e., a qubit chosen from equatorial and polar great circles on a Bloch sphere with Pati's scheme, was achieved with one cbit communication. Such a RSP scheme can be generalized to prepare a large number of qubit states and may be used in other quantum information processing and quantum computing.

  19. Neutron studies of nuclear magnetism at ultralow temperature

    Siemensmeyer, K.; Clausen, K.N.; Lefmann, K.;

    1998-01-01

    Nuclear magnetic order in copper and silver has been investigated by neutron diffraction. Antiferromagnetic order is observed in these simple, diamagnetic metals at temperatures below 50 nK and 560 pK, respectively. Both crystallize in the FCC-symmetry which is fully frustrated for nearest...... phase diagram in applied fields. The low-and the high-field structures are of type I, while in intermediate fields the unconventional ordering vector q = 2 pi(1,1/3,1/3) is observed. Strong hysteresis effects indicate first-order phase boundaries in copper. (C) 1998 Elsevier Science B.V. All rights...

  20. Implementation of Quantum Private Queries Using Nuclear Magnetic Resonance

    WANG Chuan; HAO Liang; ZHAO Lian-Jie

    2011-01-01

    @@ We present a modified protocol for the realization of a quantum private query process on a classical database.Using one-qubit query and CNOT operation,the query process can be realized in a two-mode database.In the query process,the data privacy is preserved as the sender would not reveal any information about the database besides her query information,and the database provider cannot retain any information about the query.We implement the quantum private query protocol in a nuclear magnetic resonance system.The density matrix of the memory registers are constructed.

  1. Nuclear magnetic resonance characterization of apple juice containing enzyme preparations

    In this work, 1H nuclear magnetic resonance (1H NMR) was employed to evaluate changes in apple juice in response to the addition of Panzym Yieldmash and Ultrazym AFP-L enzymatic complexes and compare it with premium apple juice. The juice was processed at different temperatures and concentrations of enzymatic complexes. The differences in the results were attributed mainly to the enzyme concentrations, since temperature did not cause any variation. A quantitative analysis indicated that the concentration of fructose increased while the concentrations of sucrose and glucose decreased in response to increasing concentrations of the enzymatic complexes. (author)

  2. Implementation of Quantum Private Queries Using Nuclear Magnetic Resonance

    We present a modified protocol for the realization of a quantum private query process on a classical database. Using one-qubit query and CNOT operation, the query process can be realized in a two-mode database. In the query process, the data privacy is preserved as the sender would not reveal any information about the database besides her query information, and the database provider cannot retain any information about the query. We implement the quantum private query protocol in a nuclear magnetic resonance system. The density matrix of the memory registers are constructed. (general)

  3. Development of Metallic Magnetic Calorimeters for Nuclear Safeguards Applications

    Bates, Cameron Russell [Univ. of California, Berkeley, CA (United States)

    2015-03-11

    Many nuclear safeguards applications could benefit from high-resolution gamma-ray spectroscopy achievable with metallic magnetic calorimeters. This dissertation covers the development of a system for these applications based on gamma-ray detectors developed at the University of Heidelberg. It demonstrates new calorimeters of this type, which achieved an energy resolution of 45.5 eV full-width at half-maximum at 59.54 keV, roughly ten times better than current state of the art high purity germanium detectors. This is the best energy resolution achieved with a gamma-ray metallic magnetic calorimeter at this energy to date. In addition to demonstrating a new benchmark in energy resolution, an experimental system for measuring samples with metallic magnetic calorimeters was constructed at Lawrence Livermore National Laboratory. This system achieved an energy resolution of 91.3 eV full-width at half-maximum at 59.54 keV under optimal conditions. Using this system it was possible to characterize the linearity of the response, the count-rate limitations, and the energy resolution as a function of temperature of the new calorimeter. With this characterization it was determined that it would be feasible to measure 242Pu in a mixed isotope plutonium sample. A measurement of a mixed isotope plutonium sample was performed over the course of 12 days with a single two-pixel metallic magnetic calorimeter. The relative concentration of 242Pu in comparison to other plutonium isotopes was determined by direct measurement to less than half a percent accuracy. This is comparable with the accuracy of the best-case scenario using traditional indirect methods. The ability to directly measure the relative concentration of 242Pu in a sample could enable more accurate accounting and detection of indications of undeclared activities in nuclear safeguards, a better constraint on source material in forensic samples containing plutonium, and improvements in verification in a future plutonium

  4. Nuclear magnetic resonance study of fluorine-graphite intercalation compounds

    To study the origin of semimetal-metal and metal-insulator transformations, localization effects and C-F bonding in fluorine-intercalated graphite CxF, 13C and 19F NMR investigations have been carried out for a wide range of fluorine content, 3.8≤x≤12.7. Fluorine spectra for small fluorine content, x>8, are attributed to mobile fluorine acceptor species which are responsible for the increase of electric conductivity in the dilute compound. When increasing the fluorine content to x∼8 corresponding to the maximum electric conductivity, covalent C-F bonds start to occur. The number of these bonds grows with fluorine content resulting in a decrease in conductivity which is caused by a percolation mechanism rather than by a change in bond length. A difference in 19F chemical shift for fluorine-intercalated graphite CxF and covalent graphite fluoride (CF)n has been observed and is attributed to different C-F bonding in these compounds. (author)

  5. Enhanced nuclear magnetic resonance in a non-magnetic cubic doublet

    In this thesis two lanthanide compounds are studied which show enhanced nuclear magnetism at low temperatures: Rb2NaHoF6 and CsNaHoF6. Chapter II gives a description of the 4He-circulating refrigerator, which was built to provide the low temperatures required for the polarization of the enhanced nuclear moments. This type of dilution refrigerator was chosen because of its simple design and large cooling power. Chapter III is devoted to a comparison of the different types of dilution refrigerators. A theoretical discussion is given of their performance, starting from the differential equations, which govern the temperature distribution in the refrigerator. In chapter IV the actual performance of the refrigerator, described in chapter II is discussed. In chapter V a description of the NMR-apparatus, developed for very-low-temperature NMR experiments is given. In chapter VI experimental results on the compound Rb2NaHoF6 are presented. The CEF-ground state of this compound is probably the non-magnetic doublet GAMMA3, but at a temperature of 170 K a structural phase transition lowers the crystal symmetry from cubic to tetragonal and the doublet is split into two singlets. In chapter VII specific heat, (enhanced) nuclear magnetic resonance and magnetization measurements on the compound Cs2NaHoF6 are presented which also has a GAMMA3-doublet ground state. In zero magnetic field the degeneracy of the doublet is removed at a temperature of 393 mK, where a phase transition is induced by quadrupolar interactions. (Auth.)

  6. Measurement of magnetic field strengths in the Mirror Fusion Test Facility using nuclear magnetic resonance techniques

    The production of the proper magnetic field profile is fundamental to plasma confinement in magnetic mirror systems. The knowledge of this profile is important for the control of a variety of physical processes which affect particle confinement, including thermal barrier and potential well formation. A system of probes using the nuclear magnetic resonance of protons in magnetic fields is used to measure the field strengths at various points in the Mirror Fusion Test Facility (MFTF-B). The system operates at high fields (1-12 T) with significant nonuniformity (≤ 1.5 T/m) by taking advantage of the phenomenon of spin echo. In addition, the probes can operate in the MFTF-B environment where low temperature capability and remote operation is necessary. These probes have been tested with laboratory magnets to develop an engineering model which relates probe signal-to-noise (S/N) ratio to probe parameters and magnetic field strengths and gradients. Engineering design formula and techniques are presented as well as data from laboratory test stands

  7. Saturation properties of nuclear matter in the presence of strong magnetic field

    Rezaei, Z

    2016-01-01

    Different saturation properties of cold symmetric nuclear matter in the strong magnetic field have been considered. We have seen that for magnetic fields about $B> 3 \\times 10 ^ {17}\\ G$, {for both cases with and without nucleon anomalous magnetic moments}, the saturation density and saturation energy grow by increasing the magnetic field. It is indicated that the magnetic susceptibility of symmetric nuclear matter becomes negative showing the diamagnetic response especially at $B 3 \\times 10 ^ {17}\\ G$, {the softening of equation of state caused by Landau quantization is overwhelmed by stiffening due to the magnetization of nuclear matter.} We have shown that the effects of strong magnetic field on nuclear matter may affect the constraints on the equation of state of symmetric nuclear matter obtained applying the experimental observable.

  8. Analysis of ringing effects due to magnetic core materials in pulsed nuclear magnetic resonance circuits

    Prabhu Gaunkar, N., E-mail: neelampg@iastate.edu; Bouda, N. R. Y.; Nlebedim, I. C.; Hadimani, R. L.; Mina, M.; Jiles, D. C. [Department of Electrical and Computer Engineering, Iowa State University, Ames, Iowa 50011 (United States); Bulu, I.; Ganesan, K.; Song, Y. Q. [Schlumberger-Doll Research, Cambridge, Massachusetts 02139 (United States)

    2015-05-07

    This work presents investigations and detailed analysis of ringing in a non-resonant pulsed nuclear magnetic resonance (NMR) circuit. Ringing is a commonly observed phenomenon in high power switching circuits. The oscillations described as ringing impede measurements in pulsed NMR systems. It is therefore desirable that those oscillations decay fast. It is often assumed that one of the causes behind ringing is the role of the magnetic core used in the antenna (acting as an inductive load). We will demonstrate that an LRC subcircuit is also set-up due to the inductive load and needs to be considered due to its parasitic effects. It is observed that the parasitics associated with the inductive load become important at certain frequencies. The output response can be related to the response of an under-damped circuit and to the magnetic core material. This research work demonstrates and discusses ways of controlling ringing by considering interrelationships between different contributing factors.

  9. COMPARATIVE ASSESSMENT OF NUCLEAR MAGNETIC RELAXATION CHARACTERISTICS OF SUNFLOWER AND RAPESEED LECITHIN

    Lisovaya E. V.; Victorova E. P.; Agafonov O. S.; Kornen N. N.; Shahray T. A.

    2015-01-01

    The article presents a comparative assessment and peculiarities of nuclear magnetic relaxation characteristics of rapeseed and sunflower lecithin. It was established, that lecithin’s nuclear magnetic relaxation characteristics, namely, protons’ spin-spin relaxation time and amplitudes of nuclear magnetic relaxation signals of lecithin components, depend on content of oil’s fat acids and phospholipids, contained in the lecithin. Comparative assessment of protons’ spin-spin relaxation time of r...

  10. Characterization of polymers by nuclear magnetic resonance (NMR)

    After having recalled some generalities which are necessary for the obtention of a spectrum and the method to be chosen, the author considers the use of the hydrogen 1 and carbon 13 high resolution nuclear magnetic resonance (in liquid and solid phase) on some examples in the field of polymers. In the case of the polymers in solution, this technology seems to be limited to liquid or soluble polymers and to insoluble polymers which are inflatable in some solvents. The other polymers (infusible and non-inflatable) require the use of the CP-MAS solid phase NMR (cross polarization magic angle spinning nuclear magnetic resonance). For liquids, the NMR allows to better know the microstructure of these compounds and to better understand the reaction mechanisms (in the case of poly-condensation, polymerization, degradation..) which can control the polymerization. The CP-MAS solid phase NMR is a particularly interesting method for the determination of insoluble three-dimensional polymers structures and for the study of the conformations and configurations of the chain carbonated skeleton. (O.M.). 46 refs., 18 figs

  11. Nuclear magnetic relaxation of liquids in porous media

    Nuclear magnetic relaxation is useful for probing physical and chemical properties of liquids in porous media. Examples are given on high surface area porous materials including calibrated porous silica glasses, granular packings, plaster pastes, cement-based materials and natural porous materials, such as sandstone and carbonate rocks. Here, we outline our recent NMR relaxation work for these very different porous materials. For instance, low field NMR relaxation of water in calibrated granular packings leads to striking different pore-size dependencies of the relaxation times T1 and T2 when changing the amount of surface paramagnetic impurities. This allows separation of the diffusion and surface limited regimes of relaxation in these macroporous media. The magnetic field dependence of the nuclear spin-lattice relaxation rate 1/T1(ω0) is also a rich source of dynamical information for characterizing the molecular dynamics of liquids in porous media. This allows a continuous characterization of the evolving microstructure of various cementitious materials. Our recent applications of two-dimensional (2D) T1-T2 and T2-z-store-T2 correlation experiments have evidenced the water exchange in connected micropores of cement pastes. The direct probing of water adsorption time on a solid surface gives access to an original characterization of the surface nano-wettability of porous plaster pastes. We show that such a parameter depends directly on the physical chemistry of the pore surfaces. Lastly, we outline our recent measurements of wettability in oil/brine/reservoir carbonate rocks.

  12. Langevin study of neutron emission in the reactions 16O+181Ta and 19F+178Hf

    YE Wei; WU Feng; YANG Hong-Wei

    2008-01-01

    The pre-scission neutrons measured in the reactions 16O+181Ta and 19F+178Hf are studied via a Langevin equation coupled with a statistical decay model.We find that because of the mass asymmetry of different entrance channels,the spin distributions of compound nuclei would be different,consequently,the measured neutrons in these two reactions would also different.This means that the entrance channel will affect the particle emission in the fission process of hot nuclei.

  13. Break-up effects of 19F projectile at ≈ 4-6 MeV/A

    In the present work analysis of excitation functions (EFs) has been used to deduce the energy dependence of ICF strength function and to study the effect of Qα-values and that of mass asymmetry. To explore the influence of ICF on CF in 19F + 159Tb reactions in the energy range ≈ 80-110 MeV, an off-line γ-ray spectroscopy technique has been employed. The present results have been compared with the existing data of 12,13C + 159Tb, and 16O + 159Tb systems

  14. Nuclear orientation with combined electric and magnetic interactions

    The combined interaction of a static electric field gradient and a static magnetic field with the electromagnetic moments of a nucleus is considered for the case of nuclear orientation at low temperature. The general expression of the angular distribution of a radiation emitted from the oriented state is developed for polycrystalline samples, where the principal axis of the electric field gradients are randomly distributed with respect to a fixed magnetic direction. Due to axial symmetry of the ensemble the effect of the quadrupole interaction is reduced to an attenuation factor on the usual Bsub(K) coefficients. Numerical calculations of these attenuation factors, for K=1, 2, 4 have been performed in the case of symmetric electric field gradient for a wide range of the electric to magnetic interactions ratio and spin values I=1/2, 1, 3/2, ...8. Typical attenuation curves for spin 5/2 and 9/2 are presented. Comparing the experimental anisotropies with the tabulated values, one can extract the quadrupole interaction value hωsub(Q)

  15. Nuclear magnetic resonance in atomic-scale superconductor/magnet multilayered systems

    Kanegae, Y

    2003-01-01

    We investigate the nuclear spin-lattice relaxation rate (T sub 1 T) sup - sup 1 in atomic-scale superconductor/magnet multilayered systems and discuss the discrepancy between two recent (T sub 1 T) sup - sup 1 experiments on Ru in RuSr sub 2 YCu sub 2 O sub 8. When the magnetic layers is are in the antiferromagnetic state, (T sub 1 T) sup - sup 1 in the magnetic layers is shown to decrease with decreasing due to the excitation gap associated with the magnetic ordering. The proximity effect of superconductivity on (T sub 1 T) sup - sup 1 in the magnetic layer is negligibly small. Our result indicates that the temperature dependence of (T sub 1 T) sup - sup 1 on Ru in RuSr sub 2 YCu sub 2 O sub 8 likely originates from the antiferromagnetism in the RuO sub 2 layers, but not from the superconductivity in the CuO sub 2 layers. (author)

  16. High temperature spin dynamics in linear magnetic chains, molecular rings, and segments by nuclear magnetic resonance

    Adelnia, Fatemeh; Lascialfari, Alessandro [Dipartimento di Fisica, Università degli Studi di Milano and INSTM, Milano (Italy); Dipartimento di Fisica, Università degli Studi di Pavia and INSTM, Pavia (Italy); Mariani, Manuel [Dipartimento di Fisica e Astronomia, Università di Bologna, Bologna (Italy); Ammannato, Luca; Caneschi, Andrea; Rovai, Donella [Dipartimento di Chimica, Università degli Studi di Firenze and INSTM, Firenze (Italy); Winpenny, Richard; Timco, Grigore [School of Chemistry, The University of Manchester, Manchester (United Kingdom); Corti, Maurizio, E-mail: maurizio.corti@unipv.it; Borsa, Ferdinando [Dipartimento di Fisica, Università degli Studi di Pavia and INSTM, Pavia (Italy)

    2015-05-07

    We present the room temperature proton nuclear magnetic resonance (NMR) nuclear spin-lattice relaxation rate (NSLR) results in two 1D spin chains: the Heisenberg antiferromagnetic (AFM) Eu(hfac){sub 3}NITEt and the magnetically frustrated Gd(hfac){sub 3}NITEt. The NSLR as a function of external magnetic field can be interpreted very well in terms of high temperature spin dynamics dominated by a long time persistence of the decay of the two-spin correlation function due to the conservation of the total spin value for isotropic Heisenberg chains. The high temperature spin dynamics are also investigated in Heisenberg AFM molecular rings. In both Cr{sub 8} closed ring and in Cr{sub 7}Cd and Cr{sub 8}Zn open rings, i.e., model systems for a finite spin segment, an enhancement of the low frequency spectral density is found consistent with spin diffusion but the high cut-off frequency due to intermolecular anisotropic interactions prevents a detailed analysis of the spin diffusion regime.

  17. Integrated Geophysical Measurements for Bioremediation Monitoring: Combining Spectral Induced Polarization, Nuclear Magnetic Resonance and Magnetic Methods

    Keating, Kristina [Rutgers Univ., Newark, NJ (United States). Dept. of Earth and Environmental Sciences; Slater, Lee [Rutgers Univ., Newark, NJ (United States). Dept. of Earth and Environmental Sciences; Ntarlagiannis, Dimitris [Rutgers Univ., Newark, NJ (United States). Dept. of Earth and Environmental Sciences; Williams, Kenneth H. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Earth Sciences Division

    2015-02-24

    This documents contains the final report for the project "Integrated Geophysical Measurements for Bioremediation Monitoring: Combining Spectral Induced Polarization, Nuclear Magnetic Resonance and Magnetic Methods" (DE-SC0007049) Executive Summary: Our research aimed to develop borehole measurement techniques capable of monitoring subsurface processes, such as changes in pore geometry and iron/sulfur geochemistry, associated with remediation of heavy metals and radionuclides. Previous work has demonstrated that geophysical method spectral induced polarization (SIP) can be used to assess subsurface contaminant remediation; however, SIP signals can be generated from multiple sources limiting their interpretation value. Integrating multiple geophysical methods, such as nuclear magnetic resonance (NMR) and magnetic susceptibility (MS), with SIP, could reduce the ambiguity of interpretation that might result from a single method. Our research efforts entails combining measurements from these methods, each sensitive to different mineral forms and/or mineral-fluid interfaces, providing better constraints on changes in subsurface biogeochemical processes and pore geometries significantly improving our understanding of processes impacting contaminant remediation. The Rifle Integrated Field Research Challenge (IFRC) site was used as a test location for our measurements. The Rifle IFRC site is located at a former uranium ore-processing facility in Rifle, Colorado. Leachate from spent mill tailings has resulted in residual uranium contamination of both groundwater and sediments within the local aquifer. Studies at the site include an ongoing acetate amendment strategy, native microbial populations are stimulated by introduction of carbon intended to alter redox conditions and immobilize uranium. To test the geophysical methods in the field, NMR and MS logging measurements were collected before, during, and after acetate amendment. Next, laboratory NMR, MS, and SIP measurements

  18. Magnetism and superconductivity in iron-based superconductors as probed by nuclear magnetic resonance

    Hammerath, Franziska

    2012-07-01

    Nuclear Magnetic Resonance (NMR) has been a fundamental player in the studies of superconducting materials for many decades. This local probe technique allows for the study of the static electronic properties as well as of the low energy excitations of the electrons in the normal and the superconducting state. On that account it has also been widely applied to Fe-based superconductors from the very beginning of their discovery in February 2008. This dissertation comprises some of these very first NMR results, reflecting the unconventional nature of superconductivity and its strong link to magnetism in the investigated compounds LaO{sub 1-x}F{sub x}FeAs and LiFeAs.

  19. Magnetism and Superconductivity in Iron-based Superconductors as Probed by Nuclear Magnetic Resonance

    Hammerath, Franziska

    2012-01-01

    Nuclear Magnetic Resonance (NMR) has been a fundamental player in the studies of superconducting materials for many decades. This local probe technique allows for the study of the static electronic properties as well as of the low energy excitations of the electrons in the normal and the superconducting state. On that account it has also been widely applied to Fe-based superconductors from the very beginning of their discovery in February 2008. This dissertation comprises some of these very first NMR results, reflecting the unconventional nature of superconductivity and its strong link to magnetism in the investigated compounds LaO1–xFxFeAs and LiFeAs.

  20. Nuclear magnetic resonance. Present results and its application to renal pathology. Experimental study of hydronephrosis

    Results of proton nuclear magnetic resonance imaging and relaxation time measurement of experimental hydronephrosis in mice are presented. The study is preceded by a description of the physical principles underlying the phenomenon of nuclear magnetic resonance and of its biomedical applications and with a review of the clinical use of NMR imaging in renal pathology

  1. Nuclear magnetic shielding in molecules. The application of GIAO's in LCAO-Xα-calculations

    A nonempirical method for the calculation of nuclear magnetic shielding based on the four current density functional formalism is presented. Using SCF-LCAO-Xα-calculations with application of GIAO's effective one particle equations are solved. The results for nuclear magnetic shielding in diatomic molecules are of good quality, compared with other theoretical and experimental data. (orig.)

  2. Nuclear magnetic resonance spectral analysis and molecular properties of berberine

    Huang, Ming-Ju; Lee, Ken S.; Hurley, Sharon J.

    An extensive theoretical study of berberine has been performed at the ab initio HF/6-31G**, HF/6-311G**, and B3LYP/6-311G** levels with and without solvent effects. The optimized structures are compared with X-ray data. We found that the optimized structures with solvent effects are in slightly better agreement with X-ray data than those without solvent effects. The 1H and 13C nuclear magnetic resonance (NMR) chemical shifts of berberine were calculated by using the gauge-independent atomic orbital (GIAO) (with and without solvent effects), CSGT, and IGAIM methods. The calculated chemical shifts were compared with the two-dimensional NMR experimental data. Overall, the calculated chemical shifts show very good agreement with the experimental results. The harmonic vibrational frequencies for berberine were calculated at the B3LYP/6-311G** level.

  3. Applications of nuclear magnetic resonance imaging in process engineering

    Gladden, Lynn F.; Alexander, Paul

    1996-03-01

    During the past decade, the application of nuclear magnetic resonance (NMR) imaging techniques to problems of relevance to the process industries has been identified. The particular strengths of NMR techniques are their ability to distinguish between different chemical species and to yield information simultaneously on the structure, concentration distribution and flow processes occurring within a given process unit. In this paper, examples of specific applications in the areas of materials and food processing, transport in reactors and two-phase flow are discussed. One specific study, that of the internal structure of a packed column, is considered in detail. This example is reported to illustrate the extent of new, quantitative information of generic importance to many processing operations that can be obtained using NMR imaging in combination with image analysis.

  4. Serum metabonomics of acute leukemia using nuclear magnetic resonance spectroscopy

    Musharraf, Syed Ghulam; Siddiqui, Amna Jabbar; Shamsi, Tahir; Choudhary, M. Iqbal; Rahman, Atta-ur

    2016-01-01

    Acute leukemia is a critical neoplasm of white blood cells. In order to differentiate between the metabolic alterations associated with two subtypes of acute leukemia, acute lymphoblastic leukemia (ALL) and acute myeloid leukemia (AML), we investigated the serum of ALL and AML patients and compared with two controls (healthy and aplastic anemia) using 1H NMR (nuclear magnetic resonance) spectroscopy. Thirty-seven putative metabolites were identified using Carr-Purcell-Meiboom-Gill (CPMG) sequence. The use of PLS-DA and OPLS-DA models gave results with 84.38% and 90.63% classification rate, respectively. The metabolites responsible for classification are mainly lipids, lactate and glucose. Compared with controls, ALL and AML patients showed serum metabonomic differences involving aberrant metabolism pathways including glycolysis, TCA cycle, lipoprotein changes, choline and fatty acid metabolisms. PMID:27480133

  5. Nuclear Magnetic Resonance Study of Nanoscale Ionic Materials

    Oommen, Joanna Mary

    2010-08-13

    Nanoscale ionic materials (NIMs) are a new class of nanomaterials that exhibit interesting properties including negligible vapor pressures and tunable physical states, among others. In this study, we analyzed the temperature-wise performance of NIMs using nuclear magnetic resonance (NMR) spectroscopy. NIMs are relatively stable over a temperature range from 300 to 383 K, rendering them usable in high temperature applications. We confirmed the presence of covalent bonds between the SiO2 core and the sulfonate group and determined relative concentrations of aromatic and aliphatic hydrocarbons. These findings serve as first hand proof-of-concept for the usefulness of NMR analyses in further studies on the diffusive properties of NIMs. © 2010 The Electrochemical Society.

  6. Phosphorus-31 nuclear magnetic resonance studies of photosynthesizing Chlorella

    Phosphorus-31 nuclear magnetic resonance studies of intact Chlorella cells under light and dark conditions are described. Psub(i), ATP, NAD, UDP-glucose and polyphosphate were observed in the cell. The presence of two compartments was postulated from two intracellular Psub(i) signals, whose chemical shift values were dependent on illumination. These two Psub(i) signals were assigned to those in the stroma of chloroplasts and in the cytoplasm based on their response to the light and dark cycle, and to the treatment of cells with 3-(3,4-dichlorophenyl)-1,1-dimethylurea. In the light the chloroplastic pH became more alkaline, while the cytoplasmic pH became more acidic. An increase in ATP was also observed upon illumination. (orig.)

  7. Explosives Detection Using Magnetic and Nuclear Resonance Techniques

    Fraissard, Jacques

    2009-01-01

    Nuclear quadrupole resonance (NQR) a highly promising new technique for bulk explosives detection: relatively inexpensive, more compact than NMR, but with considerable selectivity. Since the NQR frequency is insensitive to long-range variations in composition, mixing explosives with other materials, such as the plasticizers in plastic explosives, makes no difference. The NQR signal strength varies linearly with the amount of explosive, and is independent of its distribution within the volume monitored. NQR spots explosive types in configurations missed by the X-ray imaging method. But if NQR is so good, why it is not used everywhere? Its main limitation is the low signal-to-noise ratio, particularly with the radio-frequency interference that exists in a field environment, NQR polarization being much weaker than that from an external magnetic field. The distinctive signatures are there, but are difficult to extract from the noise. In addition, the high selectivity is partly a disadvantage, as it is hard to bui...

  8. High resolution spectroscopy in solids by nuclear magnetic resonance

    The nuclear magnetic resonance (NMR) techniques for High Resolution Spectroscopy in Solids are described. Also the construction project of a partially home made spectrometer and its applications in the characterization of solid samples are shown in detail. The high resolution spectrometer used is implemented with the double resonance multiple pulses sequences and magic angle spinning (MAS) and can be used with solid and liquid samples. The maximum spinning frequency for the MAS experiment is in excess of 5 Khz, the double resonance sequences can be performed with any type of nucleus, in the variable temperature operating range with nitrogen gas: -1200 C to +1600 C, and is fully controlled by a Macintosh IIci microcomputer. (author)

  9. Nuclear magnetic resonance studies of cytochromes c in solution

    Cytochromes c are small soluble proteins, which have been extensively studied by nuclear magnetic resonance spectroscopy. The specific NMR features of paramagnetic proteins are discussed for the oxidized form (paramagnetic shift and line broadening). Early NMR studies have focused on the electronic structure of the heme and its direct environment. The conformations of cytochromes c are now investigated by two-dimensional 1H NMR spectroscopy combined with restrained molecular dynamics. 15N and 13C NMR, which greatly benefit from isotopic enrichment, may help in obtaining reliable 1H assignments and thus high quality solution structure. Finally, hydrogen exchange rates provide insight in the rigidity (and stability) of cytochromes c in both redox states at the atomic level. (author). 50 refs., 1 fig., 1 tab

  10. High field nuclear magnetic resonance application to polysaccharide chemistry

    Nuclear magnetic resonance has been applied to polysaccharide chemistry using time averaging technique and high fields (100 and 250 MHz). The three methyl signals of methyl cellulose and cellulose triacetate are separated, and the C-6 substituent has been identified. Biosynthesis of bacterial cellulose has been performed using deuterium labelled D-glucose and Acetobacter xylinum. Per-acetylated derivative of bacterial cellulose has been studied by NMR; this study permitted us to determine the quantity of deuterium on each position of the anhydro-glucose unit in the polymer. NMR has also been used to see the anomeric end chain of cellulose and amylose derivatives and to show the fixation of bromine and t-butyl group on the free anomeric end chain of cellulose triacetate. (author)

  11. State interrogation in nuclear magnetic resonance quantum-information processing

    Reconstruction of a reduced density operator for weakly coupled systems of spins (1/2) from fits to nuclear magnetic resonance spectra is described in detail. Particular emphasis is placed on data treatment procedures that specify fewer than the 3n complete spectra that are implicitly prescribed in published references to state tomography on n-spin systems. It is shown that if the density operator is expanded in the so-called product-operator basis, it is always possible to estimate a desired coefficient in the expansion by measuring a single spectral multiplet. This simple observation can substantially reduce the experimental effort required for either complete density-matrix reconstruction or estimation of subsets of the coefficients in the product-operator expansion. A simple iterative algorithm can be used to produce reduced measurement procedures for experiments involving small numbers of qubits

  12. Nuclear magnetic resonance spectroscopy of single subnanoliter ova

    Grisi, Marco; Guidetti, Roberto; Harris, Nicola; Boero, Giovanni

    2015-01-01

    Nuclear magnetic resonance (NMR) spectroscopy is, in principle, a promising candidate to study the intracellular chemistry of single microscopic living entities. However, due to sensitivity limitations, NMR experiments were reported only on very few and relatively large single cells down to a minimum volume of 10 nl. Here we show NMR spectroscopy of single ova at volume scales (0.1 and 0.5 nl) where life development begins for a broad variety of animals, humans included. We demonstrate that the sensitivity achieved by miniaturized inductive NMR probes (few pmol of 1H nuclei in some hours at 7 T) is sufficient to observe chemical heterogeneities among subnanoliter ova of tardigrades. Such sensitivities should allow to non-invasively monitor variations of concentrated intracellular compounds, such as glutathione, in single mammalian zygotes.

  13. Physical principles of medical applications of nuclear magnetic resonance

    The theoretical principles of zeumatography a new method of visualization of internal organs in the human body are discussed. Zeumatography is a method based on the phenomenon of Nuclear Magnetic Resonance. It opens fairly broad possibilities in diagnosis as well as in theoretical research. Its sensitivity and accuracy will probably be equal to those of X-ray emission and computer tomography. The main advantage of the method which will make its future use particularly widespread is that it eliminates exposure to ionizing radiation, makes possible determination of the character of the tissue based on the content of hydrogen nucleus in a given area and enables differentiation of the tissues with different interatomic bonds, that is those which contain different chemical compounds. (author)

  14. 19F+27Al反应产物的角分布、角分散与耗散机制%Angular Distributions and Angular Dispersions of the Dissipative Products in 19F+27Al Reaction

    董玉川; 李志常; 路秀琴; 赵葵; 周平; 刘建成; Sergey Yu Kun; 王琦; 李松林; 段利敏; 吴和宇; 徐华根; 陈若富; 徐瑚珊; 韩建龙

    2005-01-01

    完成了114MeV 19F+27Al深部非弹性碰撞产物的角分布测量. 分析了反应产物B,C,N,O,F,Ne,Na,Mg和Al的实验室系角分布,讨论了反应形成的中间双核系统随时间演化过程中角分布所表现出的耗散特点. 从实验上提取了反应产物各元素的角分散参数并作了角分散参数的理论拟合,讨论了角分散参数的物理意义以及角分散参数与耗散反应产物的电荷数Z之间的依赖关系.

  15. Rotation and Deformation of the Dinuclear System Formed in Dissipative Reaction of 19F+27Al%19F+27Al耗散反应中双核系统的转动与形变

    韩建龙; 王琦; 董玉川; 李松林; 段利敏; 吴和宇; 徐华根; 陈若富; 徐瑚珊; 白真; 李志常; 路秀琴; 赵葵; 周平; 刘建成; SergeyYuKun

    2006-01-01

    测量了19F+27Al耗散反应产物B,C,N,O,F和Ne的激发函数,入射束流的能量从110.25MeV到118.75MeV,能量步长为250keV.从产物的能量自关联函数中提取了反应中所形成的中间双核系统的转动惯量,与相粘模型计算的刚体转动惯量相比较,结果表明形成的双核系统有大的形变.

  16. 19F+27Al耗散反应产物激发函数的长程关联%Long-range Correlation of Excitation Functions in Dissipative Heavy Ion Collision of 19F+27Al

    韩建龙; 王琦; 白真; 董玉川; 李松林; 段利敏; 徐瑚珊; 徐华根; 陈若富; 吴和宇; 李志常; 路秀琴; 赵葵; 周平; 刘建成; 许国基; Sergey Yu Kun

    2008-01-01

    在中国原子能科学研究院的HI- 13串列静电加速器上完成了19F+27Al耗散反应产物的激发函数测量.束流19F的入射能量从110.25 MeV到118.75 MeV, 步长250 keV, 测量了实验室系+57°, +31°, -15°和-29°出射的类弹产物B, C, N, O, F和Ne的激发函数.观测到激发函数具有耗散反应的特征涨落结构, 分析了激发函数之间的长程角度关联以及强烈的电荷数关联.

  17. Method to calculate reservoir permeability using nuclear magnetic resonance logging and capillary pressure data

    In view of the problems of SDR and Tim-Coates models in calculating permeability using nuclear magnetic resonance logging data, based on the fact that nuclear magnetic resonance T2 distribution and capillary pressure curves reflect the reservoir pore structure, a method was presented to calculate reservoir permeability using nuclear magnetic resonance logging and capillary pressure data. The correlation between Swanson parameter and permeability was established by comparing 31 core samples which were measured by mercury penetration and nuclear magnetic resonance logging. Considering the problem that capillary pressure data are limited by their quantity, the good correlativity between T2 geometric mean value of lateral relaxation time of nuclear magnetic resonance and Swanson parameter can be used to determine the Swanson parameter and to calculate reservoir permeability consecutively. The processing of the data in well A yields a permeability closer to the result of core analysis, and this indicates the accuracy of the method. (authors)

  18. Dual tuned 19F/1H multichannel coil for magnetic resonance imaging of human knee at 7.0 Tesla

    Ji, Yiyi

    2013-01-01

    Anti-inflamatórios não esteróides (NSAIDs) tópicos foram introduzidos no tratamento da artrite reumatóide, de forma a evitar os efeitos secundários da administração oral destes medicamentos. Embora seja conhecido que os NSAIDs de aplicação tópica são capazes de penetrar na pele humana, não existem estudos com humanos in vivo que mostrem a eficiência de penetração e o percurso do medicamento até ao local de inflamação. O in vivo tracking do medicamento deve ser efectuado por um método eficaz ...

  19. Nuclear magnetic resonance studies of materials for spintronic applications

    Since its discovery in liquids and also in solid matter in 1946, nuclear magnetic resonance (NMR) has been widely established as a standard tool for structural analysis of a wide range of materials. This review outlines recent NMR studies on materials considered to be useful in spintronic applications. Spintronics is a new research field which combines the use of both the charge and the spin of an electron as information carriers, which promises distinct advantages over conventional electronics which makes use only of the charge of electrons. A successful application of materials in spintronic devices requires a detailed knowledge of the interplay between the structure and the magnetic and electronic properties on an atomic scale. NMR probes the local environments of the active nuclei. This local character of NMR arises from local contributions to the hyperfine field, namely, the transferred field which depends on the nearest neighbour atoms and their magnetic moments. This enables NMR to study the structural properties of bulk samples as well as of thin films of spin polarized materials. Moreover, NMR spectroscopy also provides an indirect tool to measure the density of states of spin polarized materials via a measurement of the temperature dependence of the spin-lattice relaxation time. This review starts with an introduction into the basic concepts of NMR followed by a description of the important aspects of a pulsed NMR experiment. Thereafter, information obtained by an NMR experiment is addressed. In the subsequent main part, selected recent NMR studies (published roughly after the year 2000) of materials for spintronic applications are presented including NMR studies of, for example, Co thin films, Heusler compounds, double perovskites and pyrites. (topical review)

  20. Theoretical study on nuclear structure by the multiple Coulomb scattering and magnetic scattering of relativistic electrons

    Liu, Jian; Zhang, Xin; Xu, Chang; Ren, Zhongzhou

    2016-04-01

    Electron scattering is an effective method to study the nuclear structure. For the odd-A nuclei with proton holes in the outmost orbits, we investigate the contributions of proton holes to the nuclear quadrupole moments Q and magnetic moments μ by the multiple Coulomb scattering and magnetic scattering. The deformed nuclear charge densities are constructed by the relativistic mean-field (RMF) models. Comparing the theoretical Coulomb and magnetic form factors with the experimental data, the nuclear quadrupole moments Q and nuclear magnetic moments μ are investigated. From the electron scattering, the wave functions of the proton holes of odd-A nuclei can be tested, which can also reflect the validity of the nuclear structure model.

  1. Membrane-bound structure and alignment of the antimicrobial {beta}-sheet peptide gramicidin S derived from angular and distance constraints by solid state 19F-NMR

    Salgado, Jesus; Grage, Stephan L. [University of Jena, Department of Molecular Biology (Germany); Kondejewski, Leslie H. [University of Alberta, Protein Engineering Network of Centres of Excellence (Canada); Hodges, Robert S.; McElhaney, Ronald N. [University of Alberta, Department of Biochemistry (Canada); Ulrich, Anne S. [University of Jena, Department of Molecular Biology (Germany)

    2001-11-15

    The antimicrobial properties of the cyclic {beta}-sheet peptide gramicidin S are attributed to its destabilizing effect on lipid membranes. Here we present the membrane-bound structure and alignment of a derivative of this peptide, based on angular and distance constraints. Solid-state {sup 19}F-NMR was used to study a {sup 19}F-labelled gramicidin S analogue in dimyristoylphosphatidylcholine bilayers at a lipid:peptide ratio of 80:1 and above. Two equivalent leucine side chains were replaced by the non-natural amino acid 4F-phenylglycine, which serves as a highly sensitive reporter on the structure and dynamics of the peptide backbone. Using a modified CPMG multipulse sequence, the distance between the two {sup 19}F-labels was measured from their homonuclear dipolar coupling as 6 A, in good agreement with the known backbone structure of natural gramicidin S in solution. By analyzing the anisotropic chemical shift of the {sup 19}F-labels in macroscopically oriented membrane samples, we determined the alignment of the peptide in the bilayer and described its temperature-dependent mobility. In the gel phase, the {sup 19}F-labelled gramicidin S is aligned symmetrically with respect to the membrane normal, i.e., with its cyclic {beta}-sheet backbone lying flat in the plane of the bilayer, which is fully consistent with its amphiphilic character. Upon raising the temperature to the liquid crystalline state, a considerable narrowing of the {sup 19}F-NMR chemical shift dispersion is observed, which is attributed the onset of global rotation of the peptide and further wobbling motions. This study demonstrates the potential of the {sup 19}F nucleus to describe suitably labelled polypeptides in membranes, requiring only little material and short NMR acquisition times.

  2. Magnetic Moments of Octet Baryons in Hot and Dense Nuclear Matter

    Singh, Harpreet; Dahiya, Harleen

    2016-01-01

    We have calculated the in-medium magnetic moments of octet baryons in the presence of hot and dense symmetric nuclear matter. Effective magnetic moments of baryons have been derived from medium modified quark masses within chiral SU(3) quark mean field model.Further, for better insight of medium modification of baryonic magnetic moments, we have considered the explicit contributions from the valence as well as sea quark effects. These effects have been successful in giving the description of baryonic magnetic moments in vacuum. The magnetic moments of baryons are found to vary significantly as a function of density of nuclear medium.

  3. Solid state 19F NMR determination of new structure formation in FEP following radiolysis at 300 and 363 K

    The radiation chemistry of FEP copolymer with a mole fraction TFE of 0.90 has been studied using 60Co γ-radiation at temperatures of 300 and 363 K. New structure formation in the copolymers was analysed by solid state 19F NMR. New chain scission products were the principal new structures found. The G-value for the formation of new -CF3 groups was 2.2 and 2.1 for the radiolysis of FEP at 300 and 363 K, respectively, and the G-value for the loss of original -CF3 groups was G(-CF3)=1.0 and 0.9 at these two temperatures, respectively. There was a net loss of -CF- groups on irradiation, with G(-CF) of 1.3 and 0.9 at 300 and 363 K, respectively. (author)

  4. Fission excitation function for 19F + 194,196,198Pt at near and above barrier energies

    Singh Varinderjit

    2015-01-01

    Full Text Available Fission excitation functions for 19F + 194,196,198Pt reactions populating 213,215,217Fr compound nuclei are reported. Out of these three compound nuclei, 213Fr is a shell closed (N=126 compound nucleus and the other two are away from the shell closure. From a comparison of the experimental fission cross-sections with the statistical model predictions, it is observed that the fission cross-sections are underestimated by the statistical model predictions using shell corrected finite range rotating liquid drop model (FRLDM fission barriers. Further the FRLDM fission barriers are reduced to fit the fission cross-sections over the entire measured energy range.

  5. (19)F NMR study of ligand dynamics in carboxylate-bridged diiron(II) complexes supported by a macrocyclic ligand.

    Minier, Mikael A; Lippard, Stephen J

    2015-11-01

    A series of asymmetrically carboxylate-bridged diiron(ii) complexes featuring fluorine atoms as NMR spectroscopic probes, [Fe2(PIM)(Ar(4F-Ph)CO2)2] (10), [Fe2(F2PIM)(Ar(Tol)CO2)2] (11), and [Fe2(F2PIM)(Ar(4F-Ph)CO2)2] (12), were prepared and characterized by X-ray crystallography, Mössbauer spectroscopy, and VT (19)F NMR spectroscopy. These complexes are part of a rare family of syn N-donor diiron(ii) compounds, [Fe2(X2PIM)(RCO2)2], that are structurally very similar to the active site of the hydroxylase enzyme component of reduced methane monooxygenase (MMOHred). Solution characterization of these complexes demonstrates that they undergo intramolecular carboxylate rearrangements, or carboxylate shifts, a dynamic feature relevant to the reactivity of the diiron centers in bacterial multicomponent monooxygenases. PMID:26418547

  6. 19F NMR Study of Ligand Dynamics in Carboxylate-Bridged Diiron(II) Complexes Supported by a Macrocyclic Ligand

    Minier, Mikael A.; Lippard, Stephen J.

    2015-01-01

    A series of asymmetrically carboxylate-bridged diiron(II) complexes featuring fluorine atoms as NMR spectroscopic probes, [Fe2(PIM)(Ar4F-PhCO2)2] (10), [Fe2(F2PIM)(ArTolCO2)2] (11), and [Fe2(F2PIM)(Ar4F-PhCO2)2] (12), were prepared and characterized by X-ray crystallography, Mössbauer spectroscopy, and VT 19F NMR spectroscopy. These complexes are part of a rare family of syn-N diiron(II) complexes, [Fe2(X2PIM)(RCO2)2], that are structurally very similar to the active site of the hydroxylase enzyme component of reduced methane monooxygenase (MMOHred). Solution characterization of these complexes demonstrates that they undergo intramolecular carboxylate rearrangements, or carboxylate shifts, a dynamic feature relevant to the reactivity of the diiron centers in bacterial multicomponent monooxygenases. PMID:26418547

  7. Detection of organic sulfur by [sup 15]N and [sup 19]F NMR via formation of iminosulfuranes

    Franz, J.A.; Linehan, J.C.; Lamb, C.N.

    1992-08-01

    We have synthesized new iminosulfuranes from a variety of diaryl-and dialkyl sulfides and dibenzothiophene. The pattern of [sup 15]N chemical shifts indicates that functional groups attached to sulfur are not simply resolved into aryl and alkyl groups. Thus, resolution of sulfur functional groups using [sup 15]N NMR via iminosulfurane does not appear practicable. However, iminosulfurane formation, together with the N-haloamide reaction and the Pummerer rearrangement, provides pathways for chemical discrimination of different sulfur substituents using unique [sup 15]N- or, [sup 19]F-labelled fragments for different categories of sulfur functional groups. In efforts currently underway, we are applying these reactions to methylated extracts and conversion products of the high-organic-sulfur containing Yugoslavian Rasa and Spanish Mequinenza lignites. 1 tab, 14 refs.

  8. Detection of organic sulfur by {sup 15}N and {sup 19}F NMR via formation of iminosulfuranes

    Franz, J.A.; Linehan, J.C.; Lamb, C.N.

    1992-08-01

    We have synthesized new iminosulfuranes from a variety of diaryl-and dialkyl sulfides and dibenzothiophene. The pattern of {sup 15}N chemical shifts indicates that functional groups attached to sulfur are not simply resolved into aryl and alkyl groups. Thus, resolution of sulfur functional groups using {sup 15}N NMR via iminosulfurane does not appear practicable. However, iminosulfurane formation, together with the N-haloamide reaction and the Pummerer rearrangement, provides pathways for chemical discrimination of different sulfur substituents using unique {sup 15}N- or, {sup 19}F-labelled fragments for different categories of sulfur functional groups. In efforts currently underway, we are applying these reactions to methylated extracts and conversion products of the high-organic-sulfur containing Yugoslavian Rasa and Spanish Mequinenza lignites. 1 tab, 14 refs.

  9. (19)F-heptuloses as tools for the non-invasive imaging of GLUT2-expressing cells

    Malaisse, Willy J; Zhang, Ying; Louchami, Karim; Sharma, Sonu; Dresselaers, Tom; Himmelreich, Uwe; Novotny, Guy Wayne; Mandrup-Poulsen, Thomas; Waschke, Daniel; Leshch, Yevgeniy; Thimm, Julian; Thiem, Joachim; Sener, Abdullah

    2012-01-01

    Suitable analogs of d-mannoheptulose are currently considered as possible tools for the non-invasive imaging of pancreatic islet insulin-producing cells. Here, we examined whether (19)F-heptuloses could be used for non-invasive imaging of GLUT2-expressing cells. After 20 min incubation, the uptake......-d-glucoheptulose inhibited insulin release evoked in rat isolated pancreatic islets by 10mM d-glucose to the same extent as that observed with an equivalent concentration (10mM) of d-mannoheptulose, while 3-deoxy-3-fluoro-d-glucoheptulose and 1,3-dideoxy-1,3-difluoro-d-glucoheptulose (also 10mM) were less potent than d...

  10. Study of viscosity on the fission dynamics of the excited nuclei 228U produced in 19F + 209Bi reactions

    A two-dimensional (2D) dynamical model based on Langevin equations was applied to study the fission dynamics of the compound nuclei 228U produced in 19F + 209Bi reactions at intermediate excitation energies. The distance between the centers of masses of the future fission fragments was used as the first dimension and the projection of the total spin of the compound nucleus onto the symmetry axis, K, was considered as the second dimension in Langevin dynamical calculations. The magnitude of post-saddle friction strength was inferred by fitting measured data on the average pre-scission neutron multiplicity for 228U. It was shown that the results of calculations are in good agreement with the experimental data by using values of the post-saddle friction equal to 6–8 × 1021s-1. (author)

  11. A Selective Neutron Detector in the keV Region Utilizing the 19F (n, γ 20F Reaction

    The Research Swimming-Pool Reactor R2-0 at Studsvik has been used to investigate some resonance and threshold reactions for neutron flux measurements. This reactor, equipped with MTR type fuel elements, has a maximum neutron flux of about 1012 n/cm2/sec, giving a thermal output of 100 kW. A pneumatic rabbit was constructed to bring the samples in activation position, in which there was 15 cm H2O and 1.2 cm Al between reactor and foil. A covering, containing 1.22 g 10B/cm2 was pushed over the cadmium-covered Al tube of the rabbit. The activation of the foil was measured with a Nal(Tl)-scintillation spectrometer. From the gamma ray spectrum, recorded on a 256 channel pulse height analyzer, the epithermal neutron flux per unit of In E interval was calculated. The activation cross section for 19F (n, γ) 20F in the 10B-covering was computed to be 16 mb, and about 60 % of the induced activity is due to neutrons in the energy range of 20-70 keV. The experimental results were compared with those obtained from the more known resonance reactions 63Cu (n, γ) 64Cu and 27Al (n, γ) 28Al. The epithermal neutron flux experiments are in good agreement with each other. The fast neutron flux measurements were carried out with the following threshold detectors: 197Au (n, n') 197mAu, 58Ni (n, p) 58Co, 27Al (n, p) 27Mg and 19F (n, p) 19O. From these experiments the ratio of φepi/φfiss =0.045 ± 0.010 is determined at the activation position. The half-life of 197Au m was determined to 7.35 ± 0.25 sec

  12. Incomplete fusion studies in the 19F+159Tb system at low energies and its correlation with various systematics

    Shuaib, Mohd.; Sharma, Vijay R.; Yadav, Abhishek; Singh, Pushpendra P.; Sharma, Manoj Kumar; Singh, Devendra P.; Kumar, R.; Singh, R. P.; Muralithar, S.; Singh, B. P.; Prasad, R.

    2016-07-01

    The excitation functions of reaction residues populated via the complete fusion and incomplete fusion process in the interaction of the 19F+159Tb system have been measured at energies ≈4 -6 MeV/nucleon, using off-line γ -ray spectroscopy. The analysis of data was done within the framework of statistical model code pace4 (a compound nucleus model). A significant fraction of incomplete fusion was observed in the production of reaction residues involving α particle(s) in the exit channels, even at energies as low as near the Coulomb barrier. The incomplete fusion strength function was deduced from the experimental excitation functions and the dependence of this strength function on various entrance channel parameters was studied. The present results show a strong dependence on the projectile α -Q value that agrees well with the existing data. To probe the dependence of incomplete fusion on entrance channel mass asymmetry, the present work was compared with the results obtained in the interaction of 12C, 16O, and 19F with nearby targets available in the literature. It was observed that the mass asymmetry linearly increases for each projectile separately and turns out to be a projectile-dependent mass-asymmetry systematics. The deduced incomplete fusion strength functions in the present work are also plotted as a function of ZPZT (Coulomb effect) and compared with the existing literature. A strong dependence of the Coulomb effect on the incomplete fusion fraction was observed. It was found that the fraction of incomplete fusion linearly increases with ZPZT and was found to be more for larger ZPZT values indicating significantly important linear systematics.

  13. Nuclear orientation experiments on the magnetic moments of europium and gadolinium nuclei

    In this thesis, experimental results on the ground state nuclear magnetic moments of europium and gadolinium isotopes are presented. The nuclear orientation experiments were performed on europium and gadolinium nuclei embedded in several host lattices. Attention is paid to the hyperfine interactions of the ions. Nuclear moments are discussed in the context of nuclear shell model. The theoretical framework is described for nuclear structure and low temperature nuclear orientation. Furthermore, the experimental techniques, the technical arrangement of the orientation apparatus, the methods for radiative detection and the use of nuclear orientation thermometry are described. (Auth.)

  14. Assessment of the biodistribution and metabolism of 5-fluorouracil as monitored by 18F PET and 19F MRI: A comparative animal study

    The effective clinical use of the anticancer drug 5-fluorouracil (5-FU) requires the non-invasive assessment of its transport and metabolism, particularly in the tumor and the liver, where the drug is catabolized to α-fluoro-β-alanine (FBAL). In this study, the potentials and limitations of dynamic 18F PET and metabolic 19F MRI examinations for noninvasive 5-FU monitoring were investigated in ACI and Buffalo rats with transplanted MH3924A and TC5123 Morris hepatomas, respectively. Selective 5-[19F]FU and [19F]FBAL MR images were acquired 5 and 70 min after 5-FU injection using a CHESS MRI sequence. After administration of 5-[18F]FU, the kinetics of the regional 5-[18F]FU uptake were measured by dynamic PET scanning over 120 min. To allow a comparison between PET and MRI data, standardized uptake values (SUV) were computed at the same points in time. The TC5123 hepatoma showed a significantly (p 19F]FU and [19F]FBAL MR signal values in the tumor of both models were observed. The MR images, however, yielded the additional information that 5-FU is converted to FBAL only in the liver and not in the hepatomas

  15. Novel nuclear magnetic resonance techniques for studying biological molecules

    Over the fifty-five year history of Nuclear Magnetic Resonance (NMR), considerable progress has been made in the development of techniques for studying the structure, function, and dynamics of biological molecules. The majority of this research has involved the development of multi-dimensional NMR experiments for studying molecules in solution, although in recent years a number of groups have begun to explore NMR methods for studying biological systems in the solid-state. Despite this new effort, a need still exists for the development of techniques that improve sensitivity, maximize information, and take advantage of all the NMR interactions available in biological molecules. In this dissertation, a variety of novel NMR techniques for studying biomolecules are discussed. A method for determining backbone (φ/ψ) dihedral angles by comparing experimentally determined 13Ca, chemical-shift anisotropies with theoretical calculations is presented, along with a brief description of the theory behind chemical-shift computation in proteins and peptides. The utility of the Spin-Polarization Induced Nuclear Overhauser Effect (SPINOE) to selectively enhance NMR signals in solution is examined in a variety of systems, as are methods for extracting structural information from cross-relaxation rates that can be measured in SPINOE experiments. Techniques for the production of supercritical and liquid laser-polarized xenon are discussed, as well as the prospects for using optically pumped xenon as a polarizing solvent. In addition, a detailed study of the structure of PrP 89-143 is presented. PrP 89-143 is a 54 residue fragment of the prion proteins which, upon mutation and aggregation, can induce prion diseases in transgenic mice. Whereas the structure of the wild-type PrP 89-143 is a generally unstructured mixture of α-helical and β-sheet conformers in the solid state, the aggregates formed from the PrP 89-143 mutants appear to be mostly β-sheet.

  16. Novel nuclear magnetic resonance techniques for studying biological molecules

    Laws, David D.

    2000-06-01

    Over the fifty-five year history of Nuclear Magnetic Resonance (NMR), considerable progress has been made in the development of techniques for studying the structure, function, and dynamics of biological molecules. The majority of this research has involved the development of multi-dimensional NMR experiments for studying molecules in solution, although in recent years a number of groups have begun to explore NMR methods for studying biological systems in the solid-state. Despite this new effort, a need still exists for the development of techniques that improve sensitivity, maximize information, and take advantage of all the NMR interactions available in biological molecules. In this dissertation, a variety of novel NMR techniques for studying biomolecules are discussed. A method for determining backbone ({phi}/{psi}) dihedral angles by comparing experimentally determined {sup 13}C{sub a}, chemical-shift anisotropies with theoretical calculations is presented, along with a brief description of the theory behind chemical-shift computation in proteins and peptides. The utility of the Spin-Polarization Induced Nuclear Overhauser Effect (SPINOE) to selectively enhance NMR signals in solution is examined in a variety of systems, as are methods for extracting structural information from cross-relaxation rates that can be measured in SPINOE experiments. Techniques for the production of supercritical and liquid laser-polarized xenon are discussed, as well as the prospects for using optically pumped xenon as a polarizing solvent. In addition, a detailed study of the structure of PrP 89-143 is presented. PrP 89-143 is a 54 residue fragment of the prion proteins which, upon mutation and aggregation, can induce prion diseases in transgenic mice. Whereas the structure of the wild-type PrP 89-143 is a generally unstructured mixture of {alpha}-helical and {beta}-sheet conformers in the solid state, the aggregates formed from the PrP 89-143 mutants appear to be mostly {beta}-sheet.

  17. Nuclear magnetic resonance experiments with dc SQUID amplifiers

    The development and fabrication of dc SQUIDs (Superconducting QUantum Interference Devices) with Nb/Al2O3/Nb Josephson junctions is described. A theory of the dc SQUID as a radio-frequency amplifier is presented, with an optimization strategy that accounts for the loading and noise contributions of the postamplifier and maximizes the signal-to-noise ratio of the total system. The high sensitivity of the dc SQUID is extended to high field NMR. A dc SQUID is used as a tuned radio-frequency amplifier to detect pulsed nuclear magnetic resonance at 32 MHz from a metal film in a 3.5 Tesla static field. A total system noise temperature of 11 K has been achieved, at a bath temperature of 4.2 K. The minimum number of nuclear Bohr magnetons observable from a free precession signal after a single pulse is about 2 x 1017 in a bandwidth of 25 kHz. In a separate experiment, a dc SQUID is used as a rf amplifier in a NQR experiment to observe a new resonance response mechanism. The net electric polarization of a NaClO3 crystal due to the precessing electric quadrupole moments of the Cl nuclei is detected at 30 MHz. The sensitivity of NMR and NQR spectrometers using dc SQUID amplifiers is compared to the sensitivity of spectrometers using conventional rf amplifiers. A SQUID-based spectrometer has a voltage sensitivity which is comparable to the best achieved by a FET-based spectrometer, at these temperatures and operating frequencies

  18. A nuclear magnetic resonance study of water in aggrecan solutions

    Foster, Richard J.; Damion, Robin A.; Baboolal, Thomas G.; Smye, Stephen W.; Ries, Michael E.

    2016-01-01

    Aggrecan, a highly charged macromolecule found in articular cartilage, was investigated in aqueous salt solutions with proton nuclear magnetic resonance. The longitudinal and transverse relaxation rates were determined at two different field strengths, 9.4 T and 0.5 T, for a range of temperatures and aggrecan concentrations. The diffusion coefficients of the water molecules were also measured as a function of temperature and aggrecan concentration, using a pulsed field gradient technique at 9.4 T. Assuming an Arrhenius relationship, the activation energies for the various relaxation processes and the translational motion of the water molecules were determined from temperature dependencies as a function of aggrecan concentration in the range 0–5.3% w/w. The longitudinal relaxation rate and inverse diffusion coefficient were approximately equally dependent on concentration and only increased by upto 20% from that of the salt solution. The transverse relaxation rate at high field demonstrated greatest concentration dependence, changing by an order of magnitude across the concentration range examined. We attribute this primarily to chemical exchange. Activation energies appeared to be approximately independent of aggrecan concentration, except for that of the low-field transverse relaxation rate, which decreased with concentration. PMID:27069663

  19. Work in progress: nuclear magnetic resonance imaging of the gallbladder

    A preliminary study of the relation between food intake and intensity of gallbladder bile on nuclear magnetic resonance (NMR) images was made. Twelve subjects (seven volunteers, five patients) were imaged following a minimum of 14 hours of fasting. Six of seven volunteers were reimaged one hour after stimulation by either a fatty meal or an alcoholic beverage. An additional seven patients were imaged two hours after a hospital breakfast. It was found that concentrated bile emits a high-intensity spin echo signal (SE), while hepatic bile in the gallbladder produces a low-intensity SE signal. Following ingestion of cholecystogogue, dilute hepatic bile settles on top of the concentrated bile, each emitting SE signals of different intensity. The average T1 value of concentrated bile was 594 msec, while the T1 vaue of dilute hepatic bile was 2,646 msec. The average T2 values were 104 msec for concentrated bile and 126 msec for dilute bile. The most likely cause for the different SE intensities of bile is the higher water content, and therefore longer T1 or T2 relaxation times, of hepatic bile. It is suggested that NMR imaging has the ability to provide physiological information about the gallbladder and that it may prove to be a simple and safe clinical test of gallbladder function

  20. Discrete decoding based ultrafast multidimensional nuclear magnetic resonance spectroscopy

    The three-dimensional (3D) nuclear magnetic resonance (NMR) spectroscopy constitutes an important and powerful tool in analyzing chemical and biological systems. However, the abundant 3D information arrives at the expense of long acquisition times lasting hours or even days. Therefore, there has been a continuous interest in developing techniques to accelerate recordings of 3D NMR spectra, among which the ultrafast spatiotemporal encoding technique supplies impressive acquisition speed by compressing a multidimensional spectrum in a single scan. However, it tends to suffer from tradeoffs among spectral widths in different dimensions, which deteriorates in cases of NMR spectroscopy with more dimensions. In this study, the discrete decoding is proposed to liberate the ultrafast technique from tradeoffs among spectral widths in different dimensions by focusing decoding on signal-bearing sites. For verifying its feasibility and effectiveness, we utilized the method to generate two different types of 3D spectra. The proposed method is also applicable to cases with more than three dimensions, which, based on the experimental results, may widen applications of the ultrafast technique

  1. Measurement of total lung water from nuclear magnetic resonance images

    Nuclear magnetic resonance (NMR) spectroscopy was used to show that the water content of lung tissue could be predicted accurately from the intensity of signal resulting from a 900 saturation recovery sequence. The water contained in an image section may, therefore, be calculated by reference to a 100% water standard. Lung water was obtained by imaging the lung in continuous sections and summing the water contents of the component sections. The method performed well when applied to a sponge phantom, but underestimated by up to 30% in excised sheep lung. The total (vascular and extravascular) pulmonary water measured by NMR in six healthy volunteers was 292 g (SD 58 g) or 4.6 g/kg body weight, less than predicted by some other indirect methods and post-mortem values. A briefer examination comprising two axial sections at standardised levels was also devised. In 15 healthy volunteers the mean water content of a 1.6 cm-thick axial section through the right lung was 17.8 g at the sternal angle, and 23.3 g 5 cm caudally. In the left lung, the values were 16.4 g and 16.3 g, respectively. (author)

  2. Discrete decoding based ultrafast multidimensional nuclear magnetic resonance spectroscopy

    Wei, Zhiliang; Lin, Liangjie; Ye, Qimiao; Li, Jing; Cai, Shuhui; Chen, Zhong

    2015-07-01

    The three-dimensional (3D) nuclear magnetic resonance (NMR) spectroscopy constitutes an important and powerful tool in analyzing chemical and biological systems. However, the abundant 3D information arrives at the expense of long acquisition times lasting hours or even days. Therefore, there has been a continuous interest in developing techniques to accelerate recordings of 3D NMR spectra, among which the ultrafast spatiotemporal encoding technique supplies impressive acquisition speed by compressing a multidimensional spectrum in a single scan. However, it tends to suffer from tradeoffs among spectral widths in different dimensions, which deteriorates in cases of NMR spectroscopy with more dimensions. In this study, the discrete decoding is proposed to liberate the ultrafast technique from tradeoffs among spectral widths in different dimensions by focusing decoding on signal-bearing sites. For verifying its feasibility and effectiveness, we utilized the method to generate two different types of 3D spectra. The proposed method is also applicable to cases with more than three dimensions, which, based on the experimental results, may widen applications of the ultrafast technique.

  3. Multinuclear nuclear magnetic resonance spectroscopic study of cartilage proteoglycans

    Hyaline cartilage is a composite material whose major function is to withstand compression while retaining flexibility. Its mechanical properties are affected by tissue hydration and ionic composition. Models of the mechanical behavior of cartilage have incorporated certain assumptions about the interactions of the major components of cartilage: collagen, proteoglycans, water, and cations. To determine the validity of these assumption, the authors have used nuclear magnetic resonance spectroscopy (NMR). Two approaches have been used: (a) natural abundance carbon-13 NMR; and (b) NMR of sodium-23, potassium-39, magnesium-25, and calcium-43. Evidence from studies in intact tissues are reinforced by extensive measurements on solutions of proteoglycans and other relevant macromolecules. Based on the measurements of NMR relaxation rates and lineshapes reported here, it is concluded that neither sodium nor potassium interact strongly with bovine nasal proteoglycan aggregates or their substituent glycosaminoglycan chains in solution. Proteoglycans do bind magnesium and calcium. Therefore there is a qualitative difference between monovalent and divalent cations, which is not taken into account by polyelectrolyte models or models for the ionic dependence of mechanical properties. Cation binding to heparin, which has a higher charge density than cartilage proteoglycans, was also studied. The results presented here establish that heparin binds sodium, magnesium, and calcium

  4. Nuclear magnetic resonance metabonomics: methods for drug discovery and development.

    Ott, Karl-Heinz; Aranibar, Nelly

    2007-01-01

    Nuclear magnetic resonance (NMR)-based metabonomics is gaining popularity in drug discovery and development and in academia in a variety of settings, ranging from toxicology, preclinical, and clinical approaches to nutrition research, studies on microorganisms, and research on plants. This chapter focuses on the basic steps in a metabonomics study and emphasizes experience and lessons learned in our lab where we focused on metabonomic analyses of plant extracts, cell lines, and a variety of animal tissues and biofluids. We emphasize that a comprehensive and suitable study design is pivotal for a correct biological interpretation of the results, as well as highly controlled experimental conditions. Sample preparation and NMR protocols are detailed for a wide range of sample types. We discuss alternative data processing strategies and considerations for a general data analysis approach, paying particular attention to the statistical interpretation and validation of the results while also highlighting approaches to avoid possible pitfalls resulting from systematic and random errors. A tutorial written for the R statistical package and other small utilities are available from the authors upon request. PMID:17035690

  5. Membrane proteins structure and dynamics by nuclear magnetic resonance.

    Maltsev, Sergey; Lorigan, Gary A

    2011-10-01

    Membrane proteins represent a challenging class of biological systems to study. They are extremely difficult to crystallize and in most cases they retain their structure and functions only in membrane environments. Therefore, commonly used diffraction methods fail to give detailed molecular structure and other approaches have to be utilized to obtain biologically relevant information. Nuclear magnetic resonance (NMR) spectroscopy, however, can provide powerful structural and dynamical constraints on these complicated systems. Solution- and solid-state NMR are powerful methods for investigating membrane proteins studies. In this work, we briefly review both solution and solid-state NMR techniques for membrane protein studies and illustrate the applications of these methods to elucidate proteins structure, conformation, topology, dynamics, and function. Recent advances in electronics, biological sample preparation, and spectral processing provided opportunities for complex biological systems, such as membrane proteins inside lipid vesicles, to be studied faster and with outstanding quality. New analysis methods therefore have emerged, that benefit from the combination of sample preparation and corresponding specific high-end NMR techniques, which give access to more structural and dynamic information. PMID:23733702

  6. Cardiac energy metabolism probed with nuclear magnetic resonance. Chapter 12

    Nuclear magnetic resonance (NMR) spectroscopy possesses great potential for studying myocardial energy metabolism. To ensure that the observed NMR signal predominantly originates from the heart, localization is required, which can be achieved by excision or exposure of the heart, or by means of sophisticated NMR localization techniques. A number of different atomic nuclei have been employed. H-1 NMR has been mainly used to follow lactate accumulation is ischemic or anoxic hearts. C-13 NMR has been applied to study the fate of different substrates in the citric acid cycle and amino acid pools, and the role of glycogen metabolism in ischemia or anoxia. F-19, Na-23 and K-39 have been employed to investigate the consequences of altered energy metabolism for myocardial intracellular concentrations of Ca2+, Na+ and K+. The most abundantly used nucleus for studying myocardial energy metabolism is P-31. Numerous contributions have been made to the investigation of ischemia and reperfusion, protection of the heart against the consequences of ischemia and reperfusion, contractile failure, variation of high-energy phosphate levels over the cardiac cycle, regulation of oxidative phosphorylation and intracellular enzyme kinetics of both isolated perfused hearts and hearts in situ. Even human myocardial metabolism can be assessed by P-31 NMR, which is on the verge of becoming a clinical tool for investigating heart disease. 106 refs.; 3 figs.; 1 table

  7. Distinguishing Carbonate Reservoir Pore Facies with Nuclear Magnetic Resonance Measurements

    Characterization of carbonate rocks may involve identifying the important pore types which are present. In the past, this task has required detailed petrographic analysis of many core samples. Here, we describe a method which uses nuclear magnetic resonance (NMR) measurements to reduce the amount of petrographic analysis needed for porosity typing of carbonate reservoir rocks.For a rock sample which has been measured with NMR, our method decomposes the log(T2) spectrum into at most three Gaussian-shaped components and gives a set of nine parameters. Two characteristic quantities having geological significance are extracted from the nine parameters. Values of the two quantities are compared with a reference set, established from samples having both NMR and petrographic evaluations of porosity types. We use a Bayesian approach to the classification of the dominant porosity type.Tests of our method on 103 samples show a correct prediction in 60 to 90 percent of the samples. The lower success rate was obtained for samples with five porosity types from three fields; the higher success rate obtained with samples with three porosity types from one well. The use of geologically significant quantities extracted from the decomposition gives comparable success rate to those obtained using a standard, non-geological approach such as canonical variates

  8. Synthesis and physical studies of thiophospholipids using nuclear magnetic resonance

    1,2-Dipalmitoyl-sn-glycero-3-thiophosphocholine, DPPsC, and 1,2-dipalmitoyl-sn-glycero-3-thiophospho-L-serine, DPPsS, were synthesized and used to probe bilayer structural properties and enzymatic stereoselectivity. Using resolved diastereomers of DPPsC, the effect of a chiral phosphorus center on the thermotropic properties of lipid dispersions was probed. 31P and 2H nuclear magnetic resonance, NMR, were utilized to confirm the thermotropic phase assignments for DPPsC diastereomers observed by differential scanning calorimetry. 31P NMR of the thiophosphate analogs revealed a more rigid subgel and Lβ' gel phase than DPPC, in regard to the phosphate rotational motion. In the Pβ' gel phase, the degree of motion of Sp and (Rp+Sp) was similar to DPPC. The tiophosphate analogs in the liquid crystalline phase experienced a freer rotational environment compared to DPPC. 2H NMR was performed on DPPsC diastereomers deuterated at the three choline carbons, α, β, γ. The liquid crystalline phase was used to detect differences between the diastereomers along the choline moiety. The diastereomeric mixture of DPPsS was used as a substrate for two stereoselective enzymes, phospholipases A2 and C. Phospholipase A2 hydrolyzed (Rp)-DPPsS, while no apparent reaction was detected for the hydrolysis of (Sp)-DPPsS with phospholipase C

  9. Determination of reservoir effective porosity using nuclear magnetic logging data

    In connection with the development of nuclear magnetic logging (NML) the possibility has occurred to determine the effective porosity coefficient for rocks directly under the conditions of their occurrence. The initial amplitude of a signal of free precession of NML is proportional to the quantity of free fluid in the rock volume, which is determined by the index of free fluid (IFF). On the basis of the laboratory studies it is shown that the relation between IFF and free water content is always linear and doesn't depend on lithological characteristics of rocks, porous dimensions and distribution. Using this relation it's possible to estimate bound water content. While filling the reservoir with weakly mineralized water the IFF value coincides numerically with the effective porosity coefficient. Otherwise the content of hydrogen nuclei in a volume unit is much less; while calculating the effective porosity coefficient this fact is recorded by the index of the amplitude decrease which depends on temperature and increases with its growth (for oils). In strata containing intercalations of reservoirs and non-reservoirs the averaged according to stratum IFF value determines the mean-weighted values of effective porosity

  10. Nuclear magnetic resonance imaging of water content in the subsurface

    J. Hendricks; T. Yao; A. Kearns

    1999-01-21

    Previous theoretical and experimental studies indicated that surface nuclear magnetic resonance (NMR) has the potential to provide cost-effective water content measurements in the subsurface and is a technology ripe for exploitation in practice. The objectives of this investigation are (a) to test the technique under a wide range of hydrogeological conditions and (b) to generalize existing NMR theories in order to correctly model NMR response from conductive ground and to assess properties of the inverse problem. Twenty-four sites with different hydrogeologic settings were selected in New Mexico and Colorado for testing. The greatest limitation of surface NMR technology appears to be the lack of understanding in which manner the NMR signal is influenced by soil-water factors such as pore size distribution, surface-to-volume ratio, paramagnetic ions dissolved in the ground water, and the presence of ferromagnetic minerals. Although the theoretical basis is found to be sound, several advances need to be made to make surface NMR a viable technology for hydrological investigations. There is a research need to investigate, under controlled laboratory conditions, how the complex factors of soil-water systems affect NMR relaxation times.

  11. Electron and nuclear magnetic resonances in compounds and metallic hydrides

    Proton pulsed Nuclear Magnetic Resonance measurements were performed on the metallic hydrides ZrCr2Hx (x = 2, 3, 4) and ZrV2Hy (y = 2, 3, 4, 5) as a function of temperature between 180 and 400K. The ultimate aim was the investigation of the relaxation mechanisms in these systems by means of the measurement of both the proton (1H) spin-lattice (T1) and spin-spin (T2) relaxation times and to use these data to obtain information about the diffusive motion of the hydrogen atoms. The diffusional activation energies, the jump frequencies and the Korringa constant, Ck, related with the conduction electron contribution to the 1H relaxation were determined for the above hydrides as a function of hydrogen concentration. Our results were analysed in terms of the relaxation models described by Bloembergen, Purcell and Pound (BPP model) and by Torrey. The Korringa type relaxation due to the conduction electrons in metallic systems was also used to interpret the experimental results. We also present the Electron Paramagnetic Ressonance (EPR) study of Gd3+, Nd3+ and Er3+ ions as impurities in several AB3 intermetallic compounds where A = LA, Ce, Y, Sc, Th, Zr and B = Rh, Ir, Pt. The results were analysed in terms of the multiband model previously suggested to explain the behaviour of the resonance parameter in AB2 Laves Phase compounds. (author)

  12. Two-dimensional nuclear magnetic resonance of quadrupolar systems

    Wang, Shuanhu

    1997-09-17

    This dissertation describes two-dimensional nuclear magnetic resonance theory and experiments which have been developed to study quadruples in the solid state. The technique of multiple-quantum magic-angle spinning (MQMAS) is extensively reviewed and expanded upon in this thesis. Specifically, MQMAS is first compared with another technique, dynamic-angle spinning (DAS). The similarity between the two techniques allows us to extend much of the DAS work to the MQMAS case. Application of MQMAS to a series of aluminum containing materials is then presented. The superior resolution enhancement through MQMAS is exploited to detect the five- and six-coordinated aluminum in many aluminosilicate glasses. Combining the MQMAS method with other experiments, such as HETCOR, greatly expands the possibility of the use of MQMAS to study a large range of problems and is demonstrated in Chapter 5. Finally, the technique switching-angle spinning (SAS) is applied to quadrupolar nuclei to fully characterize a quadrupolar spin system in which all of the 8 NMR parameters are accurately determined. This dissertation is meant to demonstrate that with the combination of two-dimensional NMR concepts and new advanced spinning technologies, a series of multiple-dimensional NMR techniques can be designed to allow a detailed study of quadrupolar nuclei in the solid state.

  13. Some concepts of the advanced mass spectrometry at the COMBAS magnetic separator of nuclear reaction products

    Proposed is an in-flight measurement method of recoil nuclei masses with the help of a Penning trap located behind the COMBAS magnetic separator for nuclear reaction products. The method is based on the following operations: (i) Accepting the recoil nuclear reaction products by the magnetic separator and decreasing their kinetic energy by degraders. (ii) In-flight transportation of the retarded nuclei into the magnetic field of the Penning trap's solenoid and transforming their remaining longitudinal momentum into orbital rotation by the fringing magnetic field of the solenoid. (iii) Cooling the orbital rotation of the ions by the high-frequency azimuthal electric field of the Penning trap's electric hyperboloid. (orig.)

  14. New Approaches to Quantum Computing using Nuclear Magnetic Resonance Spectroscopy

    The power of a quantum computer (QC) relies on the fundamental concept of the superposition in quantum mechanics and thus allowing an inherent large-scale parallelization of computation. In a QC, binary information embodied in a quantum system, such as spin degrees of freedom of a spin-1/2 particle forms the qubits (quantum mechanical bits), over which appropriate logical gates perform the computation. In classical computers, the basic unit of information is the bit, which can take a value of either 0 or 1. Bits are connected together by logic gates to form logic circuits to implement complex logical operations. The expansion of modern computers has been driven by the developments of faster, smaller and cheaper logic gates. As the size of the logic gates become smaller toward the level of atomic dimensions, the performance of such a system is no longer considered classical but is rather governed by quantum mechanics. Quantum computers offer the potentially superior prospect of solving computational problems that are intractable to classical computers such as efficient database searches and cryptography. A variety of algorithms have been developed recently, most notably Shor's algorithm for factorizing long numbers into prime factors in polynomial time and Grover's quantum search algorithm. The algorithms that were of only theoretical interest as recently, until several methods were proposed to build an experimental QC. These methods include, trapped ions, cavity-QED, coupled quantum dots, Josephson junctions, spin resonance transistors, linear optics and nuclear magnetic resonance. Nuclear magnetic resonance (NMR) is uniquely capable of constructing small QCs and several algorithms have been implemented successfully. NMR-QC differs from other implementations in one important way that it is not a single QC, but a statistical ensemble of them. Thus, quantum computing based on NMR is considered as ensemble quantum computing. In NMR quantum computing, the spins with

  15. Contribution to the study of the action of electromagnetic fields on the angular correlations of nuclear radiation (1960)

    This work deals with the study of interaction of E.M. fields with nuclear moments of nuclei emitting gamma rays. We describe first experiments on delayed angular correlation showing the role played by statistic quadrupole interaction. We have measured the magnetic moment of the second excited state of 19F using an external magnetic field. In the case of 19O, experiments of angular distributions and angular correlations of gamma -rays taking into account the possibility of perturbations, allow us to determine the spin and parities of the three first levels. (author)

  16. Cross-Correlation of Excitation Functions for Different Fragments and Different Scattering Angles in 27Al(19F, x) y Reactions

    HAN Jian-Long; WU He-Yu; LI Zhi-Chang; LU Xiu-Qin; ZHAO Kui; ZHOU Ping; LIU Jian-Cheng; XU Guo-Ji; Sergey Yu Kun; WANG Qi; BAI Zhen; DONG Yu-Chuan; LI Song-Lin; DUAN Li-Min; XU Hu-Shan; XU Hua-Gen; CHEN Ruo-Fu

    2008-01-01

    @@ Excitation functions have been measured for different projectile-like fragments produced in 27 Al(19 F,x)y reactions at incident energies from 110.25 to 118. 75 Me V in 250 ke V steps. Strong cross section fluctuations of the excitation functions are observed. The cross-correlation coefficients of the excitation functions for different atomic number Z and for different scattering angle θcm have been deduced. These coefficients are much larger than the statistical theoretical calculated ones. This indicates that there are strong correlations between different exit channels in the dissipative heavy ion collision of 27 Al(19 F,x )y.

  17. Direct mapping of 19F in 19FDG-6P in brain tissue at subcellular resolution using soft X-ray fluorescence

    Poitry-yamate, Carole; Gianoncelli, A; Kourousias, G.; Kaulich, B; Lepore, Mario; Gruetter, Rolf; M. Kiskinova

    2013-01-01

    Low energy x-ray fluorescence (LEXRF) detection was optimized for imaging cerebral glucose metabolism by mapping the fluorine LEXRF signal of 19 F in 19 FDG, trapped as intracellular 19 F-deoxyglucose-6-phosphate ( 19 FDG-6P) at 1μm spatial resolution from 3μm thick brain slices. 19 FDG metabolism was evaluated in brain structures closely resembling the general cerebral cytoarchitecture following formalin fixation of brain slices and their inclusion in an epon matrix. 2-dimensional distribu...

  18. 19F+27Al耗散反应产物截面测量中的不重复性%Non-reproducibility of the Cross Sections of the Products Induced from Dissipative Reaction of 19F+27Al

    韩建龙; 王琦; 董玉川; 李松林; 段利敏; 吴和宇; 徐华根; 陈若富; 徐瑚珊; 白真; 李志常; 路秀琴; 赵葵; 周平; 刘建成; 许国基; Sergey; Yu; Kun

    2006-01-01

    在中国原子能科学研究院的HI-13串列静电加速器上完成了114MeV和118.75MeV的19F+27Al耗散反应产物B,C,N,O,F,Ne,Na和Mg的微分截面测量.条形27Al同位素靶的大小尺寸为10mm×50mm,平均厚度约67μg/cm2.固定入射束流19F的能量,通过移动靶位,先后轰击了靶上20个不同的位置.实验结果表明,在弹靶系统、入射能量以及探测系统都相同的多次独立的微分截面测量中,截面的涨落不呈现高斯型几率分布.截面测量的这种不重复现象难以用有限计数率的统计性质来解释.

  19. Scaling of transverse nuclear magnetic relaxation due to magnetic nanoparticle aggregation

    Brown, Keith A. [Harvard School of Engineering and Applied Science, 29 Oxford Street, Cambridge, MA 02138 (United States); Vassiliou, Christophoros C. [Massachusetts Institute of Technology, Department of Electrical Engineering and Computer Science, 77 Massachusetts Avenue, Cambridge, MA 02139 (United States); Issadore, David; Berezovsky, Jesse [Harvard School of Engineering and Applied Science, 29 Oxford Street, Cambridge, MA 02138 (United States); Cima, Michael J. [Massachusetts Institute of Technology, Department of Materials Science and Engineering and Koch Institute for Integrative Cancer Research, 77 Massachusetts Avenue Cambridge, MA 02139 (United States); Westervelt, R.M., E-mail: westervelt@seas.harvard.ed [Harvard School of Engineering and Applied Science, 29 Oxford Street, Cambridge, MA 02138 (United States); Harvard University, Department of Physics, 17 Oxford Street, Cambridge, MA 02138 (United States)

    2010-10-15

    The aggregation of superparamagnetic iron oxide (SPIO) nanoparticles decreases the transverse nuclear magnetic resonance (NMR) relaxation time T{sub 2}{sup CP} of adjacent water molecules measured by a Carr-Purcell-Meiboom-Gill (CPMG) pulse-echo sequence. This effect is commonly used to measure the concentrations of a variety of small molecules. We perform extensive Monte Carlo simulations of water diffusing around SPIO nanoparticle aggregates to determine the relationship between T{sub 2}{sup CP} and details of the aggregate. We find that in the motional averaging regime T{sub 2}{sup CP} scales as a power law with the number N of nanoparticles in an aggregate. The specific scaling is dependent on the fractal dimension d of the aggregates. We find T{sub 2}{sup CP{proportional_to}{Nu}-0.44} for aggregates with d=2.2, a value typical of diffusion limited aggregation. We also find that in two-nanoparticle systems, T{sub 2}{sup CP} is strongly dependent on the orientation of the two nanoparticles relative to the external magnetic field, which implies that it may be possible to sense the orientation of a two-nanoparticle aggregate. To optimize the sensitivity of SPIO nanoparticle sensors, we propose that it is best to have aggregates with few nanoparticles, close together, measured with long pulse-echo times.

  20. Scaling of transverse nuclear magnetic relaxation due to magnetic nanoparticle aggregation.

    Brown, Keith A; Vassiliou, Christophoros C; Issadore, David; Berezovsky, Jesse; Cima, Michael J; Westervelt, R M

    2010-10-01

    The aggregation of superparamagnetic iron oxide (SPIO) nanoparticles decreases the transverse nuclear magnetic resonance (NMR) relaxation time T2CP of adjacent water molecules measured by a Carr-Purcell-Meiboom-Gill (CPMG) pulse-echo sequence. This effect is commonly used to measure the concentrations of a variety of small molecules. We perform extensive Monte Carlo simulations of water diffusing around SPIO nanoparticle aggregates to determine the relationship between T2CP and details of the aggregate. We find that in the motional averaging regime T2CP scales as a power law with the number N of nanoparticles in an aggregate. The specific scaling is dependent on the fractal dimension d of the aggregates. We find T2CP∝N-0.44 for aggregates with d = 2.2, a value typical of diffusion limited aggregation. We also find that in two-nanoparticle systems, T2CP is strongly dependent on the orientation of the two nanoparticles relative to the external magnetic field, which implies that it may be possible to sense the orientation of a two-nanoparticle aggregate. To optimize the sensitivity of SPIO nanoparticle sensors, we propose that it is best to have aggregates with few nanoparticles, close together, measured with long pulse-echo times. PMID:20689678

  1. Magnetic resonance imaging and nuclear magnetic resonance investigations of bentonite systems

    This report summarizes results from a set of magnetic resonance imaging (MRI) and nuclear magnetic resonance (NMR) experiments performed on Ca and Na montmorillonite samples interacting with water. The primary goal with these studies was to provide, in a non-invasive manner, a quantitative measure of bentonite distribution in extended samples during and after different physical processes such as swelling and sedimentation and on the time scale from minutes to years. Additionally, we also studied the distribution of foreign particles (such as native minerals as well as magnetic model particles) within bentonite systems and performed some diffusion NMR experiments with the aim of characterizing the state of colloids that form after clay dissolution. Both natural montmorillonites and purified and ion-exchanged montmorillonite clays were investigated. The primary variables were clay composition and water ionic strength. Bulk samples confined in a vertical tube and in a horizontal channel were investigated. A critical issue for the stability of clay buffer layer in deep underground repository is to prevent or minimize the release of clay particles into the water phase. In our experiments, the most significant particle losses were found for Na-MX80 clay exposed to water with low ionic strength. With increasing the concentration of CaCl2 in the water phase both swelling and particle release are slowed down but not completely eliminated due probably to gradual change of water ion content via ion exchange with the clay itself. For natural MX80 samples, in spite of significant swelling expansion, no clay particle release above the sensitivity limit of 0.001 volume% was observed. Ca-MX80 exhibited the smallest expansion and no trace of clay particle released into the aqueous phase

  2. Nuclear magnetic resonance of laser-polarized noble gases in molecules, materials and organisms

    Goodson, Boyd M.

    1999-12-01

    Conventional nuclear magnetic resonance (NMR) spectroscopy and magnetic resonance imaging (MRI) are fundamentally challenged by the insensitivity that stems from the ordinarily low spin polarization achievable in even the strongest NMR magnets. However, by transferring angular momentum from laser light to electronic and nuclear spins, optical pumping methods can increase the nuclear spin polarization of noble gases by several orders of magnitude, thereby greatly enhancing their NMR sensitivity. This dissertation is primarily concerned with the principles and practice of optically pumped nuclear magnetic resonance (OPNMR). The enormous sensitivity enhancement afforded by optical pumping noble gases can be exploited to permit a variety of novel NMR experiments across many disciplines. Many such experiments are reviewed, including the void-space imaging of organisms and materials, NMR and MRI of living tissues, probing structure and dynamics of molecules in solution and on surfaces, and zero-field NMR and MRI.

  3. Nuclear magnetic resonance of laser-polarized noble gases in molecules, materials and organisms

    Conventional nuclear magnetic resonance (NMR) spectroscopy and magnetic resonance imaging (MRI) are fundamentally challenged by the insensitivity that stems from the ordinarily low spin polarization achievable in even the strongest NMR magnets. However, by transferring angular momentum from laser light to electronic and nuclear spins, optical pumping methods can increase the nuclear spin polarization of noble gases by several orders of magnitude, thereby greatly enhancing their NMR sensitivity. This dissertation is primarily concerned with the principles and practice of optically pumped nuclear magnetic resonance (OPNMR). The enormous sensitivity enhancement afforded by optical pumping noble gases can be exploited to permit a variety of novel NMR experiments across many disciplines. Many such experiments are reviewed, including the void-space imaging of organisms and materials, NMR and MRI of living tissues, probing structure and dynamics of molecules in solution and on surfaces, and zero-field NMR and MRI

  4. Nuclear magnetic resonance data of C8H10N4O2

    Jain, M.

    This document is part of Subvolume C `Chemical Shifts and Coupling Constants for Hydrogen-1, Heterocycles' of Landolt-Börnstein III/40 `Nuclear Magnetic Resonance Data', Group III `Condensed Matter'.

  5. Calculation of nuclear matter in the presence of strong magnetic field using LOCV technique

    Bordbar, G H

    2015-01-01

    In the present work, we are interested in the properties of nuclear matter at zero temperature in the presence of strong magnetic fields using the lowest order constraint variational (LOCV) method employing $AV_{18}$ nuclear potential. Our results indicate that in the absence of a magnetic field, the energy per particle is a symmetric function of the spin polarization parameter. This shows that for the nuclear matter, the spontaneous phase transition to a ferromagnetic state does not occur. However, we have found that for the magnetic fields $ B\\gtrsim 10 ^ {18}\\ G$, the symmetry of energy is broken and the energy has a minimum at a positive value of the spin polarization parameter. We have also found that the effect of magnetic field on the value of energy is more significant at the low densities. Our calculations show that at lower densities, the spin polarization parameter is more sensitive to the magnetic field.

  6. Time-odd mean fields in the rotating frame: microscopic nature of nuclear magnetism

    Afanasjev, A. V.; Ring, P.

    2000-01-01

    The microscopic role of nuclear magnetism in rotating frame is investigated for the first time in the framework of the cranked relativistic mean field theory. It is shown that nuclear magnetism modifies the expectation values of single-particle spin, orbital and total angular momenta along the rotational axis effectively creating additional angular momentum. This effect leads to the increase of kinematic and dynamic moments of inertia at given rotational frequency and has an impact on effecti...

  7. Nuclear Spin Maser at Highly Stabilized Low Magnetic Field and Search for Atomic EDM

    A nuclear spin maser is operated at a low static field through an active feedback scheme based on an optical nuclear spin detection and succeeding spin control by a transverse field application. The frequency stability of this optical-coupling spin maser is improved by installation of a low-noise current source for a solenoid magnet producing a static magnetic field in the maser operation. Experimental devices for application of the maser to EDM experiment are being developed.

  8. Nuclear and magnetic structures of nonpolar ferrofluids by small-angle neutron scattering

    Small-angle scattering of nonpolarized and polarized neutrons has proved to be a powerful technique for studying features of nuclear and magnetic structures of ferrofluids at nanoscale. The paper presents our recent results on application of the technique for comparative analysis of nonpolar ferrofluids (d-cyclohexane) stabilized by different surfactants, which are oleic and myristic acids. Qualitative difference both in nuclear and magnetic structural organization is observed and discussed

  9. A Miniaturized, 1.9F Integrated Optical Fiber and Stone Basket for Use in Thulium Fiber Laser Lithotripsy.

    Wilson, Christopher R; Hutchens, Thomas C; Hardy, Luke A; Irby, Pierce B; Fried, Nathaniel M

    2015-10-01

    The thulium fiber laser (TFL) is being explored as an alternative laser lithotripter to the standard holmium:yttrium-aluminum-garnet laser. The more uniform beam profile of the TFL enables higher power transmission through smaller fibers. In this study, a 100-μm core, 140-μm outer-diameter (OD) silica fiber with 5-mm length hollow steel tip was integrated with 1.3F (0.433-mm OD) nitinol wire basket to form a 1.9F (0.633-mm OD) device. TFL energy of 30 mJ, 500 μs pulse duration, and 500 Hz pulse rate was delivered to human uric acid stones, ex vivo. Stone ablation rates measured 1.5 ± 0.2 mg/s, comparable to 1.7 ± 0.3 mg/s using bare fiber tips separately with stone basket. With further development, this device may minimize stone retropulsion, allowing more efficient TFL lithotripsy at higher pulse rates. It may also provide increased flexibility, higher saline irrigation rates through the ureteroscope working channel, reduce fiber degradation compared with separate fiber and basket manipulation, and reduce laser-induced nitinol wire damage. PMID:26167738

  10. CP-MAS 207Pb with 19F decoupling NMR spectroscopy: medium range investigation in fluoride materials.

    Bureau, B; Silly, G; Buzaré, J Y

    1999-11-01

    The isotropic chemical shift of 207Pb is used to perform structural investigations of crystalline fluoride compounds (PbF2, Pb2ZnF6, PbGaF5, Pb3Ga2F12 and Pb9Ga2F24) and transition metal fluoride glasses (TMFG) of the PZG family (PbF2-ZnF2-GaF3). Using 207Pb Cross Polarisation Magic Angle Spinning (CP-MAS) NMR with 19F decoupling, it is shown that the isotropic chemical shift of 207Pb varies on a large scale (1000 ppm) and that the main changes of its value are not due to the nearest neighbour fluorines but may be related to the number of next nearest neighbour (nnn) Pb2+ ions. In this way, it is demonstrated that 207Pb chemical shift is an interesting probe to investigate medium range order in either crystalline or glassy fluoride systems. The 207Pb delta(iso) parameter has been linearly correlated to the number of nnn Pb2+ ions. PMID:10670899

  11. Modulation of the antioxidant activity of HO* scavengers by albumin binding: a 19F-NMR study.

    Aime, Silvio; Digilio, Giuseppe; Bruno, Erik; Mainero, Valentina; Baroni, Simona; Fasano, Mauro

    2003-08-01

    The interaction between different HO(z.rad;) radical scavengers in a three-component antioxidant system has been investigated by means of 19F-NMR spectroscopy. This system is composed of bovine serum albumin (BSA), trolox, and N-(4-hydroxyphenyl)-trifluoroacetamide (CF(3)PAF). The antioxidant capacity of BSA and trolox has been assessed by measuring the amount of trifluoroacetamide (TFAM) arising from the radical mediated decomposition of CF(3)PAF. When assayed separately, both trolox and BSA behaved as antioxidants, as they were effective to protect CF(3)PAF from HO* radical-mediated decomposition. By contrast, trolox enhanced the production of TFAM in the presence of BSA, thus behaving as a pro-oxidant. Urate, carnosine, glucose, and propylgallate showed antioxidant properties both with or without BSA. CF(3)PAF and trolox were found to bind to BSA with association constants in the order of 5 x 10(3)M(-1) and to compete for the same binding sites. These results have been discussed in terms of BSA-catalysed cross-reactions between trolox-derived secondary radicals and CF(3)PAF. PMID:12878205

  12. Science and history explored by nuclear magnetic resonance

    Nuclear Magnetic Resonance was chosen as the main tool for investigating different biological and chemical systems, as it is unique in providing the information details about the morphology and molecular structures and conformations by which the fundamental properties of these biological and chemical systems can be understood. Proton spin-diffusion experiments combined with 13C CPMAS spectroscopy were successfully applied to characterize the changes that occur during the thermal denaturation of keratin fibers from wool and hair. A model describing both the effect of thermal denaturation and the effect of different chemical treatments on keratin fibers is presented. Proton NMR spectroscopy was used for studying the proton exchange in Sulfonated Polyether Ether Ketone proton exchange membranes revealing that the water exchange processes in hydrated SPEEK-silica membranes are more efficient when low concentrations of polyethoxysiloxane (PEOS) are used for the membrane preparation. Proton 1D exchange spectroscopy combined with transverse relaxation measurements offered good insight in the state of water in hydrated SPEEK/SiO2 membranes revealing that concentrations of 5%-10% wt. PEOS could enhance the electrical conductivity of PEM. Hyperpolarized 129Xe NMR spectroscopy was successfully applied for monitoring the free radical polymerization reactions of methyl methacrylate, methyl acrylate and the copolymerization of methyl methacrylate and methyl acrylate. The observation of Xe chemical shift and linewidths during the reactions reveal information about the polymer chain growths during the polymerizations. The successful application of the NMR-MOUSE to visualise the different anatomical layers with varying proton densities opens the possibility of its use in clinical studies such as osteoporosis for bone density measurements. The NMR-MOUSE was also successfully applied for the analysis of violins and bows and a classification of the violins and bows as a function of

  13. Nuclear magnetic resonance studies of macroscopic morphology and dynamics

    Nuclear magnetic resonance techniques are traditionally used to study molecular level structure and dynamics with a noted exception in medically applied NMR imaging (MRI). In this work, new experimental methods and theory are presented relevant to the study of macroscopic morphology and dynamics using NMR field gradient techniques and solid state two-dimensional exchange NMR. The goal in this work is not to take some particular system and study it in great detail, rather it is to show the utility of a number of new and novel techniques using ideal systems primarily as a proof of principle. By taking advantage of the analogy between NMR imaging and diffraction, one may simplify the experiments necessary for characterizing the statistical properties of the sample morphology. For a sample composed of many small features, e.g. a porous medium, the NMR diffraction techniques take advantage of both the narrow spatial range and spatial isotropy of the sample's density autocorrelation function to obtain high resolution structural information in considerably less time than that required by conventional NMR imaging approaches. The time savings of the technique indicates that NMR diffraction is capable of finer spatial resolution than conventional NMR imaging techniques. Radio frequency NMR imaging with a coaxial resonator represents the first use of cylindrically symmetric field gradients in imaging. The apparatus as built has achieved resolution at the micron level for water samples, and has the potential to be very useful in the imaging of circularly symmetric systems. The study of displacement probability densities in flow through a random porous medium has revealed the presence of features related to the interconnectedness of the void volumes. The pulsed gradient techniques used have proven successful at measuring flow properties for time and length scales considerably shorter than those studied by more conventional techniques

  14. Nuclear magnetic resonance (NMR) studies of homeopathic solutions.

    Aabel, S; Fossheim, S; Rise, F

    2001-01-01

    The efficacy of homeopathy is controversial. Nuclear magnetic resonance (NMR) has been used to study homeopathic solutions, showing provocative results. We examined the reproducibility of one of the allegedly positive studies. 1H NMR spectra were recorded for Sulphur D4, diluted and succussed up to D30 (called potentization) at two different frequencies (300 and 500 MHz). The Sulphur solution had been potentiated according to homeopathic principles with deionized water and alcohol. Water proton T1 relaxation measurements were performed also at 20 MHz for the different potentiated Sulphur solutions. Furthermore, the homeopathic remedy Betula alba 30c (birch pollen extract) and appropriate control solution (deionized water, unsuccussed solutions and placebo globules) were measured analogously, both with frequencies giving spectra and T1 relaxometry. The Sulphur remedies showed identical one dimensional proton spectra (1H NMR) at 300 and 500 MHz, regardless of dilution/succussion stage, from D4 to D30. Furthermore, Betula 30c as a potentiated solution and its controls (ethanol dilutions and Betula diluted but not succussed) showed identical spectra. Nor were there any statistically significant differences in longitudinal (T1) relaxation times between deionized water and Sulphur D10 to D30 preparations. The shorter T1 of the Sulphur D4 preparation could be ascribed to the higher microviscosity within the sample matrix caused by the high concentration of dissolved material. Also, the T1 values of the Betula alba 30c preparation (in globular form) and control placebo globules were identical. In conclusion, published results from NMR research on homeopathy indicating differences between homeopathic solutions and control samples could not be reproduced. PMID:11212083

  15. Nuclear magnetic resonance studies of macroscopic morphology and dynamics

    Barrall, G A [Univ. of California, Berkeley, CA (United States). Dept. of Chemistry

    1995-09-01

    Nuclear magnetic resonance techniques are traditionally used to study molecular level structure and dynamics with a noted exception in medically applied NMR imaging (MRI). In this work, new experimental methods and theory are presented relevant to the study of macroscopic morphology and dynamics using NMR field gradient techniques and solid state two-dimensional exchange NMR. The goal in this work is not to take some particular system and study it in great detail, rather it is to show the utility of a number of new and novel techniques using ideal systems primarily as a proof of principle. By taking advantage of the analogy between NMR imaging and diffraction, one may simplify the experiments necessary for characterizing the statistical properties of the sample morphology. For a sample composed of many small features, e.g. a porous medium, the NMR diffraction techniques take advantage of both the narrow spatial range and spatial isotropy of the sample`s density autocorrelation function to obtain high resolution structural information in considerably less time than that required by conventional NMR imaging approaches. The time savings of the technique indicates that NMR diffraction is capable of finer spatial resolution than conventional NMR imaging techniques. Radio frequency NMR imaging with a coaxial resonator represents the first use of cylindrically symmetric field gradients in imaging. The apparatus as built has achieved resolution at the micron level for water samples, and has the potential to be very useful in the imaging of circularly symmetric systems. The study of displacement probability densities in flow through a random porous medium has revealed the presence of features related to the interconnectedness of the void volumes. The pulsed gradient techniques used have proven successful at measuring flow properties for time and length scales considerably shorter than those studied by more conventional techniques.

  16. Resolution Improvement in Multidimensional Nuclear Magnetic Resonance Spectroscopy of Proteins

    The work presented in this thesis is concerned with both liquid-state and solid-state nuclear magnetic resonance (NMR) spectroscopy. Most of this work is devoted to the investigation by solid-state NMR of C13-enriched compounds with the principal aim of presenting techniques devised for further improving the spectral resolution in multidimensional NMR of microcrystalline proteins. In fully C13-labelled compounds, the J-coupling induces a broadening of the carbon lineshapes. We show that spin-state-selective technique called IPAP can be successfully combined with standard polarisation transfer schemes in order to remove the J-broadening in multidimensional solid-state NMR correlation experiments of fully C13-enriched proteins. We present subsequently two techniques tailored for liquid-state NMR spectroscopy. The carbon directly detected techniques provide chemical shift information for all backbone hetero-nuclei. They are very attracting for the study of large bio-molecular systems or for the investigation of paramagnetic proteins. In the last part of this thesis, we study the spin-echo J-modulation for homonuclear two-spin 1/2 systems. Under magic-angle spinning, the theory of J-induced spin-echo modulation allows to derive a set of modulation regimes which give a spin-echo modulation exactly equal to the J-coupling. We show that the chemical-shift anisotropy and the dipolar interaction tend to stabilize the spin-echo J-modulation. The theoretical conclusions are supported by numerical simulations and experimental results obtained for three representative samples containing C13 spin pairs. (author)

  17. A Multidisciplinary Approach to High Throughput Nuclear Magnetic Resonance Spectroscopy.

    Pourmodheji, Hossein; Ghafar-Zadeh, Ebrahim; Magierowski, Sebastian

    2016-01-01

    Nuclear Magnetic Resonance (NMR) is a non-contact, powerful structure-elucidation technique for biochemical analysis. NMR spectroscopy is used extensively in a variety of life science applications including drug discovery. However, existing NMR technology is limited in that it cannot run a large number of experiments simultaneously in one unit. Recent advances in micro-fabrication technologies have attracted the attention of researchers to overcome these limitations and significantly accelerate the drug discovery process by developing the next generation of high-throughput NMR spectrometers using Complementary Metal Oxide Semiconductor (CMOS). In this paper, we examine this paradigm shift and explore new design strategies for the development of the next generation of high-throughput NMR spectrometers using CMOS technology. A CMOS NMR system consists of an array of high sensitivity micro-coils integrated with interfacing radio-frequency circuits on the same chip. Herein, we first discuss the key challenges and recent advances in the field of CMOS NMR technology, and then a new design strategy is put forward for the design and implementation of highly sensitive and high-throughput CMOS NMR spectrometers. We thereafter discuss the functionality and applicability of the proposed techniques by demonstrating the results. For microelectronic researchers starting to work in the field of CMOS NMR technology, this paper serves as a tutorial with comprehensive review of state-of-the-art technologies and their performance levels. Based on these levels, the CMOS NMR approach offers unique advantages for high resolution, time-sensitive and high-throughput bimolecular analysis required in a variety of life science applications including drug discovery. PMID:27294925

  18. Direct mapping of 19F in 19FDG-6P in brain tissue at subcellular resolution using soft X-ray fluorescence

    Low energy x-ray fluorescence (LEXRF) detection was optimized for imaging cerebral glucose metabolism by mapping the fluorine LEXRF signal of 19F in 19FDG, trapped as intracellular 19F-deoxyglucose-6-phosphate (19FDG-6P) at 1μm spatial resolution from 3μm thick brain slices. 19FDG metabolism was evaluated in brain structures closely resembling the general cerebral cytoarchitecture following formalin fixation of brain slices and their inclusion in an epon matrix. 2-dimensional distribution maps of 19FDG-6P were placed in a cytoarchitectural and morphological context by simultaneous LEXRF mapping of N and O, and scanning transmission x-ray (STXM) imaging. A disproportionately high uptake and metabolism of glucose was found in neuropil relative to intracellular domains of the cell body of hypothalamic neurons, showing directly that neurons, like glial cells, also metabolize glucose. As 19F-deoxyglucose-6P is structurally identical to 18F-deoxyglucose-6P, LEXRF of subcellular 19F provides a link to in vivo 18FDG PET, forming a novel basis for understanding the physiological mechanisms underlying the 18FDG PET image, and the contribution of neurons and glia to the PET signal

  19. Precision spectroscopy of the 207Pb19F molecule: Implications for measurement of P-odd and T-odd effects

    Here we report precision microwave spectroscopy of pure rotational transitions of the 207Pb19F isotopologue. We use these data to make predictions of the sensitivity of the molecule to P-odd, T-even and P-odd, T-odd effects.

  20. Development and applications of NMR [nuclear magnetic resonance] in low fields and zero field

    This dissertation is about nuclear magnetic resonance (NMR) spectroscopy in the absence of applied magnetic fields. NMR is usually done in large magnetic fields, often as large as can be practically attained. The motivation for going the opposite way, toward zero field, is that for certain types of materials, particularly powdered or polycrystalline solids, the NMR spectra in zero field are easier to interpret than those obtained in high field. 92 refs., 60 figs., 1 tab

  1. Nuclear magnetic relaxation and origins of RMN signals from GdAl2

    The intermetallic compound GdAl2 crystallizes in the cubic Laves phase C15. It is a simple ferromagnet below 176K. The easy direction of magnetization in this compound is such that the Al ions are distributed among two magnetically inequivalent sites. The pulsed NMR technique was used to study the origin of the signals from these two sites and the nuclear magnetic relaxation. (author)

  2. Nuclear magnetic resonance at millitesla fields using a zero-field spectrometer

    Tayler, Michael C. D.; Sjolander, Tobias F.; Pines, Alexander; Budker, Dmitry

    2016-09-01

    We describe new analytical capabilities for nuclear magnetic resonance (NMR) experiments in which signal detection is performed with chemical resolution (via spin-spin J couplings) in the zero to ultra-low magnetic field region, below 1 μT. Using magnetic fields in the 100 μT to 1 mT range, we demonstrate the implementation of conventional NMR pulse sequences with spin-species selectivity.

  3. Neutron Fermi Liquids under the presence of a strong magnetic field with effective nuclear forces

    Perez-Garcia, M Angeles; Polls, A

    2009-01-01

    Landau's Fermi Liquid parameters are calculated for non-superfluid pure neutron matter in the presence of a strong magnetic field at zero temperature. The particle-hole interactions in the system, where a net magnetization may be present, are characterized by these parameters in the framework of a multipolar formalism. We use either zero- or finite-range effective nuclear forces to describe the nuclear interaction. Using the obtained Fermi Liquid parameters, the effect of a strong magnetic field on some bulk magnitudes such as isothermal compressibility and spin susceptibility is also investigated.

  4. MEMS-Based Force-Detected Nuclear Magnetic Resonance (FDNMR) Spectrometer

    Lee, Choonsup; Butler, Mark C.; Elgammal, Ramez A.; George, Thomas; Hunt, Brian; Weitekamp, Daniel P.

    2006-01-01

    Nuclear Magnetic Resonance (NMR) spectroscopy allows assignment of molecular structure by acquiring the energy spectrum of nuclear spins in a molecule, and by interpreting the symmetry and positions of resonance lines in the spectrum. As such, NMR has become one of the most versatile and ubiquitous spectroscopic methods. Despite these tremendous successes, NMR experiments suffer from inherent low sensitivity due to the relatively low energy of photons in the radio frequency (rt) region of the electromagnetic spectrum. Here, we describe a high-resolution spectroscopy in samples with diameters in the micron range and below. We have reported design and fabrication of force-detected nuclear magnetic resonance (FDNMR).

  5. Neutron experiments on nuclear magnetism in copper and silver. Doctoral thesis

    Tuoriniemi, J.T.

    1995-12-15

    This thesis adds to the series of investigations on nuclear magnetism in metals performed during the past 20 years at the Low Temperature Laboratory of the Helsinki University of Technology. Collective behavior of nuclear spins is expected only at very low temperatures because the mutual interactions are extremely weak. To learn what the spin structure below the transition point in these metals is, neutron-diffraction experiments have been performed. The subject of this thesis is to present the results of neutron experiments on nuclear magnetism in copper and silver.

  6. Nuclear magnetic resonance of D(-)-{alpha}-amino-benzyl penicillin; Ressonancia magnetica nuclear da D(-)-{alpha}-amino-benzil penicilina

    Aguiar, Monica R.M.P.; Gemal, Andre L.; San Gil, Rosane A.S. [Universidade Federal, Rio de Janeiro, RJ (Brazil). Inst. de Quimica; Menezes, Sonia M.C. [PETROBRAS, Rio de Janeiro, RJ (Brazil). Centro de Pesquisas

    1995-12-31

    The development of new drugs from penicillins has induced the study of this substances by nuclear magnetic resonance. Several samples of D(-)-{alpha}-amino-benzyl penicillin were analysed using {sup 13} C NMR techniques in aqueous solution and solid state. Spectral data of this compounds were shown and the results were presented and analysed 7 figs., 4 tabs.

  7. Study of function response of a detector HPGe to photons of reaction 19F(p,αγ)16O

    In the 19F(p,αγ)16O reaction, characteristic gamma-rays with energies: 6.1 MeV; 6.9 MeV and 7.1 keV can be observed. These photons can be used in many important applications such as Proton Induced Gamma-ray Emission (PIGE), gamma radiography and calibration purposes. It has another advantage in calibration procedures, which is the observed photon flux is greater than other reactions studied, 27Al(p,αγ)28Si and 23Na(p,αγ)24Mg. In our laboratory, we are studying the efficiency and response function of HPGe detectors for high energy photons, and for this it is necessary a source with a level scheme with few gamma-ray transitions and known relative yields. The 19F(p,αγ)16O reaction satisfies the first condition but in the literature we found relative yields for thick targets or reaction cross section for thin targets. However, we use targets of intermediate thickness, therefore in this work we measure the relative gamma-ray yields for protons with energies between 1.36 MeV and 1.42 MeV. The experiments were performed at the 1.7 MV Pelletron tandem accelerator of the Laboratorio de Analise de Materiais por Feixes Ionicos (LAMFI) located at Instituto de Fisica da Universidade de Sao Paulo, using a reverse-electrode closed-end coaxial HPGe detector with 72.5 mm in diameter and 60.5 mm in length, at 0 deg. The proton irradiation current was 50 nA, and the target consisted of 250 g/cm2 CaF2 evaporated on a 0.1 mm Ta backing. In this reaction the 20Ne resonant state fissions in flight, and the resulting 16O excited states have different half-lives; all observed peaks are deformed due to either Doppler broadening from 16O random velocity direction or Doppler shift from nuclei that leave the target toward the vacuum chamber. Moreover, the peak deformations vary with the proton energy. These deformations were modeled by a Monte Carlo simulation that follows the oxygen nuclei in its trajectory until photon emission, considering the changes in spatial distribution of the

  8. Coexistence of phases in asymmetric nuclear matter under strong magnetic fields

    Aguirre, R

    2014-01-01

    The equation of state of nuclear matter is strongly affected by the presence of a magnetic field. Here we study the equilibrium configuration of asymmetric nuclear matter for a wide range of densities, isospin composition, temperatures and magnetic fields. Special attention is paid to the low density and low temperature domain, where a thermodynamical instability exists. Neglecting fluctuations of the Coulomb force, a coexistence of phases is found under such conditions, even for extreme magnetic intensities. We describe the nuclear interaction by using the non--relativistic Skyrme potential model within a Hartree--Fock approach. We found that the coexistence of phases modifies the equilibrium configuration, masking most of the manifestations of the spin polarized matter. However, the compressibility and the magnetic susceptibility show clear signals of this fact. Thermal effects are significative for both quantities, mainly out of the coexistence region.

  9. Assessment of chemical exchange in tryptophan–albumin solution through 19F multicomponent transverse relaxation dispersion analysis

    A number of NMR methods possess the capability of probing chemical exchange dynamics in solution. However, certain drawbacks limit the applications of these NMR approaches, particularly, to a complex system. Here, we propose a procedure that integrates the regularized nonnegative least squares (NNLS) analysis of multiexponential T2 relaxation into Carr–Purcell–Meiboom–Gill (CPMG) relaxation dispersion experiments to probe chemical exchange in a multicompartmental system. The proposed procedure was validated through analysis of 19F T2 relaxation data of 6-fluoro-DL-tryptophan in a two-compartment solution with and without bovine serum albumin. Given the regularized NNLS analysis of a T2 relaxation curve acquired, for example, at the CPMG frequency υCPMG = 125, the nature of two distinct peaks in the associated T2 distribution spectrum indicated 6-fluoro-DL-tryptophan either retaining the free state, with geometric mean */multiplicative standard deviation (MSD) = 1851.2 ms */1.51, or undergoing free/albumin-bound interconversion, with geometric mean */MSD = 236.8 ms */1.54, in the two-compartment system. Quantities of the individual tryptophan species were accurately reflected by the associated T2 peak areas, with an interconversion state-to-free state ratio of 0.45 ± 0.11. Furthermore, the CPMG relaxation dispersion analysis estimated the exchange rate between the free and albumin-bound states in this fluorinated tryptophan analog and the corresponding dissociation constant of the fluorinated tryptophan–albumin complex in the chemical-exchanging, two-compartment system

  10. Assessment of chemical exchange in tryptophan–albumin solution through {sup 19}F multicomponent transverse relaxation dispersion analysis

    Lin, Ping-Chang, E-mail: pingchang.lin@howard.edu [Howard University, Department of Radiology, College of Medicine (United States)

    2015-06-15

    A number of NMR methods possess the capability of probing chemical exchange dynamics in solution. However, certain drawbacks limit the applications of these NMR approaches, particularly, to a complex system. Here, we propose a procedure that integrates the regularized nonnegative least squares (NNLS) analysis of multiexponential T{sub 2} relaxation into Carr–Purcell–Meiboom–Gill (CPMG) relaxation dispersion experiments to probe chemical exchange in a multicompartmental system. The proposed procedure was validated through analysis of {sup 19}F T{sub 2} relaxation data of 6-fluoro-DL-tryptophan in a two-compartment solution with and without bovine serum albumin. Given the regularized NNLS analysis of a T{sub 2} relaxation curve acquired, for example, at the CPMG frequency υ{sub CPMG} = 125, the nature of two distinct peaks in the associated T{sub 2} distribution spectrum indicated 6-fluoro-DL-tryptophan either retaining the free state, with geometric mean */multiplicative standard deviation (MSD) = 1851.2 ms */1.51, or undergoing free/albumin-bound interconversion, with geometric mean */MSD = 236.8 ms */1.54, in the two-compartment system. Quantities of the individual tryptophan species were accurately reflected by the associated T{sub 2} peak areas, with an interconversion state-to-free state ratio of 0.45 ± 0.11. Furthermore, the CPMG relaxation dispersion analysis estimated the exchange rate between the free and albumin-bound states in this fluorinated tryptophan analog and the corresponding dissociation constant of the fluorinated tryptophan–albumin complex in the chemical-exchanging, two-compartment system.

  11. Nuclear spin magnetic resonance force microscopy using slice modulation

    We report a Boltzmann polarization nuclear spins detection of cycle adiabatic inversion based on resonance slice thickness modulation. The nano-scale localized spin scanning NMRFM is applied using spins locked and anti-locked in the cycling frame. We also create a number of polarization spins among 1012 observing the spin relaxation and dipole-dipole interaction at gradient field 1520 T/m. The changes of nuclear spin signal intensity and relaxation time could be evidence for the nuclear collective excitation and predictions of nuclear spin collective excitation energy

  12. Neutron Diffraction Studies of Nuclear Magnetic Ordering in Copper

    Jyrkkiö, T.A.; Huiku, M.T.; Siemensmeyer, K.;

    1989-01-01

    neutrons. By observing the (100) Bragg reflection, we have unambiguously proven antiferromagnetic ordering of the copper nuclear spins. Using a linear, position-sensitive detector, the time evolution of this peak was followed during the warm-up of the nuclear spin system. The peak intensity was found to...

  13. Nuclear magnetic resonance at 310 MHz in a superconducting solenoid

    The realisation of an NMR spectrometer with a superconducting magnet is presented in the first section. The methods to attain the best possible homogeneity of the magnetic field and to minimize the error in the spectrometer are described. The second section is devoted to the study of elastomers and nitr-oxides free radicals. A shift of the transition temperature with the magnetic field appears for the elastomers. The increasing paramagnetic shift has allowed a complete study by NMR of piperidinic and pyrrolidinic nitroxide free radicals. (author)

  14. Force-detected nuclear magnetic resonance: recent advances and future challenges

    We review recent efforts to detect small numbers of nuclear spins using magnetic resonance force microscopy. Magnetic resonance force microscopy (MRFM) is a scanning probe technique that relies on the mechanical measurement of the weak magnetic force between a microscopic magnet and the magnetic moments in a sample. Spurred by the recent progress in fabricating ultrasensitive force detectors, MRFM has rapidly improved its capability over the last decade. Today it boasts a spin sensitivity that surpasses conventional, inductive nuclear magnetic resonance detectors by about eight orders of magnitude. In this review we touch on the origins of this technique and focus on its recent application to nanoscale nuclear spin ensembles, in particular on the imaging of nanoscale objects with a three-dimensional (3D) spatial resolution better than 10 nm. We consider the experimental advances driving this work and highlight the underlying physical principles and limitations of the method. Finally, we discuss the challenges that must be met in order to advance the technique towards single nuclear spin sensitivity-and perhaps-to 3D microscopy of molecules with atomic resolution. (topical review)

  15. Introduction to the controlled nuclear fusion (magnetic containment systems)

    The magnetic containment systems, their more important features, and their potentiality to became thermonuclear reactors is described. The work is based upon the first part of a set of lectures dedicated to Plasma and Fusion Physics. (author)

  16. Solid state nuclear magnetic resonance investigations of advanced energy materials

    Bennett, George D.

    In order to better understand the physical electrochemical changes that take place in lithium ion batteries and asymmetric hybrid supercapacitors solid state nuclear magnetic resonance (NMR) spectroscopy has been useful to probe and identify changes on the atomic and molecular level. NMR is used to characterize the local environment and investigate the dynamical properties of materials used in electrochemical storage devices (ESD). NMR investigations was used to better understand the chemical composition of the solid electrolyte interphase which form on the negative and positive electrodes of lithium batteries as well as identify the breakdown products that occur in the operation of the asymmetric hybrid supercapacitors. The use of nano-structured particles in the development of new materials causes changes in the electrical, structural and other material properties. NMR was used to investigate the affects of fluorinated and non fluorinated single wall nanotubes (SWNT). In this thesis three experiments were performed using solid state NMR samples to better characterize them. The electrochemical reactions of a lithium ion battery determine its operational profile. Numerous means have been employed to enhance battery cycle life and operating temperature range. One primary means is the choice and makeup of the electrolyte. This study focuses on the characteristics of the solid electrolyte interphase (SEI) that is formed on the electrodes surface during the charge discharge cycle. The electrolyte in this study was altered with several additives in order to determine the influence of the additives on SEI formation as well as the intercalation and de-intercalation of lithium ions in the electrodes. 7Li NMR studies where used to characterize the SEI and its composition. Solid state NMR studies of the carbon enriched acetonitrile electrolyte in a nonaqueous asymmetric hybrid supercapacitor were performed. Magic angle spinning (MAS) coupled with cross polarization NMR

  17. Development of magnetic dynamic damper for nuclear power plant

    This paper describes a magnetic dynamic damper (MDD), which is a passive vibration absorber employing a permanent magnet and a conductor for both the restoring and damping force. The basic characteristics of this magnetic spring and damper system are examined through static loading tests and vibration tests using a pair of double cylindrical magnets. It is confirmed that the magnetic force analysis accurately simulates these test results. Application of this system to a rotating machinery model shows that the MDD can effectively reduce two-dimensional vibration. Moreover, through the forced vibration test in which MDD is attached to the bottom of vertical pump, it is examined that the proposed MDD can be applicable for seismic response reduction over the wide region of pump casing displacement. The top heavy valve equipped on piping vibrates biaxially at different frequencies. In this case, it is confirmed from the vibration tests using a valve-piping model that the MDD with multiple rectangular magnets is effective in reducing two-dimensional vibration with different frequencies. (author)

  18. Nanoscopic yttrium oxide fluorides: non-aqueous fluorolytic sol-gel synthesis and structural insights by 19F and 89Y MAS NMR.

    Scholz, G; Dreger, M; Bertram, R; Kemnitz, E

    2015-08-14

    Nanoscopic yttrium acetate fluorides Y(CH(3)COO)(3-z)F(z) and yttrium oxide fluorides YO(3-z)/(2)F(z )were prepared with tunable Y/F molar ratios via the fluorolytic sol-gel route. All samples were characterized by X-ray diffraction, elemental analysis and thermal analysis. In addition, local structures of all samples were studied by (19)F MAS, (19)F-(89)Y CP MAS and (1)H-(89)Y CP MAS NMR spectroscopy and the respective chemical shifts are given. For both classes of compounds, only the fluorination using one equivalent of F (z = 1) leads to defined, well crystalline matrices: yttrium acetate fluoride Y(CH(3)COO)(2)F and r-YOF. PMID:26133504

  19. Nuclear magnetic resonance detection and spectroscopy of single proteins using quantum logic

    Lovchinsky, I.; Sushkov, A. O.; Urbach, E.; de Leon, N. P.; Choi, S.; De Greve, K.; Evans, R.; Gertner, R.; Bersin, E.; Müller, C.; McGuinness, L.; Jelezko, F.; Walsworth, R. L.; Park, H.; Lukin, M. D.

    2016-02-01

    Nuclear magnetic resonance spectroscopy is a powerful tool for the structural analysis of organic compounds and biomolecules but typically requires macroscopic sample quantities. We use a sensor, which consists of two quantum bits corresponding to an electronic spin and an ancillary nuclear spin, to demonstrate room temperature magnetic resonance detection and spectroscopy of multiple nuclear species within individual ubiquitin proteins attached to the diamond surface. Using quantum logic to improve readout fidelity and a surface-treatment technique to extend the spin coherence time of shallow nitrogen-vacancy centers, we demonstrate magnetic field sensitivity sufficient to detect individual proton spins within 1 second of integration. This gain in sensitivity enables high-confidence detection of individual proteins and allows us to observe spectral features that reveal information about their chemical composition.

  20. Nuclear magnetic resonance study of pure and Ni/Co doped LiFeAs

    We present Nuclear Magnetic and Nuclear Quadrupole Resonance (NMR/NQR) measurements on pure, Ni and Co doped LiFeAs single crystals. The parent compound LiFeAs exhibits unconventional superconductivity with a transition temperature of about 17 K. Unlike other Fe based superconductors, where superconductivity is induced or stabilized by Co or Ni doping, replacement of Fe by these elements leads to a suppression of the superconducting transition temperature in LiFeAs. In case of Ni doping, a bulk magnetic order is induced below about 160 K. In contrast, for Co doping, the superconducting transition temperature is only reduced, but no magnetic order is observed. We discuss the nature and the origin of this magnetic order and its relation to unconventional superconductivity in pure LiFeAs.

  1. 19F-decoupling of half-integer spin quadrupolar nuclei in solid-state NMR: application of frequency-swept decoupling methods.

    Chandran, C Vinod; Hempel, Günter; Bräuniger, Thomas

    2011-09-01

    In solid-state NMR studies of minerals and ion conductors, quadrupolar nuclei like (7)Li, (23)Na or (133)Cs are frequently situated in close proximity to fluorine, so that application of (19)F decoupling is beneficial for spectral resolution. Here, we compare the decoupling efficiency of various multi-pulse decoupling sequences by acquiring (19)F-decoupled (23)Na-NMR spectra of cryolite (Na(3)AlF(6)). Whereas the MAS spectrum is only marginally affected by application of (19)F decoupling, the 3Q-filtered (23)Na signal is very sensitive to it, as the de-phasing caused by the dipolar interaction between sodium and fluorine is three-fold magnified. Experimentally, we find that at moderate MAS speeds, the decoupling efficiencies of the frequency-swept decoupling schemes SW(f)-TPPM and SW(f)-SPINAL are significantly better than the conventional TPPM and SPINAL sequences. The frequency-swept sequences are therefore the methods of choice for efficient decoupling of quadrupolar nuclei with half-integer spin from fluorine. PMID:21856132

  2. Completion of the Operational Closure of Tank 18F and Tank 19F at the Savannah River Site by Grouting - 13236

    Radioactive waste is stored in underground waste tanks at the Savannah River Site (SRS). The low-level fraction of the waste is immobilized in a grout waste form, and the high level fraction is disposed of in a glass waste form. Once the waste is removed, the tanks are prepared for closure. Operational closure of the tanks consists of filling with grout for the purpose of chemically stabilizing residual material, filling the tank void space for long-term structural stability, and discouraging future intrusion. Two of the old-style single-shell tanks at the SRS have received regulatory approval confirming waste removal had been completed, and have been stabilized with grout as part of completing operational closure and removal from service. Consistent with the regulatory framework, two types of grout were used for the filling of Tanks 18F and 19F. Reducing grout was used to fill the entire volume of Tanks 18F and 19F (bulk fill grout) and a more flowable grout was used to fill equipment that was left in the tank (equipment fill grout). The reducing grout was added to the tanks using portable grout pumps filled from concrete trucks, and delivered the grout through slick lines to the center riser of each tank. Filling of the two tanks has been completed, and all equipment has been filled. The final capping of riser penetrations brings the operation closure of Tanks 18F and 19F to completion. (authors)

  3. Theoretical investigation of the 19F(p, p0) differential cross section up to Ep = 2.3 MeV

    Paneta, V.; Gurbich, A.; Kokkoris, M.

    2016-03-01

    The use of experimental cross-section data on fluorine in analytical EBS studies is quite problematic, because they are indeed inadequate and discrepant (up to ∼30%). The evaluated values on the other hand, being produced by incorporating the available experimental cross sections within a unified theoretical approach, provide the most reliable data to be used and are therefore very important. The present work contributes in this field by reproducing and attempting to extend the corresponding evaluation for 19F(p, p0), which ranges up to 1730 keV, to proton energies up to 2250 keV, using the AZURE code. The performed R-matrix calculations involved the simultaneous analysis of several experimental input datasets, as well as spectroscopic information concerning the formed compound nucleus 20Ne, while valuable feedback information was provided by proton benchmarking spectra on ZnF2 taken at Ep = 1730 and 2250 keV and at several backscattering angles for the fine tuning of the parameters used. The problem of the 19F(p, p‧) and 19F(p, αx) contributions in the obtained thick target yield spectra is also discussed.

  4. Nuclear magnetic resonance imaging in patients with hypertrophic and dilated cardiomyopathy

    Patients with hypertrophic and dilated cardiomyopathy and normal subjects were investigated with nuclear magnetic resonance imaging. To evaluate the NMR scanner possibilities, the results were compared with the echocardiographic investigation of the same patients. The capabilities of NMR imaging to provide information about intracardiac anatomy are emphasized. This study is preceded by a description of the physical principles underlying the phenomenon of nuclear magnetic resonance and of the techniques used to obtain NMR images and a review of the clinical use of NMR imaging for cardiac diagnosis

  5. Diamond-nitrogen-vacancy electronic and nuclear spin-state anticrossings under weak transverse magnetic fields

    Clevenson, Hannah; Chen, Edward H.; Dolde, Florian; Teale, Carson; Englund, Dirk; Braje, Danielle

    2016-08-01

    We report on detailed studies of electronic and nuclear spin states in the diamond-nitrogen-vacancy (NV) center under weak transverse magnetic fields. We numerically predict and experimentally verify a previously unobserved NV hyperfine level anticrossing (LAC) occurring at bias fields of tens of gauss—two orders of magnitude lower than previously reported LACs at ˜500 and ˜1000 G axial magnetic fields. We then discuss how the NV ground-state Hamiltonian can be manipulated in this regime to tailor the NV's sensitivity to environmental factors and to map into the nuclear spin state.

  6. Nuclear magnetic resonance analysis of freeze-thaw damage in natural pumice concrete

    Wang, Xiaoxiao; Shen, Xiangdong; Wang, Hailong; Gao, Chu; Zhang, Tong

    2016-01-01

    This paper presents an analysis of the damage propagation features of the pore structure of natural pumice lightweight aggregate concrete (LWC) under freeze-thaw cyclic action. After freeze-thaw cycling, we conducted nuclear magnetic resonance (NMR) tests on the concrete and acquired the porosity, distribution of transverse relaxation time T2, and magnetic resonance imaging (MRI) results. The results showed the following. The T2 distribution of the LWC prior to freeze-thaw cycling presented f...

  7. SQUIDs vs. Induction Coils for Ultra-Low Field Nuclear Magnetic Resonance: Experimental and Simulation Comparison

    Matlashov, Andrei N.; Schultz, Larry J.; Espy, Michelle A.; Kraus, Robert H.; Savukov, Igor M.; Volegov, Petr L.; Wurden, Caroline J.

    2011-01-01

    Nuclear magnetic resonance (NMR) is widely used in medicine, chemistry and industry. One application area is magnetic resonance imaging (MRI). Recently it has become possible to perform NMR and MRI in the ultra-low field (ULF) regime requiring measurement field strengths of the order of only 1 Gauss. This technique exploits the advantages offered by superconducting quantum interference devices or SQUIDs. Our group has built SQUID based MRI systems for brain imaging and for liquid explosives d...

  8. Materials of the 39 Polish Seminar on Nuclear Magnetic Resonance and Its Applications - Abstracts

    The Report comprises abstracts of 78 communications presented during the 39 Polish Seminar on Nuclear Magnetic Resonance and Its Applications, held on November, 30 - December, 2006 in Cracow (PL). They cover a variety of research fields, including magnetic resonance imaging in vivo, applications of NMR spectroscopy to medical diagnosis, studies on molecular properties of different materials as well as quantum chemical calculations of NMR parameters

  9. Determination of the Defining Boundary in Nuclear Magnetic Resonance Diffusion Experiments

    Laun, Frederik Bernd; Kuder, Tristan Anselm; Semmler, Wolfhard; Stieltjes, Bram

    2010-01-01

    While nuclear magnetic resonance diffusion experiments are widely used to resolve structures confining the diffusion process, it has been elusive whether they can exactly reveal these structures. This question is closely related to X-ray scattering and to Kac's "hear the drum" problem. Although the shape of the drum is not "hearable", we show that the confining boundary of closed pores can indeed be detected using modified Stejskal-Tanner magnetic field gradients that preserve the phase infor...

  10. 41 Polish Seminar on Nuclear Magnetic Resonance and Its Applications - Abstracts

    The Report consist of abstracts of 63 communications presented during the 41 Polish Seminar on Nuclear Magnetic Resonance and Its Applications, held on December 1-2, 2008 in Cracow. Presentations cover a variety of research fields, including magnetic resonance imaging in vivo, applications of NMR spectroscopy to medical diagnosis, studies on molecular properties of different materials as well as quantum chemical calculations of NMR parameters

  11. Quantum Computation Based on Magic-Angle-Spinning Solid State Nuclear Magnetic Resonance Spectroscopy

    Ding, Shangwu; McDowell, Charles A.; Ye, Chaohui; Zhan, Mingsheng; Zhu, Xiwen; Gao, Kelin; Sun, Xianping; Mao, Xi-An; Liu, Maili

    2001-01-01

    Magic-angle spinning (MAS) solid state nuclear magnetic resonance (NMR) spectroscopy is shown to be a promising technique for implementing quantum computing. The theory underlying the principles of quantum computing with nuclear spin systems undergoing MAS is formulated in the framework of formalized quantum Floquet theory. The procedures for realizing state labeling, state transformation and coherence selection in Floquet space are given. It suggests that by this method, the largest number o...

  12. Nuclear magnetic resonance relaxation and diffusion in the presence of internal gradients: the effect of magnetic field strength.

    Mitchell, J; Chandrasekera, T C; Johns, M L; Gladden, L F; Fordham, E J

    2010-02-01

    It is known that internal magnetic field gradients in porous materials, caused by susceptibility differences at the solid-fluid interfaces, alter the observed effective Nuclear Magnetic Resonance transverse relaxation times T2,eff. The internal gradients scale with the strength of the static background magnetic field B0. Here, we acquire data at various magnitudes of B0 to observe the influence of internal gradients on T2-T2 exchange measurements; the theory discussed and observations made are applicable to any T2-T2 analysis of heterogeneous materials. At high magnetic field strengths, it is possible to observe diffusive exchange between regions of local internal gradient extrema within individual pores. Therefore, the observed exchange pathways are not associated with pore-to-pore exchange. Understanding the significance of internal gradients in transverse relaxation measurements is critical to interpreting these results. We present the example of water in porous sandstone rock and offer a guideline to determine whether an observed T2,eff relaxation time distribution reflects the pore size distribution for a given susceptibility contrast (magnetic field strength) and spin echo separation. More generally, we confirm that for porous materials T1 provides a better indication of the pore size distribution than T2,eff at high magnetic field strengths (B0>1 T), and demonstrate the data analysis necessary to validate pore size interpretations of T2,eff measurements. PMID:20365625

  13. 59Co NMR and nuclear magnetic relaxation study of the magnetic superconductor Y9Co7

    The magnetic superconductor Y9Co7 presented in its structure magnetic and non-magnetic Co atoms. A search was made of the 59Co NMR lines attributed in the literature to magnetic Co atoms, With negative results. For the strong 59Co NMR line arising from nuclei of non-magnetic Co atoms the relaxation times T1 and T2 versus temperature were measured directly at 6.5 MHz and 9.0 MHz. A linear dependence on temperature was observed for 1/T1 which can be attributed to interactions with conduction electrons. 1/T2 is not linear with temperature, an effect that is related to the temperature dependence of the magnetization. (Authors)

  14. Nuclear magnetic resonance imaging of the central nervous system

    In this article a review is given of the use of magnetic resonance imaging for the central nervous system. An example of the screening of the population for multiple scelerosis is given. A good preliminary examination and the supply of relevant information to the person which performs the imaging is necessary. (R.B.). 9 figs.; 4 tabs

  15. Design of Matrix Shim Coils System for Nuclear magnetic resonance

    Konzbul, Pavel; Švéda, Karel; Srnka, Aleš

    2000-01-01

    Roč. 36, č. 4 (2000), s. 1732-1735. ISSN 0018-9464. [COMPUMAG /12./. Sapporo, 25.10.1999-28.10.1999] R&D Projects: GA MŠk ME 181 Institutional research plan: CEZ:AV0Z2065902 Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.720, year: 2000

  16. Nuclear magnetic resonance J coupling constant polarizabilities of hydrogen peroxide

    Kjær, Hanna; Nielsen, Monia R.; Pagola, Gabriel I.;

    2012-01-01

    In this paper we present the so far most extended investigation of the calculation of the coupling constant polarizability of a molecule. The components of the coupling constant polarizability are derivatives of the NMR indirect nuclear spin-spin coupling constant with respect to an external elec...

  17. One-pion exchange current corrections for nuclear magnetic moments in relativistic mean field theory

    Li, Jian; Meng, J; Arima, A

    2010-01-01

    The one-pion exchange current corrections to isoscalar and isovector magnetic moments of double-closed shell nuclei plus and minus one nucleon with $A=15,17,39$ and 41 have been studied in the relativistic mean field (RMF) theory and compared with previous relativistic and non-relativistic results. It has been found that the one-pion exchange current gives a negligible contribution to the isoscalar magnetic moments but a significant correction to the isovector ones. However, the one-pion exchange current doesn't improve the description of nuclear isovector magnetic moments for the concerned nuclei.

  18. Bohr-Weisskopf effect: influence of the distributed nuclear magnetization on hfs

    Nuclear magnetic moments provide a sensitive test of nuclear wave functions, in particular those of neutrons, which are not readily obtainable from other nuclear data. These are taking added importance by recent proposals to study parity non-conservation (PNC) effects in alkali atoms in isotopic series. By taking ratios of the PNC effects in pairs of isotopes, uncertainties in the atomic wave functions are largely cancelled out at the cost of knowledge of the change in the neutron wave function. The Bohr-Weisskopf effect (B-W) in the hyperfine structure interaction of atoms measures the influence of the spatial distribution of the nuclear magnetization, and thereby provides an additional constraint on the determination of the neutron wave function. The added great importance of B-W in the determination of QED effects from the hfs in hydrogen-like ions of heavy elements, as measured recently at GSI, is noted. The B-W experiments require precision measurements of the hfs interactions and, independently, of the nuclear magnetic moments. A novel atomic beam magnetic resonance (ABMR) method, combining rf and laser excitation, has been developed for a systematic study and initially applied to stable isotopes. Difficulties in adapting the experiment to the ISOLDE radioactive ion beam, which have now been surmounted, are discussed. A first radioactive beam measurement for this study, the precision hfs of 126Cs, has been obtained recently. The result is 3629.515( 0.001) MHz. The ability of ABMR to determine with high precision nuclear magnetic moments in free atoms is a desideratum for the extraction of QED effects from the hfs of the hydrogen-like ions. We also point out manifestations of B-W in condensed matter and atomic physics

  19. Progress on tilted axis cranking covariant density functional theory for nuclear magnetic and antimagnetic rotation

    孟杰; 彭婧; 张双全; 赵鹏巍

    2013-01-01

    Magnetic rotation and antimagnetic rotation are exotic rotational phenomena observed in weakly deformed or near-spherical nuclei, which are respectively interpreted in terms of the shears mechanism and two shearslike mechanism. Since their observations, magnetic rotation and antimagnetic rotation phenomena have been mainly investigated in the framework of tilted axis cranking based on the pairing plus quadrupole model. For the last decades, the covariant density functional theory and its extension have been proved to be successful in describing series of nuclear ground-states and excited states properties, including the binding energies, radii, single-particle spectra, reso- nance states, halo phenomena, magnetic moments, magnetic rotation, low-lying excitations, shape phase transitions, collective rotation and vibrations, etc. This review will mainly focus on the tilted axis cranking covariant density functional theory and its application for the magnetic rotation and antimagnetic rotation phenomena.

  20. Nuclear magnetic resonance imaging in diseases of the white matter

    The progress made in the field of medical imaging since the advent of magnetic resonance tomography is particularly evident in many disorders that are a domain of neuroradiology. The diagnosis and differential diagnosis of diseases of the white matter not only require accurate examination techniques but must just as well be based on the clinical symptoms observed. In the detection of diseases of the white matter magnetic resonance tomography is much more sensitive a tool than computed tomography. As it is normal for the images of any lesions to be isointense or hypointense as a result of T1 weighting and hyperintense in connection with T2 weighting, they may lead to a doubtful diagnosis, unless the interpretation is made by an experienced investigator taking account also of the pattern of structural changes and the neurologic-psychiatric manifestations of the disease. (orig.)

  1. Magnetic Separation for Nuclear Material Detection and Surveillance

    A high performance superconducting magnet is being developed for particle retrieval from field collected samples. Results show that maximum separation effectiveness is obtained when the matrix fiber diameter approaches the diameter of the particles to be captured. Experimentally, the authors obtained a single particle capture limit with 0.8microm PuO2 particles with dodecane as a carrier fluid. The development of new matrix materials is being pursued through the controlled corrosion of stainless steel wool, or the deposition of nickel dendrites on the existing stainless steel matrix material. They have also derived a model from a continuity equation that uses empirically determined capture cross section values. This enables the prediction of high gradient magnetic separator performance for a variety of materials and applications. The model can be used to optimize the capture cross section and thus increase the capture efficiency

  2. Value of nuclear magnetic resonance imaging in cardiology

    The present study summarizes an experience with Magnetic Resonance Imaging (MRI) in the evaluation of twelve patients with a variety of cardiac abnormalities (myocardial infarction, mural thrombi, obstructive cardiomyopathy, pericarditis). The results are compared with clinical data, with measurements from other techniques such as two-dimensional echocardiography and with the images in normal subjects. An anticipated advantage of MRI is the ability to provide better tissue characterization, than has been attained with other imaging techniques, by relaxation time measurement

  3. Wavelet and adaptive filtration of the nuclear magnetic resonance signal

    Bartušek, Karel

    2002-01-01

    Roč. 11, - (2002), s. 13 - 18. ISSN 0862-9846. [Datastat'01. Brno, 27.08.2001-30.08.2001] R&D Projects: GA ČR GA102/96/1136; GA AV ČR IAA2065201 Institutional research plan: CEZ:AV0Z2065902 Keywords : Wavelet filtration * adaptive filtration * magnetic resonance signal Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering

  4. Nuclear magnetic imaging for MTRA. Spinal canal and spinal cord

    The booklet covers the following topics: (1) Clinical indications for NMR imaging of spinal cord and spinal canal; (2) Methodic requirements: magnets and coils, image processing, contrast media: (3) Examination technology: examination conditions, sequences, examination protocols; (4) Disease pattern and indications: diseases of the myelin, the spinal nerves and the spinal canal (infections, tumors, injuries, ischemia and bleedings, malformations); diseases of the spinal cord and the intervertebral disks (degenerative changes, infections, injuries, tumors, malformations).

  5. Sealed magic angle spinning nuclear magnetic resonance probe and process for spectroscopy of hazardous samples

    Cho, Herman M.; Washton, Nancy M.; Mueller, Karl T.; Sears, Jr., Jesse A.; Townsend, Mark R.; Ewing, James R.

    2016-06-14

    A magic-angle-spinning (MAS) nuclear magnetic resonance (NMR) probe is described that includes double containment enclosures configured to seal and contain hazardous samples for analysis. The probe is of a modular design that ensures containment of hazardous samples during sample analysis while preserving spin speeds for superior NMR performance and convenience of operation.

  6. A Noninvasive Method to Study Regulation of Extracellular Fluid Volume in Rats Using Nuclear Magnetic Resonance

    Time-domain nuclear magnetic resonance (TD-NMR)-based measurement of body composition of rodents is an effective method to quickly and repeatedly measure proportions of fat, lean, and fluid without anesthesia. TD-NMR provides a measure of free water in a living animal, termed % f...

  7. Nuclear magnetic resonance and sound velocity measurements of chalk saturated with magnesium rich brine

    Katika, Konstantina; Alam, Mohammad Monzurul; Fabricius, Ida Lykke

    The use of low field Nuclear Magnetic Resonance (NMR) to determine petrophysical properties of reservoirs has proved to be a good technique. Together with sonic and electrical resistivity measurements, NMR can contribute to illustrate the changes on chalk elasticity due to different pore water...

  8. Quantitative Analysis of Nail Polish Remover Using Nuclear Magnetic Resonance Spectroscopy Revisited

    Hoffmann, Markus M.; Caccamis, Joshua T.; Heitz, Mark P.; Schlecht, Kenneth D.

    2008-01-01

    Substantial modifications are presented for a previously described experiment using nuclear magnetic resonance (NMR) spectroscopy to quantitatively determine analytes in commercial nail polish remover. The revised experiment is intended for a second- or third-year laboratory course in analytical chemistry and can be conducted for larger laboratory…

  9. Nuclear Magnetic Resonance and Elastic Wave Velocity of Chalk Saturated with Brines Containing Divalent Ions

    Katika, Konstantina; Alam, Mohammad Monzurul; Fabricius, Ida Lykke

    Nuclear magnetic resonance (NMR) has proven a good technique for measuring pore size distribution in reservoir rocks. The use of low field NMR together with sonic and electrical resistivity measurements, can contribute to illustrate the effect of adsorbing ions on chalk elasticity. NMR is useful...

  10. Nuclear magnetic resonance and sound velocity measurements of chalk saturated with magnesium rich brine

    Katika, Konstantina; Alam, Mohammad Monzurul; Fabricius, Ida Lykke

    2013-01-01

    The use of low field Nuclear Magnetic Resonance (NMR) to determine petrophysical properties of reservoirs has proved to be a good technique. Together with sonic and electrical resistivity measurements, NMR can contribute to illustrate the changes on chalk elasticity due to different pore water...

  11. Phosphorus-doped thin silica films characterized by magic-angle spinning nuclear magnetic resonance spectroscopy

    Jacobsen, H.J.; Skibsted, J.; Kristensen, Martin;

    2001-01-01

    Magic-angle spinning nuclear magnetic resonance spectra of 31P and 29Si have been achieved for a thin silica film doped with only 1.8% 31P and deposited by plasma enhanced chemical vapor deposition on a pure silicon wafer. The observation of a symmetric 31P chemical shift tensor is consistent...

  12. Water balance in Cucumis plants measured by nuclear magnetic resonance. 2.

    Reinders, J.E.A.; As, van H.; Schaafsma, T.J.; Sheriff, D.W.

    1988-01-01

    Nuclear magnetic resonance (NMR) was used to investigate the effects of changes in root temperature, of changes in the area of root in contact with culture solution and of day/night rhythm on the water balance of a cucumber and a gherkin plant. Results are discussed in terms of water potential, flow

  13. Nuclear magnetic resonance study of point defects in aluminium and copper

    The principles of Nuclear Magnetic Resonance for the determination of electrical field gradients on successive nuclei shells around a point defect are given. Results in copper and aluminium containing specific impurities or monovacancies are discussed. Measurements in electron irradiated copper show unambiguously that monovacancies migrate during stage III. (author)

  14. Interest of nuclear magnetic. Resonance imaging for the study of vascular lesions of the Thalamus

    The study of vascular lesions of the thalamus using Nuclear Magnetic Resonance imaging has provided two kinds of important informations: precise topographical demarcation on saggital sections and very sensitive detection of small ischemic areas better than with computerized tomography. Particular attention is paid to NMR capabilities to increase the quality of correlation between clinical and radiological data. 4 cases are presented

  15. Nuclear magnetic resonance of iron-57 nuclei in local fields in yttrium and iron garnets

    We have demonstrated the nuclear resonance of 57Fe nuclei in the local field of each of the two magnetic sub-lattices of yttrium and iron garnets. The resonance frequencies and the relaxation times have been measured as a function of the temperature. (author)

  16. Experimental implementation of heat-bath algorithmic cooling using solid-state nuclear magnetic resonance

    Baugh, Jonathan; Moussa, Osama; Ryan, Colm A.; Nayak, Ashwin; Laflamme, Raymond

    2005-01-01

    We report here the experimental realization of multi-step cooling of a quantum system via heat-bath algorithmic cooling. The experiment was carried out using nuclear magnetic resonance (NMR) of a solid-state ensemble three-qubit system.

  17. The magnetic field dependence of cross-effect dynamic nuclear polarization under magic angle spinning

    We develop a theoretical description of Dynamic Nuclear Polarization (DNP) in solids under Magic Angle Spinning (MAS) to describe the magnetic field dependence of the DNP effect. The treatment is based on an efficient scheme for numerical solution of the Liouville-von Neumann equation, which explicitly takes into account the variation of magnetic interactions during the sample spinning. The dependence of the cross-effect MAS-DNP on various parameters, such as the hyperfine interaction, electron-electron dipolar interaction, microwave field strength, and electron spin relaxation rates, is analyzed. Electron spin relaxation rates are determined by electron paramagnetic resonance measurements, and calculations are compared to experimental data. Our results suggest that the observed nuclear magnetic resonance signal enhancements provided by MAS-DNP can be explained by discriminating between “bulk” and “core” nuclei and by taking into account the slow DNP build-up rate for the bulk nuclei

  18. Monte Carlo Simulation of Adiabatic Cooling and Nuclear Magnetism

    Lindgård, Per-Anker; Viertiö, H. E.; Mouritsen, Ole G.

    1988-01-01

    antiferromagnetic phase in the external-field–temperature plane exhibits sections of both first- and second-order transitions separated by a tricritical point. Particular attention is paid to the isentropes of the phase diagram, which correspond to the thermodynamic paths of constant entropy followed in...... constant-temperature or constant-magnetic-field quenches into the antiferromagnetic phase is found at late times to obey the classical Allen-Cahn growth law. The qualitative features of isentropic quenches and the nonequilibrium ordering phenomena during controlled heating treatments at constant rate are...

  19. Magnetic Lenz lenses increase the limit-of-detection in nuclear magnetic resonance

    Spengler, Nils; Meissner, Markus V; Wallrabe, Ulrike; Korvink, Jan G

    2016-01-01

    A high NMR detection sensitivity is indispensable when dealing with mass and volume-limited samples, or whenever a high spatial resolution is required. The use of miniaturised RF coils is a proven way to increase sensitivity, but may be impractical and is not applicable to every experimental situation. We present the use of magnetic lenses, denoted as Lenz lenses due to their working principle, to focus the magnetic flux of a macroscopic RF coil into a smaller volume and thereby locally enhance the sensitivity of the NMR experiment - at the expense of the total sensitive volume. Besides focusing, such lenses facilitate re-guiding or re-shaping of magnetic fields much like optical lenses do with light beams. For the first time we experimentally demonstrate the use of Lenz lenses in magnetic resonance and provide a compact mathematical description of the working principle. Through simulations we show that optimal arrangements can be found.

  20. Cavity- and waveguide-resonators in electron paramagnetic resonance, nuclear magnetic resonance, and magnetic resonance imaging.

    Webb, Andrew

    2014-11-01

    Cavity resonators are widely used in electron paramagnetic resonance, very high field magnetic resonance microimaging and also in high field human imaging. The basic principles and designs of different forms of cavity resonators including rectangular, cylindrical, re-entrant, cavity magnetrons, toroidal cavities and dielectric resonators are reviewed. Applications in EPR and MRI are summarized, and finally the topic of traveling wave MRI using the magnet bore as a waveguide is discussed. PMID:25456314

  1. Nuclear magnetic resonance on selected lithium based compounds

    Rudisch, Christian

    2013-11-26

    This thesis presents the NMR measurements on the single crystals LiMnPO{sub 4} and Li{sub 0.9}FeAs. Therefore, the thesis is divided into two separated sections. The first part reports on the competitive next generation cathode material LiMnPO{sub 4} with a stable reversible capacity up to 145 mAh/g and a rather flat discharge voltage curve at 4.1 V. For the basic understanding of the material the magnetic properties have been investigated by a Li and P NMR study in the paramagnetic and antiferromagnetic phase. LiMnPO{sub 4} shows a strong anisotropy of the dipolar hyperfine coupling due to the strong local magnetic moments at the Mn site. The corresponding dipole tensor of the Li- and P-nuclei is fully determined by orientation and temperature dependent NMR experiments and compared to the calculated values from crystal structure data. Deviations of the experimentally determined values from the theoretical ones are discussed in terms of Mn disorder which could have an impact on the mobility of the Li ions. The disorder is corroborated by diffuse X-ray diffraction experiments which indicate a shift of the heavy elements in the lattice, namely the Mn atoms. Furthermore, the spin arrangement in the relative strong field of 7.0494 T in the antiferromagnetic state is understood by the NMR measurements. In order to obtain parameters of the Li ion diffusion in LiMnPO{sub 4} measurements of the spin lattice relaxation rate were performed. Due to the strong dipolar coupling between the Li-nuclei and the magnetic moments at the Mn site it is difficult to extract parameters which can characterize the diffusive behavior of the Li ions. The second section reports on the AC/DC susceptibility and NMR/NQR studies on Li deficit samples labeled as Li{sub 0.9}FeAs. LiFeAs belongs to the family of the superconducting Pnictides which are discovered in 2008 by H. Hosono et al. In recent studies the stoichiometric compound reveals triplet superconductivity below T{sub c}-18 K which

  2. Development of nuclear magnetic resonance tomography technology - TORM

    The development of hardware and software necessary to implement the Magnetic Resonance Imaging (MRI) techniques is described. The major subjects were the construction of an aquisition and control system which allowed the operation of a pulsed Fourier NMR spectrometer as a NMR Tomograph; further it was oriented the developing of a NMR spectrometer whose parameters could be easily reconfigured by the controlling system. As a result a sofisticated equipment which allows, more than the proposed, working with high resolution spectroscopic techniques and spectroscopy in solids, was obtained. Since the basic techniques employed in NMR and CT Tomographs are well known, a great emphasis was also given on the understanding of the image reconstruction techniques that constitutes today the frontier of research in this area. The results obtained with the system described here are considered good, comparable to the results from commercial units developed in cooperation with imaging groups located in universities abroad. (author)

  3. Nuclear dipolar magnetism around one microkelvin in calciumhydroxide

    This thesis is devoted to a study of dipolar magnetism of the proton spins in Ca(OH)2. First, cooling techniques are described. The energy of different spin configurations are calculated in the Weiss-field approximation. Crystallographic characteristics of Ca(OH)2 are described, as well as a method to produce monocrystals and a method for crystal doping using 1.5 MeV electron beams. It is shown that the polarization mechanism of the proton spins in Ca(OH)2 doped with O2- centra is the 'Solid Effect'. Susceptibility measurements are presented as a function of the polarization. Results imply that both at positive and at negative temperatures state ordering sets in, characterized by a plateau in the susceptibility. (Auth/G.J.P.)

  4. Magnetic separation - Advanced nanotechnology for future nuclear fuel recycle

    The unique properties of magnetic nanoparticles (MNPs), such as their extremely small size and high surface area to volume ratio, provide better kinetics for the adsorption of metal ions from aqueous solutions. In this work, we demonstrated the separation of minor actinides using complex conjugates of MNPs with diethylenetriamine-pentaacetic acid (DTPA) chelator. The sorption results show the strong affinity of DTPA towards Am (III) and Pu (IV) by extracting 97% and 80% of actinides, respectively. It is shown that the extraction process is highly dependent on the pH of the solution. If these long-term heat generating actinides can be efficiently removed from the used fuel raffinates, the volume of material that can be placed in a given amount of repository space can be significantly increased. (authors)

  5. 19F NMR spectroscopic and relaxation studies of SbF5 and AsF5 intercalated in graphite, graphite fibers, and polyacetylene

    19F NMR spectra are presented for graphite powder reacted with SbF5, NOSbF6, NO2SbF6, graphite fibers reacted with AsF5, and polyacetylene reacted with NOSbF6 and with AsF5. For polyacetylene the linewidths imply rapid rotation and slow diffusion. For the other specimens linewidths imply that both rotation and diffusion are rapid. For SbF5 in graphite an activation enthalpy of 5+-1 kcal/mol is deduced from the observed T1 behavior. (orig.)

  6. Nuclear Fusion: half a century of magnetic confinement research

    This book is written by physicists, whose distinguished carrers span most of the past half-century of fusion research. The book might be described as a scientific history. In giving a physicist's view of of fusion history, the authors are careful to document their souces, with twenty seven pages of references. They outline the roots of nuclear energy and plasma physics leading to the classification of fusion research and its declassification in 1958 in Geneva. Continuing from the profusion ideas disclosed at that time, they deal in succeding chapters with open systems, pulsed toroidal configurations and other alternatives, stellarators, and tokamaks. The concluding chapter, which is remarkably up to date, discusses the steps to a fusion reactor and th ehistory and status of ITER

  7. Nuclear Fusion: half a century of magnetic confinement research

    Hutchinson, I.H

    2002-08-01

    This book is written by physicists, whose distinguished carrers span most of the past half-century of fusion research. The book might be described as a scientific history. In giving a physicist's view of of fusion history, the authors are careful to document their souces, with twenty seven pages of references. They outline the roots of nuclear energy and plasma physics leading to the classification of fusion research and its declassification in 1958 in Geneva. Continuing from the profusion ideas disclosed at that time, they deal in succeding chapters with open systems, pulsed toroidal configurations and other alternatives, stellarators, and tokamaks. The concluding chapter, which is remarkably up to date, discusses the steps to a fusion reactor and th ehistory and status of ITER.

  8. Nuclear Magnetic Resonance Quantum Computing Using Liquid Crystal Solvents

    Yannoni, C S; Vandersypen, L M K; Miller, D C; Kubinec, M G; Chuang, I L; Yannoni, Costantino S.; Sherwood, Mark H.; Vandersypen, Lieven M.K.; Miller, Dolores C.; Kubinec, Mark G.; Chuang, Isaac L.

    1999-01-01

    Liquid crystals offer several advantages as solvents for molecules used for NMR quantum computing (NMRQC). The dipolar coupling between nuclear spins manifest in the NMR spectra of molecules oriented by a liquid crystal permits a significant increase in clock frequency, while short spin-lattice relaxation times permit fast recycling of algorithms, and save time in calibration and signal-enhancement experiments. Furthermore, the use of liquid crystal solvents offers scalability in the form of an expanded library of spin-bearing molecules suitable for NMRQC. These ideas are demonstrated with the successful execution of a 2-qubit Grover search using a molecule ($^{13}$C$^{1}$HCl$_3$) oriented in a liquid crystal and a clock speed eight times greater than in an isotropic solvent. Perhaps more importantly, five times as many logic operations can be executed within the coherence time using the liquid crystal solvent.

  9. Fabrication and Magnetic Properties of Co-Doped TiO2 Powders Studied by Nuclear Magnetic Resonance

    GE Shi-Hui; WANG Xin-Wei; KOU Xiao-Ming; ZHOU Xue-Yun; XI Li; ZUO Ya-Lu; YANG Xiao-Lin; ZHAO Yu-Xuan

    2005-01-01

    @@ Co0.04 Ti0.96 O2 powders are fabricated by sol-gel method. The structure and magnetic properties are investigated under different annealing conditions systematically with emphasis on the influence of oxygen pressure. Pure anatase structure was acquired for all the samples annealed at 450 ℃ for one hour. The samples annealed in air exhibit evident room-temperature ferromagnetism (RTFM) with a small magnetic moment of 0.029μB per Co atom and coercivity Hc of 26 Oe, while the samples annealed in vacuum have strong RTFM with a larger magnetic moment of 1.18 μB per Co atom and Hc of 430 Oe. The zero-field spin echo nuclear magnetic resonance spectrum of 59 Co is obtained to prove the existence of Co clusters in the latter samples, implying that the Co clusters are responsible for the strong RTFM in the samples annealed in vacuum. No Co cluster could be observed using both XPS and NMR techniques in the samples annealed in air, implying that the RTFM found in these samples is intrinsic.

  10. Methodological aspects in the calculation of parity-violating effects in nuclear magnetic resonance parameters.

    Weijo, Ville; Bast, Radovan; Manninen, Pekka; Saue, Trond; Vaara, Juha

    2007-02-21

    We examine the quantum chemical calculation of parity-violating (PV) electroweak contributions to the spectral parameters of nuclear magnetic resonance (NMR) from a methodological point of view. Nuclear magnetic shielding and indirect spin-spin coupling constants are considered and evaluated for three chiral molecules, H2O2, H2S2, and H2Se2. The effects of the choice of a one-particle basis set and the treatment of electron correlation, as well as the effects of special relativity, are studied. All of them are found to be relevant. The basis-set dependence is very pronounced, especially at the electron correlated ab initio levels of theory. Coupled-cluster and density-functional theory (DFT) results for PV contributions differ significantly from the Hartree-Fock data. DFT overestimates the PV effects, particularly with nonhybrid exchange-correlation functionals. Beginning from third-row elements, special relativity is of importance for the PV NMR properties, shown here by comparing perturbational one-component and various four-component calculations. In contrast to what is found for nuclear magnetic shielding, the choice of the model for nuclear charge distribution--point charge or extended (Gaussian)--has a significant impact on the PV contribution to the spin-spin coupling constants. PMID:17328593

  11. What can nuclear magnetic moments reveal about the microscopic nature of tunnelling systems in glasses?

    More than thirty years ago anomalies in glasses at low temperatures were successfully explained by introducing atomic tunnelling systems (TS), described by the phenomenological standard tunnelling model. However, the universal behaviour of glasses prevented the experimental investigation of the microscopic nature of these TSs. Recently, unexpected magnetic field effects of the dielectric constant and of the two pulse polarisation echo amplitude, observed in non-magnetic glasses, turned out to be a proper experimental tool to investigate the microscopics of TSs. The echo experiments, done on glycerol and deuterated glycerol, prove that the interaction of nuclear quadrupole moments with local electric field gradients as well as interacting nuclear magnetic dipoles cause the observed magnetic field effects. Interestingly, the magnitude of the echo amplitude variations in magnetic fields is governed by the motion of the TSs. We present the measured effects together with numerical calculations based on the mentioned interactions which enable us to derive details of the TS's microscopic motions in glycerol. These calculations were done without considering dissipative processes acting at finite temperatures and, therefore, are strictly valid only at T=0. An analysis of the measured echo decay at different temperatures suggests that this quantum behaviour is observed, on the time scale of our measurements, at temperatures below 5mK.

  12. Longitudinal nuclear magnetic resonance of 3He-B superfluid

    Experiments which contribute to a better understanding of the 3He superfluid in the B phase are reported: a/ The first direct determinations of the gap parameter at zero temperature are given and the longitudinal N.M.R. frequency signal is measured for various pressures. b/ These experiments show a new saturation phenomenon in the ringing signal decay time Tsub(R)(T) at low temperatures. c/ Under conditions of slight non-linearity the excitation of 3He-B longitudinal N.M.R. gives rise to a special system wherein the ringing signal decay is all the faster as the excitation is stronger. A so-called ''memory'' time is measured distinctly longer than the ringing time measured under quasi-linear excitation conditions. It was found that the ringing signal decay, at first exponential for weak excitations γH1 approximately 7 10-3 Ωsub(L), becomes quasi-linear when the excitation is about γH1 approximately 10-2Ωsub(L). This abnormal behaviour cannot be explained by thermal effects related to N.M.R. excitation nor by inhomogeneity effects of the excitation magnetic field. Our interpretation is that excitations γH1 approximately 10-2 Ωsub(L) cause structural defects in the orientation of the vector n which are found to disappear according to an exponential law in times of around 10 ms

  13. Resolution and sensitivity of high field nuclear magnetic resonance spectroscopy

    The arrival of very high field magnets and cryogenic circuitries, and the development of relaxation-optimized pulse sequences have added powerful tools for increasing sensitivity and resolution in NMR studies of biomacromolecules. The potential of these advances is not fully realized in practice, however, since current experimental protocols do not permit sufficient data sampling for optimal resolution in the indirect dimensions. Here we analyze quantitatively how increasing resolution in indirect dimensions affects the S/N ratio and compare this with currently used sampling routines. Optimal resolution would require sampling up to ∼3R2-1, and the S/N reaches a maximum at ∼1.2R2-1. Currently used data acquisition protocols rarely sample beyond 0.4R2-1, and extending evolution times would result in prohibitively long experiments. We show that a general solution to this problem is to use non-uniform sampling, where only a small subset of data points in the indirect sampling space are measured, and possibly different numbers of transients are collected for different evolution times. Coupled with modern methods of spectrum analysis, this strategy delivers substantially improved resolution and/or reduced measuring times compared to uniform sampling, without compromising sensitivity. Higher resolution in the indirect dimensions will facilitate the use of automated assignment programs

  14. Mechanical design parameters for detection of nuclear signals by magnetic resonance force microscopy

    Recent theoretical work has shown that mechanical detection of magnetic resonance from a single nuclear spin is in principle possible. This theory has recently been experimentally validated by the mechanical detection of electron spin resonance signals using microscale cantilevers. Currently we are extending this technology in an attempt to detect nuclear signals which are extending this technology in an attempt to detect nuclear signals which are three orders of magnitude lower in intensity than electron signals. In order to achieve the needed thousand-fold improvement in sensitivity we have undertaken the development of optimized mechanical cantilevers and highly polarized samples. Finite element modeling is used as a tool to simulate cantilever beam dynamics and to optimize the mechanical properties including Q, resonant frequency, amplitude of vibration and spring constant. Simulations are compared to experiments using heterodyne hologram interferometry. Nanofabrication of optimized cantilevers via ion milling will be directed by the outcome of these simulations and experiments. Highly polarized samples are developed using a three-fold approach: (1) high magnetic field strength (2.5T), (2) low temperature (1K), and (3) use of samples polarized by dynamic nuclear polarization. Our recent experiments have demonstrated nuclear polarizations in excess of 50% in molecules of toulene

  15. Generation of low-frequency electric and magnetic fields during large- scale chemical and nuclear explosions

    Adushkin, V.V. [Academy of Sciences, Moscow (Russian Federation). Inst. for Dynamics of the Geospheres; Dubinya, V.A.; Karaseva, V.A.; Soloviev, S.P.; Surkov, V.V. [Lawrence Livermore National Lab., CA (United States)

    1995-06-01

    We discuss the main parameters of the electric field in the surface layer of the atmosphere and the results of the investigations of the natural electric field variations. Experimental investigations of the electromagnetic field for explosions in air are presented. Electromagnetic signals generated by underground nuclear and chemical explosions are discussed and explosions for 1976--1991 are listed. Long term anomalies of the earth`s electromagnetic field in the vicinity of underground explosions were also investigated. Study of the phenomenon of the irreversible shock magnetization showed that in the zone nearest to the explosion the quasistatic magnetic field decreases in inverse proportion to the distance.

  16. Electromagnetic Properties of Inner Double Walled Carbon Nanotubes Investigated by Nuclear Magnetic Resonance

    M. Bouhrara

    2013-01-01

    Full Text Available The nuclear magnetic resonance (NMR analytical technique was used to investigate the double walled carbon nanotubes (DWNTs electromagnetic properties of inner walls. The local magnetic and electronic properties of inner nanotubes in DWNTs were analyzed using 25% 13C enriched C60 by which the effect of dipolar coupling could be minimized. The diamagnetic shielding was determined due to the ring currents on outer nanotubes in DWNTs. The NMR chemical shift anisotropy (CSA spectra and spin-lattice relaxation studies reveal the metallic properties of the inner nanotubes with a signature of the spin-gap opening below 70 K.

  17. Electromagnetic properties of inner double walled carbon nanotubes investigated by nuclear magnetic resonance

    Bouhrara, M.

    2013-01-01

    The nuclear magnetic resonance (NMR) analytical technique was used to investigate the double walled carbon nanotubes (DWNTs) electromagnetic properties of inner walls. The local magnetic and electronic properties of inner nanotubes in DWNTs were analyzed using 25% 13C enriched C 60 by which the effect of dipolar coupling could be minimized. The diamagnetic shielding was determined due to the ring currents on outer nanotubes in DWNTs. The NMR chemical shift anisotropy (CSA) spectra and spin-lattice relaxation studies reveal the metallic properties of the inner nanotubes with a signature of the spin-gap opening below 70 K.

  18. 43. Polish Seminar on Nuclear Magnetic Resonance and its Applications. Cracow. Abstracts

    42 Polish Seminar on Nuclear Magnetic Resonance and its Applications, held on 1-2 December 2010 in Cracow (Poland), was devoted to the development of different magnetic resonance techniques and application of such techniques as crucial part of the studies. The Report contains 58 short descriptions of the contributions submitted by the participants of the Seminar. They cover all areas of the NMR application in major branches of basic chemistry, structural biology, medicine and materials science. Also recent results of the quantum chemical calculations of the NMR parameters are presented.

  19. Nuclear magnetic resonance of external protons using continuous dynamical decoupling with shallow NV centers

    de Las Casas, Charles; Ohno, Kenichi; Awschalom, David D.

    2015-03-01

    The nitrogen vacancy (NV) center in diamond is a paramagnetic defect with excellent spin properties that can reside within a few nanometers of the diamond surface, enabling atomic-scale magnetic resonance sensing of external nuclear spins. Here we use rotating frame longitudinal spin relaxation (T1ρ) based sensing schemes, known as Continuous Dynamical Decoupling (CDD), to detect external nuclear spins with shallow NV centers (Tesla. The increased sensitivity of this method relative to pulsed dynamical decoupling techniques demonstrates the benefits of CDD for sensing with very shallow NV centers. This work was supported by DARPA, AFOSR, and the DIAMANT program.

  20. Energy Moment Method Applied to Nuclear Quadrupole Splitting of Nuclear Magnetic Resonance Lines

    Frank, V

    1962-01-01

    Expressions giving the sum of the energy values, raised to the second and third power, for a nucleus interacting with a static magnetic field and a static electric field gradient are derived. Several applications of this method for obtaining the values of the components of the electric field...

  1. Nuclear magnetic resonance imaging in urologic diseases, 1

    NMR imaging was performed in 12 cases (10 cases of renal cell carcinoma and 2 cases of angiomyolipoma) and compared with computed tomography. The NMR imager, Toshiba model MRT 15 A with magnet of 1500 gauss, was used and images were produced in transverse, coronal and sagittal directions with different repetition times, delay times and echo times. The characteristic images associated with renal tumors were demonstrated. The renal contour was usually sharp at normal side and easily distinguished from perinephric fat which appeared white. The cortex and medullary pyramids were distinguished in excellent images. The lumen of aorta, cava and renal vessels appeared black, because flowing blood allowed little or no signal to be detected within the imaged plane. The images of vessels were valuable to diagnose the tumor embolus. Signal intensity of renal cell carcinoma was lower than the renal parenchyma and the intensity of the big angiomyolipoma was strong like fatty tissue and valuable to distinguish from renal cell carcinoma. In general, it had been shown that the Tl relaxation time of malignant tumor was longer than the corresponding normal tissue, but the renal Tl value was not examined in the series, because the measurement of Tl value did not show good reproducibility. The coronal section of NMR images gave the most valuable information in the case which had tumors in the upper or lower pole of the kidney. In this study, CT demonstrated superior resolution to NMR, but NMR was advantageous in terms of coronal and sagittal images and the information about blood flow. The ability of NMR imaging to distinguish solid from cystic renal lesions appeared almost similar to CT. While much more clinical experience is necessary before the exact role of NMR imaging in renal tumors is known, its future appears very bright. (author)

  2. The fluorine destruction in stars: First experimental study of the {sup 19}F(p,{alpha}){sup 16}O reaction at astrophysical energies

    La Cognata, M.; Mukhamedzhanov, A.; Spitaleri, C.; Indelicato, I.; Aliotta, M.; Burjan, V.; Cherubini, S.; Coc, A.; Gulino, M.; Hons, Z.; Kiss, G. G.; Kroha, V.; Lamia, L.; Mrazek, J.; Palmerini, S.; Piskor, S.; Pizzone, R. G.; Puglia, S. M. R.; Rapisarda, G. G.; Romano, S. [INFN-LNS, Catania (Italy); Cyclotron Institute, Texas A and M University, College Station, Texas (United States); University of Catania and INFN-LNS, Catania (Italy); and others

    2012-11-12

    The {sup 19}F(p,{alpha}){sup 16}O reaction is an important fluorine destruction channel in the proton-rich outer layers of asymptotic giant branch (AGB) stars and it might also play a role in hydrogendeficient post-AGB star nucleosynthesis. So far, available direct measurements do not reach the energy region of astrophysical interest (E{sub cm}{approx} 300 keV), because of the hindrance effect of the Coulomb barrier. The Trojan Horse (TH) method was thus used to access this energy region, by extracting the quasi-free contribution to the {sup 2}H({sup 19}F,{alpha}{sup 16}O)n reaction. The TH measurement of the {alpha}{sub 0} channel, which is the dominant one at such energies, shows the presence of resonant structures not observed before that cause an increase of the reaction rate at astrophysical temperatures up to a factor of 1.7, with potential important consequences for stellar nucleosynthesis.

  3. Study of high-lying, high-spin, three-nucleon-cluster states in 19F and 19Ne through heavy ion induced three nucleon transfer reactions

    The high excitation, high spin selectivities of heavy ion induced multi-nucleon transfer reactions were exploited to identify high-spin, three-nucleon cluster-like states in 19F and 19Ne via the 16O(10B, 7Be)19F, 16O(10B, 7Li)19Ne, and 16O(12C, 9Be)19Ne reactions at high bombarding energies. The Brink approximation to the semiclassical transition amplitude for these reactions was utilized in order to gain a qualitative understanding of the dynamical dependence of the transfer probabilities to various final state spins and parities. The model predictions for the relative cross sections of the known members of the ground-state rotational band in these nuclei were found to be in good agreement with the data. The model was then used to limit the spin-parity assignments for the strong transitions in the data at high excitation energies on the basis of observed strengths. The structures of these states were predicted using the rotational-particle coupling model. The results of these calculations indicate that the high excitation states populated in the above reactions can be explained in terms of high-spin members of K/sup π/ = 1/2- rotational bands having (sd)2(fp)1 and/or (fp)3 configurations outside the 16O closed-shell core

  4. Analysis of fluorine by nuclear reactions and applications to human dental enamel

    Nuclear reactions induced on Fluorine by low energy protons are investigated, thick target excitation yield curves and tables for 19F(p,p'γ)19F and 19F(p,αγ)16O reactions are given between 0.3 and 2.5 MeV. Interferences from other nuclear reactions, detection limits and sensitivity for Fluorine detection are investigated. After a wide investigation of the repartition of Fluorine in tooth enamel it is concluded that there is an equilibrium of the concentrations between tooth and saliva which is rapidly restored after the perturbation introduced by the external treatments. (author)

  5. Nuclear magnetic and quadrupole moments for nuclear structure research on exotic nuclei

    Neyens, G

    2003-01-01

    One of the key issues in current nuclear physics research is to investigate the properties of so-called 'exotic nuclei' and of 'exotic nuclear structures'. Exotic nuclei are nuclei with a proton-to-neutron ratio that is very different from the proton-to-neutron ratio in stable nuclei (a technical term related to this ratio is the 'isospin'). We define exotic nuclear structures as excitation modes of nuclei that have a very different structure than the structure (or shape) of the nuclear ground state. By putting the nucleons in a nucleus to extreme conditions of isospin and excitation energy one can investigate details of one of the four basic forces in nature: the strong force which binds the nucleons together to form a bound nucleus. While the basic properties of the strong nucleon-nucleon interaction are known from investigating the properties of nuclei near the 'valley of stability', recent developments in the study of exotic nuclei have demonstrated that specific properties of the strong interaction, such...

  6. Homometallic and Heterometallic Antiferromagnetic Rings: Magnetic Properties Studied by Nuclear Magnetic Resonance

    Casadei, Cecilia [Univ. of Pavia (Italy)

    2011-01-01

    The aim of the present thesis is to investigate the local magnetic properties of homometallic Cr8 antiferromagnetic (AFM) ring and the changes occurring by replacing one Cr3+ ion with diamagnetic Cd2+ (Cr7Cd) and with Ni2+ (Cr7Ni). In the heterometallic ring a redistribution of the local magnetic moment is expected in the low temperature ground state. We have investigated those changes by both 53Cr-NMR and 19F-NMR. We have determined the order of magnitude of the transferred hyperfine coupling constant 19F - M+ where M+ = Cr3+, Ni2+ in the different rings. This latter result gives useful information about the overlapping of the electronic wavefunctions involved in the coordinative bond.

  7. Simulation of general three-body interactions in a nuclear magnetic resonance ensemble quantum computer

    2008-01-01

    Three-body interaction plays an important role in many-body physics,and quantum computer is efficient in simulating many-body interactions. We have experimentally demonstrated the general three-body interactions in a three-qubit nuclear magnetic resonance ensemble quantum computer. Using a nuclear magnetic resonance computer we implemented general forms of three-body interactions including σ 1x σ z2 σ x3 and σ 1x σ z2 σ y3 . The results show good agreement between theory and experiment. We have also given a concise and practical formula for a general n-body interaction in terms of one-and two-body interactions.

  8. Measurement of conductivity and permittivity on samples sealed in nuclear magnetic resonance tubes

    We present a broadband impedance spectroscopy instrument designed to measure conductivity and/or permittivity for samples that are sealed in glass tubes, such as the standard 5 mm tubes used for nuclear magnetic resonance experiments. The calibrations and corrections required to extract the dielectric properties of the sample itself are outlined. It is demonstrated that good estimates of the value of dc-conductivity can be obtained even without correcting for the effects of glass or air on the overall impedance. The approach is validated by comparing data obtained from samples sealed in nuclear magnetic resonance tubes with those from standard dielectric cells, using glycerol and butylmethylimidazolium-hexafluorophosphate as respective examples of a molecular and an ionic liquid. This instrument and approach may prove useful for other studies of permittivity and conductivity where contact to the metal electrodes or to the ambient atmosphere needs to be avoided

  9. Observation of nuclear magnetic order in solid 3He

    Halperin, W.P.; Archie, C.N.; Rasmussen, Finn Berg;

    1974-01-01

    Measurements of T dp/dT have been made along the He3 melting curve near an anomaly at Ts=1.17 mK. It is found that the solid-He3 entropy decreases by 80% in an interval of 100 μK at Ts. This is attributed to onset of nuclear magnetic order.......Measurements of T dp/dT have been made along the He3 melting curve near an anomaly at Ts=1.17 mK. It is found that the solid-He3 entropy decreases by 80% in an interval of 100 μK at Ts. This is attributed to onset of nuclear magnetic order....

  10. Analysis of antimycin A by reversed-phase liquid chromatography/nuclear magnetic-resonance spectrometry

    Ha, Steven T.K.; Wilkins, Charles L.; Abidi, Sharon L.

    1989-01-01

    A mixture of closely related streptomyces fermentation products, antimycin A, Is separated, and the components are identified by using reversed-phase high-performance liquid chromatography with directly linked 400-MHz proton nuclear magnetic resonance detection. Analyses of mixtures of three amino acids, alanine, glycine, and valine, are used to determine optimal measurement conditions. Sensitivity increases of as much as a factor of 3 are achieved, at the expense of some loss in chromatographic resolution, by use of an 80-μL NMR cell, Instead of a smaller 14-μL cell. Analysis of the antimycin A mixture, using the optimal analytical high performance liquid chromatography/nuclear magnetic resonance conditions, reveals it to consist of at least 10 closely related components.

  11. Application of electronic paramagnetic, nuclear magnetic, γ-nuclear magnetic resonance, and defibrillation in experimental biology and medecine

    Piruzyan, L. A.

    2005-08-01

    Nowadays an attention is paid to pathbreaking approaches to the therapy of different pathologies with EPR, NMR and NGR dialysis and mechanisms of physical factors influence in prophylactics and therapy of a number of diseases. Any pathology is evidently begins its development in atomic-molecular levels earlier then any morphologic alterations in tissues can be detected. We have studied the alterations of FR content in liver, spleen and brain in hypoxia and hyperoxia conditions. Under hypoxia and hyperoxia the FR concentrations are equal in all organs and tissues. However this ratio is different for some forms of leucosis. For different leucosis types gas mixtures the most adequate for the current pathology should be developed. Then we represent the method of biologic objects treatment with the energy of super-high frequency field (SIT) and the instrument for its performance. The study of magnetic heterogeneity of biologic systems proposes the new approach and a set of methods for medical and scientific purpose. Application of combined with chemotherapy extraction of anionic and cationic radicals from bloodstream using EPRD, NMRD and NGRD influence and also the single ions separate extraction using NGRD are able to detect and perhaps to cure their appearance in a period before neoformation. These studies should be carried out experimentally and clinically.

  12. Tissue-Specific Metabolic Profile Study of Moringa oleifera L. Using Nuclear Magnetic Resonance Spectroscopy

    Mahmud, Iqbal; Chowdhury, Kamal; Boroujerdi, Arezue

    2014-01-01

    Moringa oleifera, an important multipurpose crop, is rich in various phytochemicals: flavonoids, antioxidants, vitamins, minerals and carotenes. The purpose of this study was to profile the groups of metabolites in leaf and stem tissues of M. oleifera. Various sugars, amino acids, and organic acid derivatives were found in all of the M. oleifera tissues with different profiles/peak intensities depending on the tissue. 1D proton nuclear magnetic resonance (NMR) was applied for collecting metab...

  13. Pulsed-field gradient nuclear magnetic resonance study of transport properties of fluid catalytic cracking catalysts

    Kortunov, P.; Vasenkov, S.; Kärger, J.; Fé Elía, M.; Perez, M.; Stöcker, M.; Papadopoulos, G. K.; Theodorou, D.; Drescher, B.; McElhiney, G.; Bernauer, B.; Krystl, V.; Kočiřík, Milan; Zikánová, Arlette; Jirglová, Hana; Berger, C.; Gläser, R.; Weitkamp, J.; Hansen, E. W.

    2005-01-01

    Roč. 23, č. 2 (2005), s. 233-237. ISSN 0730-725X Grant ostatní: TROCAT project - European Community(DE) G5RD-CT-2001-00520 Institutional research plan: CEZ:AV0Z40400503 Keywords : pulsed-field gradient * nuclear magnetic resonance * fluid catalytic cracking catalyst Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.361, year: 2005

  14. Implementation of the perfect state transfer speeded up by three- spin interactions using nuclear magnetic resonance

    Zhang, J; Suter, D; Peng, Xinhua; Suter, Dieter; Zhang, Jingfu

    2005-01-01

    The speed of perfect state transfer (PST) can be increased by the three- spin interactions in the spin XY chain. By decomposing the evolution of the spin XY chain with three- spin interactions into a series of single- spin rotations and the J- coupling evolutions between the neighboring spins, we simulate such a chain and implement the stepped-up PST using a nuclear magnetic resonance (NMR) quantum computer.

  15. Cell culture device and microchamber which can be monitored using nuclear magnetic resonance

    Celda-Muñoz, Bernardo; Esteve-Moya, Vicent; Sancho-Bielsa, Francisco; Villa Sanz, Rosa; Fernández Ledesma, Luis José; Berganzo Ruiz, Javier

    2010-01-01

    [EN] The invention relates to a cell culture device and microchamber which can be monitored using nuclear magnetic resonance and other imaging techniques, in which the culture microchamber is encapsulated and housed inside a chip. The microchamber and the device are easy for the user to handle, allowing same to be handled or repositioned without requiring complex mounting operations. In addition, the invention allows cultures to be studied for long periods, great...

  16. Quantitation of Amoxicillin in Urine by Nuclear Magnetic Resonance. Application to Five Cases

    Elise Champeil

    2014-01-01

    Aim: In this paper, we propose a procedure for the analysis and quantification of amoxicillin in urine with minimum pre-treatment of the samples using Nuclear Magnetic Resonance spectroscopy (NMR). Five clinical samples were analyzed and amoxicillin was detected and quantified in each case. Material and Method: Samples of urine from amoxicillin users were collected in accordance with an IRB-approved protocol. Donors were asked to record the day of urine collection, the length of treatment and...

  17. Nuclear magnetic resonance as a tool for on-line catalytic reaction monitoring

    Buljubasich, Lisandro

    2010-01-01

    Nuclear Magnetic Resonance (NMR) has become a well-established method in many different areas of research. The scope of the disciplines involved is extremely broad ad is still expanding, encompassing chemical, petrochemical, biological and medical research, plant physiology, aerospace engineering, process engineering, industrial food processing, materials and polymer sciences. But the power of NMR, lies in its ability to combine and extend the available techniques for a more thorough solution...

  18. Exhibition of the periodicity of Quantum Fourier Transformation in Nuclear Magnetic Resonance

    Peng, Xinhua; Zhu, Xiwen; Fang, Ximing; Feng, Mang; Yang, Xiaodong; Liu, Maili; Gao, Kelin

    2002-01-01

    The remarkable capability of quantum Fourier transformation (QFT) to extract the periodicity of a given periodic function has been exhibited by using nuclear magnetic resonance (NMR) techniques. Two separate sets of experiments were performed. In a full QFT, the periodicity were validated with state tomography and fidelity measurements. For a simplified QFT, the three-qubit pseudo-pure state was created by introducting an additional observer spin, and the spectra recorded on the observer spin...

  19. An interferometric complementarity experiment in a bulk Nuclear Magnetic Resonance ensemble

    Peng, Xinhua; Zhu, Xiwen; Fang, Ximing; Feng, Mang; Liu, Maili; Gao, Kelin

    2002-01-01

    We have experimentally demonstrated the interferometric complementarity, which relates the distinguishability $D$ quantifying the amount of which-way (WW) information to the fringe visibility $V$ characterizing the wave feature of a quantum entity, in a bulk ensemble by Nuclear Magnetic Resonance (NMR) techniques. We primarily concern on the intermediate cases: partial fringe visibility and incomplete WW information. We propose a quantitative measure of $D$ by an alternative geometric strateg...

  20. Preparation of pseudo-pure states by line-selective pulses in Nuclear Magnetic Resonance

    Peng, Xinhua; Zhu, Xiwen; Fang, Ximing; Feng, Mang; Gao, Keli; Yang, Xiaodong; Liu, Maili

    2000-01-01

    A new method of preparing the pseudo-pure state of a spin system for quantum computation in liquid nuclear magnetic resonance (NMR) was put forward and demonstrated experimentally. Applying appropriately connected line-selective pulses simultaneously and a field gradient pulse techniques we acquired straightforwardly all pseudo-pure states for two qubits in a single experiment much efficiently. The signal intensity with the pseudo-pure state prepared in this way is the same as that of tempora...

  1. Proceedings of the 37. Polish Seminar on Nuclear Magnetic Resonance and its Applications

    37. Polish Seminar on Nuclear Magnetic Resonance and Its Applications is Cyclically organised forum for discussing the actual problems, achievements and perspectives of methodology and interpretation of NMR. At presenting edition the problems of NMR imaging in medicine diagnostics, studies of biologically important organic molecules as well as inorganic compounds being interesting for microelectronics and catalysis have been especially emphasized. The progress in computerized simulation for NMR spectra interpretation has been also performed in numerous presentations

  2. Biosynthetic pathways in Methanospirillum hungatei as determined by 13C nuclear magnetic resonance.

    Ekiel, I; Smith, I C; Sprott, G D

    1983-01-01

    The main metabolic pathways in Methanospirillum hungatei GP1 were followed by using 13C nuclear magnetic resonance, with 13C-labeled acetate and CO2 as carbon sources. The labeling patterns found in carbohydrates, amino acids, lipids, and nucleosides were consistent with the formation of pyruvate from acetate and CO2 as the first step in biosynthesis. Carbohydrates are formed by the glucogenic pathway, and no scrambling of label was observed, indicating that the oxidative or reductive pentose...

  3. Proton nuclear magnetic resonance of intact friend leukemia cells: phosphorylcholine increase during differentiation

    Proton nuclear magnetic resonance of intact Friend leukemia cells was used to analyze their erythroid-like differentiation. The technique, which requires only 108 to 109 cells and approximately 2 minutes for acquisition of each spectrum, demonstrated the occurrence of many signal changes during differentiation. With cell extracts, 64 signals were assigned to 12 amino acids and 19 other intermediary metabolites, and a dramatic signal change was attributed to a fourfrease in cytoplasmic phosphorylcholines

  4. H nuclear magnetic resonance spectroscopy-based metabonomic study in patients with cirrhosis and hepatic encephalopathy

    Dabos, Konstantinos John; Parkinson, John Andrew; Sadler, Ian Howard; Plevris, John Nicholas; Hayes, Peter Clive

    2015-01-01

    AIM: To identify plasma metabolites used as biomarkers in order to distinguish cirrhotics from controls and encephalopathics. METHODS: A clinical study involving stable cirrhotic patients with and without overt hepatic encephalopathy was designed. A control group of healthy volunteers was used. Plasma from those patients was analysed using 1H - nuclear magnetic resonance spectroscopy. We used the Carr Purcell Meiboom Gill sequence to process the sample spectra at ambient probe temperature. We...

  5. Optimal grouping for a nuclear magnetic resonance scanner by means of an open queueing model

    VANDAELE, Nico; VAN NIEUWENHUYSE, Inneke; Cupers, S

    2003-01-01

    In this paper we analyze how a nuclear magnetic resonance scanner can be managed more efficiently, simultaneously improving patient comfort (in terms of total time spent in the system) and increasing availability in case of emergency calls. By means of a superposition approach, all relevant data on the arrival and service process of different patient types are transformed into a general single server, single class queueing model. The objective function consists of the weighted average patient...

  6. Surface Nuclear Magnetic Resonance (SNMR) - A new method for exploration of ground water and aquifer properties

    U. Yaramanci

    2000-01-01

    The Surface Nuclear Magnetic Resonance (SNMR) method is a fairly new technique in geophysics to assess ground water, i.e. existence, amount and productibility by measurements at the surface. The NMR technique used in medicine, physics and lately in borehole geophysics was adopted for surface measurements in the early eighties, and commercial equipment for measurements has been available since the mid nineties. The SNMR method has been tested at sites in Northern Germany with Quaternary sand a...

  7. 1H and 31P nuclear magnetic resonance spectroscopy of erythrocyte extracts in myotonic muscular dystrophy

    Extracts freshly prepared from erythrocytes of patients with myotonic muscular dystrophy, their unaffected siblings, and normal control subjects were examined with both 1H and 31P nuclear magnetic resonance spectroscopy. A moderate variability was found in the relative amounts of various nonphosphorylated compounds among patients and control subjects; however, no significant differences were found between the groups. As for the phosphorylated compounds, the sum of ADP+ATP was found significantly elevated in the myotonic muscular dystrophy patients

  8. High resolution nuclear magnetic resonance spectroscopy (NMR) studies on meat components: potentialities and prospects

    Antonio Sacco; Gino Vonghia; Francesco Giannico; Daniela Sacco; Vincenzo di Martino; Anna Caputi Jambrenghi; Maria Antonietta Brescia

    2010-01-01

    In recent years, increasing application of nuclear magnetic resonance (NMR) spectroscopy in the study of the agricultur-  al food products has been remarked, thanks to the advantages of this technique over other conventional analytical tech-  niques. This preliminary work presents, for the first time, the application of an innovative NMR technique, the  proton  high resolution magic angle spinning (1H HR-MAS), for studying meat features. It stresses that this method makes ...

  9. Instruments and Domains of Knowledge: The Case of Nuclear Magnetic Resonance Spectroscopy, 1956-1969

    Roberts, Jody Alan

    2002-01-01

    In this thesis, I traced the development of Nuclear Magnetic Resonance (NMR) Spectroscopy through the pages of the Journal of Organic Chemistry (JOC) from the year 1956 to 1969 to understand how organic chemists and Varian Associates?the makers of the first commercial NMR spectrometers?negotiated the identity of the NMR spectrometer. The work of the organic chemists was examined through their publications in the JOC. Examining the abstracts from the JOC between the years 1956 and 1969 devel...

  10. Theory and applications of maps on SO(3) in nuclear magnetic resonance

    Theoretical approaches and experimental work in the design of multiple pulse sequences in Nuclear Magnetic Resonance (NMR) are the subjects of this dissertation. Sequences of discrete pulses which reproduce the nominal effect of single pulses, but over substantially broader, narrower, or more selective ranges of transition frequencies, radiofrequency field amplitudes, and spin-spin couplings than the single pulses they replace, are developed and demonstrated. 107 refs., 86 figs., 6 tabs

  11. Solid-state nuclear-spin quantum computer based on magnetic resonance force microscopy

    We propose a nuclear-spin quantum computer based on magnetic resonance force microscopy (MRFM). It is shown that an MRFM single-electron spin measurement provides three essential requirements for quantum computation in solids: (a) preparation of the ground state, (b) one- and two-qubit quantum logic gates, and (c) a measurement of the final state. The proposed quantum computer can operate at temperatures up to 1 K. (c) 2000 The American Physical Society

  12. Solid-State Nuclear Spin Quantum Computer Based on Magnetic Resonance Force Microscopy

    Berman, G P; Hammel, P C; Tsifrinovich, V I

    1999-01-01

    We propose a nuclear spin quantum computer based on magnetic resonance force microscopy (MRFM). It is shown that an MRFM single-electron spin measurement provides three essential requirements for quantum computation in solids: (a) preparation of the ground state, (b) one- and two- qubit quantum logic gates, and (c) a measurement of the final state. The proposed quantum computer can operate at temperatures up to 1K.

  13. Magnetic moments in present relativistic nuclear theories: a mean-field problem

    We show that the magnetic moments of LS closed shell nuclei plus or minus one nucleon derived from non-relativistic Hartree-Fock mean-fields are as bad as those obtained in relativistic approaches of nuclear structure. Deviations with respect to more complete results in both cases are ascribed to the mean-field approximation which neglects some degrees of freedom in the nucleus description. 18 refs

  14. Updating of nuclear magnetic resonance installation on the basis of IBM PC computers

    Updating of nuclear magnetic resonance spectrometers TESLA BS-567 and BRUKER SXP-100 is carried out by means of the application of the multifunctional extension plate ACL-812 PG and IBM PC. This extension plate consists of the 16-channel analog multiplexer, the 12-digit ADC, the timer and the logic access circuits for DMA and IRQ. The software consists of the control program working in the operation system MS DOS

  15. Studies of phospholipid hydration by high-resolution magic-angle spinning nuclear magnetic resonance.

    Zhou, Z.; Sayer, B G; Hughes, D. W.; Stark, R E; Epand, R M

    1999-01-01

    A sample preparation method using spherical glass ampoules has been used to achieve 1.5-Hz resolution in 1H magic-angle spinning (MAS) nuclear magnetic resonance (NMR) spectra of aqueous multilamellar dispersions of 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), serving to differentiate between slowly exchanging interlamellar and bulk water and to reveal new molecular-level information about hydration phenomena in these model biolo...

  16. Nuclear Magnetic Resonance Structural Studies of Membrane Proteins in Micelles and Bilayers

    Gong, Xiao-Min; Franzin, Carla M.; Thai, Khang; Yu, Jinghua; Marassi, Francesca M.

    2007-01-01

    Nuclear magnetic resonance (NMR) spectroscopy enables determination of membrane protein structures in lipid environments, such as micelles and bilayers. This chapter outlines the steps for membrane-protein structure determination using solution NMR with micelle samples, and solid-state NMR with oriented lipid-bilayer samples. The methods for protein expression and purification, sample preparation, and NMR experiments are described and illustrated with examples from γ and CHIF, two membrane pr...

  17. Thermal transition of ribonuclease a observed using proton nuclear magnetic resonance

    The thermal transition of bovine pancreatic ribonuclease A (RNase A) was investigated using proton nuclear magnetic resonance (NMR). Significant resonance overlap in the large native protein limits accurate assignments in the 1H NMR spectrum. This study proposes extending the investigation of large proteins by dynamic analysis. Comparison of the traditional method and the correlation coefficient method suggests successful application of spectrum image analysis in dynamic protein studies by NMR

  18. S100 lathe bed pulse generator applied to pulsed nuclear magnetic resonance

    The project and construction of four channel pulse generator in the S100 standard plate and its control software for microcomputer are described. The microcomputer has total control on the pulse generator, which has seven programable parameters, defining the position of four pulses and the width for the three first ones. This pulse generator is controlled by a software developed in c language, and is used in pulsed nuclear magnetic resonance experiences. (M.C.K.)

  19. Coaxial probe for nuclear magnetic resonance diffusion and relaxation correlation experiments

    Tang, Yiqiao; Hürlimann, Martin; Mandal, Soumyajit; Paulsen, Jeffrey; Song, Yi-Qiao

    2014-02-01

    A coaxial nuclear magnetic resonance (NMR) probe is built to measure diffusion and relaxation properties of liquid samples. In particular, we demonstrate the acquisition of two-dimensional (2D) distribution functions (T1-T2 and diffusion-T2), essential for fluids characterization. The compact design holds promise for miniaturization, thus enabling the measurement of molecular diffusion that is inaccessible to conventional micro-NMR setups. Potential applications range from crude oil characterization to biomolecular screening and detections.

  20. Nuclear shape and magnetic moments in the sodium and cesium region from laserspectroscopy

    The authors present some results from extended investigation of alcali isotopes by an optical experiment on neutral atoms. From the isotope shift and hyperfine structure of the main resonance lines (D-lines) of these atoms direct information on nuclear shape and magnetic properties has been obtained for long strings of isotopes. The investigation is based on a method of non-optical detection of laser excitation of an atomic beam combined with intense production techniques for radioactive isotopes. (orig./AH)

  1. Nuclear magnetic moments and the spin-orbit current in the relativistic mean field theory

    The Dirac magnetic moments in the relativistic mean field theory are affected not only by the effective mass, but also by the spin-orbit current related to the spin-orbit force through the continuity equation. Previous arguments on the cancellation of the effective-mass effect in nuclear matter are not simply applied to finite nuclei to obtain the Schmidt values. Effects of the spin-orbit current on (e, e') response functions are also mentioned. (orig.)

  2. Theory and applications of maps on SO(3) in nuclear magnetic resonance

    Cho, H.M.

    1987-02-01

    Theoretical approaches and experimental work in the design of multiple pulse sequences in Nuclear Magnetic Resonance (NMR) are the subjects of this dissertation. Sequences of discrete pulses which reproduce the nominal effect of single pulses, but over substantially broader, narrower, or more selective ranges of transition frequencies, radiofrequency field amplitudes, and spin-spin couplings than the single pulses they replace, are developed and demonstrated. 107 refs., 86 figs., 6 tabs.

  3. Nuclear magnetic resonance (NMR) studies of diffusivity and diffusion mechanisms of hydrogen in tantalum

    Solubility and diffusivity of protons in the α-phase of Ta are deduced from the nuclear magnetization and the dipolar spin-lattice relaxation rate of hydrogen. Over the entire temperature range investigated (120 K to 450 K), protons are found to diffuse by incoherent tunnelling processes, with negligible contributions from classical over-barrier jumps. The comparison with macroscopic diffusivity measurements (Gorski effect) shows that jumps between nearest-neighbour tetrahedral interstices dominate. (orig.)

  4. Citrate and Sugar Cofermentation in Leuconostoc oenos, a (sup13)C Nuclear Magnetic Resonance Study

    Ramos, A.; Santos, H.

    1996-01-01

    (sup13)C nuclear magnetic resonance spectroscopy was used to investigate citrate-glucose cometabolism in nongrowing cell suspensions of the wine lactic acid bacterium Leuconostoc oenos. The use of isotopically enriched substrates allowed us to identify and quantify in the end products the carbon atoms derived from each of the substrates supplied; furthermore, it was possible to differentiate between products derived from the metabolism of endogenous carbon reserves and those derived from exte...

  5. Advantages and disadvantages of nuclear magnetic resonance spectroscopy as a hyphenated technique

    Silva Elipe, Maria Victoria

    2003-11-14

    A general overview of the advancements and applications of nuclear magnetic resonance (NMR) hyphenated with other analytical techniques is given from a practical point of view. Details on the advantages and disadvantages of the hyphenation of NMR with liquid chromatography as LC-NMR and also with mass spectrometry as LC-MS-NMR are demonstrated with two examples. Current developments of NMR with other analytical separation techniques, especially with capillary liquid chromatography (capLC) are discussed.

  6. COMPARATIVE ASSESSMENT OF NUCLEAR MAGNETIC RELAXATION CHARACTERISTICS OF SUNFLOWER AND RAPESEED LECITHIN

    Lisovaya E. V.

    2015-11-01

    Full Text Available The article presents a comparative assessment and peculiarities of nuclear magnetic relaxation characteristics of rapeseed and sunflower lecithin. It was established, that lecithin’s nuclear magnetic relaxation characteristics, namely, protons’ spin-spin relaxation time and amplitudes of nuclear magnetic relaxation signals of lecithin components, depend on content of oil’s fat acids and phospholipids, contained in the lecithin. Comparative assessment of protons’ spin-spin relaxation time of rapeseed and sunflower lecithin components showed, that for their identification protons’ spin-spin relaxation time of the lecithin’ first component at 40°C and 60°C temperature, when differences in values of protons’ spin-spin relaxation time of the sunflower and rapeseed lecithin’ first component are most obvious, should be used as an analytical parameter. Comparative assessment of amplitudes of proton’s NMR signals of sunflower and rapeseed lecithin components showed, that relations, established earlier for sunflower lecithin between mass share of phospholipids (substances insoluble in acetone and the sum of amplitudes of proton’s NMR signals of the third and fourth components, cannot be applied to rapeseed lecithin; that is for the development of an express method for determination of mass share of substances insoluble in acetone (phospholipids in rapeseed lecithin, it is necessary to carry out additional research with the purpose of clarifying the mentioned relations

  7. NMR absolute shielding scale and nuclear magnetic dipole moment of (207)Pb.

    Adrjan, Bożena; Makulski, Włodzimierz; Jackowski, Karol; Demissie, Taye B; Ruud, Kenneth; Antušek, Andrej; Jaszuński, Michał

    2016-06-28

    An absolute shielding scale is proposed for (207)Pb nuclear magnetic resonance (NMR) spectroscopy. It is based on ab initio calculations performed on an isolated tetramethyllead Pb(CH3)4 molecule and the assignment of the experimental resonance frequency from the gas-phase NMR spectra of Pb(CH3)4, extrapolated to zero density of the buffer gas to obtain the result for an isolated molecule. The computed (207)Pb shielding constant is 10 790 ppm for the isolated molecule, leading to a shielding of 10799.7 ppm for liquid Pb(CH3)4 which is the accepted reference standard for (207)Pb NMR spectra. The new experimental and theoretical data are used to determine μ((207)Pb), the nuclear magnetic dipole moment of (207)Pb, by applying the standard relationship between NMR frequencies, shielding constants and nuclear moments of two nuclei in the same external magnetic field. Using the gas-phase (207)Pb and (reference) proton results and the theoretical value of the Pb shielding in Pb(CH3)4, we find μ((207)Pb) = 0.59064 μN. The analysis of new experimental and theoretical data obtained for the Pb(2+) ion in water solutions provides similar values of μ((207)Pb), in the range of 0.59000-0.59131 μN. PMID:27265668

  8. Measurement of irradiation damage in nuclear pressure vessel steels by magnetic properties change

    The magnetic properties of specimens of A533B nuclear pressure vessel grade steel have been examined in the as-received condition and after neutron irradiation to various fluence levels up to 1018 cm-2 (energy greater than 0.1 MeV) in the University of Illinois Advanced TRIGA reactor core. The effect of some heat treatments was also investigated. The magnetic properties were measured by an hysteresis curve tracing method using a miniature transformer which incorporated the specimens in its core. Changes in magnetic remanence and hysteresis energy loss were correlated with neutron fluence in the case of irradiated specimens, and with microhardness measurements in the case of heat treated specimens. The relationship between the observed changes and irradiation embrittlement is discussed

  9. Moissanite anvil cell design for giga-pascal nuclear magnetic resonance

    A new design of a non-magnetic high-pressure anvil cell for nuclear magnetic resonance (NMR) experiments at Giga-Pascal pressures is presented, which uses a micro-coil inside the pressurized region for high-sensitivity NMR. The comparably small cell has a length of 22 mm and a diameter of 18 mm, so it can be used with most NMR magnets. The performance of the cell is demonstrated with external-force vs. internal-pressure experiments, and the cell is shown to perform well at pressures up to 23.5 GPa using 800 μm 6H-SiC large cone Boehler-type anvils. 1H, 23Na, 27Al, 69Ga, and 71Ga NMR test measurements are presented, which show a resolution of better than 4.5 ppm, and an almost maximum possible signal-to-noise ratio

  10. Moissanite anvil cell design for giga-pascal nuclear magnetic resonance

    Meier, Thomas; Herzig, Tobias; Haase, Jürgen

    2014-04-01

    A new design of a non-magnetic high-pressure anvil cell for nuclear magnetic resonance (NMR) experiments at Giga-Pascal pressures is presented, which uses a micro-coil inside the pressurized region for high-sensitivity NMR. The comparably small cell has a length of 22 mm and a diameter of 18 mm, so it can be used with most NMR magnets. The performance of the cell is demonstrated with external-force vs. internal-pressure experiments, and the cell is shown to perform well at pressures up to 23.5 GPa using 800 μm 6H-SiC large cone Boehler-type anvils. 1H, 23Na, 27Al, 69Ga, and 71Ga NMR test measurements are presented, which show a resolution of better than 4.5 ppm, and an almost maximum possible signal-to-noise ratio.

  11. Nuclear relaxation in an electric field enables the determination of isotropic magnetic shielding

    Garbacz, Piotr

    2016-08-01

    It is shown that in contrast to the case of nuclear relaxation in a magnetic field B, simultaneous application of the magnetic field B and an additional electric field E causes transverse relaxation of a spin-1/2 nucleus with the rate proportional to the square of the isotropic part of the magnetic shielding tensor. This effect can contribute noticeably to the transverse relaxation rate of heavy nuclei in molecules that possess permanent electric dipole moments. Relativistic quantum mechanical computations indicate that for 205Tl nucleus in a Pt-Tl bonded complex, Pt(CN)5Tl, the transverse relaxation rate induced by the electric field is of the order of 1 s-1 at E = 5 kV/mm and B = 10 T.

  12. Electric quadrupole polarizabilities of nuclear magnetic shielding in some small molecules

    Ferraro, M. B.; Caputo, M. C.; Pagola, G. I.; Lazzeretti, P.

    2008-01-01

    Computational procedures, based on (i) the Ramsey common origin approach and (ii) the continuous transformation of the origin of the quantum mechanical current density-diamagnetic zero (CTOCD-DZ), were applied at the Hartree-Fock level to determine electric quadrupole polarizabilities of nuclear magnetic shielding for molecules in the presence of a nonuniform electric field with a uniform gradient. The quadrupole polarizabilities depend on the origin of the coordinate system, but values of the magnetic field induced at a reference nucleus, determined via the CTOCD-DZ approach, are origin independent for any calculations relying on the algebraic approximation, irrespective of size and quality of the (gaugeless) basis set employed. On the other hand, theoretical estimates of the induced magnetic field obtained by single-origin methods are translationally invariant only in the limit of complete basis sets. Calculations of electric quadrupole polarizabilities of nuclear magnetic shielding are reported for H2, HF, H2O, NH3, and CH4 molecules.

  13. A Nuclear Magnetic Resonance Force Microscope for Micron-scale Liquids

    Giraldo, Felipe; Paster, Jeremy W.; Tennant, Daniel M.; Markert, John T.

    2015-03-01

    We have designed and constructed a Nuclear Magnetic Resonance Force Microscopy (NMRFM) probe for the analysis of liquid and soft matter samples. This NRMFM probe uses a magnet-on-cantilever geometry and is equipped with dual x- y- z piezoelectric motion stages, for micron-step coarse positioning and sub-nanometer fine positioning of both the laser interferometer and the sample with respect to the cantilever, permitting three-dimensional scanning-mode detection of nuclear magnetism. The probe keeps the cantilever detector in high vacuum, maintaining a high Q, while the local NMR properties of nearby aqueous samples in glass microtubes are measured. The entire probe head fits in either a 3.5-cm bore magnet or in an electromagnet with a similarly small gap. We plan to demonstrate the ability to scan and distinguish microscale NMR properties using a copper sulfate solution with concentrations in the 2-20 millimolar range, thus providing dynamical imaging of regions with differing longitudinal relaxation times, T1. This concentration range will permit us to compare the conventional saturation-recovery pulse sequence with a more efficient single-pulse detection, possible when T1 is comparable to or less than the duration of the modified cyclic-adiabatic-inversion pulse.

  14. Heterometallic Cu(II)-Dy(III) Clusters of Different Nuclearities with Slow Magnetic Relaxation.

    Modak, Ritwik; Sikdar, Yeasin; Cosquer, Goulven; Chatterjee, Sudipta; Yamashita, Masahiro; Goswami, Sanchita

    2016-01-19

    The synthesis, structures, and magnetic properties of two heterometallic Cu(II)-Dy(III) clusters are reported. The first structural motif displays a pentanuclear Cu(II)4Dy(III) core, while the second one reveals a nonanuclear Cu(II)6Dy(III)3 core. We employed o-vanillin-based Schiff base ligands combining o-vanillin with 3-amino-1-propanol, H2vap, (2-[(3-hydroxy-propylimino)-methyl]-6-methoxy-phenol), and 2-aminoethanol, H2vae, (2-[(3-hydroxy-ethylimino)-methyl]-6-methoxy-phenol). The differing nuclearities of the two clusters stem from the choice of imino alcohol arm in the Schiff bases, H2vap and H2vae. This work is aimed at broadening the diversity of Cu(II)-Dy(III) clusters and to perceive the consequence of changing the length of the alcohol arm on the nuclearity of the cluster, providing valuable insight into promising future synthetic directions. The underlying topological entity of the pentanuclear Cu4Dy cluster is reported for the first time. The investigation of magnetic behaviors of 1 and 2 below 2 K reveals slow magnetic relaxation with a significant influence coming from the variation of the alcohol arm affecting the nature of magnetic interactions. PMID:26702645

  15. Meso-scale magnetic signatures for nuclear reactor steel irradiation embrittlement monitoring

    Suter, J. D.; Ramuhalli, P.; McCloy, J. S.; Xu, K.; Hu, S.; Li, Y.; Jiang, W.; Edwards, D. J.; Schemer-Kohrn, A. L.; Johnson, B. R.

    2015-03-01

    Verifying the structural integrity of passive components in light water and advanced reactors will be necessary to ensure safe, long-term operations of the existing U.S. nuclear fleet. This objective can be achieved through nondestructive condition monitoring techniques, which can be integrated with plant operations to quantify the "state of health" of structural materials in real-time. While nondestructive methods for monitoring many classes of degradation (such as fatigue or stress corrosion cracking) are relatively advanced, this is not the case for degradation caused by irradiation. The development of nondestructive evaluation technologies for these types of degradation will require advanced materials characterization techniques and tools that enable comprehensive understanding of nuclear reactor material microstructural and behavioral changes under extreme operating environments. Irradiation-induced degradation of reactor steels causes changes in their microstructure that impacts their micro-magnetic properties. In this paper, we describe preliminary results of integrating advanced material characterization techniques with meso-scale computational models. In the future, this will help to provide an interpretive understanding of the state of degradation in structural materials. Microstructural data are presented from monocrystalline Fe and are correlated with variable-field magnetic force microscopy and micro-magnetic measurements. Ongoing research is focused on extending the measurements and models on thin films to gain insights into the structural state of irradiated materials and the resulting impact on magnetic properties. Preliminary conclusions from these correlations are presented, and next steps described.

  16. A facility for multielemental analysis by PIXE and the 19F (p, αγ) 16O reaction

    Specific advantages with Particle Induced X-Ray Emission are: its 1) multielemental capability, especially when combined with nuclear techniques for lighter elements, 32) speed, 3)low detection limits for small samples and 4) accuracy. To make full use of these advantages, analytical parameters have to be chosen optimally and the facility to be carefully designed. This paper describes an experimental facility constructed to permit continous development work to optimize the analytical conditions and to allow the gradual implementation of automatic control. Emphasis is also put on the simultaneous use of proton induced gamma rays from fluorine. The features and the performance of the set-up including its accuracy, precision and experimental detection limits are reported. (Authors)

  17. NUCLEAR-MAGNETIC MINI-RELAXOMETER FOR LIQUID AND VISCOUS MEDIA CONTROL

    V. V. Davydov

    2015-01-01

    Full Text Available The paper deals with a new method for registration of nuclear magnetic resonance signal of small volume liquid and viscous media being studied (0.5 ml in a weak magnetic field (0.06 –0.08 T, and measuring of longitudinal T1 and transverse T2 relaxation constants. A new construction of NMR mini-relaxometer magnetic system is developed for registration of NMR signal. The nonuniformity of a magnetic field in a pole where registration coil is located is 0,410–3 sm–1 (the induction is В0 = 0.079 T. An electrical circuit of autodyne receiver (weak fluctuations generator has been developed with usage of low noise differential amplifier and NMR signal operating and control scheme (based on microcontroller STM32 for measuring of relaxation constants of liquid and viscous media in automatic operating mode. New technical decisions made it possible to improve relaxometer response time and dynamic range of measurements for relaxation constants T1 and T2 in comparison with small sized nuclear-magnetic spectrometer developed by the authors earlier (with accuracy characteristics conservation. The developed schemes for self-tuning of registration frequency, generating amplitude of magnetic field H1 in registration coil, and amplitude and frequency of modulating field provide measuring of T1 and T2 with error less than 0.5 % and signal to noise ratio about 1.2 in temperature range from 3 to 400 C. A new construction of mini-relaxometer reduced the weight of the device to 4 kg (with independent supply unit and increased transportability and operating convenience.

  18. Experimental investigations on the splitting of coherent population trapping resonances by the nuclear magnetic moment

    Full text: Coherent population trapping (CPT) is a resonance phenomenon due to a quantum mechanical interference effect within an atomic system. The resonantly driven atomic level population is being trapped into a superpositional dark state, yielding the atomic medium transparent for the exciting electromagnetic fields. The observation of this effect requires a special electronic structure (Λ-System) and suitable lifetimes which can be found e.g. in alkali atoms. In the experiments transitions are excited by a bi-chromatic laser radiation within the manifold of the D1-line of 87Rb . If a magnetic field is applied, a dark resonance spectrum of several Zeeman components appears as a result of the sublevel structure of the D1-line. An additional splitting of CPT resonances is observable by virtue of a lifted degeneracy with respect to the nuclear magnetic moment even before the Paschen-Pack regime is reached. We present experimental investigations on the behavior of the CPT resonances split by the nuclear magnetic moment under different external magnetic fields, laser polarizations and laser intensities. We focus our considerations on a special type of the Λ-System formation. In this case the center of gravity of the pair of split CPT resonances (called pseudoresonance) is sensitive to external magnetic fields only to second order in the magnetic field strength. The short term frequency stability of this pseudoresonance approaches the level of 10-14/ √τ making this standard as a good candidate for applications in compact atomic clocks used e.g. in GPS receivers and satellites. (author)

  19. Set-up for irradiation of nuclear photo-emulsions in magnetic field with induction up to 100 T

    A set-up for irradiation of nuclear photo-emulsions in high magnetic field is described. It is installed at the JINR synchrotron channel of relativistic nuclei extraction. Main characteristics of the set-up module and the magnetic field obtained in the first methodical experiment on the irradiation of nuclear emulsions with the dimensions of 1.5x1x10cm by 6 GeV/c relativistic protons are presented. 6 refs.; 2 figs

  20. Substituent effects on nuclear shielding

    The important role of nuclear magnetic resonance (NMR) spectroscopy in chemistry arises largely from the consequences of nuclear shielding. The fact that nuclei in different electronic environments have different nuclear shieldings, and hence different chemical shifts, makes NMR a powerful probe of electronic structure. Empirical rules relating chemical shifts to substituent (σ) constants, electron densities, electronegativities, and a variety of other empirical parameters have proven of great benefit to problems of organic structural elucidation, and to fundamental studies of molecular electron distributions. This review focuses on one specific application in the latter category -the study of substituent electronic effects on chemical shifts. The aim is not to provide a compendium of substituent effects on chemical shifts to aid in structural assignments, but to show how fine detail relating to the distribution and polarization of electrons in molecules may be determined from chemical shift studies. Chapters are devoted to 1H, 11B, 13C, 15N, 17O, 19F, 31P, 33S, 77Se, 95Mo and 199Hg chemical shifts. (U.K.)