WorldWideScience

Sample records for 18s rrna phylogeny

  1. Investigation of molluscan phylogeny on the basis of 18S rRNA sequences.

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1996-12-01

    The 18S rRNA sequences of 12 molluscs, representing the extant classes Gastropoda, Bivalvia, Polyplacophora, Scaphopoda, and Caudofoveata, were determined and compared with selected known 18S rRNA sequences of Metazoa, including other Mollusca. These data do not provide support for a close relationship between Platyhelminthes (Turbellaria) and Mollusca, but rather suggest that the latter group belongs to a clade of eutrochozoan coelomates. The 18S rRNA data fail to recover molluscan, bivalve, or gastropod monophyly. However, the branching pattern of the eutrochozoan phyla and classes is unstable, probably due to the explosive Cambrian radiation during which these groups arose. Similarly, the 18S rRNA data do not provide a reliable signal for the molluscan interclass relationships. Nevertheless, we obtained strong preliminary support for phylogenetic inferences at more restricted taxonomic levels, such as the monophyly of Polyplacophora, Caenogastropoda, Euthyneura, Heterodonta, and Arcoida. PMID:8952075

  2. Details of gastropod phylogeny inferred from 18S rRNA sequences.

    Winnepenninckx, B; Steiner, G; Backeljau, T; De Wachter, R

    1998-02-01

    Some generally accepted viewpoints on the phylogenetic relationships within the molluscan class Gastropoda are reassessed by comparing complete 18S rRNA sequences. Phylogenetic analyses were performed using the neighbor-joining and maximum parsimony methods. The previously suggested basal position of Archaeogastropoda, including Neritimorpha and Vetigastropoda, in the gastropod clade is confirmed. The present study also provides new molecular evidence for the monophyly of both Caenogastropoda and Euthyneura (Pulmonata and Opisthobranchia), making Prosobranchia paraphyletic. The relationships within Caenogastropoda and Euthyneura data turn out to be very unstable on the basis of the present 18S rRNA sequences. The present 18S rRNA data question, but are insufficient to decide on, muricacean (Neogastropoda), neotaenioglossan, pulmonate, or stylommatophoran monophyly. The analyses also focus on two systellommatophoran families, namely, Veronicellidae and Onchidiidae. It is suggested that Systellommatophora are not a monophyletic unit but, due to the lack of stability in the euthyneuran clade, their affinity to either Opisthobranchia or Pulmonata could not be determined. PMID:9479694

  3. Limitations of metazoan 18S rRNA sequence data : implications for reconstructing a phylogeny of the animal kingdom and inferring the reality of the cambrian explosion

    Abouheif, Ehab; Zardoya, Rafael; Meyer, Axel

    1998-01-01

    We document the phylogenetic behavior of the 18S rRNA molecule in 67 taxa from 28 metazoan phyla and assess the effects of among-site rate variation on reconstructing phylogenies of the animal kingdom. This empirical assessment was undertaken to clarify further the limits of resolution of the 18S rRNA gene as a phylogenetic marker and to address the question of whether 18S rRNA phylogenies can be used as a source of evidence to infer the reality of a Cambrian explosion. A notable degree of am...

  4. An updated 18S rRNA phylogeny of tunicates based on mixture and secondary structure models

    Shenkar Noa

    2009-08-01

    suggest a sister-group relationship between Salpida and Pyrosomatida within Thaliacea. Conclusion An updated phylogenetic framework for tunicates is provided based on phylogenetic analyses using the most realistic evolutionary models currently available for ribosomal molecules and an unprecedented taxonomic sampling. Detailed analyses of the 18S rRNA gene allowed a clear definition of the major tunicate groups and revealed contrasting evolutionary dynamics among major lineages. The resolving power of this gene nevertheless appears limited within the clades composed of Phlebobranchia + Thaliacea + Aplousobranchia and Pyuridae + Styelidae, which were delineated as spots of low resolution. These limitations underline the need to develop new nuclear markers in order to further resolve the phylogeny of this keystone group in chordate evolution.

  5. ITS-2 and 18S rRNA gene phylogeny of Aplysinidae (Verongida, Demospongiae).

    Schmitt, Susanne; Hentschel, Ute; Zea, Sven; Dandekar, Thomas; Wolf, Matthias

    2005-03-01

    18S ribosomal DNA and internal transcribed spacer 2 (ITS-2) full-length sequences, each of which was sequenced three times, were used to construct phylogenetic trees with alignments based on secondary structures, in order to elucidate genealogical relationships within the Aplysinidae (Verongida). The first poriferan ITS-2 secondary structures are reported. Altogether 11 Aplysina sponges and 3 additional sponges (Verongula gigantea, Aiolochroia crassa, Smenospongia aurea) from tropical and subtropical oceans were analyzed. Based on these molecular studies, S. aurea, which is currently affiliated with the Dictyoceratida, should be reclassified to the Verongida. Aplysina appears as monophyletic. A soft form of Aplysina lacunosa was separated from other Aplysina and stands at a basal position in both 18S and ITS-2 trees. Based on ITS-2 sequence information, the Aplysina sponges could be distinguished into a single Caribbean-Eastern Pacific cluster and a Mediterranean cluster. The species concept for Aplysina sponges as well as a phylogenetic history with a possibly Tethyan origin is discussed. PMID:15871043

  6. Taxonomy of the genus Rhexinema (Ulvophyceae) based on phylogeny of the 18S rRNA and morphology

    Caisová, Lenka

    2009-01-01

    Roč. 48, č. 4 (2009), s. 15-15. ISSN 0031-8884. [International Phycological Congress /9./. 02.08.2009-08.08.2009, Tokyo] Institutional research plan: CEZ:AV0Z60050516 Keywords : Rhexinema * 18S rRNA * morphology Subject RIV: EF - Botanics

  7. Phylogeny and classification of the Litostomatea (Protista, Ciliophora), with emphasis on free-living taxa and the 18S rRNA gene.

    Vd'ačný, Peter; Bourland, William A; Orsi, William; Epstein, Slava S; Foissner, Wilhelm

    2011-05-01

    The class Litostomatea is a highly diverse ciliate taxon comprising hundreds of species ranging from aerobic, free-living predators to anaerobic endocommensals. This is traditionally reflected by classifying the Litostomatea into the subclasses Haptoria and Trichostomatia. The morphological classifications of the Haptoria conflict with the molecular phylogenies, which indicate polyphyly and numerous homoplasies. Thus, we analyzed the genealogy of 53 in-group species with morphological and molecular methods, including 12 new sequences from free-living taxa. The phylogenetic analyses and some strong morphological traits show: (i) body polarization and simplification of the oral apparatus as main evolutionary trends in the Litostomatea and (ii) three distinct lineages (subclasses): the Rhynchostomatia comprising Tracheliida and Dileptida; the Haptoria comprising Lacrymariida, Haptorida, Didiniida, Pleurostomatida and Spathidiida; and the Trichostomatia. The curious Homalozoon cannot be assigned to any of the haptorian orders, but is basal to a clade containing the Didiniida and Pleurostomatida. The internal relationships of the Spathidiida remain obscure because many of them and some "traditional" haptorids form separate branches within the basal polytomy of the order, indicating one or several radiations and convergent evolution. Due to the high divergence in the 18S rRNA gene, the chaeneids and cyclotrichiids are classified incertae sedis. PMID:21333743

  8. Molecular systematics of Volvocales (Chlorophyceae, Chlorophyta) based on exhaustive 18S rRNA phylogenetic analyses.

    Nakada, Takashi; Misawa, Kazuharu; Nozaki, Hisayoshi

    2008-07-01

    The taxonomy of Volvocales (Chlorophyceae, Chlorophyta) was traditionally based solely on morphological characteristics. However, because recent molecular phylogeny largely contradicts the traditional subordinal and familial classifications, no classification system has yet been established that describes the subdivision of Volvocales in a manner consistent with the phylogenetic relationships. Towards development of a natural classification system at and above the generic level, identification and sorting of hundreds of sequences based on subjective phylogenetic definitions is a significant step. We constructed an 18S rRNA gene phylogeny based on 449 volvocalean sequences collected using exhaustive BLAST searches of the GenBank database. Many chimeric sequences, which can cause fallacious phylogenetic trees, were detected and excluded during data collection. The results revealed 21 strongly supported primary clades within phylogenetically redefined Volvocales. Phylogenetic classification following PhyloCode was proposed based on the presented 18S rRNA gene phylogeny along with the results of previous combined 18S and 26S rRNA and chloroplast multigene analyses. PMID:18430591

  9. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)1

    Stenger, Brianna L.S.; Clark, Mark E.; Kváč, Martin; Khan, Eakalak; Giddings, Catherine W.; Dyer, Neil W.; Schultz, Jessie L.; McEvoy, John M.

    2015-01-01

    Cryptosporidium is an apicomplexan parasite that causes the disease cryptosporidiosis in humans, livestock, and other vertebrates. Much of the knowledge on Cryptosporidium diversity is derived from 18S rRNA gene (18S rDNA) phylogenies. Eukaryote genomes generally have multiple 18S rDNA copies that evolve in concert, which is necessary for the accurate inference of phylogenetic relationships. However, 18S rDNA copies in some genomes evolve by a birth-and-death process that can result in sequen...

  10. Molecular epidemiology of Plasmodium species prevalent in Yemen based on 18 s rRNA

    A Azazy Ahmed

    2010-11-01

    Full Text Available Abstract Background Malaria is an endemic disease in Yemen and is responsible for 4.9 deaths per 100,000 population per year and 43,000 disability adjusted life years lost. Although malaria in Yemen is caused mainly by Plasmodium falciparum and Plasmodium vivax, there are no sequence data available on the two species. This study was conducted to investigate the distribution of the Plasmodium species based on the molecular detection and to study the molecular phylogeny of these parasites. Methods Blood samples from 511 febrile patients were collected and a partial region of the 18 s ribosomal RNA (18 s rRNA gene was amplified using nested PCR. From the 86 positive blood samples, 13 Plasmodium falciparum and 4 Plasmodium vivax were selected and underwent cloning and, subsequently, sequencing and the sequences were subjected to phylogenetic analysis using the neighbor-joining and maximum parsimony methods. Results Malaria was detected by PCR in 86 samples (16.8%. The majority of the single infections were caused by P. falciparum (80.3%, followed by P. vivax (5.8%. Mixed infection rates of P. falciparum + P. vivax and P. falciparum + P. malariae were 11.6% and 2.3%, respectively. All P. falciparum isolates were grouped with the strain 3D7, while P. vivax isolates were grouped with the strain Salvador1. Phylogenetic trees based on 18 s rRNA placed the P. falciparum isolates into three sub-clusters and P. vivax into one cluster. Sequence alignment analysis showed 5-14.8% SNP in the partial sequences of the 18 s rRNA of P. falciparum. Conclusions Although P. falciparum is predominant, P. vivax, P. malariae and mixed infections are more prevalent than has been revealed by microscopy. This overlooked distribution should be considered by malaria control strategy makers. The genetic polymorphisms warrant further investigation.

  11. Evolutionary History of the Chaetognaths Inferred from Actin and 18S-28S rRNA Paralogous Genes

    J.P. Casanova

    2006-01-01

    Full Text Available The chaetognaths constitute a small and enigmatic phylum of marine invertebrates whose phylogenetic affinities remain uncertain. Our phylogenetical investigations inferred from partial paralogous 18S-28S rRNA genes suggest that the event resulting in the presence of two classes of rRNA genes would have occurred at approximately 300-400 million years and prior to the radiation of extant chaetognath, whereas the taxon, according to both molecular and paleontological data, would be dated from at least the Early Cambrian. These divergent rRNA genes could be the result of a whole ribosomal cluster duplication or of an allopolyploid event during a crisis period, since, the fossil are lacking posterioly to the post-Carboniferous period (c.a., 300 million years. In addition, actin phylogeny evidenced that the cytoplasmic chaetognath actin clustered with the cytoplasmic insect actins, while the muscular chaetognath actins are placed basal to all muscular vertebrate actins. The present study suggests that the gene conversion mechanisms could be inefficient in this taxon; this could explain the conservation of extremely divergent paralogous sequences in the chaetognath genomes which could be correlated to the difficulties to identify a sister group between chaetognaths and other taxa among metazoans.

  12. 18S rRNA suggests that Entoprocta are protostomes, unrelated to Ectoprocta

    Mackey, L.Y.; Winnepenninckx, B.; Wachter, R.; Backeljau, T.; Emschermann, P.; Garey, J.R.

    1996-01-01

    The Ento- and Ectoprocta are sometimes placed together in the Bryozoa, which have variously been regarded as proto- or deuterostomes. However, Entoprocta have also been allied to the pseudocoelomates, while Ectoprocta are often united with the Brachiopoda and Phoronida in the (super)phylum Lophophorata. Hence, the phylogenetic relationships of these taxa are still much debated. We determined complete 18S rRNA sequences of two entoprocts, an ectoproct, an inarticulate brachiopod, a phoronid, t...

  13. Characterization of Hydrocortisone Biometabolites and 18S rRNA Gene in Chlamydomonas reinhardtii Cultures

    Seyed Bagher Mosavi-Azam

    2008-10-01

    Full Text Available A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1. This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25ºC for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17b-Dihydroxyandrost-4-en-3-one (2, 11b-hydroxyandrost-4-en-3,17-dione (3, 11b,17a,20b,21-tetrahydroxypregn-4-en-3-one (4 and prednisolone (5 were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  14. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)

    Stenger, B.L.S.; Clark, M.E.; Kváč, Martin; Khan, E.; Giddings, C.W.; Dyer, N.W.; Schultz, J.L.; McEvoy, J.M.

    2015-01-01

    Roč. 32, JUN 2015 (2015), s. 113-123. ISSN 1567-1348 R&D Projects: GA MŠk(CZ) LH11061 Institutional support: RVO:60077344 Keywords : Cryptosporidium * Paralogy * 18S rRNA * 18S rDNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 3.015, year: 2014

  15. The effect of secondary compounds on the rumen microbial population structure measured by 16S rRNA and 18S rRNA

    Full text: Plant secondary compounds in the forages have an important role in determining forage quality. A method for evaluating their effects on microbial population structure was carried out using the in vitro gas syringe system followed by extraction of RNA and gel separation of 16S rRNA and 18S rRNA. Quantification of 16S rRNA and 18S rRNA bands indicated the prokaryote and eukaryote populations, respectively. Five types of plant materials, i.e. Nothopanax scutellarium (Mangkokan) leaves, Morinda citrifolia (Mengkudu) fruit, Sapindus rarak (lerak) fruit and two types of Sesbania sesban leaves (hgh saponin and low saponin) were tested and Pennisetum purpureum (rumput gajah, Indonesian name) was used as a control roughage. Presence of saponin in these plant materials was determined qualitatively by thin layer chromatography. Eukaryote population was found to be significantly affected by the above plant materials. Both types of S. sesban leaves caused total elimination of eukaryotes. S. rarak reduced both eukaryote and prokaryote populations. The observed inhibition of eukaryote population might be due to the presence of saponin in these plant materials. In another experiment, a methanol extract of S. rarak which contained saponin was included and its effect on in vitro fermentation of P. purpureum was evaluated. The results showed that at higher levels of inclusion of S. rarak methanol extract, eukaroytes were totally eliminated. Comparison was made between microbial mass calculated based on difference between apparent undigested residue and true undigested residue and microbial mass calculations based on 16S rRNA and 18S rRNA. Microbial mass calculated by difference method was much higher than the microbial mass calculated on the basis of 16S rRNA and 18S rRNA. The quantification of RNA can be a useful and rapid technique for an accurate assessment of the effect of new forage materials on the microbial population structure. Other parameters from in vitro

  16. Initial results on the molecular phylogeny of the Nudibranchia (Gastropoda, Opisthobranchia) based on 18S rDNA data.

    Wollscheid, E; Wägele, H

    1999-11-01

    This study investigated nudibranch phylogeny on the basis of 18S rDNA sequence data. 18S rDNA sequence data of 19 taxa representing the major living orders and families of the Nudibranchia were analyzed. Representatives of the Cephalaspidea, Anaspidea, Gymnomorpha, Prosobranchia, and Pulmonata were also sequenced and used as outgroups. An additional 28 gastropod sequences taken from GenBank were also included in our analyses. Phylogenetic analyses of these more than 50 gastropod taxa provide strong evidence for support of the monophyly of the Nudibranchia. The monophyly of the Doridoidea, Cladobranchia, and Aeolidoidea within the Nudibranchia are also strongly supported. Phylogenetic utility and information content of the 18S rDNA sequences for Nudibranchia, and Opisthobranchia in general, are examined using the program SplitsTree as well as phylogenetic reconstructions using distance and parsimony approaches. 0Results based on these molecular data are compared with hypotheses about nudibranch phylogeny inferred from morphological data. PMID:10603252

  17. Filling a gap in the phylogeny of flatworms: relationships within the Rhabdocoela (Platyhelminthes), inferred from 18S ribosomal DNA sequences

    Willems, Wim; Walberg, A.; Jondelius, U.; Littlewood, D.; Backeljau, T.; Schockaert, Ernest; Artois, Tom

    2006-01-01

    The phylogeny of the Rhabdocoela, a species-rich taxon of free-living flatworms, is reconstructed based on complete 18S rDNA sequences. The analysis includes 62 rhabdocoels and 102 representatives of all major flatworm taxa. In total, 46 new sequences are used, 41 of them from rhabdocoel species, five from proseriates. Phylogenetic analysis was performed using maximum parsimony and Bayesian inference. Clade support was evaluated with parsimony jackknifing, Bremer support indice...

  18. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    Martins Cesar

    2010-01-01

    Full Text Available Abstract Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s occurring in 39.6% of the analyzed individuals (both male and female were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement.

  19. Phylogenetic analysis of the spider mite sub-family Tetranychinae (Acari: Tetranychidae based on the mitochondrial COI gene and the 18S and the 5' end of the 28S rRNA genes indicates that several genera are polyphyletic.

    Tomoko Matsuda

    Full Text Available The spider mite sub-family Tetranychinae includes many agricultural pests. The internal transcribed spacer (ITS region of nuclear ribosomal RNA genes and the cytochrome c oxidase subunit I (COI gene of mitochondrial DNA have been used for species identification and phylogenetic reconstruction within the sub-family Tetranychinae, although they have not always been successful. The 18S and 28S rRNA genes should be more suitable for resolving higher levels of phylogeny, such as tribes or genera of Tetranychinae because these genes evolve more slowly and are made up of conserved regions and divergent domains. Therefore, we used both the 18S (1,825-1,901 bp and 28S (the 5' end of 646-743 bp rRNA genes to infer phylogenetic relationships within the sub-family Tetranychinae with a focus on the tribe Tetranychini. Then, we compared the phylogenetic tree of the 18S and 28S genes with that of the mitochondrial COI gene (618 bp. As observed in previous studies, our phylogeny based on the COI gene was not resolved because of the low bootstrap values for most nodes of the tree. On the other hand, our phylogenetic tree of the 18S and 28S genes revealed several well-supported clades within the sub-family Tetranychinae. The 18S and 28S phylogenetic trees suggest that the tribes Bryobiini, Petrobiini and Eurytetranychini are monophyletic and that the tribe Tetranychini is polyphyletic. At the genus level, six genera for which more than two species were sampled appear to be monophyletic, while four genera (Oligonychus, Tetranychus, Schizotetranychus and Eotetranychus appear to be polyphyletic. The topology presented here does not fully agree with the current morphology-based taxonomy, so that the diagnostic morphological characters of Tetranychinae need to be reconsidered.

  20. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.

    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina

    2016-05-15

    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis. PMID:27084467

  1. Translation by ribosome shunting on adenovirus and hsp70 mRNAs facilitated by complementarity to 18S rRNA

    Yueh, Andrew; Schneider, Robert J.

    2000-01-01

    Translation initiation on eukaryotic mRNAs involves 40S ribosome association with mRNA caps (m7GpppN), mediated by initiation factor eIF4F. 40S eukaryotic ribosomes and initiation factors undergo 5′ scanning to the initiation codon, with no known role for complementarity between eukaryotic 18S rRNA and the 5′ noncoding region of mRNAs. We demonstrate that the 5′ noncoding region of human adenovirus late mRNAs, known as the tripartite leader, utilizes a striking complementarity to 18S rRNA to ...

  2. Genetic variation and identification of cultivated Fallopia multiflora and its wild relatives by using chloroplast matK and 18S rRNA gene sequences.

    Yan, Ping; Pang, Qi-Hua; Jiao, Xu-Wen; Zhao, Xuan; Shen, Yan-Jing; Zhao, Shu-Jin

    2008-10-01

    FALLOPIA MULTIFLORA (Thunb.) Harald . has been widely and discriminatingly used in China for the study and treatment of anemia, swirl, deobstruent, pyrosis, insomnia, amnesia, atheroma and also for regulating immune functions. However, there is still confusion about the herbal drug's botanical origins and the phylogenetic relationship between the cultivars and the wild relatives. In order to develop an efficient method for identification, a molecular analysis was performed based on 18 S rRNA gene and partial MATK gene sequences. The 18 S rRNA gene sequences of F. MULTIFLORA were 1809 bp in length and were highly conserved, indicating that the cultivars and the wild F. MULTIFLORA have the same botanical origin. Based on our 18 S rRNA gene sequences analysis, F. MULTIFLORA could be easily distinguished at the DNA level from adulterants and some herbs with similar components. The MATK gene partial sequences were found to span 1271 bp. The phylogenetic relation of F. MULTIFLORA based on the MATK gene showed that all samples in this paper were divided into four clades. The sequences of the partial MATK gene had many permutations, which were related to the geographical distributions of the samples. MATK gene sequences provided valuable information for the identification of F. MULTIFLORA. New taxonomic information could be obtained to authenticate the botanical origin of the F. MULTIFLORA, the species and the medicines made of it. PMID:18759218

  3. A local role for the small ribosomal subunit primary binder rpS5 in final 18S rRNA processing in yeast.

    Andreas Neueder

    Full Text Available In vivo depletion of the yeast small ribosomal subunit (SSU protein S5 (rpS5 leads to nuclear degradation of nascent SSUs and to a perturbed global assembly state of the SSU head domain. Here, we report that rpS5 plays an additional local role at the head/platform interface in efficient SSU maturation. We find that yeast small ribosomal subunits which incorporated an rpS5 variant lacking the seven C-terminal amino acids have a largely assembled head domain and are exported to the cytoplasm. On the other hand, 3' processing of 18S rRNA precursors is inhibited in these ribosomal particles, although they associate with the putative endonuclease Nob1p and other late acting 40S biogenesis factors. We suggest that the SSU head component rpS5 and platform components as rpS14 are crucial constituents of a highly defined spatial arrangement in the head-platform interface of nascent SSUs, which is required for efficient processing of the therein predicted SSU rRNA 3' end. Positioning of rpS5 in nascent SSUs, including its relative orientation towards platform components in the head-platform cleft, will depend on the general assembly and folding state of the head domain. Therefore, the suggested model can explain 18S precursor rRNA 3' processing phenotypes observed in many eukaryotic SSU head assembly mutants.

  4. Gene cloning of the 18S rRNA of an ancient viable moss from the permafrost of northeastern Siberia

    Marsic, Damien; Hoover, Richard B.; Gilichinsky, David A.; Ng, Joseph D.

    1999-12-01

    A moss plant dating as much as 40,000 years old was collected from the permafrost of the Kolyma Lowlands of Northeastern Siberia. The plant tissue was revived and cultured for the extraction of its genomic DNA. Using the polymerase chain reaction technique, the 18S ribosomal RNA gene was cloned and its sequence studied. Comparative sequence analysis of the cloned ribosomal DNA to other known 18S RNA showed very high sequence identity and was revealed to be closest to the moss specie, Aulacomnium turgidum. The results of this study also show the ability of biological organisms to rest dormant in deep frozen environments where they can be revived and cultured under favorable conditions. This is significant in the notion that celestial icy bodies can be media to preserve biological function and genetic material during long term storage or transport.

  5. Multiplex RT-PCR detection of Cucumber mosaic virus subgroups and Tobamoviruses infecting Tomato using 18S rRNA as an internal control

    Shaoning Chen; Hao Gu; Xiaoming Wang; Jishuang Chen; Weimin Zhu

    2011-01-01

    A multiplex reverse-transcription polymerase chain reaction (RT-PCR) protocol was developed for simultaneous detection and discrimination of subgroups of Cucumber mosaic virus (CMV), including its satellite RNA, Tomato mosaic virus (ToMV) and Tobacco mosaic virus (TMV),using 18S rRNA as an internal control.Species- and subgroups-specific primers designed to differentiate CMV subgroups Ⅰ and Ⅱ, ToMV and TMV, were assessed using the cDNA clones of viral genomes, CMV satellite RNA and 18S rRNA gene from tomato (Solanum lycopersicum L.) or tobacco (Nicotiana tobacum).Using total RNA extracted from artificial mixture of tomato leaf tissues infected by each virus, the reaction components and cycling parmeters were optimized and a multiplex RT-PCR procedure was established.Six fragments of 704, 593, 512, 421,385, 255 bp, specific to CMV subgroup ll, CMV subgroup I, ToMV, TMV, satellite RNA and 18S rRNA, respectively, were sinultaneously amplified.The sensitivity of the multiplex RT-PCR method for detecting CMV was 100 times higher than that of double-antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA).This method was successfully used for field detection.Among 141 samples collected from East China through tomato growth seasons, 106 single infections with one of the above isolates were detected and 13 mixed infections were found.The results showed the potential use of this method for investigating the epidemiology of viral diseases infecting tomato.

  6. Cultivation-independent analysis reveals a shift in ciliate 18S rRNA gene diversity in a polycyclic aromatic hydrocarbon-polluted soil

    Lara, Enrique; Berney, Cédric; Harms, Hauke; Chatzinotas, Antonis

    2010-01-01

    Using cultivation-independent methods the ciliate communities of a clay-rich soil with a 90-year record of pollution by polycyclic aromatic hydrocarbons (PAH) (4.5 g kg−1 PAH) were compared with that of a nonpolluted soil collected in its vicinity and with similar properties. A ciliate-specific set of 18S rRNA gene targeting primers was designed and used to amplify DNA extracted from both soils (surface and 20 cm depth). Four clone libraries were generated with PCR products that covered an 18...

  7. Nematode 18S rRNA gene is a reliable tool for environmental biosafety assessment of transgenic banana in confined field trials.

    Nakacwa, R; Kiggundu, A; Talwana, H; Namaganda, J; Lilley, C; Tushemereirwe, W; Atkinson, H

    2013-10-01

    Information on relatedness in nematodes is commonly obtained by DNA sequencing of the ribosomal internal transcribed spacer region. However, the level of diversity at this locus is often insufficient for reliable species differentiation. Recent findings suggest that the sequences of a fragment of the small subunit nuclear ribosomal DNA (18S rRNA or SSU), identify genera of soil nematodes and can also distinguish between species in some cases. A database of soil nematode genera in a Ugandan soil was developed using 18S rRNA sequences of individual nematodes from a GM banana confined field trial site at the National Agricultural Research Laboratories, Kawanda in Uganda. The trial was planted to evaluate transgenic bananas for resistance to black Sigatoka disease. Search for relatedness of the sequences gained with entries in a public genomic database identified a range of 20 different genera and sometimes distinguished species. Molecular markers were designed from the sequence information to underpin nematode faunal analysis. This approach provides bio-indicators for disturbance of the soil environment and the condition of the soil food web. It is being developed to support environmental biosafety analysis by detecting any perturbance by transgenic banana or other GM crops on the soil environment. PMID:23661261

  8. The utility of diversity profiling using Illumina 18S rRNA gene amplicon deep sequencing to detect and discriminate Toxoplasma gondii among the cyst-forming coccidia.

    Cooper, Madalyn K; Phalen, David N; Donahoe, Shannon L; Rose, Karrie; Šlapeta, Jan

    2016-01-30

    Next-generation sequencing (NGS) has the capacity to screen a single DNA sample and detect pathogen DNA from thousands of host DNA sequence reads, making it a versatile and informative tool for investigation of pathogens in diseased animals. The technique is effective and labor saving in the initial identification of pathogens, and will complement conventional diagnostic tests to associate the candidate pathogen with a disease process. In this report, we investigated the utility of the diversity profiling NGS approach using Illumina small subunit ribosomal RNA (18S rRNA) gene amplicon deep sequencing to detect Toxoplasma gondii in previously confirmed cases of toxoplasmosis. We then tested the diagnostic approach with species-specific PCR genotyping, histopathology and immunohistochemistry of toxoplasmosis in a Risso's dolphin (Grampus griseus) to systematically characterise the disease and associate causality. We show that the Euk7A/Euk570R primer set targeting the V1-V3 hypervariable region of the 18S rRNA gene can be used as a species-specific assay for cyst-forming coccidia and discriminate T. gondii. Overall, the approach is cost-effective and improves diagnostic decision support by narrowing the differential diagnosis list with more certainty than was previously possible. Furthermore, it supplements the limitations of cryptic protozoan morphology and surpasses the need for species-specific PCR primer combinations. PMID:26801593

  9. Molecular analysis of 18S rRNA gene of Cryptosporidium parasites from patients living in Iran, Malawi, Nigeria and Vietnam.

    Ghaffari, Salman; Kalantari, Narges

    2012-01-01

    Cryptosporidium species are one of the most common causes of gastrointestinal infection in humans around the world. This study has aimed to investigate the hyper variable region of the 18S rRNA gene in Cryptosporidium for exact parasite identification. DNA was extracted from 26 fecal samples from which initially Cryptosporidium oocysts were identified by Ziehl-Neelsen acid-fast , Auramine phenol and ELISA techniques. Nested PCR, targeting the most polymorphic region of the 18S rRNA gene and genotyping was performed by restriction endonuclease digestion of the PCR product followed by nucleotide sequencing and phylogenic analysis. Among 26 isolates analyzed, three species of Cryptosporidium were identified; 38.5% of the isolates were C. hominis while 53.8% of the isolates were C. parvum and 7.7% of the isolates were C. meleagridis, which the last two species have the potentially zoonotic transmission. The only 11T subtype of C. hominis was demonstrated. These strains clustered distinctly into either human or animal origin regardless of the geographical origin, age, or immunity status of the patients. In summary, this work is the first report of C. meleagridis infecting human in Iran. Moreover, it suggested that multi-locus study of Cryptosporidium species in developing countries would be necessary to determine the extent of transmission of cryptosporidiosis in the populations. PMID:24551771

  10. Avian malaria in captive psittacine birds: detection by microscopy and 18S rRNA gene amplification.

    Belo, N O; Passos, L F; Júnior, L M C; Goulart, C E; Sherlock, T M; Braga, E M

    2009-03-01

    A cross-sectional survey was conducted to estimate the occurrence of malaria infection among captive psittacine birds (n=127) from three zoological gardens in Brazil. Malaria infection was evaluated by the association of direct examination of blood smears with amplification of the 18SSU rRNA gene of the Plasmodium genus, demonstrating an overall occurrence of 36%. Most infected bird species were Amazona aestiva (28/73), Ara ararauna (6/10), and Amazona amazonica (3/10). The low parasitemias observed among the infected birds suggest a chronic infection. The sequence analyses of 10 isolates indicate a potential occurrence of four distinct Plasmodium lineages. These findings provide new data on malarial infection in captive psittacine birds, and emphasize the need for better control of importation and exportation of these birds. PMID:18937986

  11. Effect of secondary compounds in forages on rumen micro-organisms quantified by 16S and 18S rRNA

    A gas syringe method was used to evaluate the effect of secondary compounds from plant materials on in vitro fermentation products and microbial biomass. The experiment used Pennisetum purpureum, Morinda citrifolia fruit, Nothopanax scutellarium leaves, Sesbania sesban LS (low saponins type), Sesbania sesban HS (high saponins type) and Sapindus rarak fruit as substrates. The incubation was conducted with and without polyethylene glycol 6000 (PEG) addition for 24 hours. Gas production and short-chain fatty acids (SCFA) were analysed. Prokaryotic and eukaryotic concentrations were measured by quantifying 16S and 18S rRNA. The percentage increase in gas production due to PEG was very small (<5%) for all plant materials, which indicated that the biological effect of tannin in these plant materials is limited. TLC analysis revealed that all materials contained saponin, but only S. rarak, followed by S. sesban, contained a high diversity of saponins. S. sesban gave the highest (234 ml/g) while S. rarak gave the lowest gas production (115 ml/g). S. rarak gave the lowest SCFA production (3.57 mmole/g) and also the lowest ratio of acetate to propionate (1.76), indicating a change in pattern of SCFA production. Total elimination of eukaryotic concentration was evident from the absence of the 18S rRNA band when S. rarak and S. sesban were used as sole substrates. S. rarak also reduced the prokaryotic concentration. To use S. rarak as a defaunating agent without affecting prokaryotes, a crude saponin extract was prepared from S. rarak for further experiment. Different concentrations of crude saponins in a methanol extract of S. rarak fruit dissolved in rumen buffer were added to a substrate consisting of elephant grass and wheat bran (7:3 w/w). Microbial biomass yield was quantified by gravimetry and using rRNA as a marker. Addition of crude saponin extract from S. rarak to a high-roughage diet increased microbial biomass (MB) yield to 1.07 and 1.14 times MB yield of the

  12. Protist 18S rRNA gene Sequence Analysis Reveals Multiple Sources of Organic Matter Contributing to Turbidity Maxima of the Columbia River Estuary

    Herfort, Lydie; Peterson, Tawnya D.; McCue, Lee Ann; Zuber, Peter A.

    2011-10-05

    The Columbia River estuary is traditionally considered a detritus-based ecosystem fueled in summer by organic matter (OM) from expired freshwater diatoms. Since Estuarine Turbidity Maxima (ETM) are sites of accumulation and transformation of this phytoplankton-derived OM, to further characterize the ETM protist assemblage, we collected in August 2007 bottom waters throughout an ETM event, as well as surface water during the peak of bottom turbidity, and performed biogeochemical, microscopic and molecular (18S rRNA gene clone libraries) analyses. These data confirmed that the majority of the particulate OM in ETMs is derived from chlorophyll a-poor particulate organic carbon tagged by DNA too damaged to be detected by molecular analysis.

  13. 罗氏沼虾18S rRNA基因生物素标记探针的制备及应用%Preparation and application of the biotin-labeled probe of 18S rRNA gene in Macrobrachium rosenbergii

    高风英; 叶星; 白俊杰; 吴锐全; 劳海华; 简清; 罗建仁

    2005-01-01

    Probes are essential for study of gene expression and regulation. In this study, a method was established to prepare the biotin-labeled probe for 18S rRNA gene of freshwater prawn, Macrobrachium rosenbergii. And the labeled method was used to produce a lysozyme gene probe, then applied in analysis of lysozyme gene expression. Primers were designed according to the nucleotide sequences of 18S rRNA of Decalxxta in order to isolate the 18S rRNA gene sequences of M. rosenbergii. Total genomic DNA was isolated from hepatopancreas of the freshwater prawn. A specific DNA fragment with desired size was amplified by PCR using the total DNA as templates. The DNA fragment was inserted into pGEM-T Easy vector and sequenced. The result of BLAST and alignment analysis confirmed that the DNA fragment isolated was the 18S rRNA gene of M. rosenbergii, which was 418 nt in length.Biotin-labeled probe of the 18S rRNA was then produced by PCR using the recombinant plasmid as templates. The biotin-21-dTTP and the non-labeled dNTP were added to the PCR reaction system. Ratio of the biotin-21-dTTP and the non-labeled dTFP was 3 to 1.The yield of the labeled probe is 300 ng·μL-1. The detection limit of the probe is 60 pg. A biotin-labeled probe of lysozyme gene was prepared by the same label method, and the yield of the lysozyme gene probe is 500 ng·μL-1. These biotin-labeled probes were applied in Northern dot blotting analysis of tissue distribution of lysoyzme mRNA of M. rosenbergii. Signals were scanned and quantified by Analysis System of Biology Image. The signal intensity ratio of the lysozyme to 18S rRNA represents the relative expression level of lysozyme mRNA. The results showed that the lysozyme mRNA existed in all the tissues checked, including eye,muscle, gill, hepatopancreas, haemocytes and intestine. But lysoyzme mRNA levels varied among different tissues. The highest level was found in the intestine, and the second was in the hepatopancreas and the lowest was in the

  14. Molecular characterization of Cryptosporidium xiaoi in goat kids in Bangladesh by nested PCR amplification of 18S rRNA gene

    AMAM; Zonaed; Siddiki; Sohana; Akter; Mina; Zinat; Farzana; Bibi; Ayesa; Rasel; Das; Mohammad; Alamgir; Hossain

    2015-01-01

    Objective:To investigate the prevalence of Cryptosporidium spp.in goat kids in selected areas of Bangladesh and to elucidate the potential zoonotic hazards.Methods:In the present study,we have used Ziehl-Neelsen staining and nested PCR approach to identify and characterize the Cryptosporidium sp.from diarrhoeic feces of goat kids.A total of 100 diarrhoeic feces samples were collected from Chittagong region in Southern Bangladesh.For nested PCR analysis,specific primers for amplification of 581 base pair fragments of 18 S rRNA gene were used.Results:A total of 15%and 3%samples were found positive in microscopic study and in nested PCR analysis respectively.Phylogenetic analysis of sequence data showed similarity with that of Cryptosporidium xiaoi recorded from sheep and goat.Conclusions:To our knowledge,this is the first report of Cryptosporidium xiaoi responsible for diarrhoea in goat kids in Bangladesh.Further study can highlight their zoonotic significance along with genetic diversity in other host species inside the country.

  15. Phylogeny of the sundews, Drosera (Droseraceae), based on chloroplast rbcL and nuclear 18S ribosomal DNA Sequences.

    Rivadavia, Fernando; Kondo, Katsuhiko; Kato, Masahiro; Hasebe, Mitsuyasu

    2003-01-01

    The sundew genus Drosera consists of carnivorous plants with active flypaper traps and includes nearly 150 species distributed mainly in Australia, Africa, and South America, with some Northern Hemisphere species. In addition to confused intrageneric classification of Drosera, the intergeneric relationships among the Drosera and two other genera in the Droseraceae with snap traps, Dionaea and Aldrovanda, are problematic. We conducted phylogenetic analyses of DNA sequences of the chloroplast rbcL gene for 59 species of Drosera, covering all sections except one. These analyses revealed that five of 11 sections, including three monotypic sections, are polyphyletic. Combined rbcL and 18S rDNA sequence data were used to infer phylogenetic relationships among Drosera, Dionaea, and Aldrovanda. This analysis revealed that all Drosera species form a clade sister to a clade including Dionaea and Aldrovanda, suggesting that the snap traps of Aldrovanda and Dionaea are homologous despite their morphological differences. MacClade reconstructions indicated that multiple episodes of aneuploidy occurred in a clade that includes mainly Australian species, while the chromosome numbers in the other clades are not as variable. Drosera regia, which is native to South Africa, and most species native to Australia, were clustered basally, suggesting that Drosera originated in Africa or Australia. The rbcL tree indicates that Australian species expanded their distribution to South America and then to Africa. Expansion of distribution to the Northern Hemisphere from the Southern Hemispere occurred in a few different lineages. PMID:21659087

  16. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics.

    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G

    2005-09-01

    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  17. Phylogeny of the cuttlefishes (Mollusca:Cephalopoda) based on mitochondrial COI and 16S rRNA gene sequence data

    LIN Xiangzhi; ZHENG Xiaodong; XIAO Shu; WANG Rucai

    2004-01-01

    To clarify cuttlefish phylogeny, mitochondrial cytochrome c oxidase subunit I (COI) gene and partial 16S rRNA gene are sequenced for 13 cephalopod species. Phylogenetic trees are constructed, with the neighbor-joining method.Coleoids are divided into two main lineages, Decabrachia and Octobrachia. The monophyly of the order Sepioidea,which includes the families Sepiidae, Sepiolidae and Idiosepiidae, is not supported. From the two families of Sepioidea examined, the Sepiolidae are polyphyletic and are excluded from the order. On the basis of 16S rRNA and amino acid of COI gene sequences data, the two genera (Sepiella and Sepia) from the Sepiidae can be distinguished, but do not have a visible boundary using COI gene sequences. The reason is explained. This suggests that the 16S rDNA of cephalopods is a precious tool to analyze taxonomic relationships at the genus level, and COI gene is fitter at a higher taxonomic level (i.e., family).

  18. Sequence and Taxonomy Analysis of Arctium lappa 18S rRNA Gene%牛蒡18S核糖体RNA基因分析和分类学研究

    蔡侃; 孔文刚; 夏红剑; 侯进慧

    2011-01-01

    Arctium lappa 18S rRNA gene was amplified,and a 1636bp DNA were sequenced with its Genbank accession number JF509958.The gene sequence of Arctium lappa 18Sr RNA was analyzed with related species in GenBank.The result shows,Arctium lappa 18S rRNA gene has a high homology with many families within Dicotyledoneae,such as Asteraceae and Caprifoliaceae.This study provides reference for further study of Arctium lappa in molecular level.%扩增牛蒡18S rRNA基因,测序获得1 636bp的DNA序列,GenBank登录号是JF703098。利用牛蒡18S rDNA序列和GenBank相关序列构建系统发育树,结果表明,牛蒡18S rRNA基因与双子叶纲的菊科、忍冬科的一些物种序列相似度高。对在分子水平上牛蒡的研究提供了资料。

  19. 多浆旱生植物霸王18SrRNA基因的克隆及序列分析%Cloning and sequence analysis of 18S rRNA gene fragment from succulent xerophyte Zygophyllum xanthoxylum

    胡静; 谢俊仁; 王锁民

    2012-01-01

    In order to reveal the relationship between succulent xerophyte Zygophyllum xanthoxylum and other plants and to provide evidences for the biologically evolution, total DNA was extracted from leaves of Z. xanthoxylurn seedlings, and the 18S rRNA gene was cloned by PCR using general primers and cloned into pGEM-T vector. The positive clone identified by PCR was sequenced. The sequencing result revealed that the 18S rRNA gene fragment from Z. xanthoxylum contains 1808 bp. Homology comparison with other plants 18S rRNA gene sequences in the GenBank showed that it shared over 96% nucleotide sequence homology, so it is concluded that 18S rRNA is very conservative gene in plants. However, Homology matrix and Blast showed that Z. xanthoxylurn shared high similarity (98%) with the identified 18S rRNA in Galearia fili formis , Cnidoscolus aconiti folius and Hevea brasiliensis. Phylogenetic tree analysis indicated that Z. xanthoxylum and Panax notoginseng were most consanguineously grouped.%为探讨多浆旱生植物霸王(Zygophyllum xanthoxylum)的生物进化历程及与其他植物的亲缘关系,本研究以霸王叶基因组DNA为模板,使用通用引物扩增其18SrRNA基因片段,并克隆到pGEM—T载体,阳性克隆经鉴定后进行测序。核苷酸序列分析结果表明,该片段长1808bp,所得序列与GenBank中注册的18SrRNA基因序列的同源性均在96%以上。可见,高等植物18SrRNA的基因非常保守。同源性分析与Blast比较结果表明,霸王与小盘木(Galearia filiformis)、驱虫苋(Cnidoscolus aconitifolius)及橡胶树(Herera brasiliensis)同源性最高。系统进化树分析表明,霸王与三七(Panax notoginseng)的亲缘关系最近。

  20. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten; Dalgaard, Jacob; Lykke-Andersen, Jens; Phan, Hoa T.N.; Trevisanato, Siro; Østergaard, Laust; Larsen, Niels; Leffers, Henrik

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows is a...

  1. 河南猪株旋毛虫18S rRNA基因的同源性序列分析%18S rRNA sequence analysis and construction of phylogenetic tree of Trichinella from swine in Henan Province

    王丽娜; 路国兵; 杨晓东; 高云; 陈晓宁

    2011-01-01

    目的 通过分析18S rRNA基因序列同源性,对河南猪株旋毛虫进行分子鉴定及分类. 方法 收集河南猪株旋毛虫成虫,提取总RNA,反转录合成cDNA,经特异引物扩增获得18S rRNA基因片段.将此目的基因与pMD18-T载体连接,转化大肠埃希菌感受态细胞,阳性克隆经PCR及酶切鉴定后进行序列测定及分析,构建系统发育树. 结果 构建的重组质粒酶切片段大小分别为2 700和1 800 bp,与预期值相符.根据18S rRNA碱基序列构建系统发生树,河南猪株旋毛虫与虫株Trichinella nativa (AY487254.1)的亲缘关系较近,同源性为99.1%. 结论 河南猪株旋毛虫归属于T2.%Objective To identify and classify Trichinella from swine in Henan Province at the molecular level by sequence homology analysis of the 18S rRNA gene. Methods Total RNA was extracted from adult Trichinella collected from swine in Henan. cDNA was obtained by reverse transcription. The 18S rRNA gene was amplified with a specific primer. The fragments of PCR products were ligated to pMD18-T. This was then transformed into E. Coli competent cells. After identification by PCR and restrictive endonuclease digestion, the positive clone was sequenced and analyzed and then a phylogenetic tree was constructed. Results The fragments of the constructed recombinant plasmid were a-bout 2 700 bp and 1 800 bp, which were consistent with expected values. In the phylogenetic tree based on the base sequence of the 18S rRNA gene, Trichinella from swine in Henan Province was the closest relative to T. Nativa (AY487254. 1) with sequence similarity of more than 99. 1%. Conclusion Trichinella from swine in Henan Province was Trichinella nativa (T2).

  2. Phylogeny of the malarial genus Plasmodium, derived from rRNA gene sequences.

    Escalante, A A; Ayala, F. J.

    1994-01-01

    Malaria is among mankind's worst scourges, affecting many millions of people, particularly in the tropics. Human malaria is caused by several species of Plasmodium, a parasitic protozoan. We analyze the small subunit rRNA gene sequences of 11 Plasmodium species, including three parasitic to humans, to infer their evolutionary relationships. Plasmodium falciparum, the most virulent of the human species, is closely related to Plasmodium reichenowi, which is parasitic to chimpanzee. The estimate...

  3. An effect of 16S rRNA intercistronic variability on coevolutionary analysis in symbiotic bacteria: Molecular phylogeny of Arsenophonus triatominarum

    Šorfová, Pavlína; Škeříková, Andrea; Hypša, Václav

    2008-01-01

    Roč. 31, č. 2 (2008), s. 88-100. ISSN 0723-2020 R&D Projects: GA ČR GA206/04/0520; GA AV ČR IAA601410708 Institutional research plan: CEZ:AV0Z60220518 Keywords : intragenomic heterogeneity * 16S rRNA * coevolution * insect symbionts * molecular phylogeny Subject RIV: EE - Microbiology, Virology Impact factor: 2.582, year: 2008

  4. Molecular phylogeny of the Cricetinae subfamily based on the mitochondrial cytochrome b and 12S rRNA genes and the nuclear vWF gene

    Neumann, K.; Michaux, Johan,; Lebedev, V.; N Yigit; Colak, E.; Ivanova, N.; Poltoraus, A.; Surov, A.; Markov, G.; Maak, S.; Neumann, S.; Gattermann, R.

    2006-01-01

    Despite some popularity of hamsters as pets and laboratory animals there is no reliable phylogeny of the subfamily Cricetinae available so far. Contradicting views exist not only about the actual number of species but also concerning the validity of several genera. We used partial DNA sequences of two mitochondrial (cytochrome b, 12S rRNA) and one partial nuclear gene (von Willebrand Factor exon 28) to provide a first gene tree of the Cricetinae based on 15 taxa comprising six genera: Accordi...

  5. Phylogeny and Taxonomy of Archaea: A Comparison of the Whole-Genome-Based CVTree Approach with 16S rRNA Sequence Analysis

    Guanghong Zuo

    2015-03-01

    Full Text Available A tripartite comparison of Archaea phylogeny and taxonomy at and above the rank order is reported: (1 the whole-genome-based and alignment-free CVTree using 179 genomes; (2 the 16S rRNA analysis exemplified by the All-Species Living Tree with 366 archaeal sequences; and (3 the Second Edition of Bergey’s Manual of Systematic Bacteriology complemented by some current literature. A high degree of agreement is reached at these ranks. From the newly proposed archaeal phyla, Korarchaeota, Thaumarchaeota, Nanoarchaeota and Aigarchaeota, to the recent suggestion to divide the class Halobacteria into three orders, all gain substantial support from CVTree. In addition, the CVTree helped to determine the taxonomic position of some newly sequenced genomes without proper lineage information. A few discrepancies between the CVTree and the 16S rRNA approaches call for further investigation.

  6. Molecular phylogeny of Pneumocystis based on 5.8S rRNA gene and the internal transcribed spacers of rRNA gene sequences

    2008-01-01

    To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis.

  7. A new set of primers directed to 18S rRNA gene for molecular identification of Cryptosporidium spp. and their performance in the detection and differentiation of oocysts shed by synanthropic rodents.

    Silva, Sheila O S; Richtzenhain, Leonardo J; Barros, Iracema N; Gomes, Alessandra M M C; Silva, Aristeu V; Kozerski, Noemila D; de Araújo Ceranto, Jaqueline B; Keid, Lara B; Soares, Rodrigo M

    2013-11-01

    Cryptosporidium spp. are cosmopolitan protozoa that infect fishes, reptiles, amphibians, birds and mammals. More than 20 species are recognized within this genus. Rodents are a group of abundant and ubiquitous organisms that have been considered reservoirs of Cryptosporidium for humans and livestock. The aim of this study was to design specific primers for the gene encoding 18S rRNA, potentially capable of amplifying any species or genotype of Cryptosporidium spp. and evaluate the diagnostic attributes of the nested-PCR based on such probes. The primers were designed to amplify the shortest segment as possible to maximize the sensitivity of the test, but preserving the discriminatory potential of the amplified sequences for phylogenetic inferences. The nested-PCR standardized in this study (nPCR-SH) was compared in terms of sensitivity with another similar assay (nPCR-XIAO) that has been largely used for the detection and identification of Cryptosporidium spp. worldwide. We also aimed to molecularly characterize samples of Cryptosporidum spp. isolated from synanthropic rodents using these probes. Forty-five rodents were captured in urban areas of the municipality of Umuarama, Paraná State, Brazil. Fecal samples were submitted to three molecular tests (nested-PCRs), two of them targeted to the 18S rDNA gene (nPCR-SH and nPCR-XIAO) and the third targeted to the gene encoding actin (nPCR-actin). The nPCR-SH was tested positive on samples of Cryptosporidum parvum, Cryptosporidum andersoni, Cryptosporidum meleagridis, Cryptosporidum hominis, Cryptosporidum canis, and Cryptosporidum serpentis. Sixteen samples of rodents were positive by nPCR-SH, six by nPCR-XIAO and five by nPCR-actin. Sequencing of amplified fragments allowed the identification of Cryptosporidum muris in three samples of Rattus rattus, and two genotypes of Cryptosporidium, the genotypes mouse II and III. Cryptosporidium genotype mouse II was found in one sample of Mus musculus and genotype mouse III

  8. Phylogeny and divergence time estimation of cheilostome bryozoans based on mitochodrial 16S rRNA sequences

    HAO Jiasheng; LI Chunxiang; SUN Xiaoyan; YANG Qun

    2005-01-01

    The mitochondrial 16S rDNA sequences of 40 species of cheilostome bryozoans including those of 24 species newly determined were used to reconstruct the phylogenetic tree using neighboring-joining and maximum-parsimony methods. By applying molecular clock technique on the basis of the appropriate phylogeny and the fossil record, the divergence times of the two main cheilostome groups, Anasca and Ascophora sensu stricto, were estimated. The results show that the molecular phylogeny of the higher taxonomic groups (superfamilies and higher taxa) of cheilostome bryozoans is mostly in conflict with the morphology-based phylogenetic trees; the divergence of the extant groups of Anasca and those of Ascophora sensu stricto is estimated to have happened about 263 Ma (Permian Guadalupian Epoch) and 183 Ma (Early Jurassic), respectively.

  9. Morphology, ontogenetic features and SSU rRNA gene-based phylogeny of a soil ciliate, Bistichella cystiformans spec. nov. (Protista, Ciliophora, Stichotrichia).

    Fan, Yangbo; Hu, Xiaozhong; Gao, Feng; Al-Farraj, Saleh A; Al-Rasheid, Khaled A S

    2014-12-01

    The morphology, ontogeny and SSU rRNA gene-based phylogeny of Bistichella cystiformans spec. nov., isolated from the slightly saline soil of a mangrove wetland in Zhanjiang, southern China, were investigated. The novel species was characterized by having five to eight buccal cirri arranged in a row, three to five transverse cirri, four macronuclear nodules aligned, and 17-32 and 20-34 cirri in frontoventral rows V and VI, respectively, both extending to the transverse cirri. The main ontogenetic features of the novel species were as follows: (1) the parental adoral zone of the membranelles is completely inherited by the proter; (2) the frontoventral and transverse cirri are formed in a six-anlagen mode; (3) basically, the frontal-ventral-transverse cirral anlagen II-V generate one transverse cirrus each at their posterior ends, while anlage VI provides no transverse cirrus; (4) both marginal rows and dorsal kineties develop intrakinetally, no dorsal kinety fragment is formed; and (5) the macronuclear nodules fuse into a single mass at the middle stage. Phylogenetic analyses based on the SSU rRNA gene showed that the novel species groups with the clade containing Bistichella variabilis, Parabistichella variabilis, Uroleptoides magnigranulosus and two species of the genus Orthoamphisiella. Given present knowledge, it was considered to be still too early to come to a final conclusion regarding the familial classification of the genus Bistichella; further investigations of key taxa with additional molecular markers are required. PMID:25242538

  10. Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA

    Medina, Monica; Collins, Allen G.; Silberman, Jeffrey; Sogin, Mitchell L.

    2001-06-21

    We studied the evolutionary relationships among basal metazoan lineages by using complete large subunit (LSU) and small subunit (SSU) ribosomal RNA sequences for 23 taxa. After identifying competing hypotheses, we performed maximum likelihood searches for trees conforming to each hypothesis. Kishino-Hasegawa tests were used to determine whether the data (LSU, SSU, and combined) reject any of the competing hypotheses. We also conducted unconstrained tree searches, compared the resulting topologies, and calculated bootstrap indices. Shimodaira-Hasegawa tests were applied to determine whether the data reject any of the topologies resulting from the constrained and unconstrained tree searches. LSU, SSU, and the combined data strongly contradict two assertions pertaining to sponge phylogeny. Hexactinellid sponges are not likely to be the basal lineage of amonophyletic Porifera or the sister group to all other animals. Instead, Hexactinellida and Demospongia form a well-supported clade of siliceous sponges, Silicea. It remains unclear, on the basis of these data alone, whether the calcarean sponges are more closely related to Silicea or to nonsponge animals. The SSU and combined data reject the hypothesis that Bilateria is more closely related to Ctenophora than it is to Cnidaria, whereas LSU data alone do not refute either hypothesis. LSU and SSU data agree in supporting the monophyly of Bilateria, Cnidaria, Ctenophora, and Metazoa. LSU sequence data reveal phylogenetic structure in a data set with limited taxon sampling. Continued accumulation of LSU sequences should increase our understanding of animal phylogeny.

  11. Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA

    We studied the evolutionary relationships among basal metazoan lineages by using complete large subunit (LSU) and small subunit (SSU) ribosomal RNA sequences for 23 taxa. After identifying competing hypotheses, we performed maximum likelihood searches for trees conforming to each hypothesis. Kishino-Hasegawa tests were used to determine whether the data (LSU, SSU, and combined) reject any of the competing hypotheses. We also conducted unconstrained tree searches, compared the resulting topologies, and calculated bootstrap indices. Shimodaira-Hasegawa tests were applied to determine whether the data reject any of the topologies resulting from the constrained and unconstrained tree searches. LSU, SSU, and the combined data strongly contradict two assertions pertaining to sponge phylogeny. Hexactinellid sponges are not likely to be the basal lineage of amonophyletic Porifera or the sister group to all other animals. Instead, Hexactinellida and Demospongia form a well-supported clade of siliceous sponges, Silicea. It remains unclear, on the basis of these data alone, whether the calcarean sponges are more closely related to Silicea or to nonsponge animals. The SSU and combined data reject the hypothesis that Bilateria is more closely related to Ctenophora than it is to Cnidaria, whereas LSU data alone do not refute either hypothesis. LSU and SSU data agree in supporting the monophyly of Bilateria, Cnidaria, Ctenophora, and Metazoa. LSU sequence data reveal phylogenetic structure in a data set with limited taxon sampling. Continued accumulation of LSU sequences should increase our understanding of animal phylogeny

  12. Investigation of molluscan phylogeny using large-subunit and small-subunit nuclear rRNA sequences.

    Passamaneck, Yale J; Schander, Christoffer; Halanych, Kenneth M

    2004-07-01

    The Mollusca represent one of the most morphologically diverse animal phyla, prompting a variety of hypotheses on relationships between the major lineages within the phylum based upon morphological, developmental, and paleontological data. Analyses of small-ribosomal RNA (SSU rRNA) gene sequence have provided limited resolution of higher-level relationships within the Mollusca. Recent analyses suggest large-subunit (LSU) rRNA gene sequences are useful in resolving deep-level metazoan relationships, particularly when combined with SSU sequence. To this end, LSU (approximately 3.5 kb in length) and SSU (approximately 2 kb) sequences were collected for 33 taxa representing the major lineages within the Mollusca to improve resolution of intraphyletic relationships. Although the LSU and combined LSU+SSU datasets appear to hold potential for resolving branching order within the recognized molluscan classes, low bootstrap support was found for relationships between the major lineages within the Mollusca. LSU+SSU sequences also showed significant levels of rate heterogeneity between molluscan lineages. The Polyplacophora, Gastropoda, and Cephalopoda were each recovered as monophyletic clades with the LSU+SSU dataset. While the Bivalvia were not recovered as monophyletic clade in analyses of the SSU, LSU, or LSU+SSU, the Shimodaira-Hasegawa test showed that likelihood scores for these results did not differ significantly from topologies where the Bivalvia were monophyletic. Analyses of LSU sequences strongly contradict the widely accepted Diasoma hypotheses that bivalves and scaphopods are closely related to one another. The data are consistent with recent morphological and SSU analyses suggesting scaphopods are more closely related to gastropods and cephalopods than to bivalves. The dataset also presents the first published DNA sequences from a neomeniomorph aplacophoran, a group considered critical to our understanding of the origin and early radiation of the Mollusca

  13. Cloning and sequence analysis of the 18S rRNA gene of Trichinella from cat in Heilongjiang province%黑龙江省猫旋毛虫18S rRNA基因分子克隆及序列分析

    李冬梅; 王秀荣; 董小波; 路义鑫; 宋铭忻

    2007-01-01

    本文利用GenBank中发表的( Trichinella spiralis )18S rRNA序列为参考设计引物,对分离自黑龙江省猫体内的旋毛虫及本地毛形线虫( Trichinella nativa )的18S rRNA基因进行扩增,克隆后测序,序列分析结果表明:猫旋毛虫与旋毛形线虫基因同源性更高.

  14. Molecular Phylogeny Analysis of Allium Sativum in Alliaceae%大蒜在葱科的分子分类地位研究

    侯进慧; 李同祥; 蔡文佳

    2014-01-01

    通过扩增获得18S rRNA和叶绿体16S rRNA基因序列,测序并提交GenBank ,登录号分别是JF719285和JF719286.利用大蒜和GenBank相关序列构建系统发育树,进行分子演化分析.结果表明:大蒜18S rRNA 基因与球序韭、韭菜、茖葱等葱科植物序列相似度高;叶绿体16S rRNA基因与龙舌兰科和薯蓣科的物种序列相似度高.大蒜与葱科植物在18S rRNA序列上具有较高的同源性.18S rRNA序列在植物演化方面的区分度比16S rRNA高.%In the paper ,molecular phylogeny of Allium sativum were discussded with the analysis of rRNA gene .18S rRNA gene and chloroplast 16S rRNA gene sequences were amplified .The two rRNA genes were submitted to Genbank and the accession numbers were JF719285 and JF719286 .Gene sequences of Allium sativum was analyzed with related species in GenBank .The results showed that :Allium sativum 18S rRNA gene has a high homology with many species within Alliaceae ,such as Allium thunbergii ,Allium tuberosum and Allium victorialis .Allium sativum and Alliaceae plants has a high similarity in 18S rDNA . The discrimination accusation of 18Sr RNA sequences in plant phylogeny analysis is better than that of 16S rRNA .

  15. Redescriptions of three trachelocercid ciliates (Protista, Ciliophora, Karyorelictea), with notes on their phylogeny based on small subunit rRNA gene sequences.

    Yan, Ying; Xu, Yuan; Yi, Zhenzhen; Warren, Alan

    2013-09-01

    Three trachelocercid ciliates, Kovalevaia sulcata (Kovaleva, 1966) Foissner, 1997, Trachelocerca sagitta (Müller, 1786) Ehrenberg, 1840 and Trachelocerca ditis (Wright, 1982) Foissner, 1996, isolated from two coastal habitats at Qingdao, China, were investigated using live observation and silver impregnation methods. Data on their infraciliature and morphology are supplied. The small subunit rRNA (SSU rRNA) genes of K. sulcata and Trachelocerca sagitta were sequenced for the first time. Phylogenetic analyses based on SSU rRNA gene sequence data indicate that both organisms, and the previously sequenced Trachelocerca ditis, are located within the trachelocercid assemblage and that K. sulcata is sister to an unidentified taxon forming a clade that is basal to the core trachelocercids. PMID:23847285

  16. Congruent Phylogenies of Most Common Small-Subunit rRNA and Dissimilatory Sulfite Reductase Gene Sequences Retrieved from Estuarine Sediments

    Joulian, Catherine; Ramsing, Niels B.; Ingvorsen, Kjeld

    2001-01-01

    The diversity of sulfate-reducing bacteria (SRB) in brackish sediment was investigated using small-subunit rRNA and dissimilatory sulfite reductase (DSR) gene clone libraries and cultivation. The phylogenetic affiliation of the most commonly retrieved clones for both genes was strikingly similar and produced Desulfosarcina variabilis-like sequences from the inoculum but Desulfomicrobium baculatum-like sequences from a high dilution in natural media. Related organisms were subsequently cultiva...

  17. The phylogeny of Aerococcus and Pediococcus as determined by 16S rRNA sequence analysis: description of Tetragenococcus gen. nov.

    Collins, M D; Williams, A M; Wallbanks, S

    1990-08-01

    The phylogenetic interrelationships of the genera Pediococcus and Aerococcus were investigated using reverse transcriptase sequencing of 16S rRNA. The genus Pediococcus was found to be phylogenetically heterogeneous. The four species P. acidilactici, P. damnosus, P. parvulus and P. pentosaceus formed a phylogenetically distinct group. Within this pediococcal cluster, P. acidilactici was closely related to P. pentosaceus whereas P. damnosus showed a specific relationship with P. parvulus. The species P. dextrinicus, although showing significant sequence relatedness with these pediococcal species, was peripheral to the genus. Pediococcus halophilus exhibited low sequence homology with all of the species examined and formed a distinct line of descent. Pediococcus halophilus exhibited a closer affinity with enterococci and carnobacteria than with the other lactic acid bacteria. Pediococcus urinae-equi was phylogenetically very closely related to Aerococcus viridans. The 16S rRNA sequences of the type strains of these species differed by only two nucleotides (99.9% sequence homology) and clearly demonstrate that P. urinae-equi is a member of the genus Aerococcus. PMID:2227360

  18. Phylogeny of 54 representative strains of species in the family Pasteurellaceae as determined by comparison of 16S rRNA sequences.

    Dewhirst, F E; Paster, B J; Olsen, I; Fraser, G J

    1992-03-01

    Virtually complete 16S rRNA sequences were determined for 54 representative strains of species in the family Pasteurellaceae. Of these strains, 15 were Pasteurella, 16 were Actinobacillus, and 23 were Haemophilus. A phylogenetic tree was constructed based on sequence similarity, using the Neighbor-Joining method. Fifty-three of the strains fell within four large clusters. The first cluster included the type strains of Haemophilus influenzae, H. aegyptius, H. aphrophilus, H. haemolyticus, H. paraphrophilus, H. segnis, and Actinobacillus actinomycetemcomitans. This cluster also contained A. actinomycetemcomitans FDC Y4, ATCC 29522, ATCC 29523, and ATCC 29524 and H. aphrophilus NCTC 7901. The second cluster included the type strains of A. seminis and Pasteurella aerogenes and H. somnus OVCG 43826. The third cluster was composed of the type strains of Pasteurella multocida, P. anatis, P. avium, P. canis, P. dagmatis, P. gallinarum, P. langaa, P. stomatis, P. volantium, H. haemoglobinophilus, H. parasuis, H. paracuniculus, H. paragallinarum, and A. capsulatus. This cluster also contained Pasteurella species A CCUG 18782, Pasteurella species B CCUG 19974, Haemophilus taxon C CAPM 5111, H. parasuis type 5 Nagasaki, P. volantium (H. parainfluenzae) NCTC 4101, and P. trehalosi NCTC 10624. The fourth cluster included the type strains of Actinobacillus lignieresii, A. equuli, A. pleuropneumoniae, A. suis, A. ureae, H. parahaemolyticus, H. parainfluenzae, H. paraphrohaemolyticus, H. ducreyi, and P. haemolytica. This cluster also contained Actinobacillus species strain CCUG 19799 (Bisgaard taxon 11), A. suis ATCC 15557, H. ducreyi ATCC 27722 and HD 35000, Haemophilus minor group strain 202, and H. parainfluenzae ATCC 29242. The type strain of P. pneumotropica branched alone to form a fifth group. The branching of the Pasteurellaceae family tree was quite complex. The four major clusters contained multiple subclusters. The clusters contained both rapidly and slowly evolving

  19. Phylogenetic study of Class Armophorea (Alveolata, Ciliophora based on 18S-rDNA data

    Thiago da Silva Paiva

    2013-01-01

    Full Text Available The 18S rDNA phylogeny of Class Armophorea, a group of anaerobic ciliates, is proposed based on an analysis of 44 sequences (out of 195 retrieved from the NCBI/GenBank database. Emphasis was placed on the use of two nucleotide alignment criteria that involved variation in the gap-opening and gap-extension parameters and the use of rRNA secondary structure to orientate multiple-alignment. A sensitivity analysis of 76 data sets was run to assess the effect of variations in indel parameters on tree topologies. Bayesian inference, maximum likelihood and maximum parsimony phylogenetic analyses were used to explore how different analytic frameworks influenced the resulting hypotheses. A sensitivity analysis revealed that the relationships among higher taxa of the Intramacronucleata were dependent upon how indels were determined during multiple-alignment of nucleotides. The phylogenetic analyses rejected the monophyly of the Armophorea most of the time and consistently indicated that the Metopidae and Nyctotheridae were related to the Litostomatea. There was no consensus on the placement of the Caenomorphidae, which could be a sister group of the Metopidae + Nyctorheridae, or could have diverged at the base of the Spirotrichea branch or the Intramacronucleata tree.

  20. Molecular phylogeny and ultrastructure of Aphelidium aff. melosirae (Aphelida, Opisthosporidia).

    Karpov, Sergey A; Mamkaeva, Maria A; Benzerara, Karim; Moreira, David; López-García, Purificación

    2014-08-01

    Aphelids are a poorly known group of parasitoids of algae that have raised considerable interest due to their pivotal phylogenetic position. Together with Cryptomycota and the highly derived Microsporidia, they have been recently re-classified as Opisthosporidia, being the sister group to fungi. Despite their huge diversity, as revealed by molecular environmental studies, and their phylogenetic interest, only three genera have been described (Aphelidium, Amoeboaphelidium, and Pseudaphelidium), from which 18S rRNA gene sequences exist only for Amoeboaphelidium species. Here, we describe the life cycle and ultrastructure of Aphelidium aff. melosirae, and provide the first 18S rRNA gene sequence obtained for this genus. Molecular phylogeny analysis indicates that Aphelidium is very distantly related to Amoebaphelidium, highlighting the wide genetic diversity of the aphelids. The parasitoid encysts and penetrates the host alga, Tribonema gayanum through an infection tube. Cyst germination leads to a young trophont that phagocytes the algal cell content and progressively develops a plasmodium, which becomes a zoospore-producing sporangium. Aphelidium aff. melosirae has amoeboflagellate zoospores, tubular/lamellar mitochondrial cristae, a metazoan type of centrosome, and closed orthomitosis with an intranuclear spindle. These features together with trophont phagocytosis distinguish Aphelidium from fungi and support the erection of the new superphylum Opisthosporidia as sister to fungi. PMID:24995586

  1. Predicting microbial traits with phylogenies.

    Goberna, Marta; Verdú, Miguel

    2016-04-01

    Phylogeny reflects genetic and phenotypic traits in Bacteria and Archaea. The phylogenetic conservatism of microbial traits has prompted the application of phylogeny-based algorithms to predict unknown trait values of extant taxa based on the traits of their evolutionary relatives to estimate, for instance, rRNA gene copy numbers, gene contents or tolerance to abiotic conditions. Unlike the 'macrobial' world, microbial ecologists face scenarios potentially compromising the accuracy of trait reconstruction methods, as, for example, extremely large phylogenies and limited information on the traits of interest. We review 990 bacterial and archaeal traits from the literature and support that phylogenetic trait conservatism is widespread through the tree of life, while revealing that it is generally weak for ecologically relevant phenotypic traits and high for genetically complex traits. We then perform a simulation exercise to assess the accuracy of phylogeny-based trait predictions in common scenarios faced by microbial ecologists. Our simulations show that ca. 60% of the variation in phylogeny-based trait predictions depends on the magnitude of the trait conservatism, the number of species in the tree, the proportion of species with unknown trait values and the mean distance in the tree to the nearest neighbour with a known trait value. Results are similar for both binary and continuous traits. We discuss these results under the light of the reviewed traits and provide recommendations for the use of phylogeny-based trait predictions for microbial ecologists. PMID:26371406

  2. Molecular characterization of 18S rDNA partial sequence in Microcosmus (Stolidobranchiata, Pyuridae

    D. FULGIONE

    2012-12-01

    Full Text Available We present a 18S rDNA based molecular phylogeny of two species of the genus Microcosmus (M. sulcatus and M. claudicans sampled in the Mediterranean, to investigate their phylogenetic position relative to species of the order Stolidobranchiata. The analysis is based on partial sequences (739 bp of the 18S rDNA. Among the 18 variable sites found between the two species, 4 correspond to transitions (ts, 14 to transversions (tv and 4 to deletions/insertions. In the considered Stolidobranchiata, we found 4.3% overall mean number of nucleotide differences and 0.06 (S.E. ±0.01 Kimura 2-parameter distance. The mean number of nucleotide differences between Microcosmus spp. and other Stolidobranchiata species was of 6% and 0.08 (S.E. ±0.01 Kimura 2-parameter distance. A molecular phylogeny obtained by Maximum Parsimony corroborates results of the traditional taxonomy.

  3. Detection, phylogeny and population dynamics of syntrophic propionate-oxidizing bacteria in anaerobic granular sludge.

    Harmsen, H. J. M.

    1996-01-01

    The research described this thesis concerns the diversity and phylogeny of syntrophic propionate-oxidizing bacteria and their ecology in granular sludge, from which they were obtained. 16S rRNA was used as a molecular marker to study both the phylogeny and the ecology of these bacteria. Sequence analysis of the 16S rRNA gave information on the phylogeny of the syntrophic bacteria, while specific oligonucleotide probes based on these sequences enabled quantification and detection of these bact...

  4. Reconsideration of systematic relationships within the order Euplotida (Protista, Ciliophora) using new sequences of the gene coding for small-subunit rRNA and testing the use of combined data sets to construct phylogenies of the Diophrys-complex.

    Yi, Zhenzhen; Song, Weibo; Clamp, John C; Chen, Zigui; Gao, Shan; Zhang, Qianqian

    2009-03-01

    Comprehensive molecular analyses of phylogenetic relationships within euplotid ciliates are relatively rare, and the relationships among some families remain questionable. We performed phylogenetic analyses of the order Euplotida based on new sequences of the gene coding for small-subunit RNA (SSrRNA) from a variety of taxa across the entire order as well as sequences from some of these taxa of other genes (ITS1-5.8S-ITS2 region and histone H4) that have not been included in previous analyses. Phylogenetic trees based on SSrRNA gene sequences constructed with four different methods had a consistent branching pattern that included the following features: (1) the "typical" euplotids comprised a paraphyletic assemblage composed of two divergent clades (family Uronychiidae and families Euplotidae-Certesiidae-Aspidiscidae-Gastrocirrhidae), (2) in the family Uronychiidae, the genera Uronychia and Paradiophrys formed a clearly outlined, well-supported clade that seemed to be rather divergent from Diophrys and Diophryopsis, suggesting that the Diophrys-complex may have had a longer and more separate evolutionary history than previously supposed, (3) inclusion of 12 new SSrRNA sequences in analyses of Euplotidae revealed two new clades of species within the family and cast additional doubt on the present classification of genera within the family, and (4) the intraspecific divergence among five species of Aspidisca was far greater than those of closely related genera. The ITS1-5.8S-ITS2 coding regions and partial histone H4 genes of six morphospecies in the Diophrys-complex were sequenced along with their SSrRNA genes and used to compare phylogenies constructed from single data sets to those constructed from combined sets. Results indicated that combined analyses could be used to construct more reliable, less ambiguous phylogenies of complex groups like the order Euplotida, because they provide a greater amount and diversity of information. PMID:19121402

  5. A multilocus molecular phylogeny of Fasciolariidae (Neogastropoda: Buccinoidea).

    Couto, Diogo R; Bouchet, Philippe; Kantor, Yuri I; Simone, Luiz R L; Giribet, Gonzalo

    2016-06-01

    The neogastropod family Fasciolariidae Gray, 1853 - tulips, horse-conchs, spindles, etc., comprises important representatives of tropical and subtropical molluscan assemblages, with over 500 species in the subfamilies Fasciolariinae Gray, 1853, Fusininae Wrigley, 1927 and Peristerniinae Tryon, 1880. Fasciolariids have had a rather complicated taxonomical history, with several genus names for a long time used as waste baskets to group many unrelated species; based on shell characters, recent taxonomic revisions have, however, began to set some order in its taxonomy. The present work is the first molecular approach to the phylogeny of Fasciolariidae based on a multigene dataset, which provides support for fasciolariids, an old group with a fossil record dating back to the Cretaceous. Molecular markers used were the mitochondrial genes 16S rRNA and cytochrome c oxidase subunit I, and the nuclear genes 18S rRNA, 28S rRNA and histone H3, sequenced for up to 116 ingroup taxa and 17 outgroups. Phylogenetic analyses revealed monophyly of Dolicholatirus Bellardi, 1884 and Teralatirus Coomans, 1965, however it was not possible to discern if the group is the sister clade to the remaining fasciolariids; the latter, on the other hand, proved monophyletic and contained highly supported groups. A first split grouped fusinines and Pseudolatirus Bellardi, 1884; a second split grouped the peristerniine genera Peristernia Mörch, 1852 and Fusolatirus Kuroda and Habe, 1971, while the last group comprised fasciolariines and the remaining peristerniines. None of these clades correspond to the present-day accepted circumscription of the three recognized subfamilies. PMID:27033950

  6. Phylogenetic relationships within the Mysidae (Crustacea, Peracarida, Mysida) based on nuclear 18S ribosomal RNA sequences

    Remerie, T.; Bulckaen, B.; Calderon, J; Deprez, T.; Mees, J.; J. Vanfleteren; Vanreusel, A.; Vierstraete, A; Vincx, M.; Wittmann, K.J.; Wooldridge, T.

    2005-01-01

    Species of the order Mysida (Crustacea, Peracarida) are shrimp-like animals that occur in vast numbers in coastal regions of the world. The order Mysida comprises 1053 species and 165 genera. The present study covers 25 species of the well-defined Mysidae, the most speciose family within the order Mysida. 18S rRNA sequence analysis confirms that the subfamily Siriellinae is monophyletic. On the other hand the subfamily Gastrosaccinae is paraphyletic and the subfamily Mysinae, represented in t...

  7. Description of Eurystomatella sinica n. gen., n. sp., with establishment of a new family Eurystomatellidae n. fam. (Protista, Ciliophora, Scuticociliatia) and analyses of its phylogeny inferred from sequences of the small-subunit rRNA gene.

    Miao, Miao; Wang, Yangang; Song, Weibo; Clamp, John C; Al-Rasheid, Khaled A S

    2010-02-01

    Recently, an undescribed marine ciliate was isolated from China. Investigation of its morphology and infraciliature revealed it as an undescribed species representing a new genus, Eurystomatella n. gen., the type of the new family Eurystomatellidae n. fam. The new family is defined by close-set, apically positioned oral membranelles and a dominant buccal field that is surrounded by an almost completely circular paroral membrane. The new genus is defined by having a small oral membranelle 1 (M1), bipartite M2 and well-developed M3, a body surface faintly sculptured with a silverline system in a quadrangular, reticulate pattern and a cytostome located at the anterior third of a large buccal field. The type species of the new genus, Eurystomatella sinica n. sp., is a morphologically unique form that is defined mainly by the combination of a conspicuously flattened body, several caudal cilia, extremely long cilia associated with the buccal apparatus and a contractile vacuole located subcaudally. According to phylogenetic analyses of small-subunit (SSU) rRNA gene sequences, Eurystomatella clusters with the genus Cyclidium, as a sister group to the family Pleuronematidae. The great divergence in both buccal and somatic ciliature between Eurystomatella and all other known scuticociliates supports the establishment of a new family for Eurystomatella. PMID:19651734

  8. Phylogeny of filamentous ascomycetes

    Lumbsch, H. T.

    Phylogenetic studies of higher ascomycetes are enhanced by the introduction of molecular markers. Most studies employed sequences of the SSU rRNA gene, but recently data from additional genes (RPB2, LSU rRNA) have become available. Several groups defined by their ascoma-type, such as Pyrenomycetes, are supported while others, like the Discomycetes, appear to be paraphyletic. The Pezizales with operculate asci are basal to other eu-ascomycetes, while other Discomycetes appear to be derived eu-ascomycetes. The re-evaluation of classical characters using molecular data is discussed using three examples. Ascus types are often regarded as being of major importance in ascomycete systematics, but prototunicate asci were found to be of poor taxonomic value, since ascomycetes with prototunicate asci are polyphyletic. The independence of the Agyriales, assumed from their morphological characters, is supported by sequence data but the relationship to supposed sister groups remains dubious. The phylogeny of ascolocularous fungi and their circumscription requires further study. While a circumscription based on bitunicate asci can be rejected, it remains unclear whether fungi with ascolocularous ascoma development represent a monophyletic entity.

  9. Phylogeny of Tetillidae (Porifera, Demospongiae, Spirophorida) based on three molecular markers.

    Szitenberg, Amir; Becking, Leontine E; Vargas, Sergio; Fernandez, Júlio C C; Santodomingo, Nadiezhda; Wörheide, Gert; Ilan, Micha; Kelly, Michelle; Huchon, Dorothée

    2013-05-01

    Tetillidae are spherical to elliptical cosmopolitan demosponges. The family comprises eight genera: namely, Acanthotetilla Burton, 1959, Amphitethya Lendenfeld, 1907, CinachyraSollas, 1886, CinachyrellaWilson, 1925, Craniella Schmidt, 1870, Fangophilina Schmidt, 1880, Paratetilla Dendy, 1905, and Tetilla Schmidt, 1868. These genera are characterized by few conflicting morphological characters, resulting in an ambiguity of phylogenetic relationships. The phylogeny of tetillid genera was investigated using the cox1, 18S rRNA and 28S rRNA (C1-D2 domains) genes in 88 specimens (8 genera, 28 species). Five clades were identified: (i) Cinachyrella, Paratetilla and Amphitethya species, (ii) Cinachyrella levantinensis, (iii) Tetilla, (iv) Craniella, Cinachyra and Fangophilina and (v) Acanthotetilla. Consequently, the phylogenetic analysis supports the monophyly of Tetilla, a genus lacking any known morphological synapomorphy. Acanthotetilla is also recovered. In contrast, within the first clade, species of the genera Paratetilla and Amphitethya were nested within Cinachyrella. Similarly, within the fourth clade, species of the genera Cinachyra and Fangophilina were nested within Craniella. As previously postulated by taxonomists, the loss of ectodermal specialization (i.e., a cortex) has occurred several times independently. Nevertheless, the presence or absence of a cortex and its features carry a phylogenetic signal. Surprisingly, the common view that assumes close relationships among sponges with porocalices (i.e., surface depressions) is refuted. PMID:23485919

  10. Molecular phylogenies support homoplasy of multiple morphological characters used in the taxonomy of Heteroscleromorpha (Porifera: Demospongiae).

    Morrow, Christine C; Redmond, Niamh E; Picton, Bernard E; Thacker, Robert W; Collins, Allen G; Maggs, Christine A; Sigwart, Julia D; Allcock, A Louise

    2013-09-01

    Sponge classification has long been based mainly on morphocladistic analyses but is now being greatly challenged by more than 12 years of accumulated analyses of molecular data analyses. The current study used phylogenetic hypotheses based on sequence data from 18S rRNA, 28S rRNA, and the CO1 barcoding fragment, combined with morphology to justify the resurrection of the order Axinellida Lévi, 1953. Axinellida occupies a key position in different morphologically derived topologies. The abandonment of Axinellida and the establishment of Halichondrida Vosmaer, 1887 sensu lato to contain Halichondriidae Gray, 1867, Axinellidae Carter, 1875, Bubaridae Topsent, 1894, Heteroxyidae Dendy, 1905, and a new family Dictyonellidae van Soest et al., 1990 was based on the conclusion that an axially condensed skeleton evolved independently in separate lineages in preference to the less parsimonious assumption that asters (star-shaped spicules), acanthostyles (club-shaped spicules with spines), and sigmata (C-shaped spicules) each evolved more than once. Our new molecular trees are congruent and contrast with the earlier, morphologically based, trees. The results show that axially condensed skeletons, asters, acanthostyles, and sigmata are all homoplasious characters. The unrecognized homoplasious nature of these characters explains much of the incongruence between molecular-based and morphology-based phylogenies. We use the molecular trees presented here as a basis for re-interpreting the morphological characters within Heteroscleromorpha. The implications for the classification of Heteroscleromorpha are discussed and a new order Biemnida ord. nov. is erected. PMID:23753661

  11. Apical groove type and molecular phylogeny suggests reclassification of Cochlodinium geminatum as Polykrikos geminatum.

    Dajun Qiu

    Full Text Available Traditionally Cocholodinium and Gymnodinium sensu lato clade are distinguished based on the cingulum turn number, which has been increasingly recognized to be inadequate for Gymnodiniales genus classification. This has been improved by the combination of the apical groove characteristics and molecular phylogeny, which has led to the erection of several new genera (Takayama, Akashiwo, Karenia, and Karlodinium. Taking the apical groove characteristics and molecular phylogeny combined approach, we reexamined the historically taxonomically uncertain species Cochlodinium geminatum that formed massive blooms in Pearl River Estuary, China, in recent years. Samples were collected from a bloom in 2011 for morphological, characteristic pigment, and molecular analyses. We found that the cingulum in this species wraps around the cell body about 1.2 turns on average but can appear under the light microscopy to be >1.5 turns after the cells have been preserved. The shape of its apical groove, however, was stably an open-ended anticlockwise loop of kidney bean shape, similar to that of Polykrikos. Furthermore, the molecular phylogenetic analysis using 18S rRNA-ITS-28S rRNA gene cistron we obtained in this study also consistently placed this species closest to Polykrikos within the Gymnodinium sensu stricto clade and set it far separated from the clade of Cochlodinium. These results suggest that this species should be transferred to Polykrikos as Polykrikos geminatum. Our results reiterate the need to use the combination of apical groove morphology and molecular phylogeny for the classification of species within the genus of Cochlodinium and other Gymnodiniales lineages.

  12. SSU rRNA reveals a sequential increase in shell complexity among the euglyphid testate amoebae (Rhizaria: Euglyphida)

    Lara, Enrique; Heger, Thierry J; Mitchell, Edward A D; Meisterfeld, Ralf; Ekelund, Flemming

    2007-01-01

    The existing data on the molecular phylogeny of filose testate amoebae from order Euglyphida has revealed contradictions between traditional morphological classification and SSU rRNA phylogeny and, moreover, the position of several important genera remained unknown. We therefore carried out a study...... aiming to fill several important gaps and better understand the relationships among the main euglyphid testate amoebae and the evolutionary steps that led to the present diversity at a higher level. We obtained new SSU rRNA sequences from five genera and seven species. This new phylogeny obtained shows...

  13. Molecular phylogeny of Neotropical monogeneans (Platyhelminthes: Monogenea) from catfishes (Siluriformes)

    Mendoza-Palmero, Carlos Alonso; Blasco-Costa, I.; Scholz, Tomáš

    2015-01-01

    Roč. 8, MAR 18 2015 (2015), s. 164. ISSN 1756-3305 R&D Projects: GA ČR GBP505/12/G112 Institutional support: RVO:60077344 Keywords : Phylogeny * Monogenea * Dactylogyridae * Neotropical region * Diversity * Siluriformes * 28S rRNA Subject RIV: EG - Zoology Impact factor: 3.430, year: 2014

  14. Phylogeny of not-yet-cultured spirochetes from termite guts

    Paster, B.J.; Dewhirst, F.E.; Cooke, S.M.;

    1996-01-01

    Comparisons of 16S rDNA sequences were used to determine the phylogeny of not-yet-cultured spirochetes from hindguts of the African higher termite, Nasutitermes lujae (Wasmann). The 16S rRNA genes were amplified directly from spirochete-rich hindguts by using universal primers, and the amplified...

  15. rRNA fragmentation induced by a yeast killer toxin.

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  16. Does phylogeny control U37K -temperature sensitivity? Implications for lacustrine alkenone paleothermometry

    D'Andrea, William J.; Theroux, Susanna; Bradley, Raymond S.; Huang, Xiaohui

    2016-02-01

    Alkenone paleothermometry (via the U37K and U37K‧ indices) has long been used to reconstruct sea surface temperature and has more recently been proven effective in lacustrine settings. Genetic analyses indicate that there is a diversity of different alkenone-producing lacustrine haptophytes, and differences among U37K -temperature calibrations suggest that unique calibrations might be required to quantify past temperature variation from individual lakes. The only term necessary to quantify U37K -inferred temperature relative to a reference period (e.g., modern temperature 20th Century mean) is the slope of the calibration regression, the U37K -temperature sensitivity (i.e., the change in U37K per °C temperature change). Here, we bring together all of the existing U37K -temperature calibrations in order to compare the variability among U37K -temperature sensitivities. We also report a new in situ U37K -temperature calibration along with environmental genomic analysis based on the 18S rRNA gene of an alkenone producing haptophyte from lake Vikvatnet in Norway. We propose and test the hypothesis that U37K -temperature sensitivity is controlled by phylogeny and that this term can be used to quantify past temperature variation from lake sediments if the genetic identity of the lake's alkenone-producer is known. Using the existing calibration data sets, we determine four phylotype-specific U37K -temperature sensitivities for use in cases where in situ calibration is unavailable but the phylogeny of the alkenone producers is known.

  17. Inhibition of deoxyribonucleic acid transcription by ultraviolet irradiation in mammalian cells: determination of the transcriptional linkage of the 18S and 28S ribosomal ribonucleic acid genes

    The inhibition of deoxyribonucleic acid (DNA) transcription in mammalian cells by ultraviolet irradiation has been studied. The reduction in the rates and the amounts of total ribonucleic acid (RNA) synthesis and of 18S, 28S, and 45S ribosomal RNA (rRNA) synthesis, in tissue cultured mouse L cells, were examined as functions of ultraviolet dose and time after ultraviolet irradiation. Total RNA synthesis in the ultraviolet irradiated L cell was found to decrease as a function of ultraviolet dose. The rates of synthesis for the 18S and 28S rRNAs and the 45S precursor RNA decreased exponentially with ultraviolet dose; the respective D37 values were 310 erg/mm2, 130 erg/mm2, and 90 erg/mm2. Ultraviolet inactivation kinetics of rRNA synthesis in HeLa cells indicated that, as in L cells, each 45S rRNA transcriptional unit has its own promotor, and that the 18S rRNA cistron is promotor proximal and the 28S rRNA cistron is promotor distal. All of the above findings support the hypothesis that irradiation of mammalian cells with ultraviolet light causes the formation of lesions on the DNA templates which result in premature termination of transcription. (U.S.)

  18. Phylogeny of the Paracalanidae Giesbrecht, 1888 (Crustacea: Copepoda: Calanoida).

    Cornils, Astrid; Blanco-Bercial, Leocadio

    2013-12-01

    The Paracalanidae are ecologically-important marine planktonic copepods that occur in the epipelagic zone in temperate and tropical waters. They are often the dominant taxon - in terms of biomass and abundance - in continental shelf regions. As primary consumers, they form a vital link in the pelagic food web between primary producers and higher trophic levels. Despite the ecological importance of the taxon, evolutionary and systematic relationships within the family remain largely unknown. A multigene phylogeny including 24 species, including representatives for all seven genera, was determined based on two nuclear genes, small-subunit (18S) ribosomal RNA and Histone 3 (H3) and one mitochondrial gene, cytochrome c oxidase subunit I (COI). The molecular phylogeny was well supported by Maximum likelihood and Bayesian inference analysis; all genera were found to be monophyletic, except for Paracalanus, which was separated into two distinct clades: the Paracalanus aculeatus group and Paracalanus parvus group. The molecular phylogeny also confirmed previous findings that Mecynocera and Calocalanus are genera of the family Paracalanidae. For comparison, a morphological phylogeny was created for 35 paracalanid species based on 54 morphological characters derived from published descriptions. The morphological phylogeny did not resolve all genera as monophyletic and bootstrap support was not strong. Molecular and morphological phylogenies were not congruent in the positioning of Bestiolina and the Paracalanus species groups, possibly due to the lack of sufficient phylogenetically-informative morphological characters. PMID:23831457

  19. Estimation of divergence times in litostomatean ciliates (Ciliophora: Intramacronucleata), using Bayesian relaxed clock and 18S rRNA gene.

    Vďačný, Peter

    2015-08-01

    The class Litostomatea comprises a diverse assemblage of free-living and endosymbiotic ciliates. To understand diversification dynamic of litostomateans, divergence times of their main groups were estimated with the Bayesian molecular dating, a technique allowing relaxation of molecular clock and incorporation of flexible calibration points. The class Litostomatea very likely emerged during the Cryogenian around 680 Mya. The origin of the subclass Rhynchostomatia is dated to about 415 Mya, while that of the subclass Haptoria to about 654 Mya. The order Pleurostomatida, emerging about 556 Mya, was recognized as the oldest group within the subclass Haptoria. The order Spathidiida appeared in the Paleozoic about 442 Mya. The three remaining haptorian orders evolved in the Paleozoic/Mesozoic periods: Didiniida about 419 Mya, Lacrymariida about 269 Mya, and Haptorida about 194 Mya. The subclass Trichostomatia originated from a spathidiid ancestor in the Mesozoic about 260 Mya. A further goal of this study was to investigate the impact of various settings on posterior divergence time estimates. The root placement and tree topology as well as the priors of the rate-drift model, birth-death process and nucleotide substitution rate, had no significant effect on calculation of posterior divergence time estimates. However, removal of calibration points could significantly change time estimates at some nodes. PMID:26204556

  20. Yeast 18 S rRNA Is Directly Involved in the Ribosomal Response to Stringent AUG Selection during Translation Initiation

    Nemoto, N.; Singh, Ch. R.; Udagawa, T.; Wang, S.; Thorson, E.; Winter, Z.; Ohira, T.; Li, M.; Valášek, Leoš; Brown, S. J.; Asano, K.

    2010-01-01

    Roč. 285, č. 42 (2010), s. 32200-32212. ISSN 0021-9258 Institutional research plan: CEZ:AV0Z50200510 Keywords : START CODON SELECTION * SACCHAROMYCES - CEREVISIAE * IN-VIVO Subject RIV: EE - Microbiology, Virology Impact factor: 5.328, year: 2010

  1. Systematics of Chaetognatha under the light of molecular data, using duplicated ribosomal 18S DNA sequences.

    Papillon, Daniel; Perez, Yvan; Caubit, Xavier; Le Parco, Yannick

    2006-03-01

    While the phylogenetic position of Chaetognatha has became central to the question of early bilaterian evolution, the internal systematics of the phylum are still not clear. The phylogenetic relationships of the chaetognaths were investigated using newly obtained small subunit ribosomal RNA nuclear 18S (SSU rRNA) sequences from 16 species together with 3 sequences available in GenBank. As previously shown with the large subunit ribosomal RNA 28S gene, two classes of Chaetognatha SSU rRNA gene can be identified, suggesting a duplication of the whole ribosomal cluster; allowing the rooting of one class of genes by another in phylogenetic analyses. Maximum Parsimony, Maximum Likelihood and Bayesian analyses of the molecular data, and statistical tests showed (1) that there are three main monophyletic groups: Sagittidae/Krohnittidae, Spadellidae/Pterosagittidae, and Eukrohniidae/Heterokrohniidae, (2) that the group of Aphragmophora without Pterosagittidae (Sagittidae/Krohnittidae) is monophyletic, (3) the Spadellidae/Pterosagittidae and Eukrohniidae/Heterokrohniidae families are very likely clustered, (4) the Krohnittidae and Pterosagittidae groups should no longer be considered as families as they are included in other groups designated as families, (5) suborder Ctenodontina is not monophyletic and the Flabellodontina should no longer be considered as a suborder, and (6) the Syngonata/Chorismogonata and the Monophragmophora/Biphragmophora hypotheses are rejected. Such conclusions are considered in the light of morphological characters, several of which are shown to be prone to homoplasy. PMID:16434216

  2. Phylogeny of mycoplasmalike organisms (phytoplasmas): a basis for their classification.

    Gundersen, D E; Lee, I M; Rehner, S A; Davis, R. E.; Kingsbury, D T

    1994-01-01

    A global phylogenetic analysis using parsimony of 16S rRNA gene sequences from 46 mollicutes, 19 mycoplasmalike organisms (MLOs) (new trivial name, phytoplasmas), and several related bacteria placed the MLOs definitively among the members of the class Mollicutes and revealed that MLOs form a large discrete monophyletic clade, paraphyletic to the Acholeplasma species, within the Anaeroplasma clade. Within the MLO clade resolved in the global mollicutes phylogeny and a comprehensive MLO phyloge...

  3. The phylogeny of Arthrotardigrada

    Hansen, Jesper Guldberg

    2011-01-01

    The order Arthrotardigrada, or water bears, constitutes a small group of 160 species of marine, microscopical invertebrates, within the phylum Tardigrada. Although the position of tardigrades in the Animal Kingdom has received much attention focusing on the metazoan phylogeny, the phylogenetic...... arthrotardigrade phylogeny based on combined morphological and molecular data. As a first step to reach this goal, detailed examinations of more than 100 species and thorough revisions of various arthrotardigrade genera were conducted to uncover their taxonomic diversity and morphological disparity, generating new...... Faroestygarctus nov. gen. belonging to the families Coronarctidae, Halechiniscidae (Euclavarctinae, Florarctinae), Renaudarctidae and Stygarctidae (Megastygarctidinae, Stygarctinae). In addition, diagnostic characters are given for 8 species of Archechiniscus and 3 species of Florarctinae nov. gen. Phylogenies of...

  4. Analysis of the 5.8S rRNA gene and the internal transcribed spacers in Naegleria spp. and in N. fowleri.

    Pélandakis, M; Serre, S; Pernin, P

    2000-01-01

    Internal transcribed spacers (ITS) and the 5.8S ribosomal gene of 21 Naegleria fowleri strains and eight other species including Naegleria gruberi were sequenced. The results showed that this region can help differentiate between and within species. The phylogeny of Naegleria spp. deduced from the ITS and the 5.8S gene produced four major lineages, fowleri-lovaniensis, galeacystis-italica-clarki-gruberi-australiensis, andersoni-jamiesoni, and pussardi, that fit perfectly with those inferred from the 18S rRNA gene analysis. The N. gruberi isolate, NG260, was closely related to Naegleria pussardi. The other N. gruberi isolates branched together with Naegleria australiensis in another lineage. The ITS and 5.8S results for N. fowleri were congruent with those previously deduced by RAPD analysis. The phylogenetic analysis inferred from ITS and RAPD data revealed two major groups. The French Cattenom and Chooz and South Pacific strains constituted the first group. The second group encompassed the strains corresponding to the Euro-American and Widespread RAPD variants and shared the same substitution in the 5.8S gene. In addition, it was possible to define species specific primers in ITS regions to rapidly identify N. fowleri. PMID:10750838

  5. Improving the Analysis of Dinoflagellate Phylogeny based on rDNA

    Murray, Shauna; Jørgensen, Mårten Flø; Ho, Simon Y.W.;

    2005-01-01

    may not closely fit the data. We constructed and examined alignments of SSU and partial LSU rRNA along with a concatenated alignment of the two molecules. The alignments showed several characteristics that may confound phylogeny reconstruction: paired helix (stem) regions that contain non...

  6. Variation in secondary structure of the 16S rRNA molecule in cyanobacteria with implications for phylogenetic analysis

    Řeháková, Klára; Johansen, J. R.; Bowen, M.B.; Martin, M.P.; Sheil, C.A.

    2014-01-01

    Roč. 14, č. 2 (2014), s. 161-178. ISSN 1802-5439 Institutional support: RVO:60077344 Keywords : 16S rRNA secondary structure * cyanobacteria * phylogeny Subject RIV: EE - Microbiology, Virology Impact factor: 1.930, year: 2014

  7. Fossils and decapod phylogeny

    Schram, Frederick R.; Dixon, Christopher

    2003-01-01

    An expanded series of morphological characters developed for a cladistic analysis of extant decapods has yielded a new hypothesis for the phylogeny of the group. Application of this database to selected fossil genera produces some interesting results and demonstrates the feasibility of treating foss

  8. Building a Twig Phylogeny

    Flinn, Kathryn M.

    2015-01-01

    In this classroom activity, students build a phylogeny for woody plant species based on the morphology of their twigs. Using any available twigs, students can practice the process of cladistics to test evolutionary hypotheses for real organisms. They identify homologous characters, determine polarity through outgroup comparison, and construct a…

  9. Mapping Mutations on Phylogenies

    Nielsen, Rasmus

    2005-01-01

    This chapter provides a short review of recent methodologies developed for mapping mutations on phylogenies. Mapping of mutations, or character changes in general, using the maximum parsimony principle has been one of the most powerful tools in phylogenetics, and it has been used in a variety of...

  10. Phylogeny of hard- and soft-tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences.

    Black, W C; Piesman, J

    1994-01-01

    Ticks are parasitiform mites that are obligate hematophagous ectoparasites of amphibians, reptiles, birds, and mammals. A phylogeny for tick families, subfamilies, and genera has been described based on morphological characters, life histories, and host associations. To test the existing phylogeny, we sequenced approximately 460 bp from the 3' end of the mitochondrial 16S rRNA gene (rDNA) in 36 hard- and soft-tick species; a mesostigmatid mite, Dermanyssus gallinae, was used as an outgroup. P...

  11. Constructing computer virus phylogenies

    Goldberg, L.A. [Warwick Univ., Coventry (United Kingdom) Dept. of Computer Science; Goldberg, P.W. [Aston Univ., Birmingham (United Kingdom) Dept. of Applied Mathematics; Phillips, C.A. [Sandia National Labs., Albuquerque, NM (United States); Sorkin, G.B. [International Business Machines Corp., Yorktown Heights, NY (United States). Thomas J. Watson Research Center

    1996-03-01

    There has been much recent algorithmic work on the problem of reconstructing the evolutionary history of biological species. Computer virus specialists are interested in finding the evolutionary history of computer viruses--a virus is often written using code fragments from one or more other viruses, which are its immediate ancestors. A phylogeny for a collection of computer viruses is a directed acyclic graph whose nodes are the viruses and whose edges map ancestors to descendants and satisfy the property that each code fragment is ``invented`` only once. To provide a simple explanation for the data, we consider the problem of constructing such a phylogeny with a minimal number of edges. In general, this optimization problem cannot be solved in quasi-polynomial time unless NQP=QP; we present positive and negative results for associated approximated problems. When tree solutions exist, they can be constructed and randomly sampled in polynomial time.

  12. Molecular Phylogeny of Acanthamoeba

    Kong, Hyun Hee

    2009-01-01

    After morphological grouping of Acanthamoeba by Pussard and Pons, phylogeny of the genus has been always a big topic to the researchers. Because of the variability of morphological characteristics, unchangeable and stable characters have been investigated for phylogenic criteria. Isoenzyme and mitochondrial DNA RFLP (Mt DNA RFLP) analyses revealed different patterns among strains assigned to a same species. Therefore, these characteristics would be considered as tools for strain discriminatio...

  13. Phylogeny of mycoplasmalike organisms (phytoplasmas): a basis for their classification.

    Gundersen, D E; Lee, I M; Rehner, S A; Davis, R E; Kingsbury, D T

    1994-09-01

    A global phylogenetic analysis using parsimony of 16S rRNA gene sequences from 46 mollicutes, 19 mycoplasmalike organisms (MLOs) (new trivial name, phytoplasmas), and several related bacteria placed the MLOs definitively among the members of the class Mollicutes and revealed that MLOs form a large discrete monophyletic clade, paraphyletic to the Acholeplasma species, within the Anaeroplasma clade. Within the MLO clade resolved in the global mollicutes phylogeny and a comprehensive MLO phylogeny derived by parsimony analyses of 16S rRNA gene sequences from 30 diverse MLOs representative of nearly all known distinct MLO groups, five major phylogenetic groups with a total of 11 distinct subclades (monophyletic groups or taxa) could be recognized. These MLO subclades (roman numerals) and designated type strains were as follows: i, Maryland aster yellows AY1; ii, apple proliferation AP-A; iii, peanut witches'-broom PnWB; iv, Canada peach X CX; v, rice yellow dwarf RYD; vi, pigeon pea witches'-broom PPWB; vii, palm lethal yellowing LY; viii, ash yellows AshY; ix, clover proliferation CP; x, elm yellows EY; and xi, loofah witches'-broom LfWB. The designations of subclades and their phylogenetic positions within the MLO clade were supported by a congruent phylogeny derived by parsimony analyses of ribosomal protein L22 gene sequences from most representative MLOs. On the basis of the phylogenies inferred in the present study, we propose that MLOs should be represented taxonomically at the minimal level of genus and that each phylogenetically distinct MLO subclade identified should represent at least a distinct species under this new genus. PMID:8071198

  14. Angiosperm phylogeny inferred from sequences of four mitochondrial genes

    Yin-Long QIU; Zhi-Duan CHEN; Libo LI; Bin WANG; Jia-Yu XUE; Tory A. HENDRY; Rui-Qi LI; Joseph W. BROWN; Yang LIU; Geordan T. HUDSON

    2010-01-01

    An angiosperm phylogeny was reconstructed in a maximum likelihood analysis of sequences of four mitochondrial genes, atpl, matR, had5, and rps3, from 380 species that represent 376 genera and 296 families of seed plants. It is largely congruent with the phylogeny of angiosperms reconstructed from chloroplast genes atpB, matK, and rbcL, and nuclear 18S rDNA. The basalmost lineage consists of Amborella and Nymphaeales (including Hydatellaceae). Austrobaileyales follow this clade and are sister to the mesangiosperms, which include Chloranthaceae, Ceratophyllum, magnoliids, monocots, and eudicots. With the exception of Chloranthaceae being sister to Ceratophyllum, relationships among these five lineages are not well supported. In eudicots, Ranunculales, Sabiales, Proteales, Trochodendrales, Buxales, Gunnerales, Saxifragales, Vitales, Berberidopsidales, and Dilleniales form a basal grade of lines that diverged before the diversification of rosids and asterids. Within rosids, the COM (Celastrales-Oxalidales-Malpighiales) clade is sister to malvids (or rosid Ⅱ), instead of to the nitrogen-fixing clade as found in all previous large-scale molecular analyses of angiosperms. Santalales and Caryophyllales are members of an expanded asterid clade. This study shows that the mitochondrial genes are informative markers for resolving relationships among genera, families, or higher rank taxa across angiosperms. The low substitution rates and low homoplasy levels of the mitochondrial genes relative to the chloroplast genes, as found in this study, make them particularly useful for reconstructing ancient phylogenetic relationships. A mitochondrial gene-based angiosperm phylogeny provides an independent and essential reference for comparison with hypotheses of angiosperm phylogeny based on chloroplast genes, nuclear genes, and non-molecular data to reconstruct the underlying organismal phylogeny.

  15. Isolation, morphological and molecular characterization of phytate-hydrolysing fungi by 18S rDNA sequence analysis

    Iti Gontia-Mishra

    2013-01-01

    Full Text Available Phytate is the primary storage form of phosphate in plants. Monogastric animals like poultry, pigs and fishes have very low or no phytase activities in their digestive tracts therefore, are incapable to efficiently utilize phytate phosphorus from the feed. Phytase from microbial sources are supplemented to feedstuff of these to increase the uptake of phytate phosphorus. In the present work efforts were made to isolate and characterize proficient phytase producing fungi from soil. Phytase producing fungi were isolated using phytate specific medium. Fungal isolates were selected according to their higher phytase activities. These isolates were further characterized and identified by morphological and microscopic analysis and confirmed by amplification of 18S rRNA gene, using specific primers. This gene was subsequently sequenced and phylogenetic affiliations were assigned. Fungal isolates were identified as various species of Aspergillus. Phytases from these fungi could be utilized as a feed additive in poultry and swine industries.

  16. 3-Nitropropionic acid modifies neurotrophin mRNA expression in the mouse striatum:18S-rRNA is a reliable control gene for studies of the striatum

    S.Espíndola; A Vilches-Flores; E.Hernández-Echeagaray

    2012-01-01

    Objective The aim of the present study was to determine the changes in the mRNA levels ofneurotrophins and their receptors in the striatal tissue of mice treated with 3-nitropropionic acid (3-NP).Methods At 1 and 48 h after the last drug administration,the mRNA expression of nerve growth factor,brain-derived neurotrophic factor,neurotrophin-3 and neurotrophin-4/5 as well as their receptors p75,TrkA,TrkB and TrkC,was evaluated using semi-quantitative (semi-Q) and real-time RT-PCR.β-actin mRNA and ribosomal 18S (18S rRNA) were tested as internal controls.Results 3-NP treatment did not affect mRNA expression of all neurotrophins and their respective receptors equally.Also,differences in neurotrophin and receptor mRNA expression were observed between semi-Q and real-time RT-PCR.Real-time RT-PCR was more accurate in evaluating the mRNA expression of the neurotrophins than semi-Q,and 18S rRNA was more reliable than β-actin as an internal control.Conclusion Neurotrophins and their receptors expression is differentially affected by neuronal damage produced by inhibition of mitochondrial respiration with 3-NP treatment in low,sub-chronic doses in vivo.

  17. Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses

    Tsui, Clement K M; Daniel, Heide-Marie; Robert, Vincent; Meyer, Wieland

    2008-01-01

    Yeasts of the artificial genus Candida include plant endophytes, insect symbionts, and opportunistic human pathogens. Phylogenies based on rRNA gene and actin sequences confirmed that the genus is not monophyletic, and the relationships among Candida species and allied teleomorph genera are not clea

  18. Phylogeny and morphological variability of trypanosomes from African pelomedusid turtles with redescription of Trypanosoma mocambicum Pienaar, 1962

    Dvořáková, N.; Čepička, I.; Qablan, M. A.; Gibson, W.; Blažek, Radim; Široký, P.

    2015-01-01

    Roč. 166, č. 6 (2015), s. 599-608. ISSN 1434-4610 Institutional support: RVO:68081766 Keywords : Trypanosoma * turtle * Pelusios * polymorphism * phylogeny * SSU rRNA gene Subject RIV: EG - Zoology Impact factor: 3.045, year: 2014

  19. PCR amplification of a multi-copy mitochondrial gene (cox3) improves detection of Cytauxzoon felis infection as compared to a ribosomal gene (18S).

    Schreeg, Megan E; Marr, Henry S; Griffith, Emily H; Tarigo, Jaime L; Bird, David M; Reichard, Mason V; Cohn, Leah A; Levy, Michael G; Birkenheuer, Adam J

    2016-07-30

    Cytauxzoon felis is a tick-transmitted protozoan parasite that infects felids. Clinical disease caused by acute C. felis infection rapidly progresses in domestic cats, leading to high morbidity and mortality. Accurately diagnosing cytauxzoonosis as soon as possible during acute infection would allow for earlier initiation of antiprotozoal therapy which could lead to higher survival rates. Molecular detection of parasite rRNA genes (18S) by PCR has previously been shown to be a sensitive method of diagnosing C. felis infections. Based on evidence from related apicomplexan species, we hypothesized that C. felis mitochondrial genes would exist at higher copy numbers than 18S and would be a more sensitive diagnostic target. In this study we have designed a PCR assay targeting the C. felis mitochondrial gene cytochrome c oxidase subunit III (cox3). Herein we demonstrate that (1) the cox3 PCR can detect as low as 1 copy of DNA target and can detect C. felis in samples with known mitochondrial sequence heterogeneity, (2) cox3 copy number is increased relative to 18S in blood and tissue samples from acutely infected cats, and (3) the cox3 PCR is more sensitive than 18S PCR for detection of C. felis during early infections. PMID:27369587

  20. The shape of mammalian phylogeny

    Purvis, Andy; Fritz, Susanne A; Rodríguez, Jesús;

    2011-01-01

    six simple macroevolutionary models, showing that those where speciation slows down as geographical or niche space is filled, produce more realistic phylogenies than do models involving key innovations. Lastly, an analysis of the spatial scaling of imbalance shows that the phylogeny of species within...... an assemblage, ecoregion or larger area always tends to be more unbalanced than expected from the phylogeny of species at the next more inclusive spatial scale. We conclude with a verbal model of mammalian macroevolution, which emphasizes the importance to diversification of accessing new regions...... of geographical or niche space....

  1. Molecular Phylogeny of the Bamboo Sharks (Chiloscyllium spp.

    Noor Haslina Masstor

    2014-01-01

    Full Text Available Chiloscyllium, commonly called bamboo shark, can be found inhabiting the waters of the Indo-West Pacific around East Asian countries such as Malaysia, Myanmar, Thailand, Singapore, and Indonesia. The International Union for Conservation of Nature (IUCN Red List has categorized them as nearly threatened sharks out of their declining population status due to overexploitation. A molecular study was carried out to portray the systematic relationships within Chiloscyllium species using 12S rRNA and cytochrome b gene sequences. Maximum parsimony and Bayesian were used to reconstruct their phylogeny trees. A total of 381 bp sequences’ lengths were successfully aligned in the 12S rRNA region, with 41 bp sites being parsimony-informative. In the cytochrome b region, a total of 1120 bp sites were aligned, with 352 parsimony-informative characters. All analyses yield phylogeny trees on which C. indicum has close relationships with C. plagiosum. C. punctatum is sister taxon to both C. indicum and C. plagiosum while C. griseum and C. hasseltii formed their own clade as sister taxa. These Chiloscyllium classifications can be supported by some morphological characters (lateral dermal ridges on the body, coloring patterns, and appearance of hypobranchials and basibranchial plate that can clearly be used to differentiate each species.

  2. Cladistic analysis of ribosomal RNAs--the phylogeny of eukaryotes with respect to the endosymbiotic theory.

    Wolters, J; Erdmann, V A

    1988-01-01

    A strict cladistic analysis of 5S and 16S rRNA secondary and primary structure confirms particular hypotheses concerning the phylogeny of eukaryotes: plastids of Euglena, green algae and land plants, and the cyanelle of Cyanophora share a specific character and are closely related to cyanobacteria of the Synechococcus-type. Angiosperm mitochondria share specific signatures with the alpha subdivision of rhodobacteria. Cyanophora is a member of the Euglenozoa, the Oomycetes are derived from a group of heterokont algae. PMID:3395680

  3. Molecular analysis of the rRNA genes of Babesia spp and Ehrlichia canis detected in dogs from RibeirÃo Preto, Brazil

    de Oliveira, L. P.; Cardozo, G.P.; E.V. Santos; Mansur, M.A.B.; I.A.N. Donini; Zissou, V.G.; P.G. Roberto; M. Marins

    2009-01-01

    The partial DNA sequences of the 18S rRNA gene of Babesia canis and the 16S rRNA gene of Ehrlichia canis detected in dogs from Ribeirão Preto, Brazil, were compared to sequences from other strains deposited in GenBank. The E. canis strain circulating in Ribeirão Preto is identical to other strains previously detected in the region, whereas the subspecies Babesia canis vogeli is the main Babesia strain circulating in dogs from Ribeirão Preto.As sequências parciais dos genes RNAr 18S de Babesia...

  4. Molecular evolution of rDNA in early diverging Metazoa: First comparative analysis and phylogenetic application of complete SSU rRNA secondary structures in Porifera

    Wörheide Gert; Erpenbeck Dirk; Voigt Oliver

    2008-01-01

    Abstract Background The cytoplasmic ribosomal small subunit (SSU, 18S) ribosomal RNA (rRNA) is the most frequently-used gene for molecular phylogenetic studies. However, information regarding its secondary structure is neglected in most phylogenetic analyses. Incorporation of this information is essential in order to apply specific rRNA evolutionary models to overcome the problem of co-evolution of paired sites, which violates the basic assumption of the independent evolution of sites made by...

  5. Development of 18S rRNA-targeted oligonucleotide probes for specific detection of Hartmannella and Naegleria in Legionella-positive environmental samples.

    Grimm, D; Ludwig, W F; Brandt, B C; Michel, R; Schleifer, K H; Hacker, J; Steinert, M

    2001-04-01

    Aquatic protozoa are natural hosts of the human pathogen Legionella pneumophila. The fluorescence labeled 16S rRNA-targeted oligonucleotide probe LEGPNE1 has recently been shown to specifically detect extracellular legionellae as well as intracellular legionellae parasitizing protozoa. In this study we designed oligonucleotide probes which are complementary to distinct regions of the 18S rRNA of the Legionella host organisms of the genera Hartmannella and Naegleria. The specificity of the probes, HART498 and NAEG1088, was tested by in situ hybridization of various laboratory reference strains. In order to evaluate the fluorescent probes for environmental studies three selected Legionella-positive cold water habitats were examined for the presence of these protozoa. Traditional culture methods followed by morphological identification revealed an almost consistent presence of Naegleria spp. in cold water habitats. Other protozoa species including Acanthamoeba spp., Echinamoeba spp., Hartmannella spp., Platyamoeba placida, Saccamoeba spp., Thecamoeba quadrilineata, and Vexillifera spp. were found sporadically. Concomitant analysis of the pH, conductivity and temperature of the water samples revealed no preference of Legionella or the respective protozoa for certain environmental conditions. The specificity of the newly designed 18S rRNA probes demonstrates that they are valuable and rapid tools for the identification of culturable environmental protozoa. PMID:11403402

  6. Experimental Conditions: SE18_S1_M1_D1 [Metabolonote[Archive

    Full Text Available liver and brain by Orbitrap MS and automated search engine Lipid Search SE18_S1 Mouse liver SE18_S1_M1 34.1...phy. SE18_MS1 Preparation of lipid extract and ESI negative detection by LC-MS analysis SE18_DS1 Identification of phospholipids with Lipid Search default ...

  7. Experimental Conditions: SE18_S2_M1_D1 [Metabolonote[Archive

    Full Text Available liver and brain by Orbitrap MS and automated search engine Lipid Search SE18_S2 Mouse brain SE18_S2_M1 10.8...phy. SE18_MS1 Preparation of lipid extract and ESI negative detection by LC-MS analysis SE18_DS1 Identification of phospholipids with Lipid Search default ...

  8. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    William Orsi

    Full Text Available The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC, nitrate, sulfide, and dissolved inorganic carbon (DIC. These correlations are supported by terminal restriction length polymorphism (TRFLP analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  9. Summary of Laurasiatheria (Mammalia) Phylogeny

    Jingyang HU; Yaping ZHANG; Li YU

    2012-01-01

    Laurasiatheria is one of the richest and most diverse superorders of placental mammals.Because this group had a rapid evolutionary radiation,the phylogenetic relationships among the six orders of Laurasiatheria remain a subject of heated debate and several issues related to its phylogeny remain open.Reconstructing the true phylogenetic relationships of Laurasiatheria is a significant case study in evolutionary biology due to the diversity of this suborder and such research will have significant implications for biodiversity conservation.We review the higher-level (inter-ordinal) phylogenies of Laurasiatheria based on previous cytogenetic,morphological and molecular data,and discuss the controversies of its phylogenetic relationship.This review aims to outline future researches on Laurasiatheria phylogeny and adaptive evolution.

  10. Phylogenetic position of the Phacotaceae within the Chlamydophyceaeas revealed by analysis of 18S rDNA and rbcL sequences.

    Hepperle, D; Nozaki, H; Hohenberger, S; Huss, V A; Morita, E; Krienitz, L

    1998-10-01

    Four genera of the Phacotaceae (Phacotus, Pteromonas, Wislouchiella, Dysmorphococcus), a family of loricated green algal flagellates within the Volvocales, were investigated by means of transmission electron microscopy and analysis of the nuclear encoded small-subunit ribosomal RNA (18S rRNA) genes and the plastid-encoded rbcL genes. Additionally, the 18S rDNA of Haematococcus pluvialis and the rbcL sequences of Chlorogonium elongatum, C. euchlorum, Dunaliella parva, Chloromonas serbinowii, Chlamydomonas radiata, and C. tetragama were determined. Analysis of ultrastructural data justified the separation of the Phacotaceae into two groups. Phacotus, Pteromonas, and Wislouchiella generally shared the following characters: egg-shaped protoplasts, a single pyrenoid with planar thylakoid double-lamellae, three-layered lorica, flagellar channels as part of the central lorica layer, mitochondria located in the central cytoplasm, lorica development that occurs in mucilaginous zoosporangia that are to be lysed, and no acid-resistant cell walls. Dysmorphococcus was clearly different in each of the characters mentioned. Direct comparison of sequences of Phacotus lenticularis, Pteromonas sp., Pteromonas protracta, and Wislouchiella planctonica revealed DNA sequence homologies of >/=98. 0% within the 18S gene and 93.9% within the rbcL gene. D. globosus was quite different from these species, with a maximum of 92.9% homology in the 18S rRNA and 18S rDNA of Dunaliella salina, with 95.3%, and to the rbcL sequence of Chlamydomonas tetragama, with 90.3% sequence homology. Additionally, the Phacotaceae sensu stricto exclusively shared 10 (rbcL: 4) characters which were present neither in other Chlamydomonadales nor in Dysmorphococcus globosus. Different phylogenetic analysis methods confirmed the hypothesis that the Phacotaceae are polyphyletic. The Phacotaceae sensu stricto form a stable cluster with affinities to the

  11. Reconciling classical and molecular phylogenies in the stichotrichines (Ciliophora, Spirotrichea), including new sequences from some rare species

    Foissner, W.; Moon-van der Staay, S.Y.; Staay, G.W.M. van der; Hackstein, J.H.P.; Krautgartner, W.D.; Berger, H.

    2004-01-01

    We performed a comparative morphological and molecular study on oxytrichid and urostylid stichotrichs (= part of the former hypotrichs). Included are new small subunit (18S) ribosomal RNA (rRNA) gene sequences from five rare oxytrichids (Gonostomum namibiense, Cyrtohymena citrina, Hemiurosoma terric

  12. Molecular phylogeny of Babesia poelea from brown boobies (Sula leucogaster) from Johnston Atoll, Central Pacific

    Yabsley, Michael J.; Work, Thierry M.; Rameyer, Robert A.

    2006-01-01

    The phylogenetic relationship of avian Babesia with other piroplasms remains unclear, mainly because of a lack of objective criteria such as molecular phylogenetics. In this study, our objective was to sequence the entire 18S, ITS-1, 5.8S, and ITS-2 regions of the rRNA gene and partial β-tubulin gene of B. poelea, first described from brown boobies (Sula leucogaster) from the central Pacific, and compare them to those of other piroplasms. Phylogenetic analyses of the entire 18S rRNA gene sequence revealed that B. poelea belonged to the clade of piroplasms previously detected in humans, domestic dogs, and wild ungulates in the western United States. The entire ITS-1, 5.8S, ITS-2, and partial β-tubulin gene sequence shared conserved regions with previously described Babesia and Theileria species. The intron of the β-tubulin gene was 45 bp. This is the first molecular characterization of an avian piroplasm.

  13. Molecular phylogeny of Daucus (Apiaceae)

    We studied the phylogeny of 22 accessions of Daucus: D. broteri, D. capillifolius, D. carota, D. carota subsp. carota, D. carota subsp. commutatus, D. carota subsp. commutatus, D. carota subsp. drepanensis, D. carota subsp. gadecaei, D. carota subsp. gummifer, D. carota subsp. halophilius, D. carota...

  14. First record of Bothriocephalus acheilognathi (Cestoda: Pseudophyllidea) in the Rio Grande with comparative analysis of ITS2 and V4-18S rRNA gene sequences

    Bean, M. G.; Škeříková, Andrea; Bonner, T. H.; Scholz, Tomáš; Huffman, D. G.

    2007-01-01

    Roč. 19, č. 2 (2007), s. 71-76. ISSN 0899-7659 R&D Projects: GA ČR GA524/04/0342; GA MŠk LC522 Institutional research plan: CEZ:AV0Z60220518 Keywords : Cestoda * Bothriocephalus * fish parasite Subject RIV: EG - Zoology Impact factor: 1.178, year: 2007

  15. An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5 ' UTRs and its implications for eukaryotic gene translation regulation

    Pánek, Josef; Kolář, Michal; Vohradský, Jiří; Valášek, Leoš

    2013-01-01

    Roč. 41, č. 16 (2013), s. 7625-7634. ISSN 0305-1048 R&D Projects: GA ČR(CZ) GBP305/12/G034 Institutional support: RVO:61388971 ; RVO:68378050 Keywords : 80S RIBOSOME * UNTRANSLATED REGION * ANGSTROM RESOLUTION Subject RIV: CE - Biochemistry Impact factor: 8.808, year: 2013

  16. An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5 ' UTRs and its implications for eukaryotic gene translation regulation

    Pánek, J. (Josef); Kolář, M. (Michal); Vohradský, J; Valášek, L. (Leoš)

    2013-01-01

    There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computat...

  17. Application of 16S rRNA, cytochrome b and control region sequences for understanding the phylogenetic relationships in Oryx species.

    Khan, H A; Arif, I A; Al Homaidan, A A; Al Farhan, A H

    2008-01-01

    The present study reports the application of mitochondrial markers for the molecular phylogeny of Oryx species, including the Arabian oryx (AO), scimitar-horned oryx (SHO) and plains oryx (PO), using the Addax as an outgroup. Sequences of three molecular markers, 16S rRNA, cytochrome b and a control region, for the above four taxa were aligned and the topologies of respective phylogenetic trees were compared. All these markers clearly differentiated the genus Addax from Oryx. However, for species-level grouping, while 16S rRNA and cytochrome b produced similar phylogeny (SHO grouped with PO), the control region grouped SHO with AO. Further studies are warranted to generate more sequencing data, apply multiple bioinformatics tools and to include relevant nuclear markers for phylogenetic analysis of Oryx species. PMID:19224456

  18. The phylogenetic relationship of the family Lutjanidae based on analyses of AFLP and mitochondrial 12S rRNA sequences

    ZHANG Junbin; LIU Xin

    2006-01-01

    Fishes of the family Lutjanidae are commercially important in South China Sea. However,the phylogeny of Lutjanids is still unclear and there are many controversies over it. Herein, studies about the phylogeny of Lutjanids were performed based on Amplified Fragment Length Polymorphism (AFLP) analysis of genome DNA and sequence analysis of mitochondrial 12S rRNA gene, and 10 Lutjanidae species and 1 Lethrinidae species were employed.The topologies of minimum evolution (ME) trees based on the two analyses respectively were congruent except for positions of genera Pristipomoides and Caesio. The optimal substitution model TrN + G for DNA sequences of 12S rRNA genes in Lutjanids was obtained using MODELTEST 3.6 software and maximum likelihood (ML) analysis supports the topology displayed by the ME tree. The test of log-likelihood suggests that the use of molecular clock calibrations to estimate species divergence time appeared valid. Phylogenetic analyses using AFLP data and DNA sequences of mitochondrial 12S rRNA genes indicated the monophyly of Lutjanus genra. However, further studies are required to reveal the phylogenetic relationship among other genera. In addition, the results demonstrated that AFLP genetic marker was suitable for the phylogenetic analysis of Lutjanids.

  19. Phylogenetic relationships of some spirurine nematodes (Nematoda: Chromadorea: Rhabditida: Spirurina) parasitic in fishes inferred from SSU rRNA gene sequences

    Černotíková, Eva; Horák, Aleš; Moravec, František

    2011-01-01

    Roč. 58, č. 2 (2011), s. 135-148. ISSN 0015-5683 R&D Projects: GA ČR(CZ) GA524/06/0170; GA MŠk LC522 Institutional research plan: CEZ:AV0Z60220518 Keywords : Nematoda * Spirurina * SSU rRNA * phylogeny * taxonomy Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 1.812, year: 2011 http://www.paru.cas.cz/folia/pdfs/showpdf.php?pdf=21981

  20. High-Performance Phylogeny Reconstruction

    Tiffani L. Williams

    2004-11-10

    Under the Alfred P. Sloan Fellowship in Computational Biology, I have been afforded the opportunity to study phylogenetics--one of the most important and exciting disciplines in computational biology. A phylogeny depicts an evolutionary relationship among a set of organisms (or taxa). Typically, a phylogeny is represented by a binary tree, where modern organisms are placed at the leaves and ancestral organisms occupy internal nodes, with the edges of the tree denoting evolutionary relationships. The task of phylogenetics is to infer this tree from observations upon present-day organisms. Reconstructing phylogenies is a major component of modern research programs in many areas of biology and medicine, but it is enormously expensive. The most commonly used techniques attempt to solve NP-hard problems such as maximum likelihood and maximum parsimony, typically by bounded searches through an exponentially-sized tree-space. For example, there are over 13 billion possible trees for 13 organisms. Phylogenetic heuristics that quickly analyze large amounts of data accurately will revolutionize the biological field. This final report highlights my activities in phylogenetics during the two-year postdoctoral period at the University of New Mexico under Prof. Bernard Moret. Specifically, this report reports my scientific, community and professional activities as an Alfred P. Sloan Postdoctoral Fellow in Computational Biology.

  1. Assessment of helminth biodiversity in wild rats using 18S rDNA based metagenomics.

    Ryusei Tanaka

    Full Text Available Parasite diversity has important implications in several research fields including ecology, evolutionary biology and epidemiology. Wide-ranging analysis has been restricted because of the difficult, highly specialised and time-consuming processes involved in parasite identification. In this study, we assessed parasite diversity in wild rats using 18S rDNA-based metagenomics. 18S rDNA PCR products were sequenced using an Illumina MiSeq sequencer and the analysis of the sequences using the QIIME software successfully classified them into several parasite groups. The comparison of the results with those obtained using standard methods including microscopic observation of helminth parasites in the rat intestines and PCR amplification/sequencing of 18S rDNA from isolated single worms suggests that this new technique is reliable and useful to investigate parasite diversity.

  2. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  3. Phylogeny of hard- and soft-tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences.

    Black, W C; Piesman, J

    1994-01-01

    Ticks are parasitiform mites that are obligate hematophagous ectoparasites of amphibians, reptiles, birds, and mammals. A phylogeny for tick families, subfamilies, and genera has been described based on morphological characters, life histories, and host associations. To test the existing phylogeny, we sequenced approximately 460 bp from the 3' end of the mitochondrial 16S rRNA gene (rDNA) in 36 hard- and soft-tick species; a mesostigmatid mite, Dermanyssus gallinae, was used as an outgroup. Phylogenies derived using distance, maximum-parsimony, or maximum-likelihood methods were congruent. The existing phylogeny was largely supported with four exceptions. In hard ticks (Ixodidae), members of Haemaphysalinae were monophyletic with the primitive Amblyomminae and members of Hyalomminae grouped within the Rhipicephalinae. In soft ticks (Argasidae), the derived phylogeny failed to support a monophyletic relationship among members of Ornithodorinae and supported placement of Argasinae as basal to the Ixodidae, suggesting that hard ticks may have originated from an Argas-like ancestor. Because most Argas species are obligate bird octoparasites, this result supports earlier suggestions that hard ticks did not evolve until the late Cretaceous. PMID:7937832

  4. [Transport of newly synthesized rRNA from the nucleus to the cytoplasm in freely suspended cells of parsley (Petroselinum sativum)].

    Seitz, U; Seitz, U

    1972-06-01

    A rapidly labelled rRNA precursor can be detected in callus cells of Petroselinum sativum grown on a liquid synthetic medium. Its molecular weight has been calculated to be 2.3×10(6). This value agrees with that of the rRNA precursor from other plant material. In order to follow the synthesis and processing of rRNA in time and to correlate single steps in this process with cell organelles it was necessary to obtain pure fractions of nuclei and ribosomes. The isolation method for nuclei is given in detail. The nucleic acids are separated on polyacrylamide gels of low acrylamide concentration. Pulse-chase experiments show that the rRNA precursor is split into two fragments within the nucleus: an 18S and a 25S component. The 18S RNA leaves the nucleus rapidly. It is already found quantitatively in the ribosomal fraction after 30-60 min chase. At that time the 25S RNA is still within the nucleus; it appears much later in the ribosomes. Since the increase in ribosomal label occurs simultaneously with the decrease in nuclear label, it is concluded that there is no degradation of 18S RNA within the nucleus. Apparently there are two distinct transport mechanisms with different kinetics for the two RNA components. PMID:24477955

  5. Phylogeny and subgeneric taxonomy of Aspergillus

    Peterson, S.W.; Varga, Janos; Frisvad, Jens Christian;

    2008-01-01

    The phylogeny of the genus Aspergillus and its teleomorphs is discussed based on multilocus sequence data. DNA sequence analysis was used to formulate a nucleotide sequence framework of the genus and to analyze character changes in relationship to the phylogeny hypothesized from the DNA sequence...

  6. Phylogeny Constructed by Using Dsing Diversity Increment

    Shi Feng; Li Na-na; Li Yuan-xiang; Zhou Huai-bei

    2003-01-01

    A new approach based on the concept of the diversity increment is applied to reconstruct a phylogeny. The phylogeny of the Eutherian orders use concatenated H-stranded amino acid sequences, and the result is consistent with the commonly accepted one for the Eutherians.

  7. Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

    Xiao Li Shi

    Full Text Available The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX, which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

  8. Molecular organization of the 25S-18S rDNA IGS of Fagus sylvatica and Quercus suber: a comparative analysis.

    Inácio, Vera; Rocheta, Margarida; Morais-Cecílio, Leonor

    2014-01-01

    The 35S ribosomal DNA (rDNA) units, repeated in tandem at one or more chromosomal loci, are separated by an intergenic spacer (IGS) containing functional elements involved in the regulation of transcription of downstream rRNA genes. In the present work, we have compared the IGS molecular organizations in two divergent species of Fagaceae, Fagus sylvatica and Quercus suber, aiming to comprehend the evolution of the IGS sequences within the family. Self- and cross-hybridization FISH was done on representative species of the Fagaceae. The IGS length variability and the methylation level of 18 and 25S rRNA genes were assessed in representatives of three genera of this family: Fagus, Quercus and Castanea. The intergenic spacers in Beech and Cork Oak showed similar overall organizations comprising putative functional elements needed for rRNA gene activity and containing a non-transcribed spacer (NTS), a promoter region, and a 5'-external transcribed spacer. In the NTS: the sub-repeats structure in Beech is more organized than in Cork Oak, sharing some short motifs which results in the lowest sequence similarity of the entire IGS; the AT-rich region differed in both spacers by a GC-rich block inserted in Cork Oak. The 5'-ETS is the region with the higher similarity, having nonetheless different lengths. FISH with the NTS-5'-ETS revealed fainter signals in cross-hybridization in agreement with the divergence between genera. The diversity of IGS lengths revealed variants from ∼ 2 kb in Fagus, and Quercus up to 5.3 kb in Castanea, and a lack of correlation between the number of variants and the number of rDNA loci in several species. Methylation of 25S Bam HI site was confirmed in all species and detected for the first time in the 18S of Q. suber and Q. faginea. These results provide important clues for the evolutionary trends of the rDNA 25S-18S IGS in the Fagaceae family. PMID:24893289

  9. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio

    2010-04-01

    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae. PMID:19656941

  10. Phylogenetic position of the yeast-like symbiotes of Tagosodes orizicolus (Homoptera: Delphacidae) based on 18S ribosomal DNA partial sequences.

    Xet-Mull, Ana M; Quesada, Tania; Espinoza, Ana M

    2004-09-01

    Tagosodes orizicolus Muir (Homoptera: Delphacidae), the endemic delphacid species of tropical America carries yeast-like symbiotes (YLS) in the abdominal fat bodies and the ovarial tissues, like other rice planthoppers of Asia. These YLS are obligate symbiotes, which are transmitted transovarially, and maintain a mutualistic relationship with the insect host. This characteristic has made in vitro culture and classification of YLS rather difficult using conventional methods. Nevertheless, microorganisms of similar characteristics have been successfully classified by using molecular taxonomy. In the present work, the YLS of Tagosodes orizicolus (YLSTo) were purified on Percoll gradients, and specific segments of 18S rDNA were amplified by PCR, cloned and sequenced. Sequences were aligned by means of the CLUSTAL V (DNASTAR) program; phylogenetic trees were constructed with the Phylogeny Inference Package (PHYLIP), showing that YLSTo belong to the fungi class Pyrenomycetes, phylum Ascomycota. Similarities between 98% and 100% were observed among YLS of the rice delphacids Tagosodes orizicolus, Nilaparvata lugens, Laodelphax striatellus and Sogatella fur cifera, and between 89.8% and 90.8% when comparing the above to YLS of the aphid Hamiltonaphis styraci. These comparisons revealed that delphacid YLS are a highly conserved monophyletic group within the Pyrenomycetes and are closely related to Hypomyces chrysospermus. PMID:17361570

  11. Aligned 18S for Zoraptera (Insecta) : Phylogenetic position and molecular evolution

    Yoshizawa, Kazunori; Johnson, Kevin P.

    2005-01-01

    The order Zoraptera (angel insects) is one of the least known insect groups, containing only 32 extant species. The phylogenetic position of Zoraptera is poorly understood, but it is generally thought to be closely related to either Paraneoptera (hemipteroid orders: booklice, lice, thrips, and bugs), Dictyoptera (blattoid orders: cockroaches, termites, and mantis), or Embioptera (web spinners). We inferred the phylogenetic position of Zoraptera by analyzing nuclear 18S rDNA sequences, which w...

  12. Identification of a potential fungal species by 18S rDNA for ligninases production.

    Ferhan, M; Santos, S N; Melo, I S; Yan, N; Sain, M

    2013-12-01

    Fungal species for ligninases production was investigated by 18S ribosomal DNA sequence analysis. Two primer sets were chosen to amplify a major part of the 18S rDNA, which resulted in intense PCR product of approximately 550-820 bp in size per sample. The results suggest that the 18S rDNA-based approach is a useful tool for identification of unknown potential fungal species for ligninases production. The isolated fungal species produces mainly manganese peroxidase (MnP). The enzyme oxidized a variety of the usual MnP substrates, including lignin related polyphenols. Time course studies showed that maximum production of ligninolytic enzymes MnP (64 IU L⁻¹), lignin peroxidase (26.35 IU L⁻¹), and laccase (5.44 IU L⁻¹), respectively, were achieved after 10 days of cultivation under optimum conditions. Furthermore, the biological decolorization of Remazol Brilliant Blue R dye following 10 days of cultivation was 94 %. NCBI BLAST was used to search for closest matched sequences in the GenBank database and based on sequence homology the first BLAST hit was Dothioraceae sp. LM572 with accession number EF060858.1. PMID:23744034

  13. Multigene phylogeny reveals eusociality evolved twice in vespid wasps

    Hines, Heather M.; Hunt, James H.; O'Connor, Timothy K.; Gillespie, Joseph J.; Cameron, Sydney A.

    2007-01-01

    Eusocial wasps of the family Vespidae are thought to have derived their social behavior from a common ancestor that had a rudimentary caste-containing social system. In support of this behavioral scenario, the leading phylogenetic hypothesis of Vespidae places the eusocial wasps (subfamilies Stenogastrinae, Polistinae, and Vespinae) as a derived monophyletic clade, thus implying a single origin of eusocial behavior. This perspective has shaped the investigation and interpretation of vespid social evolution for more than two decades. Here we report a phylogeny of Vespidae based on data from four nuclear gene fragments (18S and 28S ribosomal DNA, abdominal-A and RNA polymerase II) and representatives from all six extant subfamilies. In contrast to the current phylogenetic perspective, our results indicate two independent origins of vespid eusociality, once in the clade Polistinae+Vespinae and once in the Stenogastrinae. The stenogastrines appear as an early diverging clade distantly related to the vespines and polistines and thus evolved their distinctive form of social behavior from a different ancestor than that of Polistinae+Vespinae. These results support earlier views based on life history and behavior and have important implications for interpreting transitional stages in vespid social evolution. PMID:17360641

  14. Phylogenetic relationships of Salmonella based on rRNA sequences

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

  15. Molecular phylogeny of oligotrich genera Omegastrombidium and Novistrombidium (Protozoa, Ciliophora) for the systematical relationships within Family Strombidiidae

    Zhang, Qianqian; Yi, Zhenzhen; Xu, Dapeng; Al-Rasheid, Khaled A. S.; Gong, Jun; Song, Weibo

    2010-07-01

    The phylogeny of the oligotrich ciliates is currently a hot debate despite the availability of both morphological and molecular data. In the present paper, further small subunit rRNA (SS rRNA) genes were analyzed from the Genera Omegastrombidium and Novistrombidium, as well as from Strombidium, and combined with three new SS rRNA sequences from Strombidium basimorphum, S. sulcatum population QD-1, and Novistrombidium testaceum population GD. The phylogenetic positions of these organisms were inferred using Bayesian inference, Maximum Likelihood, and Maximum Parsimony methods. The main results are: (1) the SS rRNA gene sequence analyses match the recent findings about the molecular evolution of oligotrichs, indicating that the family Strombidiidae is paraphyletic; (2) the Genus Omegastrombidium is separated from the Genus Strombidium, as shown in recent cladistic analyses; (3) morphospecies in Genus Novistrombidium, based on similarity of somatic ciliature, are separated from each other in all topological trees, indicating that this genus could be a paraphyletic group; (4) the molecular data indicate a possibility of paraphyly for the genus Strombidium; and (5) the similarities of the SS rRNA gene of specimens identified as S. sulcatum and S. inclinatum are 99.8%-100%. However, present knowledge on the oligotrichs sensu stricto is still insufficient and further studies based on both molecular and other technologies are required.

  16. Magic wavelengths for the $5s-18s$ transition in rubidium

    Goldschmidt, E A; Koller, S B; Wyllie, R; Brown, R C; Porto, J V; Safronova, U I; Safronova, M S

    2015-01-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the $5s-18s$ transition of rubidium, and compare the calculation to experiment by measuring the light shift for atoms held in an optical dipole trap at a range of wavelengths near a calculated magic value.

  17. Molecular phylogeny of the families Pleuronectidae and Poecilopsettidae (PISCES, Pleuronectiformes) from Korea, with a Proposal for a new classification

    Ji, Hwan-Sung; Kim, Jin-Koo; Kim, Byung-Jik

    2016-03-01

    A new classification of the Korean pleuronectids was proposed based on a molecular phylogeny using specimens collected from Korea (including some Japanese specimens) between 2008 and 2013. A molecular phylogeny based on partial sequences of the two mitochondrial DNA regions (COI and 16S rRNA) supported the reciprocal monophyly of the three genera, Cleisthenes, Pleuronectes and Pseudopleuronectes. We also found that the genus Poecilopsetta is clearly distinct from Pleuronectidae at the family level. Therefore, the previous classification of the Korean pleuronectids should be changed as follows; two families (Pleuronectidae and Poecilopsettidae), 18 genera, and 26 species. Further research is required to resolve the taxonomic uncertainty of the five species in the genus Limanda, which clustered into two clades in our analysis.

  18. Molecular phylogeny of the forensically important genus Cochliomyia (Diptera: Calliphoridae).

    Yusseff-Vanegas, Sohath; Agnarsson, Ingi

    2016-01-01

    Cochliomyia Townsend includes several abundant and one of the most broadly distributed, blow flies in the Americas, and is of significant economic and forensic importance. For decades, Cochliomyia hominivorax (Coquerel) and Cochliomyia macellaria (Fabricius) have received attention as livestock parasites and primary indicator species in forensic entomology. However, Cochliomyia minima Shannon and Cochliomyia aldrichi Del Ponte have only been subject to basic taxonomy and faunistic studies. Here we present the first complete phylogeny of Cochliomyia including numerous specimens per species, collected from 13 localities in the Caribbean. Four genes, the mitochondrial COI and the nuclear EF-1α, 28S rRNA, and ITS2, were analyzed. While we found some differences among gene trees, a concatenated gene matrix recovered a robustly supported monophyletic Cochliomyia with Compsomyiops Townsend as its sister group and recovered the monophyly of Cochliomyia hominivorax, Cochliomyia macellaria and Cochliomyia minima. Our results support a close relationship between Cochliomyia minima and Cochliomyia aldrichi. However, we found Cochliomyia aldrichi containing Cochliomyia minima, indicating recent speciation, or issues with the taxonomy of the group. We provide basic information on habitat preference, distribution and feeding habits of Cochliomyia minima and Cochliomyia aldrichi that will be useful for future forensic studies in the Caribbean. PMID:27563274

  19. Molecular phylogeny of the forensically important genus Cochliomyia (Diptera: Calliphoridae)

    Yusseff-Vanegas, Sohath; Agnarsson, Ingi

    2016-01-01

    Abstract Cochliomyia Townsend includes several abundant and one of the most broadly distributed, blow flies in the Americas, and is of significant economic and forensic importance. For decades, Cochliomyia hominivorax (Coquerel) and Cochliomyia macellaria (Fabricius) have received attention as livestock parasites and primary indicator species in forensic entomology. However, Cochliomyia minima Shannon and Cochliomyia aldrichi Del Ponte have only been subject to basic taxonomy and faunistic studies. Here we present the first complete phylogeny of Cochliomyia including numerous specimens per species, collected from 13 localities in the Caribbean. Four genes, the mitochondrial COI and the nuclear EF-1α, 28S rRNA, and ITS2, were analyzed. While we found some differences among gene trees, a concatenated gene matrix recovered a robustly supported monophyletic Cochliomyia with Compsomyiops Townsend as its sister group and recovered the monophyly of Cochliomyia hominivorax, Cochliomyia macellaria and Cochliomyia minima. Our results support a close relationship between Cochliomyia minima and Cochliomyia aldrichi. However, we found Cochliomyia aldrichi containing Cochliomyia minima, indicating recent speciation, or issues with the taxonomy of the group. We provide basic information on habitat preference, distribution and feeding habits of Cochliomyia minima and Cochliomyia aldrichi that will be useful for future forensic studies in the Caribbean. PMID:27563274

  20. Molecular phylogeny of Duvenhage virus

    Louis H. Nel

    2011-11-01

    Full Text Available The Duvenhage virus (DUVV constitutes one of the 11 species in the Lyssavirus genus and causes fatal rabies encephalitis. The virus is associated with insectivorous bat species and three human cases have been reported, all of which were linked to contact with bats. Few of these isolates have been studied and thus little is known about the phylogeny and epidemiology of this lyssavirus. Until 2007, when an isolate was made from the East African country of Kenya, all isolations of this virus had been from southern Africa. This discovery led to many questions regarding the spread and diversity of this lyssavirus. Phylogenetic analysis indicated that the DUVV isolates constitute two different lineages, in which the southern African isolates group together to form one lineage and the more recent isolate from Kenya constitutes a new, second lineage. We found that the new isolate has a genetic variation that has not yet been seen for DUVV. Not only is our lack of knowledge regarding the geographical distribution of this uniquely African virus emphasised, but we have also demonstrated the potential diversity within this genotype.

  1. Phylogenetic relationships among six species of Epistylis inferred from 18S-ITS1 sequences

    缪炜; 余育和; 沈韫芬; 张锡元

    2002-01-01

    Phylogenetic relationships among six species of Epistylis (i. e. E. plicatilis, E. urceolata, E. chrysemydis, E. hentscheli, E. wenrichi, and E. galea) were investigated using sequences of the first internal transcribed spacer region (ITS-1) of ribosomal DNA (rDNA). Amplified rDNA fragment sequences consisted of 215 or 217 bases of the flanking 18S and 5.8S regions, and the entire ITS-1 region (from 145 to 155 bases). There were more than 33 variable bases between E. galea and the other five species in both the 18S region and the ITS-1 region. The affiliation of them was assessed using Neighbor-joining (NJ), maximum parsimony (MP) and maximum likelihood (ML) analyses. In all the NJ, MP and ML analyses E. galea, whose macronucleic position and shape are distinctly different from those of the other five species, was probably diverged from the ancestor of Epistylis earlier than the other five species. The topology in which E. plicatilis and E. hentscheli formed a strongly supported sister clade to E. urceolata, E. chrysemydis, and E. wenrichi was consistent with variations in the thickness of the peristomial lip. We concluded that the macronucleus and peristomial lip might be the important phylogenetic characteristics within the genus Epistylis.

  2. 18S-rDNA SEQUENCING, ENZYME PATTERNS AND MORPHOLOGICAL CHARACTERIZATION OF TRICHOPHYTON ISOLATES

    Nascimento Adriana Mendes do

    2001-01-01

    Full Text Available Dermatophytes, capable to use keratin of the host for nutrition, belong to one of the major groups of pathogenic fungi. Since dermatophytes are a closely related group they share various common features, and the morphology of isolates of a given species can be atypical, making species identification and differentiation even more difficult. Many methods have been explored in attempts to distinguish dermatophytes, but the combined use of different approaches for the investigation of the intraspecific and interspecific variability of Trichophyton continues to be scarce. Some studies have shown that amplified fragments of the small ribosomal DNA subunit 18S contains variable regions which can be used to discriminate between medically relevant yeast species, indicating that these regions could also be used for differentiation between dermatophytes. In our study, sequence analysis of the 18S-rDNA gene was combined with morphological and biochemical criteria in order to detect genetic differences between seven Trichophyton isolates and estimate their phylogenetic relationships. The results show that the isolates investigated belong to the Trichophyton group, which potentially contains the Trichophyton rubrum cluster.

  3. Complete mitochondrial DNA sequence of Chinese alligator,Alligator sinensis, and phylogeny of crocodiles

    WU Xiaobing; WANG Yiquan; ZHOU Kaiya; ZHU Weiquan; NIE Jishan; WANG Chaolin

    2003-01-01

    The 16746-neucleotide (nt) sequence of mitochondrial DNA (mtDNA) of Chinese alligator, Alligator sinensis, was determined using the Long-PCR and primer walking methods. As is typical in vertebrates, the mtDNA encodes 13 proteins, 2 rRNA, 22 tRNA genes, and a noncoding control region. The composition of bases is respectively 29.43% A, 24.59% T, 14.86% G, 31.12% C. The gene arrangement differs from the common vertebrate gene arrangement, but is similar to that of other crocodiles. DNA sequence data from 12S rRNA, 16S rRNA, protein-coding genes and combined sequence data were used to reconstruct the phylogeny of reptiles with the MP and ML methods. With this large data set and an appropriate range of outgroup taxa,the authors demonstrate that Chinese alligator is most closely related to American alligator among three crocodilian species, which suppors the traditional viewpoint. According to the branch lengths of ML tree from the combined data set,the primary divergence between Alligator and Caiman genus was dated at about 74.9 Ma, the split between Chinese alligator and American alligator was dated at 50.9 Ma.

  4. Juvenile morphology in baleen whale phylogeny

    Tsai, Cheng-Hsiu; Fordyce, R. Ewan

    2014-09-01

    Phylogenetic reconstructions are sensitive to the influence of ontogeny on morphology. Here, we use foetal/neonatal specimens of known species of living baleen whales (Cetacea: Mysticeti) to show how juvenile morphology of extant species affects phylogenetic placement of the species. In one clade (sei whale, Balaenopteridae), the juvenile is distant from the usual phylogenetic position of adults, but in the other clade (pygmy right whale, Cetotheriidae), the juvenile is close to the adult. Different heterochronic processes at work in the studied species have different influences on juvenile morphology and on phylogenetic placement. This study helps to understand the relationship between evolutionary processes and phylogenetic patterns in baleen whale evolution and, more in general, between phylogeny and ontogeny; likewise, this study provides a proxy how to interpret the phylogeny when fossils that are immature individuals are included. Juvenile individuals in the peramorphic acceleration clades would produce misleading phylogenies, whereas juvenile individuals in the paedomorphic neoteny clades should still provide reliable phylogenetic signals.

  5. Research Progress in Phylogeny of Microsporidium%微孢子虫系统发育研究进展

    马兰; 李灿

    2012-01-01

    Microsporidium is specially parasitical unicellular eukaryote with polar filament and without mitochondria. This paper introduced the advances in the application of biological characteristics, SSU rRNA of nbosome, ITS interval sequence, LSU rRNA, microtubulin gene and proteomics to the researches of microsporidian phylogeny.%微孢子虫是一类专营寄生生活、具极丝但无线粒体的单细胞真核生物,介绍了生物学特征、核糖体的SSU rRNA、ITS间隔序列、LSU rRNA、微管蛋白基因及蛋白质组学在微孢子虫的系统发育研究中的应用.

  6. Identification of Chlorophyceae based on 18S rDNA sequences from Persian Gulf.

    Raheem Haddad

    2014-12-01

    Full Text Available Chlorophyceae are important constituents of marine phytoplankton. The taxonomy of Chlorophyceae was traditionally based solely on morphological characteristics. In the present research project, genetic diversity was investigated to analyze five species of Chlorophyceae from waters of the Persian Gulf.A clone library of the ribosomal small subunit RNA gene (18S rDNA in the nuclear genome was constructed by PCR, and then, after examining the clones, selected clones were sequenced. The determined clone sequences were analyzed by a similarity search of the NCBI GenBank database using BLAST.Eleven sequences were identified correctly and used for phylogenetic analysis. We identified species of Chlorophyta (Chlorella sorokiniana, Chlamydomonas sp., Neochloris aquatic, Picochlorum sp. and Nannochloris atomus without the need to conduct extensive colony isolation techniques. Therefore, this improved molecular method can be used to generate a robust database describing the species diversity of environmental samples.

  7. 18S rDNA dataset profiling microeukaryotic populations within Chicago area nearshore waters

    Daniel Searle

    2016-03-01

    Full Text Available Despite their critical role in the aquatic food web and nutrient cycling, microeukaryotes within freshwater environments are under-studied. Herein we present the first high-throughput molecular survey of microeukaryotes within Lake Michigan. Every two weeks from May 13 to August 5, 2014, we collected surface water samples from the nearshore waters of four Chicago area beaches: Gillson Park, Montrose Beach, 57th Street Beach, and Calumet Beach. Four biological replicates were collected for each sampling date and location, resulting in 112 samples. Eighty-nine of these samples were surveyed through targeted sequencing of the V7 and V8 regions of the 18S rDNA gene. Both technical and biological replicates were sequenced and are included in this dataset. Raw sequence data is available via NCBI’s SRA database (BioProject PRJNA294919.

  8. 'Think before you buy under-18s drink': evaluation of a community alcohol intervention.

    Kypri, Kypros; Dean, Johanna; Kirby, Sandra; Harris, Jennifer; Kake, Tai

    2005-01-01

    Hazardous consumption of alcohol by teenagers is a significant public health problem in New Zealand. Concern about supply of alcohol to minors motivated 'Think before you buy under-18s drink', a campaign to reduce alcohol-related harm by discouraging inappropriate supply of alcohol by adults. Two intervention districts and a comparison district, in the South Island of New Zealand, were selected for the purpose of evaluating the campaign. Primary outcome measures were changes in the prevalence of parent supply to their teenager (13-17 years) for unsupervised drinking (SUD), and changes in the prevalence of binge drinking among teenagers. At baseline, 49% of teenagers reported a recent episode of binge drinking. SUD in the past month was reported by 36% of teenagers. Recent purchases of alcohol by under-18s were common (bottle shops: 16%; pubs/bars: 11%). In contrast to teenagers, only 2% of parents reported SUD in the past month. Levels of binge drinking decreased in all three districts. Analysis of data from 474 teenagers who completed questionnaires, at baseline and follow-up, showed decreased SUD in Ashburton and Waitaki relative to Clutha, although this was not significant (OR=0.73; 95% CI: 0.43, 1.25). Discrepancies between teenager and parent reports of SUD may be due to the latter providing a socially desirable survey response and to differences in the interpretation of what constitutes adult supervision. The lack of a significant association between changes in SUD and binge drinking may be a consequence of teenagers obtaining relatively small amounts of alcohol from their parents and larger quantities from other sources, e.g. peers (some of whom may be able to purchase alcohol legally) and from licensed premises. PMID:16191716

  9. The phylogeny of Orussidae (Insecta: Hymenoptera) revisited

    Vilhelmsen, Lars

    2007-01-01

    The phylogeny of the parasitic wasp family Orussidae is analyzed with a slightly expanded version of a previously published data set. The basal splitting events in the family between two fossil taxa and the extant members are not unambiguously resolved. Intergeneric relationships in general are...... poorly supported and change under different analytical conditions. This corroborates earlier fi ndings regarding the phylogeny of the family. A resumé of the evolutionary history of the Orussidae is provided. Leptorussus madagascarensis sp.n. is described. Udgivelsesdato: 7/12...

  10. The phylogeny graphs of doubly partial orders

    Park, Boram

    2011-01-01

    The competition graph of a doubly partial order is known to be an interval graph. The CCE graph and the niche graph of a doubly partial order are also known to be interval graphs if the graphs do not contain a cycle of length four and three as an induced subgraph, respectively. Phylogeny graphs are variant of competition graphs. The phylogeny graph $P(D)$ of a digraph $D$ is the (simple undirected) graph defined by $V(P(D)):=V(D)$ and $E(P(D)):=\\{xy \\mid N^+_D(x) \\cap N^+_D(y) \

  11. Molecular data and phylogeny of family

    Family Smilacaceae's higher order taxonomy remained disputed for many years. It was treated as an order 'Smilacales' and was also placed under Liliales by several taxonomists. Even some considered as part of family Liliacaeae. In present paper, we investigated the family's higher order phylogeny and also compared its rbcL gene sequence data with related taxa to elucidate its phylogeny. The data suggests that its family stature is beyond dispute because of its advanced karyotype, woody climbing habit and DNA sequence data. The data suggest that Smilacaceae may be a sister group of order Liliales and it forms a clear clade with the order. (author)

  12. Downregulation of rRNA Transcription Triggers Cell Differentiation

    Yuki Hayashi; Takao Kuroda; Hiroyuki Kishimoto; Changshan Wang; Atsushi Iwama; Keiji Kimura

    2014-01-01

    Responding to various stimuli is indispensable for the maintenance of homeostasis. The downregulation of ribosomal RNA (rRNA) transcription is one of the mechanisms involved in the response to stimuli by various cellular processes, such as cell cycle arrest and apoptosis. Cell differentiation is caused by intra- and extracellular stimuli and is associated with the downregulation of rRNA transcription as well as reduced cell growth. The downregulation of rRNA transcription during differentiati...

  13. Multilocus phylogeny of Sciurini tree squirrels

    Pečnerová, P.; Martínková, Natália

    Brno : Akademické nakladatelství CERM, 2012 - (Budinská, E.; Popovici, V.), s. 55-63 ISBN 978-80-7204-804-5. [Summer School on Computational Biology /8./. Mikulov (CZ), 12.09.2012-15.09.2012] Institutional support: RVO:68081766 Keywords : phylogeny * supermatrix * supertree * squirrels Subject RIV: EG - Zoology

  14. The Binary Perfect Phylogeny with Persistent characters

    Braghin, Chiara; Trucco, Gabriella; Bonizzoni, Paola

    2011-01-01

    The near-perfect phylogeny over binary set of characters has been proposed as an extension of the too restrictive model of the perfect phylogeny in order to model biological events such as homoplasy. However the model appears to be too general to model some situations and is computationally inefficient on some instances. In this paper we consider the problem of reconstructing a near-perfect phylogeny where only a type of homoplasy is allowed in the tree: we consider back mutations according to notion of {\\em persistency}, that is characters can be gained and lost at most once. The notion of persistency leads to the problem of the Persistent Perfect Phylogeny (referred as P-PPH). By exploring combinatorial properties of the problem we develop an exact algorithm for solving the P-PPH problem that in the worst case runs in time that is exponential in the number of characters, but is polynomial in the number of species. Indeed, we show that the P-PPH problem can be restated as a special case of the Incomplete Per...

  15. Bayesian inference of the metazoan phylogeny

    Glenner, Henrik; Hansen, Anders J; Sørensen, Martin V;

    2004-01-01

    Metazoan phylogeny remains one of evolutionary biology's major unsolved problems. Molecular and morphological data, as well as different analytical approaches, have produced highly conflicting results due to homoplasy resulting from more than 570 million years of evolution. To date, parsimony has...

  16. Delineation of the species Haemophilus influenzae by phenotype, multilocus sequence phylogeny, and detection of marker genes

    Nørskov-Lauritsen, Niels; Overballe, MD; Kilian, Mogens

    2009-01-01

    encoded hemin biosynthesis genes were identified, and sequence analysis showed these genes to represent an ancestral genotype rather than recent transfers from, e.g., Haemophilus parainfluenzae. Strains previously assigned to H. haemolyticus formed several separate lineages within a distinct but deeply......To obtain more information on the much-debated definition of prokaryotic species, we investigated the borders of Haemophilus influenzae by comparative analysis of H. influenzae reference strains with closely related bacteria including strains assigned to Haemophilus haemolyticus, cryptic...... genospecies biotype IV, and the never formally validated species "Haemophilus intermedius". Multilocus sequence phylogeny based on six housekeeping genes separated a cluster encompassing the type and the reference strains of H. influenzae from 31 more distantly related strains. Comparison of 16S rRNA gene...

  17. Phylogenetic relationship of 16 Oedipodidae species (Insecta: Orthoptera) based on the 16S rRNA gene sequences

    HUI-MENG LU; YUAN HUANG

    2006-01-01

    The sequences of the mitochondrial 16S rRNA gene of 16 Oedipodidae species were amplified and sequenced. All sequences were aligned and analyzed and the phyloge netic relationships were inferred. The properties of 16S gene in Oedipodidae showed typical patterns of many insects such as a high A+T content and variable distance-dependent transition/transversion ratios. The 0.2 weight for sites of loops may be advisable for phylogeny reconstruction using the maximum parsimony method. The phylogenetic analysis results do not support the current subfamily classification systems of Oedipodidae. Bryodemellinae and Bryodeminae are closely related and should be merged as one subfamily. The status of Oedipodinae and Locustinae is also problematic.

  18. Classification and phylogeny of the cyanobiont Anabaena azollae Strasburger: an answered question?

    Pereira, Ana L; Vasconcelos, Vitor

    2014-06-01

    The symbiosis Azolla-Anabaena azollae, with a worldwide distribution in pantropical and temperate regions, is one of the most studied, because of its potential application as a biofertilizer, especially in rice fields, but also as an animal food and in phytoremediation. The cyanobiont is a filamentous, heterocystic cyanobacterium that inhabits the foliar cavities of the pteridophyte and the indusium on the megasporocarp (female reproductive structure). The classification and phylogeny of the cyanobiont is very controversial: from its morphology, it has been named Nostoc azollae, Anabaena azollae, Anabaena variabilis status azollae and recently Trichormus azollae, but, from its 16S rRNA gene sequence, it has been assigned to Nostoc and/or Anabaena, and from its phycocyanin gene sequence, it has been assigned as non-Nostoc and non-Anabaena. The literature also points to a possible co-evolution between the cyanobiont and the Azolla host, since dendrograms and phylogenetic trees of fatty acids, short tandemly repeated repetitive (STRR) analysis and restriction fragment length polymorphism (RFLP) analysis of nif genes and the 16S rRNA gene give a two-cluster association that matches the two-section ranking of the host (Azolla). Another controversy surrounds the possible existence of more than one genus or more than one species strain. The use of freshly isolated or cultured cyanobionts is an additional problem, since their morphology and protein profiles are different. This review gives an overview of how morphological, chemical and genetic analyses influence the classification and phylogeny of the cyanobiont and future research. PMID:24737795

  19. Genetic Characterization of Nematodirella cameli Based on 18S rDNA and Cytochrome c Oxidase Subunit 1 (CO1

    Hassan SHARIFIYAZDI

    2015-01-01

    Full Text Available To determine the phylogenic position and genetic diversity of Nematodirella cameli two portions of nuclear ribosomal DNA, 18S rDNA and mitochondrial DNA gene, the subunit 1 of cytochrome C oxidase gene (CO1 were sequenced and compared with those previously reported for other nematodes in Trichostrongylina. The phylogenetic trees constructed based upon the 18S rDNA sequences, yielded strong support for close relationship between the N. cameli and Nematodirus battus, with a high bootstrap value of 100%. In the present research, the level of sequence polymorphism among N. cameli isolates was higher for CO1 with 32 polymorphic sites compared to 18S rDNA sequence. Accordingly, molecular assays based on CO1 mitochondrial marker, demonstrated the existence of at least 11 distinct haplotypes (accession nos. JX305966 to JX305976 with an intraspecific diversity of 3-7% in Iran. Whereas, all of N. cameli samples examined herein (n=11, had a unique 18S sequence (accession no. JX305977. In addition, N. cameli CO1 sequences found in this study showed maximum identities to Haemonchus (88% and Ostertagia (87% in BLAST analysis for existing Trichostrongylina sequences. Further information is necessary to infer interspecific and intraspecific phylogenetic relationships between genera and species in Trichostrongylina. This study describes for the first time the nuclear 18S rDNA and mitochondrial CO1 sequence data from Nematodirella cameli species.

  20. Construction of Porphyra yezoensis Pure Line from Protoplasts and Its 18S rDNA Sequence Determination

    LIU Hongquan; YU Wengong; DAI Jixun; GONG Qianhong; SHI Xiaochong; YANG Kunfeng

    2004-01-01

    The wild Porphyra yezoensis collected from the Qingdao coast was used to prepare protoplasts by enzyme digestion. The pure line was constructed by cultivating the protoplasts. The 18S rDNA of the P. yezoensis pure line was cloned and sequenced. Sequence analysis was executed for this sequence and other 22 sequences retrieved from GenBank. A phylogenetic tree was constructed using the neighbor-joining method. The results revealed a high diversity of 18S rDNA sequences in genus Porphyra and the considerable variation of 18S rDNA sequences in different strains of the same species P. yezoensis and P. tenera. Significant difference of 18S rDNA sequence was observed between P. yezoensis from Qingdao, China, and the two strains of P. yezoensis from Japan, but the three strains of P. yezoensis formed a stable clade in the phylogenetic tree. These results indicate the possibility of interspecies and intraspecies discrimination of Porphyra using the 18S rDNA sequences.

  1. Downregulation of rRNA transcription triggers cell differentiation.

    Yuki Hayashi

    Full Text Available Responding to various stimuli is indispensable for the maintenance of homeostasis. The downregulation of ribosomal RNA (rRNA transcription is one of the mechanisms involved in the response to stimuli by various cellular processes, such as cell cycle arrest and apoptosis. Cell differentiation is caused by intra- and extracellular stimuli and is associated with the downregulation of rRNA transcription as well as reduced cell growth. The downregulation of rRNA transcription during differentiation is considered to contribute to reduced cell growth. However, the downregulation of rRNA transcription can induce various cellular processes; therefore, it may positively regulate cell differentiation. To test this possibility, we specifically downregulated rRNA transcription using actinomycin D or a siRNA for Pol I-specific transcription factor IA (TIF-IA in HL-60 and THP-1 cells, both of which have differentiation potential. The inhibition of rRNA transcription induced cell differentiation in both cell lines, which was demonstrated by the expression of the common differentiation marker CD11b. Furthermore, TIF-IA knockdown in an ex vivo culture of mouse hematopoietic stem cells increased the percentage of myeloid cells and reduced the percentage of immature cells. We also evaluated whether differentiation was induced via the inhibition of cell cycle progression because rRNA transcription is tightly coupled to cell growth. We found that cell cycle arrest without affecting rRNA transcription did not induce differentiation. To the best of our knowledge, our results demonstrate the first time that the downregulation of rRNA levels could be a trigger for the induction of differentiation in mammalian cells. Furthermore, this phenomenon was not simply a reflection of cell cycle arrest. Our results provide a novel insight into the relationship between rRNA transcription and cell differentiation.

  2. Phylogeny of novel naked Filose and Reticulose Cercozoa: Granofilosea cl. n. and Proteomyxidea revised.

    Bass, David; Chao, Ema E-Y; Nikolaev, Sergey; Yabuki, Akinori; Ishida, Ken-Ichiro; Berney, Cédric; Pakzad, Ursula; Wylezich, Claudia; Cavalier-Smith, Thomas

    2009-02-01

    Naked filose and reticulose protozoa were long lumped as proteomyxids or left outside higher groups. We cultivated eight naked filose or reticulose strains, did light microscopy, 18S rDNA sequencing and phylogeny (showing all are Cercozoa), and sequenced 80 environmental 18S-types. Filose species belong in subphylum Filosa and reticulose ones in subphylum Endomyxa, making proteomyxids polyphyletic. We therefore transfer the classically mainly reticulose Proteomyxidea to Endomyxa, removing evident filosans as new class Granofilosea (including Desmothoracida, Acinetactis and new heliomonad family Heliomorphidae (new genus Heliomorpha (=Dimorpha)). Five new species of Limnofila gen. n. (L. mylnikovi; L. anglica; L. longa; L. oxoniensis; L. borokensis, previously misidentified as Biomyxa (=Gymnophrys) cometa) form a large freshwater clade (new order Limnofilida). Mesofila limnetica gen., sp. n. and Nanofila marina gen., sp. n. group separately in Granofilosea (Cryptofilida ord. n.). In Endomyxa, a new genus of reticulose proteomyxids (Filoreta marina, F. japonica, F. turcica spp. n., F. (=Corallomyxa) tenera comb. n.) forms a clade (Reticulosida) related to Gromiidea/Ascetosporea. Platyreta germanica gen., sp. n. and Arachnula impatiens are related vampyrellids (Aconchulinida) within a large clade beside Phytomyxea. Biomyxidae and Rhizoplasmidae fam. n. remain incertae sedis within Proteomyxidea. Gymnophrydium and Borkovia are revised. The reticulose Corallomyxa are unlike Filoreta and possibly Amoebozoa, not Cercozoa. PMID:18952499

  3. 18S rDNA sequences from microeukaryotes reveal oil indicators in mangrove sediment.

    Henrique F Santos

    Full Text Available BACKGROUND: Microeukaryotes are an effective indicator of the presence of environmental contaminants. However, the characterisation of these organisms by conventional tools is often inefficient, and recent molecular studies have revealed a great diversity of microeukaryotes. The full extent of this diversity is unknown, and therefore, the distribution, ecological role and responses to anthropogenic effects of microeukaryotes are rather obscure. The majority of oil from oceanic oil spills (e.g., the May 2010 accident in the Gulf of Mexico converges on coastal ecosystems such as mangroves, which are threatened with worldwide disappearance, highlighting the need for efficient tools to indicate the presence of oil in these environments. However, no studies have used molecular methods to assess the effects of oil contamination in mangrove sediment on microeukaryotes as a group. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the population dynamics and the prevailing 18S rDNA phylotypes of microeukaryotes in mangrove sediment microcosms with and without oil contamination, using PCR/DGGE and clone libraries. We found that microeukaryotes are useful for monitoring oil contamination in mangroves. Our clone library analysis revealed a decrease in both diversity and species richness after contamination. The phylogenetic group that showed the greatest sensitivity to oil was the Nematoda. After contamination, a large increase in the abundance of the groups Bacillariophyta (diatoms and Biosoecida was detected. The oil-contaminated samples were almost entirely dominated by organisms related to Bacillariophyta sp. and Cafeteria minima, which indicates that these groups are possible targets for biomonitoring oil in mangroves. The DGGE fingerprints also indicated shifts in microeukaryote profiles; specific band sequencing indicated the appearance of Bacillariophyta sp. only in contaminated samples and Nematoda only in non-contaminated sediment. CONCLUSIONS

  4. Molecular evolution of rDNA in early diverging Metazoa: First comparative analysis and phylogenetic application of complete SSU rRNA secondary structures in Porifera

    Wörheide Gert

    2008-02-01

    Full Text Available Abstract Background The cytoplasmic ribosomal small subunit (SSU, 18S ribosomal RNA (rRNA is the most frequently-used gene for molecular phylogenetic studies. However, information regarding its secondary structure is neglected in most phylogenetic analyses. Incorporation of this information is essential in order to apply specific rRNA evolutionary models to overcome the problem of co-evolution of paired sites, which violates the basic assumption of the independent evolution of sites made by most phylogenetic methods. Information about secondary structure also supports the process of aligning rRNA sequences across taxa. Both aspects have been shown to increase the accuracy of phylogenetic reconstructions within various taxa. Here, we explore SSU rRNA secondary structures from the three extant classes of Phylum Porifera (Grant, 1836, a pivotal, but largely unresolved taxon of early branching Metazoa. This is the first phylogenetic study of poriferan SSU rRNA data to date that includes detailed comparative secondary structure information for all three sponge classes. Results We found base compositional and structural differences in SSU rRNA among Demospongiae, Hexactinellida (glass sponges and Calcarea (calcareous sponges. We showed that analyses of primary rRNA sequences, including secondary structure-specific evolutionary models, in combination with reconstruction of the evolution of unusual structural features, reveal a substantial amount of additional information. Of special note was the finding that the gene tree topologies of marine haplosclerid demosponges, which are inconsistent with the current morphology-based classification, are supported by our reconstructed evolution of secondary structure features. Therefore, these features can provide alternative support for sequence-based topologies and give insights into the evolution of the molecule itself. To encourage and facilitate the application of rRNA models in phylogenetics of early

  5. Molecular evolution of rDNA in early diverging Metazoa: First comparative analysis and phylogenetic application of complete SSU rRNA secondary structures in Porifera

    2008-01-01

    Background The cytoplasmic ribosomal small subunit (SSU, 18S) ribosomal RNA (rRNA) is the most frequently-used gene for molecular phylogenetic studies. However, information regarding its secondary structure is neglected in most phylogenetic analyses. Incorporation of this information is essential in order to apply specific rRNA evolutionary models to overcome the problem of co-evolution of paired sites, which violates the basic assumption of the independent evolution of sites made by most phylogenetic methods. Information about secondary structure also supports the process of aligning rRNA sequences across taxa. Both aspects have been shown to increase the accuracy of phylogenetic reconstructions within various taxa. Here, we explore SSU rRNA secondary structures from the three extant classes of Phylum Porifera (Grant, 1836), a pivotal, but largely unresolved taxon of early branching Metazoa. This is the first phylogenetic study of poriferan SSU rRNA data to date that includes detailed comparative secondary structure information for all three sponge classes. Results We found base compositional and structural differences in SSU rRNA among Demospongiae, Hexactinellida (glass sponges) and Calcarea (calcareous sponges). We showed that analyses of primary rRNA sequences, including secondary structure-specific evolutionary models, in combination with reconstruction of the evolution of unusual structural features, reveal a substantial amount of additional information. Of special note was the finding that the gene tree topologies of marine haplosclerid demosponges, which are inconsistent with the current morphology-based classification, are supported by our reconstructed evolution of secondary structure features. Therefore, these features can provide alternative support for sequence-based topologies and give insights into the evolution of the molecule itself. To encourage and facilitate the application of rRNA models in phylogenetics of early metazoans, we present 52 SSU rRNA

  6. Wide genetic variations at 18S ribosomal RNA locus of Cyclospora cayetanensis isolated from Egyptian patients using high resolution melting curve.

    Hussein, Eman M; El-Moamly, Amal A; Mahmoud, Moushira A; Ateek, Nayera S

    2016-07-01

    A variable clinical picture of cyclosporiasis including gastrointestinal tract (GIT) symptomatic or asymptomatic beside extraintestinal consequences suggests a possibility of heterogenicity of Cyclospora cayetanensis. The present work aimed to explore the possibility of genetic variation of C. cayetanensis using high-resolution melting (HRM) curve of polymerase chain reaction (PCR) amplified 18S rRNA genes. DNAs extracted from the stool samples of 70 cyclosporiasis patients were amplified and scanned by PCR/HRM curve. The results showed that there are four different genotypic profiles of C. cayetanensis with presence of mixed ones. Although Tm of all profiles was within the same range, they were discerned by plotting of the temperature-shifted florescence difference between normalized melting curves (dF/dT). Genotypic profile I was found alone in 40 % of patients and mixed with genotypic profile II and/or III in 25.7 % of patients, followed by genotypic profile II in 14.3 % then genotypic profile III and IV (10 % each). A significant relation was found between genotypic profiles and GIT symptomatic status as profile I and profile II were mostly detected in patients with acute GIT symptoms without or with chronic illness, respectively, while profile IV cases only were GIT asymptomatic. Statistical significance relations between genotypic profiles and age, gender, residence and oocyst shape index were determined. In conclusion, PCR/HRM proved a wide variation on C. cayetanensis genes that could be reflected on its pathogenic effects and explaining the variability of the clinical manifestations presented by cyclosporiasis patients. PMID:27041342

  7. Phylogeny and subgeneric taxonomy of Aspergillus

    Peterson, S.W.; Varga, Janos; Frisvad, Jens Christian; Samson, Robert A.

    The phylogeny of the genus Aspergillus and its teleomorphs is discussed based on multilocus sequence data. DNA sequence analysis was used to formulate a nucleotide sequence framework of the genus and to analyze character changes in relationship to the phylogeny hypothesized from the DNA sequence...... analysis. The sequence data used to delimitate subgeneric taxa included partial calmodulin, rDNA and RNA polymerase gene sequences. In our phylogenic structure of Aspergillus extrolite data of the various Aspergillus taxa collected from ex-type cultures and numerous other isolates are also discussed. A new...... subgeneric classification is proposed which includes 8 subgenera and 22 sections within the Aspergillus genus. Characteristics of these taxa are shortly discussed in this chapter....

  8. Measuring Asymmetry in Time-Stamped Phylogenies.

    Dearlove, Bethany L.; Simon D W Frost

    2015-01-01

    Previous work has shown that asymmetry in viral phylogenies may be indicative of heterogeneity in transmission, for example due to acute HIV infection or the presence of ‘core groups’ with higher contact rates. Hence, evidence of asymmetry may provide clues to underlying population structure, even when direct information on, for example, stage of infection or contact rates, are missing. However, current tests of phylogenetic asymmetry (a) suffer from false positives when the tips of the phylo...

  9. Mammalian phylogeny reveals recent diversification rate shifts

    Stadler, Tanja

    2011-01-01

    Phylogenetic trees of present-day species allow investigation of the rate of evolution that led to the present-day diversity. A recent analysis of the mammalian phylogeny challenged the view of explosive mammalian evolution after the Cretaceous–Tertiary (K/T) boundary (65 Mya). However, due to lack of appropriate methods, the diversification (speciation minus extinction) rates in the more recent past of mammalian evolution could not be determined. In this paper, I provide a method that reveal...

  10. Measuring Asymmetry in Time-Stamped Phylogenies

    Dearlove, Bethany L; Frost, Simon D. W.

    2015-01-01

    Previous work has shown that asymmetry in viral phylogenies may be indicative of heterogeneity in transmission, for example due to acute HIV infection or the presence of ‘core groups’ with higher contact rates. Hence, evidence of asymmetry may provide clues to underlying population structure, even when direct information on, for example, stage of infection or contact rates, are missing. However, current tests of phylogenetic asymmetry (a) suffer from false positives when the tips of the phylo...

  11. Whole genome phylogenies for multiple Drosophila species

    Seetharam Arun

    2012-12-01

    Full Text Available Abstract Background Reconstructing the evolutionary history of organisms using traditional phylogenetic methods may suffer from inaccurate sequence alignment. An alternative approach, particularly effective when whole genome sequences are available, is to employ methods that don’t use explicit sequence alignments. We extend a novel phylogenetic method based on Singular Value Decomposition (SVD to reconstruct the phylogeny of 12 sequenced Drosophila species. SVD analysis provides accurate comparisons for a high fraction of sequences within whole genomes without the prior identification of orthologs or homologous sites. With this method all protein sequences are converted to peptide frequency vectors within a matrix that is decomposed to provide simplified vector representations for each protein of the genome in a reduced dimensional space. These vectors are summed together to provide a vector representation for each species, and the angle between these vectors provides distance measures that are used to construct species trees. Results An unfiltered whole genome analysis (193,622 predicted proteins strongly supports the currently accepted phylogeny for 12 Drosophila species at higher dimensions except for the generally accepted but difficult to discern sister relationship between D. erecta and D. yakuba. Also, in accordance with previous studies, many sequences appear to support alternative phylogenies. In this case, we observed grouping of D. erecta with D. sechellia when approximately 55% to 95% of the proteins were removed using a filter based on projection values or by reducing resolution by using fewer dimensions. Similar results were obtained when just the melanogaster subgroup was analyzed. Conclusions These results indicate that using our novel phylogenetic method, it is possible to consult and interpret all predicted protein sequences within multiple whole genomes to produce accurate phylogenetic estimations of relatedness between

  12. Phylogeny of Eunicida (Annelida) and exploring data congruence using a partition addition bootstrap alteration (PABA) approach.

    Struck, Torsten H; Purschke, Günter; Halanych, Kenneth M

    2006-02-01

    Even though relationships within Annelida are poorly understood, Eunicida is one of only a few major annelid lineages well supported by morphology. The seven recognized eunicid families possess sclerotized jaws that include mandibles and a maxillary apparatus. The maxillary apparatuses vary in shape and number of elements, and three main types are recognized in extant taxa: ctenognath, labidognath, and prionognath. Ctenognath jaws are usually considered to represent the plesiomorphic state of Eunicida, whereas taxa with labidognath and prionognath are thought to form a derived monophyletic assemblage. However, this hypothesis has never been tested in a statistical framework even though it holds considerable importance for understanding annelid phylogeny and possibly lophotrochozoan evolution because Eunicida has the best annelid fossil record. Therefore, we used maximum likelihood and Bayesian inference approaches to reconstruct Eunicida phylogeny using sequence data from nuclear 18S and 28S rDNA genes and mitochondrial 16S rDNA and cytochrome c oxidase subunit I genes. Additionally, we conducted three different tests to investigate suitability of combining data sets. Incongruence length difference (ILD) and Shimodaira-Hasegawa (SH) test comparisons of resultant trees under different data partitions have been widely used previously but do not give a good indication as to which nodes may be causing the conflict. Thus, we developed a partition addition bootstrap alteration (PABA) approach that evaluates congruence or conflict for any given node by determining how bootstrap scores are altered when different data partitions are added. PABA shows the contribution of each partition to the phylogeny obtained in the combined analysis. Generally, the ILD test performed worse than the other approaches in detecting incongruence. Both PABA and the SH approach indicated the 28S and COI data sets add conflicting signal, but PABA is more informative for elucidating which data

  13. Two-gene phylogeny of bright-spored Myxomycetes (slime moulds, superorder Lucisporidia.

    Anna Maria Fiore-Donno

    Full Text Available Myxomycetes, or plasmodial slime-moulds, are one of the largest groups in phylum Amoebozoa. Nonetheless, only ∼10% are in the database for the small subunit (SSU ribosomal RNA gene, the most widely used gene for phylogenetics and barcoding. Most sequences belong to dark-spored Myxomycetes (order Fuscisporida; the 318 species of superorder Lucisporidia (bright-spored are represented by only eleven genuine sequences. To compensate for this, we provide 66 new sequences, 37 SSU rRNA and 29 elongation factor 1-alpha (EF-1α, for 82% of the genera of Lucisporidia. Phylogenetic analyses of single- and two-gene alignments produce congruent topologies and reveal both morphological characters that have been overemphasised and those that have been overlooked in past classifications. Both classical orders, Liceida and Trichiida, and several families and genera are para/polyphyletic; some previously unrecognised clades emerge. We discuss possible evolutionary pathways. Our study fills a gap in the phylogeny of Amoebozoa and provides an extensive SSU rRNA sequence reference database for environmental sampling and barcoding. We report a new group I intron insertion site for Myxomycetes in one Licea.

  14. Phylogeny of the Neotropical killifish family Rivulidae (Cyprinodontiformes, Aplocheiloidei) inferred from mitochondrial DNA sequences.

    Murphy, W J; Thomerson, J E; Collier, G E

    1999-11-01

    Phylogenetic relationships of 70 taxa representing 68 species of the Neotropical killifish family Rivulidae were derived from analysis of 1516 nucleotides sampled from four different segments of the mitochondrial genome: 12S rRNA, 16S rRNA, cytochrome oxidase I, and cytochrome b. The basal bifurcation of Cynolebiatinae and Rivulinae (Costa, 1990a,b) is supported; however, Terranatos, Maratecoara, and Plesiolebias are rivulins, not cynolebiatins. These three genera, along with the other recognized annual rivulin genera, form a monophyletic clade. Austrofundulus, Rachovia, Renova, Terranatos, and 3 species of the genus Pterolebias, all from northeastern South America, form a monophyletic clade excluding other species of Pterolebias. Pterolebias as presently understood is clearly polyphyletic. Trigonectes and Moema are supported as sister groups but do not form a monophyletic group with the genera Neofundulus and Renova as previously proposed. The suite of adaptations necessary for an annual life history has clearly been lost several times in the course of rivulid evolution. Also revealed is a considerable increase in substitution rate in most annual lineages relative to the nonannual Rivulus species. The widespread and speciose genus Rivulus is paraphyletic, representing both basal and terminal clades within the Rivulidae. Previous hypotheses regarding the vicariant origin of Greater Antillean Rivulus species are supported. Most rivulid clades show considerable endemism; thus, detailed analysis of rivulid phylogeny and distribution will contribute robust hypotheses to the clarification of Neotropical biogeography. PMID:10603257

  15. 16S/18S ribosomal DNA clone library analysis of rumen microbial diversity

    The rumen contains a complex ecosystem where billions of bacteria, archaea, protozoa and fungi reside. This diverse microbiota is well adapted to live in the rumen and play an important role in the digestion of feed and nutrient supply to the host in the form of microbial protein and volatile fatty acids. It is estimated that the rumen microbial population consists of about 106 protozoa/ml, 103-107 fungi/ml, 1010 bacteria/ml, and 109 methanogens/ml. To better understand the complex relationships in the rumen, it is necessary to gain an insight into the diversity of the rumen microbes and how the quantity and composition of rumen micro-organisms are altered by a number of different host factors such as age, genetics and diet. In the past, the diversity of micro-organisms from the digestive tracts of domesticated ruminants has been identified by classical microbiological techniques. However, given the fastidious growth requirements of rumen micro-organisms, it is reasonable to concede that the culture-dependent methods may select against some species, or taxonomic groups, leading researchers to underestimate the microbial diversity that is actually present in the rumen. In fact, it has been speculated that 90% of micro-organisms in nature have escaped traditional cultivation methods. Therefore, a major challenge in microbial ecology has been to assess the diversity and structure of natural microbial communities. The field of molecular biology has advanced with many innovative technological breakthroughs. The ability to extract and to isolate high-molecular weight DNA from rumen digesta, PCR amplify genes from specific microbial groups and obtain gene sequence data is now a routine event. The small subunit ribosomal RNA (SSU-rRNA) gene, called 16S in prokaryotes and 18S in eukaryotes, is the most widely used molecular marker to presumptively identify morphologically indistinguishable species, to infer their phylogenetic relationships, and to elucidate microbial

  16. Phylogenetic relationships of Salmonella based on rRNA sequences

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    To establish the phylogenetic relationships between the subspecies of Salmonella enterica (official name Salmonella choleraesuis), Salmonella bongori and related members of Enterobacteriaceae, sequence comparison of rRNA was performed by maximum-likelihood analysis. The two Salmonella species were...

  17. Re-appraisal of the phylogeny and fluorescence in situ hybridization probes for the analysis of the Competibacteraceae in wastewater treatment systems

    McIlroy, Simon Jon; Nittami, Tadashi; Kanai, Eri;

    2015-01-01

    Members of the family Competibacteraceae are common in wastewater treatment plants (WWTP) designed for enhanced biological phosphorus removal (EBPR) and are putatively deleterious to the process of P removal. Their ability to accumulate large amounts of polyhydroxyalkanoates is also suggested to be...... of potential commercial interest for bioplastic production. In this study we have updated the 16S rRNA based phylogeny of the Competibacter- and the Plasticicumulans-lineages. The former is delineated by 13 clades including 2 described genera; “Ca. Competibacter” and “Ca. Contendobacter”. The...

  18. Molecular phylogeny of intracellular symbiotic Gammaproteobacteria in insects

    HUSNÍK, Filip

    2010-01-01

    Many groups of insects harbor mutualistic intracellular bacteria. These bacteria originated mainly from two bacterial phyla: Bacteroidetes and Proteobacteria. The thesis is focused on phylogeny of Enterobacteriaceae - the most diverse group of endosymbiotic bacteria within Gammaproteobacteria. The study brings new phylogenetical data on "primary" symbionts and summarizes the current state of knowledge on their phylogeny, evolution and diversity.

  19. Chromosomal phylogeny and evolution of gibbons (Hylobatidae).

    Müller, Stefan; Hollatz, Melanie; Wienberg, Johannes

    2003-11-01

    Although human and gibbons are classified in the same primate superfamily (Hominoidae), their karyotypes differ by extensive chromosome reshuffling. To date, there is still limited understanding of the events that shaped extant gibbon karyotypes. Further, the phylogeny and evolution of the twelve or more extant gibbon species (lesser apes, Hylobatidae) is poorly understood, and conflicting phylogenies have been published. We present a comprehensive analysis of gibbon chromosome rearrangements and a phylogenetic reconstruction of the four recognized subgenera based on molecular cytogenetics data. We have used two different approaches to interpret our data: (1) a cladistic reconstruction based on the identification of ancestral versus derived chromosome forms observed in extant gibbon species; (2) an approach in which adjacent homologous segments that have been changed by translocations and intra-chromosomal rearrangements are treated as discrete characters in a parsimony analysis (PAUP). The orangutan serves as an "outgroup", since it has a karyotype that is supposed to be most similar to the ancestral form of all humans and apes. Both approaches place the subgenus Bunopithecus as the most basal group of the Hylobatidae, followed by Hylobates, with Symphalangus and Nomascus as the last to diverge. Since most chromosome rearrangements observed in gibbons are either ancestral to all four subgenera or specific for individual species and only a few common derived rearrangements at subsequent branching points have been recorded, all extant gibbons may have diverged within relatively short evolutionary time. In general, chromosomal rearrangements produce changes that should be considered as unique landmarks at the divergence nodes. Thus, molecular cytogenetics could be an important tool to elucidate phylogenies in other species in which speciation may have occurred over very short evolutionary time with not enough genetic (DNA sequence) and other biological divergence to

  20. A supertree approach to shorebird phylogeny

    Thomas Gavin H

    2004-08-01

    Full Text Available Abstract Background Order Charadriiformes (shorebirds is an ideal model group in which to study a wide range of behavioural, ecological and macroevolutionary processes across species. However, comparative studies depend on phylogeny to control for the effects of shared evolutionary history. Although numerous hypotheses have been presented for subsets of the Charadriiformes none to date include all recognised species. Here we use the matrix representation with parsimony method to produce the first fully inclusive supertree of Charadriiformes. We also provide preliminary estimates of ages for all nodes in the tree. Results Three main lineages are revealed: i the plovers and allies; ii the gulls and allies; and iii the sandpipers and allies. The relative position of these clades is unresolved in the strict consensus tree but a 50% majority-rule consensus tree indicates that the sandpiper clade is sister group to the gulls and allies whilst the plover group is placed at the base of the tree. The overall topology is highly consistent with recent molecular hypotheses of shorebird phylogeny. Conclusion The supertree hypothesis presented herein is (to our knowledge the only complete phylogenetic hypothesis of all extant shorebirds. Despite concerns over the robustness of supertrees (see Discussion, we believe that it provides a valuable framework for testing numerous evolutionary hypotheses relating to the diversity of behaviour, ecology and life-history of the Charadriiformes.

  1. An expanded phylogeny of social amoebas (Dictyostelia shows increasing diversity and new morphological patterns

    Stephenson Steven L

    2011-03-01

    Full Text Available Abstract Background Social Amoebae or Dictyostelia are eukaryotic microbes with a unique life cycle consisting of both uni- and multicellular stages. They have long fascinated molecular, developmental and evolutionary biologists, and Dictyostelium discoideum is now one of the most widely studied eukaryotic microbial models. The first molecular phylogeny of Dictyostelia included most of the species known at the time and suggested an extremely deep taxon with a molecular depth roughly equivalent to Metazoa. The group was also shown to consist of four major clades, none of which correspond to traditional genera. Potential morphological justification was identified for three of the four major groups, on the basis of which tentative names were assigned. Results Over the past four years, the Mycetozoan Global Biodiversity Survey has identified many new isolates that appear to be new species of Dictyostelia, along with numerous isolates of previously described species. We have determined 18S ribosomal RNA gene sequences for all of these new isolates. Phylogenetic analyses of these data show at least 50 new species, and these arise from throughout the dictyostelid tree breaking up many previously isolated long branches. The resulting tree now shows eight well-supported major groups instead of the original four. The new species also expand the known morphological diversity of the previously established four major groups, violating nearly all previously suggested deep morphological patterns. Conclusions A greatly expanded phylogeny of Dictyostelia now shows even greater morphological plasticity at deep taxonomic levels. In fact, there now seem to be no obvious deep evolutionary trends across the group. However at a finer level, patterns in morphological character evolution are beginning to emerge. These results also suggest that there is a far greater diversity of Dictyostelia yet to be discovered, including novel morphologies.

  2. Persistent Phylogeny: A Galled-Tree and Integer Linear Programming Approach

    Gusfield, Dan

    2015-01-01

    The Persistent-Phylogeny Model is an extension of the widely studied Perfect-Phylogeny Model, encompassing a broader range of evolutionary phenomena. Biological and algorithmic questions concerning persistent phylogeny have been intensely investigated in recent years. In this paper, we explore two alternative approaches to the persistent-phylogeny problem that grow out of our previous work on perfect phylogeny, and on galled trees. We develop an integer programming solution to the Persistent-...

  3. A comprehensive molecular phylogeny of dalytyphloplanida (platyhelminthes: rhabdocoela reveals multiple escapes from the marine environment and origins of symbiotic relationships.

    Niels Van Steenkiste

    Full Text Available In this study we elaborate the phylogeny of Dalytyphloplanida based on complete 18S rDNA (156 sequences and partial 28S rDNA (125 sequences, using a Maximum Likelihood and a Bayesian Inference approach, in order to investigate the origin of a limnic or limnoterrestrial and of a symbiotic lifestyle in this large group of rhabditophoran flatworms. The results of our phylogenetic analyses and ancestral state reconstructions indicate that dalytyphloplanids have their origin in the marine environment and that there was one highly successful invasion of the freshwater environment, leading to a large radiation of limnic and limnoterrestrial dalytyphloplanids. This monophyletic freshwater clade, Limnotyphloplanida, comprises the taxa Dalyelliidae, Temnocephalida, and most Typhloplanidae. Temnocephalida can be considered ectosymbiotic Dalyelliidae as they are embedded within this group. Secondary returns to brackish water and marine environments occurred relatively frequently in several dalyeliid and typhloplanid taxa. Our phylogenies also show that, apart from the Limnotyphloplanida, there have been only few independent invasions of the limnic environment, and apparently these were not followed by spectacular speciation events. The distinct phylogenetic positions of the symbiotic taxa also suggest multiple origins of commensal and parasitic life strategies within Dalytyphloplanida. The previously established higher-level dalytyphloplanid clades are confirmed in our topologies, but many of the traditional families are not monophyletic. Alternative hypothesis testing constraining the monophyly of these families in the topologies and using the approximately unbiased test, also statistically rejects their monophyly.

  4. Genome-level homology and phylogeny of Shewanella (Gammaproteobacteria: lteromonadales: Shewanellaceae

    Dikow Rebecca B

    2011-05-01

    Full Text Available Abstract Background The explosion in availability of whole genome data provides the opportunity to build phylogenetic hypotheses based on these data as well as the ability to learn more about the genomes themselves. The biological history of genes and genomes can be investigated based on the taxomonic history provided by the phylogeny. A phylogenetic hypothesis based on complete genome data is presented for the genus Shewanella (Gammaproteobacteria: Alteromonadales: Shewanellaceae. Nineteen taxa from Shewanella (16 species and 3 additional strains of one species as well as three outgroup species representing the genera Aeromonas (Gammaproteobacteria: Aeromonadales: Aeromonadaceae, Alteromonas (Gammaproteobacteria: Alteromonadales: Alteromonadaceae and Colwellia (Gammaproteobacteria: Alteromonadales: Colwelliaceae are included for a total of 22 taxa. Results Putatively homologous regions were found across unannotated genomes and tested with a phylogenetic analysis. Two genome-wide data-sets are considered, one including only those genomic regions for which all taxa are represented, which included 3,361,015 aligned nucleotide base-pairs (bp and a second that additionally includes those regions present in only subsets of taxa, which totaled 12,456,624 aligned bp. Alignment columns in these large data-sets were then randomly sampled to create smaller data-sets. After the phylogenetic hypothesis was generated, genome annotations were projected onto the DNA sequence alignment to compare the historical hypothesis generated by the phylogeny with the functional hypothesis posited by annotation. Conclusions Individual phylogenetic analyses of the 243 locally co-linear genome regions all failed to recover the genome topology, but the smaller data-sets that were random samplings of the large concatenated alignments all produced the genome topology. It is shown that there is not a single orthologous copy of 16S rRNA across the taxon sampling included in this

  5. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA in the fish Prochilodus lineatus (Characiformes, Prochilodontidae)

    Marcelo Ricardo Vicari; Mara Cristina de Almeida; Luiz Antonio Carlos Bertollo; Orlando Moreira-Filho; Roberto Ferreira Artoni

    2006-01-01

    We used differential staining techniques (BSG, GTG, AgNO3, DAPI and CMA3 banding) and fluorescent in situ hybridization (FISH) with 5S and 18S probes to investigated the karyotypic and cytogenetic chracteristics of Prochilodus lineatus specimens from a population in Vila Velha state park (Parque Estadual de Vila Velha, Ponta Grossa, Paraná state, southern Brazil). The specimens studied showed the same karyotype as that found in other P. lineatus populations, i.e. 2n = 54 biarmed chromosomes (...

  6. Partitional Classification: A Complement to Phylogeny

    Salomon, Marc; Dassy, Bruno

    2016-01-01

    The tree of life is currently an active object of research, though next to vertical gene transmission non vertical gene transfers proved to play a significant role in the evolutionary process. To overcome this difficulty, trees of life are now constructed from genes hypothesized vital, on the assumption that these are all transmitted vertically. This view has been challenged. As a frame for this discussion, we developed a partitional taxonomical system clustering taxa at a high taxonomical rank. Our analysis (1) selects RNase P RNA sequences of bacterial, archaeal, and eucaryal genera from genetic databases, (2) submits the sequences, aligned, to k-medoid analysis to obtain clusters, (3) establishes the correspondence between clusters and taxa, (4) constructs from the taxa a new type of taxon, the genetic community (GC), and (5) classifies the GCs: Archaea–Eukaryotes contrastingly different from the six others, all bacterial. The GCs would be the broadest frame to carry out the phylogenies. PMID:27346943

  7. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  8. Phylogeny and Species Diversity of Gulf of California Oysters

    U.S. Environmental Protection Agency — Dataset of DNA sequence data from two mitochondrial loci (COI and 16S) used to infer the phylogeny of oysters in the genus Ostrea along the Pacific coast of North...

  9. A MOLECULAR PHYLOGENY FOR THE PROTOSTRONGYLIDAE (NEMATODA: METASTRONGYLINA)

    Protostrongylids, a putative monophyletic group among the lungworms (Metastrongylina: Metastrongyloidea), are economically important pathogens infecting domestic and free-ranging ungulate and leporid hosts throughout the world. Here, we reconstruct a molecular phylogeny based on ribosomal DNA (28S) ...

  10. Phylogeny And Biogeography of the Carnivorous Plant Family Sarraceniaceae

    Davis, Charles Cavender; Ellison, Aaron M.; Butler, Elena D.; Hicks, Emily Jean; Calie, Patrick J.; Bell, Charles D.; Naczi, Robert F. C.

    2012-01-01

    The carnivorous plant family Sarraceniaceae comprises three genera of wetland-inhabiting pitcher plants: Darlingtonia in the northwestern United States, Sarracenia in eastern North America, and Heliamphora in northern South America. Hypotheses concerning the biogeographic history leading to this unusual disjunct distribution are controversial, in part because genus- and species-level phylogenies have not been clearly resolved. Here, we present a robust, species-rich phylogeny of Sarraceniacea...

  11. Phylogeny reconstruction based on protein phylogenetic profiles of organisms

    2003-01-01

    With the coming of the Post Genomic Era, more and more genomes have been sequenced and it has become possible to study phylogeny reconstruction at genome level. The concept of protein phylogenetic profiles of organisms is defined in this work which is used in phylogeny reconstruction by proteome comparisons. This method is more stable than the prevailing molecular systematics methods and can be used widely. It will develop very fast with the rapid progress in genome sequencing.

  12. Genetic diversity of Cryptosporidium in fish at the 18S and actin loci and high levels of mixed infections.

    Yang, Rongchang; Palermo, Cindy; Chen, Linda; Edwards, Amanda; Paparini, Andrea; Tong, Kaising; Gibson-Kueh, Susan; Lymbery, Alan; Ryan, Una

    2015-12-15

    Cryptosporidium is an enteric parasite that infects humans and a wide range of animals. Relatively little is known about the epidemiology and taxonomy of Cryptosporidium in fish. In the present study, a total of 775 fish, belonging to 46 species and comprising ornamental fish, marine fish and freshwater fish were screened for the prevalence of Cryptosporidium by PCR. The overall prevalence of Cryptosporidium in fish was 5.3% (41/775), with prevalences ranging from 1.5 to 100% within individual host species. Phylogenetic analysis of these Cryptosporidium isolates as well as 14 isolates from previous studies indicated extensive genetic diversity as well as evidence for mixed infections. At the 18S locus the following species were identified; Cryptosporidium molnari-like genotype (n=14), Cryptosporidium huwi (n=8), piscine genotype 2 (n=4), piscine genotype 3-like (n=1), piscine genotype 4 (n=2), piscine genotype 5 (n=13), piscine genotype 5-like (n=1) and five novel genotypes (n=5). At the actin locus, species identification agreed with the 18S locus for only 52.3% of isolates sequenced, indicating high levels of mixed infections. Future studies will need to employ both morphological characterization and deep sequencing amplicon-based technologies to better understand the epidemiological and phylogenetic relationships of piscine-derived Cryptosporidium species and genotypes, particularly when mixed infections are detected. PMID:26527238

  13. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae

    Victor Manuel Gomez-Rodriguez

    2013-08-01

    Full Text Available Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in A. tequilana Weber, 1902 ‘Azul’, A. cupreata Trelease et Berger, 1915 and A. angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH was used for physical mapping of 5S and 18S ribosomal DNA (rDNA. All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  14. Identification of cephalopod species from the North and Baltic Seas using morphology, COI and 18S rDNA sequences

    Gebhardt, Katharina; Knebelsberger, Thomas

    2015-09-01

    We morphologically analyzed 79 cephalopod specimens from the North and Baltic Seas belonging to 13 separate species. Another 29 specimens showed morphological features of either Alloteuthis mediaor Alloteuthis subulata or were found to be in between. Reliable identification features to distinguish between A. media and A. subulata are currently not available. The analysis of the DNA barcoding region of the COI gene revealed intraspecific distances (uncorrected p) ranging from 0 to 2.13 % (average 0.1 %) and interspecific distances between 3.31 and 22 % (average 15.52 %). All species formed monophyletic clusters in a neighbor-joining analysis and were supported by bootstrap values of ≥99 %. All COI haplotypes belonging to the 29 Alloteuthis specimens were grouped in one cluster. Neither COI nor 18S rDNA sequences helped to distinguish between the different Alloteuthis morphotypes. For species identification purposes, we recommend the use of COI, as it showed higher bootstrap support of species clusters and less amplification and sequencing failure compared to 18S. Our data strongly support the assumption that the genus Alloteuthis is only represented by a single species, at least in the North Sea. It remained unclear whether this species is A. subulata or A. media. All COI sequences including important metadata were uploaded to the Barcode of Life Data Systems and can be used as reference library for the molecular identification of more than 50 % of the cephalopod fauna known from the North and Baltic Seas.

  15. A new phylogeny of the Cephalaspidea (Gastropoda: Heterobranchia) based on expanded taxon sampling and gene markers.

    Oskars, Trond R; Bouchet, Philippe; Malaquias, Manuel António E

    2015-08-01

    The Cephalaspidea is a diverse marine clade of euthyneuran gastropods with many groups still known largely from shells or scant anatomical data. The definition of the group and the relationships between members has been hampered by the difficulty of establishing sound synapomorphies, but the advent of molecular phylogenetics is helping to change significantly this situation. Yet, because of limited taxon sampling and few genetic markers employed in previous studies, many questions about the sister relationships and monophyletic status of several families remained open. In this study 109 species of Cephalaspidea were included covering 100% of traditional family-level diversity (12 families) and 50% of all genera (33 genera). Bayesian and maximum likelihood phylogenetics analyses based on two mitochondrial (COI, 16S rRNA) and two nuclear gene markers (28S rRNA and Histone-3) were used to infer the relationships of Cephalaspidea. The monophyly of the Cephalaspidea was confirmed. The families Cylichnidae, Diaphanidae, Haminoeidae, Philinidae, and Retusidae were found non-monophyletic. This result suggests that the family level taxonomy of the Cephalaspidea warrants a profound revision and several new family and genus names are required to reflect the new phylogenetic hypothesis presented here. We propose a new classification of the Cephalaspidea including five new families (Alacuppidae, Colinatydidae, Colpodaspididae, Mnestiidae, Philinorbidae) and one new genus (Alacuppa). Two family names (Acteocinidae, Laonidae) and two genera (Laona, Philinorbis) are reinstated as valid. An additional lineage with family rank (Philinidae "Clade 4") was unravelled, but no genus and species names are available to reflect the phylogeny and formal description will take place elsewhere. PMID:25916189

  16. Phylogeny of minute carabid beetles and their relatives based upon DNA sequence data (Coleoptera, Carabidae, Trechitae

    David Maddison

    2011-11-01

    Full Text Available The phylogeny of ground beetles of supertribe Trechitae is inferred using DNA sequences of genes that code for 28S ribosomal RNA, 18S ribosomal RNA, and wingless. Within the outgroups, austral psydrines are inferred to be monophyletic, and separate from the three genera of true Psydrina (Psydrus, Nomius, Laccocenus; the austral psydrines are formally removed from Psydrini and are treated herein as their own tribe, Moriomorphini Sloane. All three genes place Gehringia with Psydrina. Trechitae is inferred to be monophyletic, and sister to Patrobini.Within trechites, evidence is presented that Tasmanitachoides is not a tachyine, but is instead a member of Trechini. Perileptus is a member of subtribe Trechodina. Against Erwin’s hypothesis of anillines as a polyphyletic lineage derived from the tachyine genus Paratachys, the anillines sampled are monophyletic, and not related to Paratachys. Zolini, Pogonini, Tachyina, and Xystosomina are all monophyletic, with the latter two being sister groups. The relationships of the subtribe Bembidiina were studied in greater detail. Phrypeus is only distantly related to Bembidion, and there is no evidence from sequence data that it belongs within Bembidiina. Three groups that have been recently considered to be outside of the large genus Bembidion are shown to be derived members of Bembidion, related to subgroups: Cillenus is related to the Ocydromus complex of Bembidion, Zecillenus is related to the New Zealand subgenus Zeplataphus, and Hydrium is close to subgenus Metallina. The relationships among major lineages of Trechitae are not, however, resolved with these data.

  17. Phylogeny of the quadriflagellate Volvocales (Chlorophyceae) based on chloroplast multigene sequences.

    Nozaki, Hisayoshi; Misumi, Osami; Kuroiwa, Tsuneyoshi

    2003-10-01

    Since the phylogenetic relationships of the green plants (green algae and land plants) have been extensively studied using 18S ribosomal RNA sequences, change in the arrangement of basal bodies in flagellate cells is considered to be one of the major evolutionary events in the green plants. However, the phylogenetic relationships between biflagellate and quadriflagellate species within the Volvocales remain uncertain. This study examined the phylogeny of three genera of quadriflagellate Volvocales (Carteria, Pseudocarteria, and Hafniomonas) using concatenated sequences from three chloroplast genes. Using these multigene sequences, all three quadriflagellate genera were basal to other members (biflagellates) of the CW (clockwise) group (the Volvocales and their relatives, the Chlorophyceae) and formed three robust clades. Since the flagellar apparatuses of these three quadriflagellate lineages are diverse, including counter clockwise (CCW) and CW orientation of the basal bodies, the CW orientation of the basal bodies might have evolved from the CCW orientation in the ancestral quadriflagellate volvocalean algae, giving rise to the biflagellates, major members of the CW group. PMID:12967607

  18. Molecular analysis of the rRNA genes of Babesia spp and Ehrlichia canis detected in dogs from Ribeirão Preto, Brazil Análise dos genes rRNA de Babesia spp e Ehrlichia canis detectados em cães de Ribeirão Preto, Brasil

    L.P. Oliveira

    2009-06-01

    Full Text Available The partial DNA sequences of the 18S rRNA gene of Babesia canis and the 16S rRNA gene of Ehrlichia canis detected in dogs from Ribeirão Preto, Brazil, were compared to sequences from other strains deposited in GenBank. The E. canis strain circulating in Ribeirão Preto is identical to other strains previously detected in the region, whereas the subspecies Babesia canis vogeli is the main Babesia strain circulating in dogs from Ribeirão Preto.As sequências parciais dos genes RNAr 18S de Babesia canis e RNAr 16S e Ehrlichiacanis detectados em cães de Ribeirão Preto, Brasil, foram comparadas à sequências de outras linhagens depositadas no GeneBank. A linhagem de E. canis circulando em Ribeirão Preto é idêntica a outras detectadas previamente na região, enquanto a sub-espécie B. canis vogeli é a principal linhagem de Babesia circulando em cães de Ribeirão Preto.

  19. Ribbon worm relationships: a phylogeny of the phylum Nemertea.

    Thollesson, Mikael; Norenburg, Jon L

    2003-01-01

    We present the most extensive phylogenetic analysis to date, to our knowledge, of higher-level nemertean relationships, based on sequence data from four different genes (the nuclear genes for nuclear large subunit rRNA (28S rRNA) and histone H3 (H3), and the mitochondrial genes for mitochondrial large subunit rRNA (16S rRNA) and cytochrome c oxidase subunit I (COI)). Well-supported clades are, in general, compatible with earlier, more limited, analyses, and current classification is largely i...

  20. Bootstrapping phylogenies inferred from rearrangement data

    Lin Yu

    2012-08-01

    Full Text Available Abstract Background Large-scale sequencing of genomes has enabled the inference of phylogenies based on the evolution of genomic architecture, under such events as rearrangements, duplications, and losses. Many evolutionary models and associated algorithms have been designed over the last few years and have found use in comparative genomics and phylogenetic inference. However, the assessment of phylogenies built from such data has not been properly addressed to date. The standard method used in sequence-based phylogenetic inference is the bootstrap, but it relies on a large number of homologous characters that can be resampled; yet in the case of rearrangements, the entire genome is a single character. Alternatives such as the jackknife suffer from the same problem, while likelihood tests cannot be applied in the absence of well established probabilistic models. Results We present a new approach to the assessment of distance-based phylogenetic inference from whole-genome data; our approach combines features of the jackknife and the bootstrap and remains nonparametric. For each feature of our method, we give an equivalent feature in the sequence-based framework; we also present the results of extensive experimental testing, in both sequence-based and genome-based frameworks. Through the feature-by-feature comparison and the experimental results, we show that our bootstrapping approach is on par with the classic phylogenetic bootstrap used in sequence-based reconstruction, and we establish the clear superiority of the classic bootstrap for sequence data and of our corresponding new approach for rearrangement data over proposed variants. Finally, we test our approach on a small dataset of mammalian genomes, verifying that the support values match current thinking about the respective branches. Conclusions Our method is the first to provide a standard of assessment to match that of the classic phylogenetic bootstrap for aligned sequences. Its

  1. A nesting of vipers: Phylogeny and historical biogeography of the Viperidae (Squamata: Serpentes).

    Wüster, Wolfgang; Peppin, Lindsay; Pook, Catharine E; Walker, Daniel E

    2008-11-01

    Despite their medical interest, the phylogeny of the snake family Viperidae remains inadequately understood. Previous studies have generally focused either on the pitvipers (Crotalinae) or on the Old World vipers (Viperinae), but there has been no comprehensive molecular study of the Viperidae as a whole, leaving the affinities of key taxa unresolved. Here, we infer the phylogenetic relationships among the extant genera of the Viperidae from the sequences of four mitochondrial genes (cytochrome b, NADH subunit 4, 16S and 12S rRNA). The results confirm Azemiops as the sister group of the Crotalinae, whereas Causus is nested within the Viperinae, and thus not a basal viperid or viperine. Relationships among the major clades of Viperinae remain poorly resolved despite increased sequence information compared to previous studies. Bayesian molecular dating in conjunction with dispersal-vicariance analysis suggests an early Tertiary origin in Asia for the crown group Viperidae, and rejects suggestions of a relatively recent, early to mid-Tertiary origin of the Caenophidia. PMID:18804544

  2. Phylogeny and dating of divergences within the genus Thymallus (Salmonidae: Thymallinae) using complete mitochondrial genomes.

    Ma, Bo; Jiang, Haiying; Sun, Peng; Chen, Jinping; Li, Linmiao; Zhang, Xiujuan; Yuan, Lihong

    2016-09-01

    The genus Thymallus has attracted increasing attention in recent years because of its sharp demographic decline. In this study, we reported four complete mitochondrial genomes in the Thymallus genus: Baikal-Lena grayling (T. arcticus baicalolenensis), lower Amur grayling (T. tugarinae), Yalu grayling (T. a. yaluensis), and Mongolian grayling (T. brevirostris). The total length of the four new grayling mtDNAs ranged from 16 658 to 16 663 bp, all of which contained 13 protein-coding genes, 22 tRNA genes, two rRNA genes, and one control region. The results suggested that mitochondrial genomes could be a powerful marker for resolving the phylogeny within Thymallinae. Our study validated that the Yalu grayling should be a synonym of the Amur grayling (T. grubii) at the whole mitogenome level. The phylogenetic and dating analyses placed the Amur grayling at the deepest divergence node within Thymallus, diverging at ∼14.95 Ma. The lower Amur grayling diverged at the next deepest node (∼12.14 Ma). This was followed by T. thymallus, which diverged at ∼9.27 Ma. The Mongolian grayling and the ancestor of the sister species, T. arcticus and T. arcticus baicalolenensis, diverged at ∼7.79 Ma, with T. arcticus and T. arcticus baicalolenensis separating at ∼6.64 Ma. Our study provides far better resolution of the phylogenetic relationships and divergence dates of graylings than previous studies. PMID:26329113

  3. Molecular phylogeny of western Atlantic Farfantepenaeus and Litopenaeus shrimp based on mitochondrial 16S partial sequences.

    Maggioni, R; Rogers, A D; Maclean, N; D'Incao, F

    2001-01-01

    Partial sequences for the 16S rRNA mitochondrial gene were obtained from 10 penaeid shrimp species: Farfantepenaeus paulensis, F. brasiliensis, F. subtilis, F. duorarum, F. aztecus, Litopenaeus schmitti, L. setiferus, and Xiphopenaeus kroyeri from the western Atlantic and L. vannamei and L. stylirostris from the eastern Pacific. Sequences were also obtained from an undescribed morphotype of pink shrimp (morphotype II) usually identified as F. subtilis. The phylogeny resulting from the 16S partial sequences showed that these species form two well-supported monophyletic clades consistent with the two genera proposed in a recent systematic review of the suborder Dendrobranchiata. This contrasted with conclusions drawn from recent molecular phylogenetic work on penaeid shrimps based on partial sequences of the mitochondrial COI region that failed to support recent revisions of the Dendrobranchiata based on morphological analysis. Consistent differences observed in the sequences for morphotype II, coupled with previous allozyme data, support the conclusion that this is a previously undescribed species of Farfantepenaeus. PMID:11161743

  4. Insect gut bacterial diversity determined by environmental habitat, diet, developmental stage, and phylogeny of host.

    Yun, Ji-Hyun; Roh, Seong Woon; Whon, Tae Woong; Jung, Mi-Ja; Kim, Min-Soo; Park, Doo-Sang; Yoon, Changmann; Nam, Young-Do; Kim, Yun-Ji; Choi, Jung-Hye; Kim, Joon-Yong; Shin, Na-Ri; Kim, Sung-Hee; Lee, Won-Jae; Bae, Jin-Woo

    2014-09-01

    Insects are the most abundant animals on Earth, and the microbiota within their guts play important roles by engaging in beneficial and pathological interactions with these hosts. In this study, we comprehensively characterized insect-associated gut bacteria of 305 individuals belonging to 218 species in 21 taxonomic orders, using 454 pyrosequencing of 16S rRNA genes. In total, 174,374 sequence reads were obtained, identifying 9,301 bacterial operational taxonomic units (OTUs) at the 3% distance level from all samples, with an average of 84.3 (± 97.7) OTUs per sample. The insect gut microbiota were dominated by Proteobacteria (62.1% of the total reads, including 14.1% Wolbachia sequences) and Firmicutes (20.7%). Significant differences were found in the relative abundances of anaerobes in insects and were classified according to the criteria of host environmental habitat, diet, developmental stage, and phylogeny. Gut bacterial diversity was significantly higher in omnivorous insects than in stenophagous (carnivorous and herbivorous) insects. This insect-order-spanning investigation of the gut microbiota provides insights into the relationships between insects and their gut bacterial communities. PMID:24928884

  5. Short communication: Genetic variants of Sarcocystis cruzi in infected Malaysian cattle based on 18S rDNA.

    Ng, Yit Han; Fong, Mun Yik; Subramaniam, Vellayan; Shahari, Shahhaziq; Lau, Yee Ling

    2015-12-01

    Sarcocystis species are pathogenic parasites that infect a wide range of animals, including cattle. A high prevalence of cattle sarcocystosis has been reported worldwide, but its status is unknown in Malaysia. This study focused on utilizing 18S rDNA to identify Sarcocystis species in Malaysian cattle and to determine their genetic variants. In this study, only Sarcocystis cruzi was detected in Malaysian cattle. The intra-species S. cruzi phylogenetic tree analysis and principal coordinate analysis (PCoA), respectively displayed two minor groups among the parasite isolates. This finding was supported by high Wright FST value (FST=0.647). The definitive hosts (dogs) may play a fundamental role in the development of S. cruzi genetic variants. Additionally, the existence of microheterogeneity within the S. cruzi merozoites and/or distinct genetic variants arisen from independent merozoites in mature sarcocysts, possibly contributed to the existence of intra-species variations within the population. PMID:26679818

  6. Phylogeny based discovery of regulatory elements

    Cohen Barak A

    2006-05-01

    Full Text Available Abstract Background Algorithms that locate evolutionarily conserved sequences have become powerful tools for finding functional DNA elements, including transcription factor binding sites; however, most methods do not take advantage of an explicit model for the constrained evolution of functional DNA sequences. Results We developed a probabilistic framework that combines an HKY85 model, which assigns probabilities to different base substitutions between species, and weight matrix models of transcription factor binding sites, which describe the probabilities of observing particular nucleotides at specific positions in the binding site. The method incorporates the phylogenies of the species under consideration and takes into account the position specific variation of transcription factor binding sites. Using our framework we assessed the suitability of alignments of genomic sequences from commonly used species as substrates for comparative genomic approaches to regulatory motif finding. We then applied this technique to Saccharomyces cerevisiae and related species by examining all possible six base pair DNA sequences (hexamers and identifying sequences that are conserved in a significant number of promoters. By combining similar conserved hexamers we reconstructed known cis-regulatory motifs and made predictions of previously unidentified motifs. We tested one prediction experimentally, finding it to be a regulatory element involved in the transcriptional response to glucose. Conclusion The experimental validation of a regulatory element prediction missed by other large-scale motif finding studies demonstrates that our approach is a useful addition to the current suite of tools for finding regulatory motifs.

  7. Bacterial phylogeny structures soil resistomes across habitats

    Forsberg, Kevin J.; Patel, Sanket; Gibson, Molly K.; Lauber, Christian L.; Knight, Rob; Fierer, Noah; Dantas, Gautam

    2014-05-01

    Ancient and diverse antibiotic resistance genes (ARGs) have previously been identified from soil, including genes identical to those in human pathogens. Despite the apparent overlap between soil and clinical resistomes, factors influencing ARG composition in soil and their movement between genomes and habitats remain largely unknown. General metagenome functions often correlate with the underlying structure of bacterial communities. However, ARGs are proposed to be highly mobile, prompting speculation that resistomes may not correlate with phylogenetic signatures or ecological divisions. To investigate these relationships, we performed functional metagenomic selections for resistance to 18 antibiotics from 18 agricultural and grassland soils. The 2,895 ARGs we discovered were mostly new, and represent all major resistance mechanisms. We demonstrate that distinct soil types harbour distinct resistomes, and that the addition of nitrogen fertilizer strongly influenced soil ARG content. Resistome composition also correlated with microbial phylogenetic and taxonomic structure, both across and within soil types. Consistent with this strong correlation, mobility elements (genes responsible for horizontal gene transfer between bacteria such as transposases and integrases) syntenic with ARGs were rare in soil by comparison with sequenced pathogens, suggesting that ARGs may not transfer between soil bacteria as readily as is observed between human pathogens. Together, our results indicate that bacterial community composition is the primary determinant of soil ARG content, challenging previous hypotheses that horizontal gene transfer effectively decouples resistomes from phylogeny.

  8. Molecular epidemiology, phylogeny and evolution of Legionella.

    Khodr, A; Kay, E; Gomez-Valero, L; Ginevra, C; Doublet, P; Buchrieser, C; Jarraud, S

    2016-09-01

    Legionella are opportunistic pathogens that develop in aquatic environments where they multiply in protozoa. When infected aerosols reach the human respiratory tract they may accidentally infect the alveolar macrophages leading to a severe pneumonia called Legionnaires' disease (LD). The ability of Legionella to survive within host-cells is strictly dependent on the Dot/Icm Type 4 Secretion System that translocates a large repertoire of effectors into the host cell cytosol. Although Legionella is a large genus comprising nearly 60 species that are worldwide distributed, only about half of them have been involved in LD cases. Strikingly, the species Legionella pneumophila alone is responsible for 90% of all LD cases. The present review summarizes the molecular approaches that are used for L. pneumophila genotyping with a major focus on the contribution of whole genome sequencing (WGS) to the investigation of local L. pneumophila outbreaks and global epidemiology studies. We report the newest knowledge regarding the phylogeny and the evolution of Legionella and then focus on virulence evolution of those Legionella species that are known to have the capacity to infect humans. Finally, we discuss the evolutionary forces and adaptation mechanisms acting on the Dot/Icm system itself as well as the role of mobile genetic elements (MGE) encoding T4ASSs and of gene duplications in the evolution of Legionella and its adaptation to different hosts and lifestyles. PMID:27180896

  9. Phylogeny of the gudgeons (Teleostei: Cyprinidae: Gobioninae).

    Tang, Kevin L; Agnew, Mary K; Chen, Wei-Jen; Vincent Hirt, M; Raley, Morgan E; Sado, Tetsuya; Schneider, Leah M; Yang, Lei; Bart, Henry L; He, Shunping; Liu, Huanzhang; Miya, Masaki; Saitoh, Kenji; Simons, Andrew M; Wood, Robert M; Mayden, Richard L

    2011-10-01

    The members of the cyprinid subfamily Gobioninae, commonly called gudgeons, form one of the most well-established assemblages in the family Cyprinidae. The subfamily is a species-rich group of fishes, these fishes display diverse life histories, appearances, and behavior. The phylogenetic relationships of Gobioninae are examined using sequence data from four loci: cytochrome b, cytochrome c oxidase I, opsin, and recombination activating gene 1. This investigation produced a data matrix of 4114 bp for 162 taxa that was analyzed using parsimony, maximum likelihood, and Bayesian inference methods. The phylogenies our analyses recovered corroborate recent studies on the group. The subfamily Gobioninae is monophyletic and composed of three major lineages. We find evidence for a Hemibarbus-Squalidus group, and the tribes Gobionini and Sarcocheilichthyini, with the Hemibarbus-Squalidus group sister to a clade of Gobionini-Sarcocheilichthyini. The Hemibarbus-Squalidus group includes those two genera; the tribe Sarcocheilichthyini includes Coreius, Coreoleuciscus, Gnathopogon, Gobiocypris, Ladislavia, Paracanthobrama, Pseudorasbora, Pseudopungtungia, Pungtungia, Rhinogobio, and Sarcocheilichthys; the tribe Gobionini includes Abbottina, Biwia, Gobio, Gobiobotia, Huigobio, Microphysogobio, Platysmacheilus, Pseudogobio, Romanogobio, Saurogobio, and Xenophysogobio. The monotypic Acanthogobio is placed into the synonymy of Gobio. We tentatively assign Belligobio to the Hemibarbus-Squalidus group and Mesogobio to Gobionini; Paraleucogobio and Parasqualidus remain incertae sedis. Based on the topologies presented, the evolution of swim bladder specializations, a distinctive feature among cyprinids, has occurred more than once within the subfamily. PMID:21672635

  10. Molecular phylogeny of euthyneura (mollusca: gastropoda).

    Grande, Cristina; Templado, José; Cervera, J Lucas; Zardoya, Rafael

    2004-02-01

    A new phylogenetic hypothesis for Euthyneura is proposed based on the analysis of primary sequence data (mitochondrial cox1, trnV, rrnL, trnL(cun), trnA, trnP, nad6, and nad5 genes) and the phylogenetic utility of two rare genomic changes (the relative position of the mitochondrial trnP gene, and an insertion/deletion event in a conserved region of the mitochondrial Cox1 protein) is addressed. Both sources of phylogenetic information clearly rejected the monophyly of pulmonates, a group of gastropods well supported so far by morphological evidence. The marine basommatophoran pulmonate Siphonaria was placed within opisthobranchs and shared with them the insertion of a Glycine in the Cox 1 protein. The marine systellommatophoran pulmonate Onchidella was recovered at the base of the opisthobranch + Siphonaria clade. Opisthobranchs, Siphonaria, and Onchidella shared the relative position of the mitochondrial trnP gene between the mitochondrial trnA and nad6 genes. The land snails and slugs (stylommatophoran pulmonates) were recovered as an early split in the phylogeny of advanced gastropods. The monophyly of the Euthyneura (Opisthobranchia + Pulmonata) was rejected by the inclusion of the heterostrophan Pyramidella. PMID:14660702

  11. Phylogeny and diversification patterns among vesicomyid bivalves.

    Carole Decker

    Full Text Available Vesicomyid bivalves are among the most abundant and diverse symbiotic taxa in chemosynthetic-based ecosystems: more than 100 different vesicomyid species have been described so far. In the present study, we investigated the phylogenetic positioning of recently described vesicomyid species from the Gulf of Guinea and their western Atlantic and Pacific counterparts using mitochondrial DNA sequence data. The maximum-likelihood (ML tree provided limited support for the recent taxonomic revision of vesicomyids based on morphological criteria; nevertheless, most of the newly sequenced specimens did not cluster with their morphological conspecifics. Moreover, the observed lack of geographic clustering suggests the occurrence of independent radiations followed by worldwide dispersal. Ancestral character state reconstruction showed a significant correlation between the characters "depth" and "habitat" and the reconstructed ML phylogeny suggesting possible recurrent events of 'stepwise speciation' from shallow to deep waters in different ocean basins. This is consistent with genus or species bathymetric segregation observed from recent taxonomic studies. Altogether, our results highlight the need for ongoing re-evaluation of the morphological characters used to identify vesicomyid bivalves.

  12. Analysis of 16S rRNA and mxaF genes reveling insights into Methylobacterium niche-specific plant association

    Manuella Nóbrega Dourado

    2012-01-01

    Full Text Available The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant.

  13. On simulated annealing phase transitions in phylogeny reconstruction.

    Strobl, Maximilian A R; Barker, Daniel

    2016-08-01

    Phylogeny reconstruction with global criteria is NP-complete or NP-hard, hence in general requires a heuristic search. We investigate the powerful, physically inspired, general-purpose heuristic simulated annealing, applied to phylogeny reconstruction. Simulated annealing mimics the physical process of annealing, where a liquid is gently cooled to form a crystal. During the search, periods of elevated specific heat occur, analogous to physical phase transitions. These simulated annealing phase transitions play a crucial role in the outcome of the search. Nevertheless, they have received comparably little attention, for phylogeny or other optimisation problems. We analyse simulated annealing phase transitions during searches for the optimal phylogenetic tree for 34 real-world multiple alignments. In the same way in which melting temperatures differ between materials, we observe distinct specific heat profiles for each input file. We propose this reflects differences in the search landscape and can serve as a measure for problem difficulty and for suitability of the algorithm's parameters. We discuss application in algorithmic optimisation and as a diagnostic to assess parameterisation before computationally costly, large phylogeny reconstructions are launched. Whilst the focus here lies on phylogeny reconstruction under maximum parsimony, it is plausible that our results are more widely applicable to optimisation procedures in science and industry. PMID:27150349

  14. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    Triman, K; Becker, E; Dammel, C;

    1989-01-01

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alle...

  15. Ontogeny tends to recapitulate phylogeny in digital organisms.

    Clune, Jeff; Pennock, Robert T; Ofria, Charles; Lenski, Richard E

    2012-09-01

    Biologists have long debated whether ontogeny recapitulates phylogeny and, if so, why. Two plausible explanations are that (i) changes to early developmental stages are selected against because they tend to disrupt later development and (ii) simpler structures often precede more complex ones in both ontogeny and phylogeny if the former serve as building blocks for the latter. It is difficult to test these hypotheses experimentally in natural systems, so we used a computational system that exhibits evolutionary dynamics. We observed that ontogeny does indeed recapitulate phylogeny; traits that arose earlier in a lineage's history also tended to be expressed earlier in the development of individuals. The relative complexity of traits contributed substantially to this correlation, but a significant tendency toward recapitulation remained even after accounting for trait complexity. This additional effect provides evidence that selection against developmental disruption also contributed to the conservation of early stages in development. PMID:22854085

  16. Gene order phylogeny and the evolution of methanogens.

    Haiwei Luo

    Full Text Available Methanogens are a phylogenetically diverse group belonging to Euryarchaeota. Previously, phylogenetic approaches using large datasets revealed that methanogens can be grouped into two classes, "Class I" and "Class II". However, some deep relationships were not resolved. For instance, the monophyly of "Class I" methanogens, which consist of Methanopyrales, Methanobacteriales and Methanococcales, is disputable due to weak statistical support. In this study, we use MSOAR to identify common orthologous genes from eight methanogen species and a Thermococcale species (outgroup, and apply GRAPPA and FastME to compute distance-based gene order phylogeny. The gene order phylogeny supports two classes of methanogens, but it differs from the original classification of methanogens by placing Methanopyrales and Methanobacteriales together with Methanosarcinales in Class II rather than with Methanococcales. This study suggests a new classification scheme for methanogens. In addition, it indicates that gene order phylogeny can complement traditional sequence-based methods in addressing taxonomic questions for deep relationships.

  17. [Summary of phylogeny in family Felidae of Carnivora].

    Wang, Jin-Feng; Zhang, Ya-Ping; Yu, Li

    2012-11-01

    Felidae (cats) is one of the strict carnivorous groups in the order Carnivora, many of which are most familiar and spectacular to us. They are the top predators in the world. Thirty-six of 37 living cat species are considered as either "endangered" or "threatened". The relationships among species of the family Felidae, which evolved recently and rapidly, are difficult to resolve, and have been the subject of debate. Construction of a reliable Felidae phylogeny will be of evolutionarily significance and conservation value. In this paper, we summarized phylogeny of Felidae, including cytological, morphological and molecular evidence, and pointed out the existing phylogenetic problems. This review is expected to guide future researches of Felidae phylogeny, and to lay a theoretic foundation for the protection of this animal group. PMID:23208134

  18. Bayesian phylogeny analysis via stochastic approximation Monte Carlo

    Cheon, Sooyoung

    2009-11-01

    Monte Carlo methods have received much attention in the recent literature of phylogeny analysis. However, the conventional Markov chain Monte Carlo algorithms, such as the Metropolis-Hastings algorithm, tend to get trapped in a local mode in simulating from the posterior distribution of phylogenetic trees, rendering the inference ineffective. In this paper, we apply an advanced Monte Carlo algorithm, the stochastic approximation Monte Carlo algorithm, to Bayesian phylogeny analysis. Our method is compared with two popular Bayesian phylogeny software, BAMBE and MrBayes, on simulated and real datasets. The numerical results indicate that our method outperforms BAMBE and MrBayes. Among the three methods, SAMC produces the consensus trees which have the highest similarity to the true trees, and the model parameter estimates which have the smallest mean square errors, but costs the least CPU time. © 2009 Elsevier Inc. All rights reserved.

  19. Inference of Large Phylogenies Using Neighbour-Joining

    Simonsen, Martin; Mailund, Thomas; Pedersen, Christian Nørgaard Storm

    2011-01-01

    The neighbour-joining method is a widely used method for phylogenetic reconstruction which scales to thousands of taxa. However, advances in sequencing technology have made data sets with more than 10,000 related taxa widely available. Inference of such large phylogenies takes hours or days using...... the Neighbour-Joining method on a normal desktop computer because of the O(n^3) running time. RapidNJ is a search heuristic which reduce the running time of the Neighbour-Joining method significantly but at the cost of an increased memory consumption making inference of large phylogenies infeasible....... We present two extensions for RapidNJ which reduce the memory requirements and \\makebox{allows} phylogenies with more than 50,000 taxa to be inferred efficiently on a desktop computer. Furthermore, an improved version of the search heuristic is presented which reduces the running time of RapidNJ on...

  20. Molecular phylogeny of metazoan intermediate filament proteins.

    Erber, A; Riemer, D; Bovenschulte, M; Weber, K

    1998-12-01

    We have cloned cytoplasmic intermediate filament (IF) proteins from a large number of invertebrate phyla using cDNA probes, the monoclonal antibody IFA, peptide sequence information, and various RT-PCR procedures. Novel IF protein sequences reported here include the urochordata and nine protostomic phyla, i.e., Annelida, Brachiopoda, Chaetognatha, Echiura, Nematomorpha, Nemertea, Platyhelminthes, Phoronida, and Sipuncula. Taken together with the wealth of data on IF proteins of vertebrates and the results on IF proteins of Cephalochordata, Mollusca, Annelida, and Nematoda, two IF prototypes emerge. The L-type, which includes 35 sequences from 11 protostomic phyla, shares with the nuclear lamins the long version of the coil 1b subdomain and, in most cases, a homology segment of some 120 residues in the carboxyterminal tail domain. The S-type, which includes all four subfamilies (types I to IV) of vertebrate IF proteins, lacks 42 residues in the coil 1b subdomain and the carboxyterminal lamin homology segment. Since IF proteins from all three phyla of the chordates have the 42-residue deletion, this deletion arose in a progenitor prior to the divergence of the chordates into the urochordate, cephalochordate, and vertebrate lineages, possibly already at the origin of the deuterostomic branch. Four phyla recently placed into the protostomia on grounds of their 18S rDNA sequences (Brachiopoda, Nemertea, Phoronida, and Platyhelminthes) show IF proteins of the L-type and fit by sequence identity criteria into the lophotrochozoic branch of the protostomia. PMID:9847417

  1. toward a phylogeny of the kukri snakes, genus oligodon

    2010-01-01

    the south and southeast asian snake genus oligodon,known for its egg-eating feeding behavior,has been a taxonomically and systematically challenging group.this work provides the first phylogenetic hypothesis for the genus.we use approximately 1900 base pairs of mitochondrial dna sequence data to infer the relationships of these snakes,and we examine congruence between the phylogeny and hemipenial characters.a hypothesis for the position of oligodon within the colubridae is also proposed.we discuss the implications of the phylogeny for previous taxonomic groupings,and consider the usefulness of the trees in analysis of behavior and biogeography of this genus.

  2. Chromosome evolution in tiger beetles: Karyotypes and localization of 18S rDNA loci in Neotropical Megacephalini (Coleoptera, Cicindelidae

    Sónia J.R. Proença

    2005-12-01

    Full Text Available Four Neotropical tiger beetle species, three from the genus Megacephala and one from the genus Oxycheila, currently assigned to the tribe Megacephalini were examined cytogenetically. All three Megacephala species showed simple sex chromosome systems of the X0/XX type but different numbers of autosomal pairs (15 in M. cruciata, 14 in M. sobrina and 12 in M. rutilans, while Oxycheila tristis was inferred to have a multiple sex chromosome system with four X chromosomes (2n = 24 + X1X2X3X4Y/X1X1X2X2X3X3X4X4. Fluorescence in situ hybridization (FISH using a PCR-amplified 18S rDNA fragment as a probe revealed the presence of rDNA clusters located exclusively on the autosomes in all the Megacephala species (five clusters in M. cruciata, eight in M. sobrina and three in M. rutilans, indicating variability in the number of clusters and the presence of structural polymorphisms. The same methodology showed that O. tristis had six rDNA clusters, apparently also located on the autosomes. Although our data also show cytogenetic variability within the genus Megacephala, our findings support the most accepted hypothesis for chromosome evolution in the family Cicindelidae. The description of multiple sex chromosomes in O. tristis along with phylogenetic analyses and larval morphological characters may be assumed as an additional evidence for the exclusion of the genus Oxycheila and related taxa from the tribe Megacephalini.

  3. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA in the fish Prochilodus lineatus (Characiformes, Prochilodontidae

    Marcelo Ricardo Vicari

    2006-01-01

    Full Text Available We used differential staining techniques (BSG, GTG, AgNO3, DAPI and CMA3 banding and fluorescent in situ hybridization (FISH with 5S and 18S probes to investigated the karyotypic and cytogenetic chracteristics of Prochilodus lineatus specimens from a population in Vila Velha state park (Parque Estadual de Vila Velha, Ponta Grossa, Paraná state, southern Brazil. The specimens studied showed the same karyotype as that found in other P. lineatus populations, i.e. 2n = 54 biarmed chromosomes (40m + 14 sm and c-positive heterochromatin preferentially located pericentromerically in all chromosomes. The presence of partial or totally heterochromatic supernumerary chromosomes with numeric intra-individual variation was confirmed in the analyzed population. The nucleolar organizing regions (NORs were interstitially situated on the long arm of chromosome pair 4 directly beneath the centromere. The differential banding techniques and FISH revealed NOR size polymorphism due to structural events such as breaks and duplication of the larger rDNA site cluster. We also observed syntenic localization of the 5S ribosomal genes in the distal segment of the 45S cluster.

  4. 'View From A Bridge': A New Perspective on Eukaryotic rRNA Base Modification.

    Sharma, Sunny; Lafontaine, Denis L J

    2015-10-01

    Eukaryotic rRNA are modified frequently, although the diversity of modifications is low: in yeast rRNA, there are only 12 different types out of a possible natural repertoire exceeding 112. All nine rRNA base methyltransferases (MTases) and one acetyltransferase have recently been identified in budding yeast, and several instances of crosstalk between rRNA, tRNA, and mRNA modifications are emerging. Although the machinery has largely been identified, the functions of most rRNA modifications remain to be established. Remarkably, a eukaryote-specific bridge, comprising a single ribosomal protein (RP) from the large subunit (LSU), contacts four rRNA base modifications across the ribosomal subunit interface, potentially probing for their presence. We hypothesize in this article that long-range allosteric communication involving rRNA modifications is taking place between the two subunits during translation or, perhaps, the late stages of ribosome assembly. PMID:26410597

  5. Eukaryotic rRNA Modification by Yeast 5-Methylcytosine-Methyltransferases and Human Proliferation-Associated Antigen p120.

    Gabrielle Bourgeois

    Full Text Available Modified nucleotide 5-methylcytosine (m5C is frequently present in various eukaryotic RNAs, including tRNAs, rRNAs and in other non-coding RNAs, as well as in mRNAs. RNA:m5C-methyltranferases (MTases Nop2 from S. cerevisiae and human proliferation-associated nucleolar antigen p120 are both members of a protein family called Nop2/NSUN/NOL1. Protein p120 is well-known as a tumor marker which is over-expressed in various cancer tissues. Using a combination of RNA bisulfite sequencing and HPLC-MS/MS analysis, we demonstrated here that p120 displays an RNA:m5C- MTase activity, which restores m5C formation at position 2870 in domain V of 25S rRNA in a nop2Δ yeast strain. We also confirm that yeast proteins Nop2p and Rcm1p catalyze the formation of m5C in domains V and IV, respectively. In addition, we do not find any evidence of m5C residues in yeast 18S rRNA. We also performed functional complementation of Nop2-deficient yeasts by human p120 and studied the importance of different sequence and structural domains of Nop2 and p120 for yeast growth and m5C-MTase activity. Chimeric protein formed by Nop2 and p120 fragments revealed the importance of Nop2 N-terminal domain for correct protein localization and its cellular function. We also validated that the presence of Nop2, rather than the m5C modification in rRNA itself, is required for pre-rRNA processing. Our results corroborate that Nop2 belongs to the large family of pre-ribosomal proteins and possesses two related functions in pre-rRNA processing: as an essential factor for cleavages and m5C:RNA:modification. These results support the notion of quality control during ribosome synthesis by such modification enzymes.

  6. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  7. A phylogeny and molecular barcodes for Caenorhabditis, with numerous new species from rotting fruits

    Kiontke Karin C

    2011-11-01

    Full Text Available Abstract Background The nematode Caenorhabditis elegans is a major laboratory model in biology. Only ten Caenorhabditis species were available in culture at the onset of this study. Many of them, like C. elegans, were mostly isolated from artificial compost heaps, and their more natural habitat was unknown. Results Caenorhabditis nematodes were found to be proliferating in rotten fruits, flowers and stems. By collecting a large worldwide set of such samples, 16 new Caenorhabditis species were discovered. We performed mating tests to establish biological species status and found some instances of semi-fertile or sterile hybrid progeny. We established barcodes for all species using ITS2 rDNA sequences. By obtaining sequence data for two rRNA and nine protein-coding genes, we determined the likely phylogenetic relationships among the 26 species in culture. The new species are part of two well-resolved sister clades that we call the Elegans super-group and the Drosophilae super-group. We further scored phenotypic characters such as reproductive mode, mating behavior and male tail morphology, and discuss their congruence with the phylogeny. A small space between rays 2 and 3 evolved once in the stem species of the Elegans super-group; a narrow fan and spiral copulation evolved once in the stem species of C. angaria, C. sp. 8 and C. sp. 12. Several other character changes occurred convergently. For example, hermaphroditism evolved three times independently in C. elegans, C. briggsae and C. sp. 11. Several species can co-occur in the same location or even the same fruit. At the global level, some species have a cosmopolitan distribution: C. briggsae is particularly widespread, while C. elegans and C. remanei are found mostly or exclusively in temperate regions, and C. brenneri and C. sp. 11 exclusively in tropical zones. Other species have limited distributions, for example C. sp. 5 appears to be restricted to China, C. sp. 7 to West Africa and C. sp

  8. Microfaunal indicators, Ciliophora phylogeny and protozoan population shifts in an intermittently aerated and fed bioreactor

    Ntougias, Spyridon, E-mail: sntougia@env.duth.gr [Democritus University of Thrace, Department of Environmental Engineering, Laboratory of Wastewater Management and Treatment Technologies, Vas. Sofias 12, 67100 Xanthi (Greece); Tanasidis, Spartakos; Melidis, Paraschos [Democritus University of Thrace, Department of Environmental Engineering, Laboratory of Wastewater Management and Treatment Technologies, Vas. Sofias 12, 67100 Xanthi (Greece)

    2011-02-28

    Microfauna community structure was examined in the mixed liquor of a bench-scale bioreactor equipped with an intermittent aeration and feeding system. The reactor was operated under an intermittent aeration of 25 min in every 1 h and varying feeding conditions (0.264, 0.403 and 0.773 kg BOD{sub 5}/m{sup 3} d). A total of 14 protozoan and metazoan taxa were identified by microscopic examination. Sessile ciliates, followed by crawling ciliates, were the major protozoan groups under 0.403 kg BOD{sub 5}/m{sup 3} d organic loading conditions, while sessile ciliate population was remarkably increased under an organic loading of 0.773 kg BOD{sub 5}/m{sup 3} d. Principal Component Analysis and Pearson correlation coefficient tests were performed in order to reveal relationships between microfauna community and operational parameters. Ciliophora specific-18S rRNA gene clone library was constructed to identify ciliate diversity under 0.773 kg BOD{sub 5}/m{sup 3} d organic loading conditions. Ciliophora diversity consisted of members of Aspidiscidae, Epistylidae, Opisthonectidae and Vorticellidae, with the majority of the clones being associated with the species Vorticella fusca. At least one novel phylogenetic linkage among Ciliophora was identified. Comparisons made after molecular characterization and microscopic examination of Ciliophora community showed that the estimation of broad ciliate groups is useful for ecological considerations and evaluation of the operational conditions in wastewater treatment plants.

  9. Relating Phylogeny to Alkenone Distributions in Lacustrine Alkenone-Producing Haptophytes: Implications for Continental Paleotemperature Reconstructions

    Theroux, S.; D'Andrea, W. J.; Toney, J. L.; Zettler, L. A.; Huang, Y.

    2008-12-01

    The alkenone unsaturation index (Uk'37) is a widely used surface water paleotemperature proxy in marine settings, but has seen limited use in lacustrine environments. On-going discovery of alkenone- containing lake sediments worldwide expand our ability to reconstruct continental paleotemperatures. However, disparate alkenone profiles among these lakes suggest a diversity of alkenone-producing organisms. The utility of the paleotemperature proxy is constrained by the accurate calibration of the Uk'37 against temperature for individual lakes. In this study, we report the findings from an 18S rRNA gene-based phylogenetic survey of globally distributed lakes containing alkenone-producing haptophyte algae to infer which haptophyte lineages likely possess common alkenone production pathways. Our phylogenetic analyses reveal that monophyletic groups of haptophytes possess similar lipid profiles. This correlation indicates the potential for applying a minimal number of calibrations to a multitude of diverse geographic settings. Furthermore, the expanded dataset of alkenone-containing lake sediments and robust phylogenetic analyses reflect the evolution of alkenone-producing haptophytes, and provide insights into the last common ancestor that was capable of alkenone production in the Cretaceous. The physiology, behavior, and culture conditions of a newly-isolated alkenone-producing haptophyte from polar waters possessing anomalous alkenone-concentrations, will also be discussed.

  10. Microfaunal indicators, Ciliophora phylogeny and protozoan population shifts in an intermittently aerated and fed bioreactor

    Microfauna community structure was examined in the mixed liquor of a bench-scale bioreactor equipped with an intermittent aeration and feeding system. The reactor was operated under an intermittent aeration of 25 min in every 1 h and varying feeding conditions (0.264, 0.403 and 0.773 kg BOD5/m3 d). A total of 14 protozoan and metazoan taxa were identified by microscopic examination. Sessile ciliates, followed by crawling ciliates, were the major protozoan groups under 0.403 kg BOD5/m3 d organic loading conditions, while sessile ciliate population was remarkably increased under an organic loading of 0.773 kg BOD5/m3 d. Principal Component Analysis and Pearson correlation coefficient tests were performed in order to reveal relationships between microfauna community and operational parameters. Ciliophora specific-18S rRNA gene clone library was constructed to identify ciliate diversity under 0.773 kg BOD5/m3 d organic loading conditions. Ciliophora diversity consisted of members of Aspidiscidae, Epistylidae, Opisthonectidae and Vorticellidae, with the majority of the clones being associated with the species Vorticella fusca. At least one novel phylogenetic linkage among Ciliophora was identified. Comparisons made after molecular characterization and microscopic examination of Ciliophora community showed that the estimation of broad ciliate groups is useful for ecological considerations and evaluation of the operational conditions in wastewater treatment plants.

  11. Outside-in recrystallization of ZnS-Cu1.8 S hollow spheres with interdispersed lattices for enhanced visible light solar hydrogen generation.

    Zhu, Ting; Nuo Peh, Connor Kang; Hong, Minghui; Ho, Ghim Wei

    2014-09-01

    For the first time an earth-abundant and nontoxic ZnS-Cu(1.8) S hybrid photocatalyst has been engineered with well-defined nanosheet hollow structures by a template-engaged method. In contrast to conventional surface coupling and loading, the unique outside-in recrystallization promotes co-precipitation of ZnS and Cu(1.8) S into homogeneous interdispersed lattices, hence forming a hybrid semiconductor with visible responsive photocatalytic activity. The as-derived ZnS-Cu(1.8) S semiconductor alloy is tailored into a hierarchical hollow structure to provide readily accessible porous shells and interior spaces for effective ion transfer/exchange. Notably, this synergistic morphology, interface and crystal lattice engineering, aim towards the design of novel nanocatalysts for various sustainable environmental and energy applications. PMID:25043270

  12. Morphology and 18S rDNA of Henneguya gurlei (Myxosporea) from Ameiurus nebulosus (Siluriformes) in North Carolina

    Iwanowicz, L.R.; Iwanowicz, D.D.; Pote, L.M.; Blazer, V.S.; Schill, W.B.

    2008-01-01

    Henneguya gurlei was isolated from Ameiurus nebulosus captured in North Carolina and redescribed using critical morphological features and 18S small-subunit ribosomal RNA (SSU rDNA) gene sequence. Plasmodia are white, spherical, or subspherical, occur in clusters, measure up to 1.8 mm in length, and are located on the dorsal, pectoral, and anal fins. Histologically, plasmodia are located in the dermis and subdermally, and the larger cysts disrupt the melanocyte pigment layer. The spore body is lanceolate, 18.2 ?? 0.3 ??m (range 15.7-20.3) in length, and 5.4 ?? 0.1 ??m (range 3.8-6.1) in width in valvular view. The caudal appendages are 41.1 ?? 1.1 ??m (range 34.0-49.7) in length. Polar capsules are pyriform and of unequal size. The longer polar capsule measures 6.2 ?? 0.1 ??m (range 5.48-7.06), while the shorter is 5.7 ?? 0.1 ??m (range 4.8-6.4) in length. Polar capsule width is 1.2 ?? 0.03 ??m (range 1.0-1.54). The total length of the spore is 60.9 ?? 1.2 ??m (range 48.7-68.5). Morphologically, this species is similar to other species of Henneguya that are known to infect ictalurids. Based on SSU rDNA sequences, this species is most closely related to H. exilis and H. ictaluri, which infect Ictalurus punctatus. ?? American Society of Parasitologists 2008.

  13. Cryptic species in tropic sands--interactive 3D anatomy, molecular phylogeny and evolution of meiofaunal Pseudunelidae (Gastropoda, Acochlidia.

    Timea P Neusser

    Full Text Available BACKGROUND: Towards realistic estimations of the diversity of marine animals, tiny meiofaunal species usually are underrepresented. Since the biological species concept is hardly applicable on exotic and elusive animals, it is even more important to apply a morphospecies concept on the best level of information possible, using accurate and efficient methodology such as 3D modelling from histological sections. Molecular approaches such as sequence analyses may reveal further, cryptic species. This is the first case study on meiofaunal gastropods to test diversity estimations from traditional taxonomy against results from modern microanatomical methodology and molecular systematics. RESULTS: The examined meiofaunal Pseudunela specimens from several Indo-Pacific islands cannot be distinguished by external features. Their 3D microanatomy shows differences in the organ systems and allows for taxonomic separation in some cases. Additional molecular analyses based on partial mitochondrial cytochrome c oxidase subunit I (COI and 16S rRNA markers revealed considerable genetic structure that is largely congruent with anatomical or geographical patterns. Two new species (Pseudunela viatoris and P. marteli spp. nov. are formally described integrating morphological and genetic analyses. Phylogenetic analysis using partial 16S rRNA, COI and the nuclear 18S rRNA markers shows a clade of Pseudunelidae species as the sister group to limnic Acochlidiidae. Within Pseudunela, two subtypes of complex excretory systems occur. A complex kidney already evolved in the ancestor of Hedylopsacea. Several habitat shifts occurred during hedylopsacean evolution. CONCLUSIONS: Cryptic species occur in tropical meiofaunal Pseudunela gastropods, and likely in other meiofaunal groups with poor dispersal abilities, boosting current diversity estimations. Only a combined 3D microanatomical and molecular approach revealed actual species diversity within Pseudunela reliably. Such

  14. Relationships within phylogeny of vespertilionid bats (Chiroptera: Vespertilionidae)

    Dolinay, M.; Martínková, Natália

    Brno: Ústav biologie obratlovců AV ČR, 2013 - (Bryja, J.; Řehák, Z.; Zukal, J.). s. 56-57 ISBN 978-80-87189-14-6. [Zoologické dny. 07.02.2013-08.02.2013, Brno] Institutional support: RVO:68081766 Keywords : bats * phylogeny Subject RIV: EG - Zoology

  15. Ecological interaction and phylogeny, studying functionality on composed networks

    Cruz, Claudia P. T.; Fonseca, Carlos Roberto; Corso, Gilberto

    2012-02-01

    We study a class of composed networks that are formed by two tree networks, TP and TA, whose end points touch each other through a bipartite network BPA. We explore this network using a functional approach. We are interested in how much the topology, or the structure, of TX (X=A or P) determines the links of BPA. This composed structure is a useful model in evolutionary biology, where TP and TA are the phylogenetic trees of plants and animals that interact in an ecological community. We make use of ecological networks of dispersion of fruits, which are formed by frugivorous animals and plants with fruits; the animals, usually birds, eat fruits and disperse their seeds. We analyse how the phylogeny of TX determines or is correlated with BPA using a Monte Carlo approach. We use the phylogenetic distance among elements that interact with a given species to construct an index κ that quantifies the influence of TX over BPA. The algorithm is based on the assumption that interaction matrices that follows a phylogeny of TX have a total phylogenetic distance smaller than the average distance of an ensemble of Monte Carlo realisations. We find that the effect of phylogeny of animal species is more pronounced in the ecological matrix than plant phylogeny.

  16. Ontogeny and Phylogeny from an Epigenetic Point of View.

    Lovtrup, Soren

    1984-01-01

    The correlation between ontogeny and phylogeny is analyzed through the discussion of four theories on the reality, history, epigenetic, and ecological aspects of the mechanism of evolution. Also discussed are historical and creative aspects of evolution and three epigenetic mechanisms instantiated in the case of the amphibian embryo. (Author/RH)

  17. Low frequency of paleoviral infiltration across the avian phylogeny

    Cui, Jie; Zhao, Wei; Huang, Zhiyong;

    2014-01-01

    endogenous viral element evolution.Results: Through a systematic screening of the genomes of 48 species sampled across the avian phylogeny we reveal that birds harbor a limited number of endogenous viral elements compared to mammals, with only five viral families observed: Retroviridae, Hepadnaviridae...

  18. Incorporating indel information into phylogeny estimation for rapidly emerging pathogens

    Suchard Marc A

    2007-03-01

    Full Text Available Abstract Background Phylogenies of rapidly evolving pathogens can be difficult to resolve because of the small number of substitutions that accumulate in the short times since divergence. To improve resolution of such phylogenies we propose using insertion and deletion (indel information in addition to substitution information. We accomplish this through joint estimation of alignment and phylogeny in a Bayesian framework, drawing inference using Markov chain Monte Carlo. Joint estimation of alignment and phylogeny sidesteps biases that stem from conditioning on a single alignment by taking into account the ensemble of near-optimal alignments. Results We introduce a novel Markov chain transition kernel that improves computational efficiency by proposing non-local topology rearrangements and by block sampling alignment and topology parameters. In addition, we extend our previous indel model to increase biological realism by placing indels preferentially on longer branches. We demonstrate the ability of indel information to increase phylogenetic resolution in examples drawn from within-host viral sequence samples. We also demonstrate the importance of taking alignment uncertainty into account when using such information. Finally, we show that codon-based substitution models can significantly affect alignment quality and phylogenetic inference by unrealistically forcing indels to begin and end between codons. Conclusion These results indicate that indel information can improve phylogenetic resolution of recently diverged pathogens and that alignment uncertainty should be considered in such analyses.

  19. A large phylogeny of turtles (Testudines) using molecular data

    Guillon, J.-M.; Guéry, L.; Hulin, V.; Girondot, M.

    2012-01-01

    Turtles (Testudines) form a monophyletic group with a highly distinctive body plan. The taxonomy and phylogeny of turtles are still under discussion, at least for some clades. Whereas in most previous studies, only a few species or genera were considered, we here use an extensive compilation of DNA

  20. The genus Gloriosa (Colchicaceae) : ethnobotany, phylogeny and taxonomy

    Maroyi, A.

    2012-01-01

    This thesis focuses on the ethnobotany, phylogeny and taxonomy of the genus Gloriosa L. over its distributional range. Some Gloriosa species are known to have economic and commercial value, but the genus is also well known for its complex alpha taxonomy. An appropriate taxonomy for this group is of

  1. Phylogeny predicts future habitat shifts due to climate change.

    Matjaž Kuntner

    Full Text Available BACKGROUND: Taxa may respond differently to climatic changes, depending on phylogenetic or ecological effects, but studies that discern among these alternatives are scarce. Here, we use two species pairs from globally distributed spider clades, each pair representing two lifestyles (generalist, specialist to test the relative importance of phylogeny versus ecology in predicted responses to climate change. METHODOLOGY: We used a recent phylogenetic hypothesis for nephilid spiders to select four species from two genera (Nephilingis and Nephilengys that match the above criteria, are fully allopatric but combined occupy all subtropical-tropical regions. Based on their records, we modeled each species niche spaces and predicted their ecological shifts 20, 40, 60, and 80 years into the future using customized GIS tools and projected climatic changes. CONCLUSIONS: Phylogeny better predicts the species current ecological preferences than do lifestyles. By 2080 all species face dramatic reductions in suitable habitat (54.8-77.1% and adapt by moving towards higher altitudes and latitudes, although at different tempos. Phylogeny and life style explain simulated habitat shifts in altitude, but phylogeny is the sole best predictor of latitudinal shifts. Models incorporating phylogenetic relatedness are an important additional tool to predict accurately biotic responses to global change.

  2. Multiple nuclear ortholog next generation sequencing phylogeny of Daucus

    Next generation sequencing is helping to solve the data insufficiency problem hindering well-resolved dominant gene phylogenies. We used Roche 454 technology to obtain DNA sequences from 93 nuclear orthologs, dispersed throughout all linkage groups of Daucus. Of these 93 orthologs, ten were designed...

  3. Molecular phylogeny and evolution of mosquito parasitic Microsporidia (Microsporidia: Amblyosporidae)

    Vossbrinck, C. R.; Andreadis, T.; Vávra, Jiří; Becnel, J. J.

    2004-01-01

    Roč. 51, č. 1 (2004), s. 88-95. ISSN 1066-5234 Institutional research plan: CEZ:AV0Z6022909 Keywords : Microsporidia * molecular phylogeny * evolution Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.403, year: 2004

  4. Phylogeny and adaptation shape the teeth of insular mice.

    Ledevin, Ronan; Chevret, Pascale; Ganem, Guila; Britton-Davidian, Janice; Hardouin, Emilie A; Chapuis, Jean-Louis; Pisanu, Benoit; da Luz Mathias, Maria; Schlager, Stefan; Auffray, Jean-Christophe; Renaud, Sabrina

    2016-02-10

    By accompanying human travels since prehistorical times, the house mouse dispersed widely throughout the world, and colonized many islands. The origin of the travellers determined the phylogenetic source of the insular mice, which encountered diverse ecological and environmental conditions on the various islands. Insular mice are thus an exceptional model to disentangle the relative role of phylogeny, ecology and climate in evolution. Molar shape is known to vary according to phylogeny and to respond to adaptation. Using for the first time a three-dimensional geometric morphometric approach, compared with a classical two-dimensional quantification, the relative effects of size variation, phylogeny, climate and ecology were investigated on molar shape diversity across a variety of islands. Phylogeny emerged as the factor of prime importance in shaping the molar. Changes in competition level, mostly driven by the presence or absence of the wood mouse on the different islands, appeared as the second most important effect. Climate and size differences accounted for slight shape variation. This evidences a balanced role of random differentiation related to history of colonization, and of adaptation possibly related to resource exploitation. PMID:26842576

  5. The complete nucleotide sequence of the rat 18S ribosomal RNA gene and comparison with the respective yeast and frog genes.

    Torczynski, R; Bollon, A P; Fuke, M

    1983-01-01

    The complete nucleotide sequence of the rat 18S ribosomal RNA gene has been determined. A comparison of the rat 18S ribosomal RNA gene sequence with the known sequences of yeast and frog revealed three conserved (stable) regions, two unstable regions, and three large inserts. (A,T) leads to (G,C) changes were more frequent than (G,C) leads to (A,T) changes for three comparisons (yeast leads to frog, frog leads to rat, and yeast leads to rat). GC pairs were inserted preferentially over AT pair...

  6. Comparative evaluation of microscopy, OptiMAL®and 18S rRNAgene based multiplex PCR for detection of Plasmodium falciparum & Plasmodium vivax from field isolates of Bikaner, India

    Deepak Pakalapati; Jyoti Acharya; Dhanpat Kumar Kochar; Ashis Das; Shilpi Garg; She Middha; Abhishek Kochar; Amit Kumar Subudhi; Boopathi Pon Arunachalam; Sanjay Kumar Kochar; Vishal Saxena; Pareek RP

    2013-01-01

    Objective: To evaluate microscopy, OptiMAL®and multiplex PCR for the identification of Plasmodium falciparum (P. falciparum) and Plasmodium vivax (P. vivax) from the field isolates of Bikaner, Rajasthan (Northwest India). Methods: In this study, a multiplex PCR (P. falciparum and P. vivax) was further developed with the incorporation of Plasmodium malariae (P. malariae) specific primer and also a positive control. The performance of microscopy, plasmodium lactate dehydrogenase (pLDH) based malaria rapid diagnostic test OptiMAL®and 18S rRNA gene based multiplex PCR for the diagnosis of P. falciparum and P. vivax was compared. Results: The three species multiplex PCR (P. falciparum, P. vivax and P. malariae) with an inbuilt positive control was developed and evaluated. In comparison with multiplex PCR, which showed the sensitivity and specificity of 99.36% (95% CI, 98.11%-100.00%) and 100.00% (95% CI, 100.00%-100.00%), the sensitivity and specificity of microscopy was 90.44% (95% CI, 88.84%-95.04%) and 99.22% (95%CI, 97.71%-100.00%), and OptiMAL®was 93.58% (95% CI, 89.75%-97.42%) and 97.69% (95% CI, 95.10%-100.00%). The efficiencies were 99.65%, 95.10% and 95.45% for multiplex PCR, microscopy and OptiMAL®, respectively. Conclusions: Our results raise concerns over the overall sensitivities of microscopy and OptiMAL®, when compared to the multiplex PCR and thus stress the need for new molecular interventions in the accurate detection of the malarial parasites. This further highlights the fact that further developments are needed to improve the performance of rapid diagnostic tests at field level.

  7. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA. PMID:26853884

  8. Molecular phylogeny restores the supra-generic subdivision of homoscleromorph sponges (Porifera, Homoscleromorpha.

    Eve Gazave

    Full Text Available BACKGROUND: Homoscleromorpha is the fourth major sponge lineage, recently recognized to be distinct from the Demospongiae. It contains <100 described species of exclusively marine sponges that have been traditionally subdivided into 7 genera based on morphological characters. Because some of the morphological features of the homoscleromorphs are shared with eumetazoans and are absent in other sponges, the phylogenetic position of the group has been investigated in several recent studies. However, the phylogenetic relationships within the group remain unexplored by modern methods. METHODOLOGY/PRINCIPAL FINDINGS: Here we describe the first molecular phylogeny of Homoscleromorpha based on nuclear (18S and 28S rDNA and complete mitochondrial DNA sequence data that focuses on inter-generic relationships. Our results revealed two robust clades within this group, one containing the spiculate species (genera Plakina, Plakortis, Plakinastrella and Corticium and the other containing aspiculate species (genera Oscarella and Pseudocorticium, thus rejecting a close relationship between Pseudocorticium and Corticium. Among the spiculate species, we found affinities between the Plakortis and Plakinastrella genera, and between the Plakina and Corticium. The validity of these clades is furthermore supported by specific morphological characters, notably the type of spicules. Furthermore, the monophyly of the Corticium genus is supported while the monophyly of Plakina is not. CONCLUSIONS/SIGNIFICANCE: As the result of our study we propose to restore the pre-1995 subdivision of Homoscleromorpha into two families: Plakinidae Schulze, 1880 for spiculate species and Oscarellidae Lendenfeld, 1887 for aspiculate species that had been rejected after the description of the genus Pseudocorticium. We also note that the two families of homoscleromorphs exhibit evolutionary stable, but have drastically distinct mitochondrial genome organizations that differ in gene content

  9. The long way to diversity--phylogeny and evolution of the Heterobranchia (Mollusca: Gastropoda).

    Dinapoli, Angela; Klussmann-Kolb, Annette

    2010-04-01

    Heterobranchia are one of the most species rich groups within Gastropoda, with poorly resolved phylogenetic relationships especially in basal taxa. In order to resolve phylogenetic relationships within the Heterobranchia, we pursued a molecular systematic approach by sequencing and analysing a variety of genetic markers (including nuclear 28S rDNA+18S rDNA and mitochondrial 16S rDNA+COI sequences). Maximum likelihood as well as Bayesian inference methods were used for phylogenetic reconstruction. Moreover, data quality was estimated for the purpose of proving the plausibility of the novel phylogenetic hypothesis using a variety of statistical tests as well as network analyses. Finally, a case study was conducted in order to estimate divergence ages using a "relaxed" molecular clock approach with fossils as minimum age constraints. All phylogenetic analyses revealed the Heterobranchia as monophyletic. Within the Heterobranchia, several well supported clades could be resolved. However, the traditional classification based on morphological data could not be confirmed due to paraphyletic Euthyneura as well as paraphyletic Pulmonata and polyphyletic Opisthobranchia. The estimation of data quality yielded a high degree of substitution saturation in many of the nucleotide positions while the Relative-Rate-Test revealed the highest evolution rates within the "Lower Heterobranchia". Although the dataset shows much conflict, many of the proposed hypotheses are supported by splits of the network analysis. The molecular clock approach was able to confirm some evolutionary hypotheses based on fossils such as the late occurrence of Pulmonata and Stylommatophora, respectively, during the Mesozoic. However, large 95% highest posterior density (HPD) intervals at some of the nodes made a precise dating of these nodes difficult. This molecular phylogenetic investigation provides the most comprehensive molecular study of relationships within the Heterobranchia to date. Due to the

  10. High throughput 16S rRNA gene amplicon sequencing

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup;

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r...... belonging to the phylum Chloroflexi. Based on knowledge about their ecophysiology, other control measures were introduced and the bulking problem was reduced after 2 months. Besides changes in the filament abundance and composition also other changes in the microbial community were observed that likely...... correlated with the bacterial species composition in 25 Danish full-scale WWTPs with nutrient removal. Examples of properties were SVI, filament index, floc size, floc strength, content of cations and amount of extracellular polymeric substances. Multivariate statistics provided several important insights...

  11. Fragmentation of 23S rRNA in Strains of Proteus and Providencia Results from Intervening Sequences in the rrn (rRNA) Genes

    Miller, Wayne L.; Pabbaraju, Kanti; Sanderson, Kenneth E.

    2000-01-01

    Intervening sequences (IVSs) were originally identified in the rrl genes for 23S rRNA (rrl genes, for large ribosomal subunit, part of rrn operon encoding rRNA) of Salmonella enterica serovars Typhimurium LT2 and Arizonae. These sequences are transcribed but later removed during RNase III processing of the rRNA, resulting in fragmentation of the 23S species; IVSs are uncommon, but have been reported in at least 10 bacterial genera. Through PCR amplification of IVS-containing regions of the rr...

  12. Louse (Insecta : Phthiraptera) mitochondrial 12S rRNA secondary structure is highly variable

    Page, R.D.M.; Cruickshank, R.; Johnson, K P

    2002-01-01

    Lice are ectoparasitic insects hosted by birds and mammals. Mitochondrial 12S rRNA sequences obtained from lice show considerable length variation and are very difficult to align. We show that the louse 12S rRNA domain III secondary structure displays considerable variation compared to other insects, in both the shape and number of stems and loops. Phylogenetic trees constructed from tree edit distances between louse 12S rRNA structures do not closely resemble trees constructed from sequence ...

  13. Fragmentations of the large-subunit rRNA in the family Rhizobiaceae.

    Selenska-Pobell, S; Evguenieva-Hackenberg, E

    1995-01-01

    A 130-nucleotide-long rRNA species corresponding to the 5' end of the 23S rRNA gene was found in 96 strains belonging to different Rhizobium, Bradyrhizobium, and Agrobacterium species. Additional fragmentation in the central region of the large-subunit rRNA occurred in all agrobacteria, except Agrobacterium vitis, and in most Rhizobium leguminosarum and Rhizobium etli strains but did not occur in any of the other rhizobia and bradyrhizobia studied.

  14. Further insights into the phylogeny of two ciliate classes Nassophorea and Prostomatea (Protista, Ciliophora).

    Zhang, Qianqian; Yi, Zhenzhen; Fan, Xinpeng; Warren, Alan; Gong, Jun; Song, Weibo

    2014-01-01

    The Nassophorea and Prostomatea are two of the key classes in understanding the morphological diversification and higher classification of the phylum Ciliophora. However, their phylogenetic relationships with other ciliate groups within the subphylum Intramacronucleata remain elusive. In this study, we investigated the small and large subunit (SSU and LSU) rRNA gene-based phylogeny of these groups with sequences of additional taxa including several key species. The results show that: (1) the class Nassophorea remains polyphyletic, with the microthoracids clustering with the Phyllopharyngea, whereas the nassulids represent a basal group of the CONthreeP superclade in the SSU tree; (2) the Prostomatea is not depicted as a monophyletic group in phylogenetic trees, and the monophyly of this class is marginally rejected by statistical tree topology tests; (3) the nassulid genus Parafurgasonia is more closely related to the family Colpodidiidae than to Furgasonia; (4) Paranassula, which was previously thought to be a nassulid, is phylogenetically related to the oligohymenophorean peniculids in both the SSU and LSU trees; (5) the microthoracid genus Discotricha does not group with the other microthoracids in either SSU or LSU trees; (6) the family Plagiocampidae is closely related to the prostome parasite Cryptocaryon irritans and to the family Urotrichidae in the order Prorodontida; and (7) the family Placidae, represented by Placus salinus, is sister to the family Holophryidae in the order Prorodontida. Based on the present data, we consider the genus Discotricha to be an unclassified taxon within the CONthreeP. We also propose resurrecting the order Paranassulida and classifying it within the subclass Peniculia, class Oligohymenophorea. Primary and secondary structure signatures for higher taxa within Phyllopharyngea and Nassophorea are supplied. PMID:24075983

  15. Re-appraisal of the phylogeny and fluorescence in situ hybridization probes for the analysis of the Competibacteraceae in wastewater treatment systems.

    McIlroy, Simon J; Nittami, Tadashi; Kanai, Eri; Fukuda, Junji; Saunders, Aaron M; Nielsen, Per Halkjaer

    2015-04-01

    Members of the family Competibacteraceae are common in wastewater treatment plants (WWTPs) designed for enhanced biological phosphorus removal (EBPR) and are putatively deleterious to the process of P removal. Their ability to accumulate large amounts of polyhydroxyalkanoates is also suggested to be of potential commercial interest for bioplastic production. In this study we have updated the 16S rRNA-based phylogeny of the Competibacter and the Plasticicumulans lineages. The former is delineated by 13 clades including two described genera; 'Ca. Competibacter' and 'Ca. Contendobacter'. The oligonucleotide probes used for detection of the family by fluorescence in situ hybridization (FISH) were re-evaluated and designed for coverage of these clades. Surveys of full-scale WWTPs based on 16S rRNA gene amplicon sequencing and FISH analysis indicate that a number of member clades always coexist, with their relative abundances varying substantially between and temporally within plants. The hypothesis that these differences are based on niche partitioning is supported by marked phenotypic differences between clades. An in-depth understanding of the ecology of the family requires further studies of the metabolism of individual clades in situ. The proposed phylogeny and FISH probes will provide the foundation for such studies. PMID:25224028

  16. Comparative Analysis of 18S and 28S rDNA Sequences of Schistosoma japonicum from Mainland China, the Philippines and Japan

    G.H. Zhao

    2011-01-01

    Full Text Available In the present study, a portion of the 18S and 28S ribosomal DNA (rDNA sequences of 35 Schistosoma japonicum isolates representing three geographical strains from mainland China, the Philippines and Japan were amplified and compared and phylogenetic relationships were also reconstructed by Unweighted Pair-Group Method with Arithmetic averages (UPGMA using combined 18S and 28S rDNA sequences as well as the corresponding sequences of other species belonging to the Schistosoma genus available in the public database. The results indicated that the partial 18S and 28S rDNA sequences of all S. japonicum isolates were 745 and 618 bp, respectively and displayed low genetic variation among S. japonicum strains and isolates. Phylogenetic analysis revealed that the combined 18S and 28S rDNA sequences were not able to distinguish S. japonicum isolates from three geographical origins but provided an effective molecular marker for the inter-species phylogenetic analysis and differential identification of different Schistosoma species.

  17. Utility of 18S rDNA and ITS sequences as population markers for Lepeophtheirus salmonis (Copepoda: Caligidae) parasitising Atlantic salmon (Salmo salar) in Scotland

    Shinn, A.P.; Banks, B.A.; Tange, N.; Bron, J.E.; Sommerville, C.; Aoki, T.; Wootten, R.

    2000-01-01

    Genetic differentiation within the salmon louse Lepeophtheirus salmonis (Krøyer, 1837), was investigated by the sequencing of specific nucleotide regions. Partial sequences of the 18S ribosomal RNA gene and the ribosomal internal transcribed spacer (ITS-1) region from single sea lice were amplified

  18. Phylogenetic analyses of four species of Ulva and Monostroma grevillei using ITS, rbcL and 18S rDNA sequence data

    LIN Zhongheng; SHEN Songdong; CHEN Weizhou; LI Huihui

    2013-01-01

    Chlorophyta species are common in the southern and northern coastal areas of China.In recent years,frequent green tide incidents in Chinese coastal waters have raised concerns and attracted the attention of scientists.In this paper,we sequenced the 18S rDNA genes,the internal transcribed spacer (ITS) regions and the rbcL genes in seven organisms and obtained 536-566 bp long ITS sequences,1 377-1 407 bp long rbcL sequences and 1 718-1 761 bp long partial 18S rDNA sequences.The GC base pair content was highest in the ITS regions and lowest in the rbcL genes.The sequencing results showed that the three Ulvaprolifera (or U.pertusa) gene sequences from Qingdao and Nan'ao Island were identical.The ITS,18S rDNA and rbcL genes in U.prolifera and U.pertusa from different sea areas in China were unchanged by geographic distance.U.flexuosa had the least evolutionary distance from U.californica in both the ITS regions (0.009) and the 18S rDNA (0.002).These data verified that Ulva and Enteromorpha are not separate genera.

  19. Neoparamoeba spp. and their eukaryotic endosymbionts similar to Perkinsela amoebae (Hollande, 1980): Coevolution demonstrated by SSU rRNA gene phylogenies

    Dyková, Iva; Fiala, Ivan; Pecková, Hana

    2008-01-01

    Roč. 44, č. 4 (2008), s. 269-277. ISSN 0932-4739 R&D Projects: GA MŠk LC522; GA ČR GA206/05/2384 Institutional research plan: CEZ:AV0Z60220518 Keywords : Neoparamoeba spp. * Perkinsela amoebae * coevolution Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 1.000, year: 2008

  20. Further consideration of the phylogeny of some "traditional" heterotrichs (Protista, Ciliophora) of uncertain affinities, based on new sequences of the small subunit rRNA gene.

    Miao, Miao; Song, Weibo; Clamp, John C; Al-Rasheid, Khaled A S; Al-Khedhairy, Abdulaziz A; Al-Arifi, Saud

    2009-01-01

    The systematic relationships and taxonomic positions of the traditional heterotrich genera Condylostentor, Climacostomum, Fabrea, Folliculina, Peritromus, and Condylostoma, as well as the licnophorid genus Licnophora, were re-examined using new data from sequences of the gene coding for small subunit ribosomal RNA. Trees constructed using distance-matrix, Bayesian inference, and maximum-parsimony methods all showed the following relationships: (1) the "traditional" heterotrichs consist of several paraphyletic groups, including the current classes Heterotrichea, Armophorea and part of the Spirotrichea; (2) the class Heterotrichea was confirmed as a monophyletic assemblage based on our analyses of 31 taxa, and the genus Peritromus was demonstrated to be a peripheral group; (3) the genus Licnophora occupied an isolated branch on one side of the deepest divergence in the subphylum Intramacronucleata and was closely affiliated with spirotrichs, armophoreans, and clevelandellids; (4) Condylostentor, a recently defined genus with several truly unique morphological features, is more closely related to Condylostoma than to Stentor; (5) Folliculina, Eufolliculina, and Maristentor always clustered together with high bootstrap support; and (6) Climacostomum occupied a paraphyletic position distant from Fabrea, showing a close relationship with Condylostomatidae and Chattonidiidae despite of modest support. PMID:19527351

  1. Toward image phylogeny forests: automatically recovering semantically similar image relationships.

    Dias, Zanoni; Goldenstein, Siome; Rocha, Anderson

    2013-09-10

    In the past few years, several near-duplicate detection methods appeared in the literature to identify the cohabiting versions of a given document online. Following this trend, there are some initial attempts to go beyond the detection task, and look into the structure of evolution within a set of related images overtime. In this paper, we aim at automatically identify the structure of relationships underlying the images, correctly reconstruct their past history and ancestry information, and group them in distinct trees of processing history. We introduce a new algorithm that automatically handles sets of images comprising different related images, and outputs the phylogeny trees (also known as a forest) associated with them. Image phylogeny algorithms have many applications such as finding the first image within a set posted online (useful for tracking copyright infringement perpetrators), hint at child pornography content creators, and narrowing down a list of suspects for online harassment using photographs. PMID:23890634

  2. Phase Transition in Distance-Based Phylogeny Reconstruction

    Roch, Sebastien

    2011-01-01

    We introduce a new distance-based phylogeny reconstruction technique which provably achieves, at sufficiently short branch lengths, a logarithmic sequence-length requirement---improving significantly over previous polynomial bounds for distance-based methods and matching existing results for general methods. The technique is based on an averaging procedure that implicitly reconstructs ancestral sequences. In the same token, we extend previous results on phase transitions in phylogeny reconstruction to general time-reversible models. More precisely, we show that in the so-called Kesten-Stigum zone (roughly, a region of the parameter space where ancestral sequences are well approximated by "linear combinations" of the observed sequences) sequences of length $O(\\log n)$ suffice for reconstruction when branch lengths are discretized. Here $n$ is the number of extant species. Our results challenge, to some extent, the conventional wisdom that estimates of evolutionary distances alone carry significantly less infor...

  3. Phylogeny and biogeography of hogfishes and allies (Bodianus, Labridae).

    Santini, Francesco; Sorenson, Laurie; Alfaro, Michael E

    2016-06-01

    Bodianus wrasses comprise one of the most diverse genera of labrids. Also known as hogfishes due to the presence of a large pig-like snout, Bodianus species are found in warm waters across the Pacific, Atlantic and Indian Oceans. To this date no densely sampled molecular phylogeny is available for this group, and a single morphological study did not include two genera (Clepticus and Semicossyphus) that have been shown to belong within hogfishes by molecular studies. Our study produced the first multi-locus molecular phylogeny of Bodianus species, and corroborated the non-monophyly of this group without the inclusion of the Creole wrasse (Clepticus) and the sheepheads (Semicossyphus). We further showed that hogfishes and allies started to radiate during the Early Miocene, ∼20Ma, and that while this group originated in the Indo-western and South-western Pacific, it experienced multiple episodes during which it successfully invaded different geographic regions and/or ocean basins. PMID:26944013

  4. Phylogeny, diversity and toxin production related to cyanobacterial symbioses

    Papaefthimiou, Dimitra

    2007-01-01

    Phylogeny and morphology were examined for the cyanobionts from the water fern Azolla and the cyanobacterial genus Nostoc originating from symbioses with different host plants (genera Gunnera, Cycas, Dioon, Encephalarthos, Macrozamia, and Anthoceros), the lichen genus Pannaria, and free-living Nostoc isolates from different habitats. Nostoc isolates of Pannaria formed a closely related group, but, in general, no monophyletic nature was attributed to the genus Nostoc, in contrast to the cyanob...

  5. Pyvolve: A Flexible Python Module for Simulating Sequences along Phylogenies

    Spielman, Stephanie J.; Wilke, Claus O

    2015-01-01

    We introduce Pyvolve, a flexible Python module for simulating genetic data along a phylogeny using continuous-time Markov models of sequence evolution. Easily incorporated into Python bioinformatics pipelines, Pyvolve can simulate sequences according to most standard models of nucleotide, amino-acid, and codon sequence evolution. All model parameters are fully customizable. Users can additionally specify custom evolutionary models, with custom rate matrices and/or states to evolve. This flexi...

  6. Multigenic phylogeny and analysis of tree incongruences in Triticeae (Poaceae)

    Guilhaumon Claire; Cenci Alberto; Scornavacca Céline; Escobar Juan S; Santoni Sylvain; Douzery Emmanuel JP; Ranwez Vincent; Glémin Sylvain; David Jacques

    2011-01-01

    Abstract Background Introgressive events (e.g., hybridization, gene flow, horizontal gene transfer) and incomplete lineage sorting of ancestral polymorphisms are a challenge for phylogenetic analyses since different genes may exhibit conflicting genealogical histories. Grasses of the Triticeae tribe provide a particularly striking example of incongruence among gene trees. Previous phylogenies, mostly inferred with one gene, are in conflict for several taxon positions. Therefore, obtaining a r...

  7. Revised phylogeny of whales suggested by mitochondrial ribosomal DNA sequences

    Milinkovitch, M.C.; Orti, G.; Meyer, A.

    1993-01-01

    Living cetaceans are subdivided into two highly distinct suborders, Odontoceti (the echolocating toothed whales) and Mysticeti (the filter-feeding baleen whales), which are believed to have had a long independent history. Here we report the determination of DNA sequences from two mitochondrial ribosomal gene segments (930 base pairs per species) for 16 species of cetaceans, a perissodactyl and a sloth, and construct the first phylogeny for whales and dolphins based on explicit cladistic metho...

  8. Multigene phylogeny of the red algal subclass Nemaliophycidae.

    Lam, Daryl W; Verbruggen, Heroen; Saunders, Gary W; Vis, Morgan L

    2016-01-01

    The red algae (Rhodophyta) are a lineage of primary endosymbionts whose ancestors represent some of the first photosynthetic eukaryotes on the planet. They primarily inhabit marine ecosystems, with only ∼5% of species found in freshwater systems. The subclass Nemaliophycidae is very diverse in ecological and life history features and therefore a useful model to study these traits, but the phylogenetic relationships among the orders are, for the most part, poorly resolved. To elucidate the phylogeny of the Nemaliophycidae, we constructed a nine-gene dataset comprised of nuclear, plastid, and mitochondrial markers for 67 red algal specimens. The resulting maximum likelihood (ML) phylogeny confirmed the monophyly of all orders. The sister relationship of the Acrochaetiales and Palmariales received high support and the relationship of the Balliales with Balbianiales and Entwisleiales with Colaconematales was moderately supported. The Nemaliales, Entwisleiales, Colaconematales, Palmariales and Acrochaetiales formed a highly supported clade. Unfortunately, all other relationships among the orders had low bootstrap support. Although the ML analysis did not resolve many of the relationships, further analyses suggested that a resolution is possible. A Phycas analysis supported a dichotomously branching tree and Bayesian analysis showed a similar topology with all relationships highly supported. Simulations extrapolating the number of nucleotide characters beyond the current size of the dataset suggested that most nodes in the phylogeny would be resolved if more data become available. Phylogenomic approaches will be necessary to provide a well-supported phylogeny of this subclass with all relationships resolved such that the evolution of freshwater species from marine ancestors as well as reproductive traits can be explored. PMID:26518739

  9. Incomplete Lineage Sorting: Consistent Phylogeny Estimation From Multiple Loci

    Mossel, Elchanan

    2008-01-01

    We introduce a simple algorithm for reconstructing phylogenies from multiple gene trees in the presence of incomplete lineage sorting, that is, when the topology of the gene trees may differ from that of the species tree. We show that our technique is statistically consistent under standard stochastic assumptions, that is, it returns the correct tree given sufficiently many unlinked loci. We also show that it can tolerate moderate estimation errors.

  10. Teleostean phylogeny based on osteological and myological characters

    Diogo, R.; Doadrio, I.; Vandewalle, P

    2008-01-01

    Despite the progresses done in the field of teleostean phylogeny in the last decades, recent studies continue to raise questions concerning the higher-level relationships of this remarkably diverse group of fishes. The main aim of the present work is to help to clarify teleostean higher-level relationships. For that purpose, we undertook a cladistic analysis including 70 terminal taxa of 20 different orders and 271 morphological characters, concerning mainly osteological and myological struct...

  11. Congruence of morphologically-defined genera with molecular phylogenies

    Jablonski, David; Finarelli, John A.

    2009-01-01

    Morphologically-defined mammalian and molluscan genera (herein “morphogenera”) are significantly more likely to be monophyletic relative to molecular phylogenies than random, under 3 different models of expected monophyly rates: ≈63% of 425 surveyed morphogenera are monophyletic and 19% are polyphyletic, although certain groups appear to be problematic (e.g., nonmarine, unionoid bivalves). Compiled nonmonophyly rates are probably extreme values, because molecular analyses have focused on “pro...

  12. Deciphering deuterostome phylogeny: molecular, morphological and palaeontological perspectives

    Swalla, Billie J.; Smith, Andrew B.

    2008-01-01

    Deuterostomes are a monophyletic group of animals that include the vertebrates, invertebrate chordates, ambulacrarians and xenoturbellids. Fossil representatives from most major deuterostome groups, including some phylum-level crown groups, are found in the Lower Cambrian, suggesting that evolutionary divergence occurred in the Late Precambrian, in agreement with some molecular clock estimates. Molecular phylogenies, larval morphology and the adult heart/kidney complex all support echinoderms...

  13. Deep phylogeny and evolution of sponges (phylum Porifera).

    Wörheide, G; Dohrmann, M; Erpenbeck, D; Larroux, C; Maldonado, M; Voigt, O; Borchiellini, C; Lavrov, D V

    2012-01-01

    Sponges (phylum Porifera) are a diverse taxon of benthic aquatic animals of great ecological, commercial, and biopharmaceutical importance. They are arguably the earliest-branching metazoan taxon, and therefore, they have great significance in the reconstruction of early metazoan evolution. Yet, the phylogeny and systematics of sponges are to some extent still unresolved, and there is an on-going debate about the exact branching pattern of their main clades and their relationships to the other non-bilaterian animals. Here, we review the current state of the deep phylogeny of sponges. Several studies have suggested that sponges are paraphyletic. However, based on recent phylogenomic analyses, we suggest that the phylum Porifera could well be monophyletic, in accordance with cladistic analyses based on morphology. This finding has many implications for the evolutionary interpretation of early animal traits and sponge development. We further review the contribution that mitochondrial genes and genomes have made to sponge phylogenetics and explore the current state of the molecular phylogenies of the four main sponge lineages (Classes), that is, Demospongiae, Hexactinellida, Calcarea, and Homoscleromorpha, in detail. While classical systematic systems are largely congruent with molecular phylogenies in the class Hexactinellida and in certain parts of Demospongiae and Homoscleromorpha, the high degree of incongruence in the class Calcarea still represents a challenge. We highlight future areas of research to fill existing gaps in our knowledge. By reviewing sponge development in an evolutionary and phylogenetic context, we support previous suggestions that sponge larvae share traits and complexity with eumetazoans and that the simple sedentary adult lifestyle of sponges probably reflects some degree of secondary simplification. In summary, while deep sponge phylogenetics has made many advances in the past years, considerable efforts are still required to achieve a

  14. Phylogeny and disjunct distribution: evolution of Saintpaulia (Gesneriaceae).

    Möller, M; Cronk, Q C

    1997-01-01

    The molecular phylogeny of African violets (Saintpaulia H. Wendl.), based on ribosomal DNA internal transcribed spacer (ITS) sequences, follows the disjunct biogeography of the genus. Sequence analysis by parsimony of 19 accessions, representing 17 currently recognized Saintpaulia species, resulted in four trees of 182 steps. The first major division is between S. goetzeana, from the Uluguru Mts, Tanzania, and the rest of the genus. The basal position of S. goetzeana, and its putative primiti...

  15. The higher-level phylogeny of Archosauria (Tetrapoda:Diapsida)

    Brusatte, S. L.; Benton, M. J.; Desojo, J.B.; Langer, M.C.

    2010-01-01

    Crown group Archosauria, which includes birds, dinosaurs, crocodylomorphs, and several extinct Mesozoic groups, is a primary division of the vertebrate tree of life. However, the higher-level phylogenetic relationships within Archosauria are poorly resolved and controversial, despite years of study. The phylogeny of crocodile-line archosaurs (Crurotarsi) is particularly contentious, and has been plagued by problematic taxon and character sampling. Recent discoveries and renewed focus on archo...

  16. Phylogeny of Rosellinia capetribulensis sp. nov. and its allies (Xylariaceae)

    Bahl, J; Jeewon, R; Hyde, KD

    2005-01-01

    A new Rosellinia species, R. capetribulensis isolated from Calamus sp. in Australia is described. R. capetribulensis is characterized by perithecia immersed within a carbonaceous stroma surrounded by subiculum-like hyphae, asci with large, barrel-shaped amyloid apical apparatus and large dark brown spores. Morphologically, R. capetribulensis appears to be similar to R. bunodes, R. markhamiae and R. megalospora. To gain further insights into the phylogeny of this new taxon we analyzed the ITS-...

  17. Improvement of molecular phylogenetic inference and the phylogeny of Bilateria

    Lartillot, Nicolas; Philippe, Hervé

    2008-01-01

    Inferring the relationships among Bilateria has been an active and controversial research area since Haeckel. The lack of a sufficient number of phylogenetically reliable characters was the main limitation of traditional phylogenies based on morphology. With the advent of molecular data, this problem has been replaced by another one, statistical inconsistency, which stems from an erroneous interpretation of convergences induced by multiple changes. The analysis of alignments rich in both gene...

  18. Phylogeny, diet, and cranial integration in australodelphian marsupials.

    Anjali Goswami

    Full Text Available Studies of morphological integration provide valuable information on the correlated evolution of traits and its relationship to long-term patterns of morphological evolution. Thus far, studies of morphological integration in mammals have focused on placentals and have demonstrated that similarity in integration is broadly correlated with phylogenetic distance and dietary similarity. Detailed studies have also demonstrated a significant correlation between developmental relationships among structures and adult morphological integration. However, these studies have not yet been applied to marsupial taxa, which differ greatly from placentals in reproductive strategy and cranial development and could provide the diversity necessary to assess the relationships among phylogeny, ecology, development, and cranial integration. This study presents analyses of morphological integration in 20 species of australodelphian marsupials, and shows that phylogeny is significantly correlated with similarity of morphological integration in most clades. Size-related correlations have a significant affect on results, particularly in Peramelia, which shows a striking decrease in similarity of integration among species when size is removed. Diet is not significantly correlated with similarity of integration in any marsupial clade. These results show that marsupials differ markedly from placental mammals in the relationships of cranial integration, phylogeny, and diet, which may be related to the accelerated development of the masticatory apparatus in marsupials.

  19. Novel mutation in 16S rRNA associated with streptomycin dependence in Mycobacterium tuberculosis.

    Honoré, N; Marchal, G.; Cole, S T

    1995-01-01

    Molecular characterization of a streptomycin-dependent mutant of Mycobacterium tuberculosis revealed the presence of a novel mutation in the rrs gene encoding 16S rRNA. Insertion of an additional cytosine in the 530 loop of 16S rRNA, a region known to be involved in streptomycin susceptibility and resistance, was associated with streptomycin dependence.

  20. A molecular phylogeny of rose chafers (Coleoptera: Scarabaeidae: Cetoniinae) reveals a complex and concerted morphological evolution related to their flight mode.

    Šípek, Petr; Fabrizi, Silvia; Eberle, Jonas; Ahrens, Dirk

    2016-08-01

    Rose chafers (Cetoniinae) are a large group of flower visitors within the pleurostict Scarabaeidae that are characterized by their distinctive flight mode with nearly closed forewings. Despite their popularity, this is the first study to use molecular data to infer their phylogenetic relationships. We used partial gene sequences for 28S rRNA, cytochrome oxidase I (cox1) and 16S rRNA (rrnL) for 299 species, representing most recognized subfamilies of Scarabaeidae, including 125 species of Cetoniinae. Combined analyses using maximum parsimony, maximum likelihood and Bayesian inferences recovered Cetoniinae as monophyletic in all analyses, with the sister clade composed of Rutelinae and Dynastinae. Rutelinae was always recovered as paraphyletic with respect to Dynastinae. Trichiini sensu lato (s.l.) was recovered as a polyphyletic clade, while Cetoniini s.l. was recovered as paraphyletic. The inferred topologies were also supported by site bootstrapping of the ML trees. With the exception of Cremastochelini, most tribes of Cetoniinae were poly- or paraphyletic, indicating the critical need for a careful revision of rose chafer classification. Analysis of elytral base structure (including 11 scored characters) in the context of phylogeny, revealed a complex, concerted and rapid transformation of the single trait elements linked to a modified flight mode with closed elytra. This appears to be unlinked to the lateral sinuation of the elytra, which originated independently several times at later stages in the evolution of the group. PMID:27165937

  1. Subnuclear partitioning of rRNA genes between the nucleolus and nucleoplasm reflects alternative epiallelic states

    Pontvianne, Frederic; Blevins, Todd; Chandrasekhara, Chinmayi; Mozgová, Iva; Hassel, Christiane; Pontes, Olga M.F.; Tucker, Sarah; Mokroš, Petr; Muchová, Veronika; Fajkus, Jiří; Pikaard, Craig S.

    2013-01-01

    Eukaryotes can have thousands of 45S ribosomal RNA (rRNA) genes, many of which are silenced during development. Using fluorescence-activated sorting techniques, we show that active rRNA genes in Arabidopsis thaliana are present within sorted nucleoli, whereas silenced rRNA genes are excluded. DNA methyltransferase (met1), histone deacetylase (hda6), or chromatin assembly (caf1) mutants that disrupt silencing abrogate this nucleoplasmic–nucleolar partitioning. Bisulfite sequencing data indicate that active nucleolar rRNA genes are nearly completely demethylated at promoter CGs, whereas silenced genes are nearly fully methylated. Collectively, the data reveal that rRNA genes occupy distinct but changeable nuclear territories according to their epigenetic state. PMID:23873938

  2. CVTree3 Web Server for Whole-genome-based and Alignment-free Prokaryotic Phylogeny and Taxonomy

    Guanghong Zuo; Bailin Hao

    2015-01-01

    A faithful phylogeny and an objective taxonomy for prokaryotes should agree with each other and ultimately follow the genome data. With the number of sequenced genomes reaching tens of thousands, both tree inference and detailed comparison with taxonomy are great challenges. We now provide one solution in the latest Release 3.0 of the alignment-free and whole-genome-based web server CVTree3. The server resides in a cluster of 64 cores and is equipped with an interactive, collapsible, and expandable tree display. It is capable of comparing the tree branching order with prokaryotic classification at all taxonomic ranks from domains down to species and strains. CVTree3 allows for inquiry by taxon names and trial on lineage modifications. In addition, it reports a summary of monophyletic and non-monophyletic taxa at all ranks as well as produces print-quality subtree figures. After giving an overview of retrospective verification of the CVTree approach, the power of the new server is described for the mega-classification of prokaryotes and determination of taxonomic placement of some newly-sequenced genomes. A few discrepancies between CVTree and 16S rRNA analyses are also summarized with regard to possible taxonomic revisions. CVTree3 is freely accessible to all users at http://tlife.fudan.edu.cn/cvtree3/without login requirements.

  3. The complete mitochondrial genome of the Atylotus miser (Diptera: Tabanomorpha: Tabanidae), with mitochondrial genome phylogeny of lower Brachycera (Orthorrhapha).

    Wang, Kai; Li, Xuankun; Ding, Shuangmei; Wang, Ning; Mao, Meng; Wang, Mengqing; Yang, Ding

    2016-07-15

    Brachycera is a clade with over 80,000 described species and originated from the Mesozoic, and its larvae employ comprehensive feeding strategies. The phylogeny of the lower Brachycera has been studied intensively over the past decades. In order to supplement the lack of genetic data in this important group, we sequenced the complete mitochondrial (mt) genome of Atylotus miser as well as the nearly complete mt genomes of another 11 orthorrhaphous flies. The mt genome of A. miser is 15,858bp, which is typical of Diptera, with 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes and a 993bp control region. The rest of the orthorrhaphous mt genomes in our study have the similar structure with A. miser. Additionally, we conducted a phylogenetic analysis of 20 mt genomes using Maximum-likelihood and Bayesian methods in order to reconstruct the evolutionary relationship of Orthorrhapha. The results show that all infraorders of Brachycera are monophyletic, and a relationship of Tabanomorpha+((Xylophagomorpha+Stratiomyomorpha)+Muscomorpha) has been proposed. Within Xylophagomorpha, Nemestrinoidae forms the sister group of Xylophagidae. PMID:27063560

  4. Complete mitochondrial genome of Bactrocera arecae (Insecta: Tephritidae) by next-generation sequencing and molecular phylogeny of Dacini tribe.

    Yong, Hoi-Sen; Song, Sze-Looi; Lim, Phaik-Eem; Chan, Kok-Gan; Chow, Wan-Loo; Eamsobhana, Praphathip

    2015-01-01

    The whole mitochondrial genome of the pest fruit fly Bactrocera arecae was obtained from next-generation sequencing of genomic DNA. It had a total length of 15,900 bp, consisting of 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and a non-coding region (A + T-rich control region). The control region (952 bp) was flanked by rrnS and trnI genes. The start codons included 6 ATG, 3 ATT and 1 each of ATA, ATC, GTG and TCG. Eight TAA, two TAG, one incomplete TA and two incomplete T stop codons were represented in the protein-coding genes. The cloverleaf structure for trnS1 lacked the D-loop, and that of trnN and trnF lacked the TΨC-loop. Molecular phylogeny based on 13 protein-coding genes was concordant with 37 mitochondrial genes, with B. arecae having closest genetic affinity to B. tryoni. The subgenus Bactrocera of Dacini tribe and the Dacinae subfamily (Dacini and Ceratitidini tribes) were monophyletic. The whole mitogenome of B. arecae will serve as a useful dataset for studying the genetics, systematics and phylogenetic relationships of the many species of Bactrocera genus in particular, and tephritid fruit flies in general. PMID:26472633

  5. Incongruent gene trees, complex evolutionary processes, and the phylogeny of a group of North American minnows (Hybognathus Agassiz 1855).

    Moyer, G R; Remington, R K; Turner, T F

    2009-03-01

    Hybognathus is a putatively monophyletic group of North American minnows containing seven extant species. Although much is known about the taxonomy, biology, and life history of Hybognathus species, their phylogenetic relations with each other remain unclear. We address this problem with partial sequences of mitochondrial cytochrome-b, 16S rRNA, and ND4 mtDNA genes and nuclear growth hormone (GH) and S7 introns from representatives of all Hybognathus species and four outgroup taxa. Phylogenetic analyses of these data corroborated previous studies on the monophyly of seven recognized species of Hybognathus, and indicated weak support for monophyly of the genus. Topological tests, however, revealed significant (all P<0.001) conflict among molecular data sets. Ad hoc removal of taxa from topologies and subsequent testing indicated that incongruence was localized to two specific ingroup taxa (H. hayi and H. regius) and suggested that the conflict is a function of underlying processes that have generated the observed phylogenetic patterns. Hybridization (ancestral), which is commonplace in cyprinids, may best explain topological disagreements among datasets; however, retention of ancestral polymorphism and natural selection remain as alternative hypotheses. Our results highlight methodological and topological problems associated with estimating interspecific phylogenies from multiple genes. PMID:19041406

  6. Localization of 18S ribosomal genes in suckermouth armoured catfishes Loricariidae (Teleostei, Siluriformes with discussion on the Ag-NOR evolution

    Anderson Alves

    2012-09-01

    Full Text Available The family Loricariidae with about 690 species divided into six subfamilies, is one of the world’s largest fish families. Cytogenetic studies conducted in the family showed that among 90 species analyzed the diploid number ranges from 2n=38 in Ancistrus sp. to 2n=96 in Hemipsilichthys gobio Luetken, 1874. In the present study, fluorescence in situ hybridization (FISH was employed to determine the chromosomal localization of the 18S rDNA gene in four suckermouth armoured catfishes: Kronichthys lacerta (Nichols, 1919, Pareiorhaphis splendens (Bizerril, 1995, Liposarcus multiradiatus (Hancock, 1828 and Hypostomus prope plecostomus (Linnaeus, 1758. All species analyzed showed one chromosome pair with 18S rDNA sequences, as observed in the previous Ag-NORs analyses. The presence of size and numerical polymorphism was observed and discussed, with proposing a hypothesis of the Ag-NOR evolution in Loricariidae.

  7. Performance Based Logistics (PBL) for the FA-18/S-3/P-3/C-2 auxiliary power unit (APU) at Honeywell: an applied analysis

    Landreth, Clifford J.; Corporon, Laura L.; Wilhelm, Richard H.

    2005-01-01

    The purpose of this MBA project is to evaluate and assess the metrics, incentives and other terms and conditions of the Performance Based Logistics (PBL) contract between Naval Aviation Inventory Control Point (NAVICP) and Honeywell in support of FA-18/S-3/P-3/C-2 Auxiliary Power Unit (APU) to determine if the contractual terms and conditions established are effective in facilitating and encouraging the full potential of PBL savings and improved performance. PBL is an acquisition reform initi...

  8. The spatial and temporal distribution of microalgae in the South China Sea: evidence from GIS-based analysis of 18S rDNA sequences

    LI LvYan; HUANG QiaoJuan; WU ShuHui; LIN Duan; CHEN JiaHui; CHEN YueQin

    2008-01-01

    The purpose of this study was to estimate the spatial and temporal variation of microalgae in the South China Sea and to demonstrate the environmental factors controlling the diversity of microalgae by GIS (geographic information system)-based analysis of 18S rDNA sequences. Six 18S rDNA libraries were constructed from environmental samples collected at different sites in the study area, and more than 600 18S rDNA sequences were determined. The rDNA sequence data were then analyzed by DIVA-GIS software to display the spatial and temporal variation of phytoplankton's composition. It was shown that the autotrophic eukaryotic plankton dominated over the heterotrophic cells in most of our clone libraries, and the dominating phytoplankton was Dinophyceae except for Bacillariophyta at the Xiamen harbor. The percentages of these two groups were controlled by water temperature and salinity. Our results also revealed that the species composition of Chlorophyta showed a close relationship with latitude, changing from Prasinophyceae at the high latitude to Trebouxiophyceae at the low latitude. Several newly classified picoplankton lineages were first uncovered in the South China Sea, including the pico-sized green alga Ostreococcus sp. and Picochlorum eukaryotum, and picobiliphytes, which was just discovered in 2007 with unknown affinities to other eukaryotes. Their spatial and temporal variation were also analyzed and discussed.

  9. The spatial and temporal distribution of microalgae in the South China Sea:evidence from GIS-based analysis of 18S rDNA sequences

    2008-01-01

    The purpose of this study was to estimate the spatial and temporal variation of microalgae in the South China Sea and to demonstrate the environmental factors controlling the diversity of microalgae by GIS (geographic information system)-based analysis of 18S rDNA sequences. Six 18S rDNA libraries were constructed from environmental samples collected at different sites in the study area, and more than 600 18S rDNA sequences were determined. The rDNA sequence data were then analyzed by DIVA-GIS software to display the spatial and temporal variation of phytoplankton’s composition. It was shown that the autotrophic eukaryotic plankton dominated over the heterotrophic cells in most of our clone libraries, and the dominating phytoplankton was Dinophyceae except for Bacillariophyta at the Xiamen harbor. The percentages of these two groups were controlled by water temperature and salinity. Our results also revealed that the species composition of Chlorophyta showed a close relationship with latitude, changing from Prasinophyceae at the high latitude to Trebouxiophyceae at the low latitude. Several newly classified picoplankton lineages were first uncovered in the South China Sea, including the pico-sized green alga Ostreococcus sp. and Picochlorum eukaryotum, and picobiliphytes, which was just discovered in 2007 with unknown affinities to other eukaryotes. Their spatial and temporal variation were also analyzed and discussed.

  10. The small subunit rRNA gene sequence of the chonotrich Chilodochona carcini Jankowski, 1973 confirms chonotrichs as a dysteriid-derived clade (Phyllopharyngea, Ciliophora).

    Lynn, Denis H

    2016-08-01

    The chonotrichs are sessile ciliated protozoa that are ectosymbiotic on the body parts of a variety of crustaceans. They have long been considered a separate group because their sessile habit has resulted in the evolution of a very divergent body form and reproductive strategy compared to free-living ciliates. In the mid-20th Century, the free-living dysteriid cyrtophorian ciliates were proposed as a potential sister clade because the chonotrich bud or daughter cell showed similarities during division morphogenesis (i.e. ontogeny) to these free-living dysteriids. A single small subunit (SSU) rRNA gene sequence is available for the chonotrich Isochona sp. However, its authenticity has recently been questioned, and the placement of this sequence within the dysteriid clade has added to this controversy. In this report, the SSUrRNA gene sequence of the chonotrich Chilodochona carcini, ectosymbiotic on the green crab Carcinus maenas, is provided. Topology testing of the SSUrRNA gene phylogeny, constructed by Bayesian Inference, robustly supports the sister-group relationship of Isochona sp. and Chilodochona carcini, the monophyly of these two chonotrichs, and the divergence of the chonotrich clade within the dysteriid clade. PMID:27151876

  11. Host specificity, pathogenicity, and mixed infections/nof trypanoplasms from freshwater fishes

    Losev, A.; Grybchuk-Ieremenko, A.; Kostygov, A.Y.; Lukeš, Julius; Yurchenko, V.

    2015-01-01

    Roč. 114, č. 3 (2015), s. 1071-1078. ISSN 0932-0113 R&D Projects: GA MŠk(CZ) EE2.3.30.0032 Institutional support: RVO:60077344 Keywords : Trypanoplasma * Freshwater fish * Mixed infections * Phylogeny * 18S rRNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.098, year: 2014

  12. High prevalence of trypanosome co-infections in freshwater fishes

    Grybchuk-Ieremenko, A.; Losev, A.; Kostygov, A.Y.; Lukeš, Julius; Yurchenko, Vyacheslav

    2014-01-01

    Roč. 61, č. 6 (2014), s. 495-504. ISSN 0015-5683 R&D Projects: GA MŠk(CZ) EE2.3.30.0032 Institutional support: RVO:60077344 Keywords : Trypanosoma, * blood parasites * mixed infections * phylogeny * 18S rRNA * teleosts Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.147, year: 2014

  13. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    Cangelosi, G A; Brabant, W H

    1997-07-01

    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA probes to measure steady-state cellular pre-16S rRNA pools during growth state transitions in Escherichia coli. Pre-16S rRNA became undetectable when cells entered the stationary phase on rich medium and was replenished upon restoration of favorable growth conditions. These fluctuations were of much greater magnitude than concurrent fluctuations in the mature 16S rRNA pool. The extent of pre-16S rRNA depletion depended upon the circumstances limiting growth. It was significantly more pronounced in carbon-energy-starved cells than in nitrogen-starved cells or in cells treated with energy uncouplers. In the presence of the transcriptional inhibitor rifampin, rates of pre-16S rRNA depletion in carbon-energy-starved cells and nitrogen-starved cells were similar, suggesting that the difference between these conditions resides primarily at the level of pre-rRNA synthesis. Chloramphenicol, which inhibits the final steps in rRNA maturation, halted pre-16S rRNA depletion under all conditions. The data show that E. coli cells continue to process pre-rRNA after growth and rrn operon transcription cease, leading to drainage of the pre-rRNA pool. This supports the feasibility of using pre-rRNA-targeted probes to monitor bacterial growth in natural systems, with the caveat that patterns of pre-rRNA depletion vary with the conditions limiting growth. PMID:9226253

  14. Sequencing of 16S rRNA Gene: A Rapid Tool for Identification of Bacillus anthracis

    Sacchi, Claudio T.; Whitney, Anne M.; Mayer, Leonard W.; Morey, Roger; Steigerwalt, Arnold; Boras, Ariana; Weyant, Robin S.; Popovic, Tanja

    2002-01-01

    In a bioterrorism event, a tool is needed to rapidly differentiate Bacillus anthracis from other closely related spore-forming Bacillus species. During the recent outbreak of bioterrorism-associated anthrax, we sequenced the 16S rRNA generom these species to evaluate the potential of 16S rRNA gene sequencing as a diagnostic tool. We found eight distinct 16S types among all 107 16S rRNA gene seqs fuences that differed from each other at 1 to 8 positions (0.06% to 0.5%). All 86 B. anthracis had...

  15. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O139 outbreak based on the intergenomic heterogeneity of the 16S-23S rRNA intergenic spacer regions

    Atreyi Ghatak; Anasuya Majumdar; Ranajit K Ghosh

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O139 outbreak. ISR classes ‘a’ and ‘g’ were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O139 serogroup and post-O139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  16. A Simple Characterization of the Minimal Obstruction Sets for Three-State Perfect Phylogenies

    Shutters, Brad

    2011-01-01

    Lam, Gusfield, and Sridhar (2009) showed that a set of three-state characters has a perfect phylogeny if and only if every subset of three characters has a perfect phylogeny. They also gave a complete characterization of the sets of three three-state characters that do not have a perfect phylogeny. However, it is not clear from their characterization how to find a subset of three characters that does not have a perfect phylogeny without testing all triples of characters. In this note, we build upon their result by giving a simple characterization of when a set of three-state characters does not have a perfect phylogeny that can be inferred from testing all pairs of characters.

  17. PhyloGrid: a development for a workflow in Phylogeny

    Montes, Esther; Mayo, Rafael

    2010-01-01

    In this work we present the development of a workflow based on Taverna which is going to be implemented for calculations in Phylogeny by means of the MrBayes tool. It has a friendly interface developed with the Gridsphere framework. The user is able to define the parameters for doing the Bayesian calculation, determine the model of evolution, check the accuracy of the results in the intermediate stages as well as do a multiple alignment of the sequences previously to the final result. To do this, no knowledge from his/her side about the computational procedure is required.

  18. Pollination, biogeography and phylogeny of oceanic island bellflowers (Campanulaceae)

    Olesen, Jens Mogens; Alarcón, M.; Ehlers, Bodil;

    2012-01-01

    the species, and at least C. jacobaea had both insect- and self-pollination. Several morphological traits were interpreted as adaptations to bird and lizard pollination, e.g. all had a robust flower morphology and, in addition, bird-pollinated species were scentless, whereas lizard-pollinated species...... of these species and their relatives were gathered from atpB, matK, rbcL and trnL-F regions, building the most complete phylogeny of Campanulaceae to date. Six of the island bellflower species were bird-pollinated and two (A. vidalii and M. aurea) were lizard-pollinated. Insects also visited some of...

  19. PhyloGrid: a development for a workflow in Phylogeny

    Montes, Esther; Isea, Raul; Mayo, Rafael

    2010-01-01

    In this work we present the development of a workflow based on Taverna which is going to be implemented for calculations in Phylogeny by means of the MrBayes tool. It has a friendly interface developed with the Gridsphere framework. The user is able to define the parameters for doing the Bayesian calculation, determine the model of evolution, check the accuracy of the results in the intermediate stages as well as do a multiple alignment of the sequences previously to the final result. To do t...

  20. The comparison of yeast-like symbionts in the brown planthopper,Nilaparvata lugens St(a)l with different virulence based on partial 18S rDNA sequence%褐飞虱不同致害性种群体内共生菌 18S rDNA部分序列比较

    张珏锋; 吕仲贤; 陈法军; 陈建明; 郑许松; 徐红星; 陈列忠; 俞晓平

    2006-01-01

    分离纯化了褐飞虱3种不同致害性种群体内类酵母共生菌(yeast-like symbionts,YLS),并对其18S rDNA基因序列进行了比较.结果表明,褐飞虱3种不同致害性种群体内类酵母共生菌18S rDNA均扩增出600 bp左右的片断.依据获得的18S rDNA特异性序列,结合已知真菌的18S rDNA部分序列,构建了不同宿主的YLS分子系统树.结果显示,褐飞虱3种不同致害性种群体内的YLS同属子囊菌亚门(Ascomycotina)的核菌纲(Pyrenomycetes),并与此纲中的Hypomyces chrysospermus亲缘关系相对最近.

  1. Methylation pattern of the intergenic spacer of rRNA genes in excised cotyledons of Cucurbita pepo L. (Zucchini) after hormone treatment

    High molecular mass genomic DNA was isolated from excised marrow cotyledons (Cucurbita pepo L. zucchini) treated with 6-benzyladenine (BA) of methyl ester of jasmonic acid (MeJA) for 24 h in darkness. DNA purified from contaminating polysaccharides with Celite column was completely digested with the restriction enzyme Eco RI and the changes in the methylation pattern of the intergenic spacer (IGS) of r RNA genes were studied after subsequent digestion with the couple of restriction enzymes-isoschizomers MSP I and Hpa II by the method of 'indirect end labelling'. As rDNA units probe a cloned 32P-labelled Eco RI 2.1 kb fragment spanning in the most part of 18S r RNA gene from flax rDNA was used. Results showed heavy methylation of the rRNA genes. As judged from the almost total lack of digestion with HPA II, there were no methylation free regions in repeated rDNA units or little if any were observed. A hypo methylated Hps II site was detected near the promoter region in some of the repeats. Digestion with Msp I affected nearly 50% of the repeating units. The Msp digestion fragments of the 6.2 kb Eco RI fragment of r DNA were few in number and large in size (0.5 - 2.5 kb). This suggested that in addition with -CpG- sequences, methylation in -CpNpG- might not be random. Methylation pattern in IGS was not changed upon treatment of the cotyledons in vivo with BA and MeJA. Thus, previously observed hormone-mediated effects on the eactivity of rRNA gene expression were not accompanied by any significant changes of the methylation pattern in IGS. (authors)

  2. Recognition determinants for proteins and antibiotics within 23S rRNA

    Douthwalte, S; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup;

    1995-01-01

    Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of...... molecular genetic and biochemical probing techniques, we have concentrated on regions of the rRNA that are connected with specific functions. These are located in different domains within the 23S rRNA and include the ribosomal GTPase-associated center in domain II, which contains the binding sites for r......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...

  3. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria

    Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.

    2015-01-01

    Roč. 15, APR 2015 (2015). ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EE - Microbiology , Virology Impact factor: 2.729, year: 2014

  4. Inhibition of Escherichia coli precursor-16S rRNA processing by mouse intestinal contents

    Licht, Tine Rask; Tolker-Nielsen, Tim; Holmstrøm, Kim; Krogfelt, Karen A.; Molin, Søren

    1999-01-01

    . We have applied fluorescence in situ hybridization of pre-16S rRNA to Escherichia coli cells growing in vitro in extracts from two different compartments of the mouse intestine: the caecal mucus layer, where E. coli grew rapidly, and the contents of the caecum, which supported much slower bacterial......The correlation between ribosome content and growth rate found in many bacterial species has proved useful for estimating the growth activity of individual cells by quantitative in situ rRNA hybridization. However, in dynamic environments, the stability of mature ribosomal RNA causes problems in...... using cellular rRNA contents for direct monitoring of bacterial growth activity in situ. In a recent paper, Cangelosi and Brabant suggested monitoring the content of precursors in rRNA synthesis (pre-rRNAs) as an alternative approach. These are rapidly broken down after the cessation of bacterial growth...

  5. Mutations in the 16S rRNA Genes of Helicobacter pylori Mediate Resistance to Tetracycline

    Trieber, Catharine A.; Taylor, Diane E.

    2002-01-01

    Low-cost and rescue treatments for Helicobacter pylori infections involve combinations of several drugs including tetracycline. Resistance to tetracycline has recently emerged in H. pylori. The 16S rRNA gene sequences of two tetracycline-resistant clinical isolates (MIC = 64 μg/ml) were determined and compared to the consensus H. pylori 16S rRNA sequence. One isolate had four nucleotide substitutions, and the other had four substitutions and two deletions. Natural transformation with the 16S ...

  6. 16S rRNA Mutation Associated with Tetracycline Resistance in a Gram-Positive Bacterium

    Ross, Jeremy I.; Eady, E Anne; Cove, Jonathan H.; Cunliffe, William J.

    1998-01-01

    A genetic basis for tetracycline resistance in cutaneous propionibacteria was suggested by comparing the nucleotide sequences of the 16S rRNA genes from 16 susceptible and 21 resistant clinical isolates and 6 laboratory-selected tetracycline-resistant mutants of a susceptible strain. Fifteen clinical isolates resistant to tetracycline were found to have cytosine instead of guanine at a position cognate with Escherichia coli 16S rRNA base 1058 in a region important for peptide chain terminatio...

  7. Functional interactions within 23S rRNA involving the peptidyltransferase center.

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S rRNA peptidyltransferase loop. All three base substitutions at position 2032 produce an erythromycin-hypersensitive phenotype. The 2032 substitutions were compared with and combined with a 12-bp deletion muta...

  8. Phylogeny and Evolution of Bracts and Bracteoles in Tacca (Dioscoreaceae)

    Ling Zhang; Hong-Tao Li; Lian-Ming Gao; Jun-Bo Yang; De-Zhu Li; Charles H. Cannon; Jin Chen; Qing-Jun Li

    2011-01-01

    Most species in the genus Tacca (Dioscoreaceae) feature green to black purple,conspicuous inflorescence involucral bracts with variable shapes,motile filiform appendages (bracteoles),and diverse types of inflorescence morphology.To infer the evolution of these inflorescence traits,we reconstructed the molecular phylogeny of the genus,using DNA sequences from one nuclear,one mitochondrial,and three plastid loci (Internal Transcribed Spacer (ITS),atpA,rbcL,trnL-F,and trnH-psbA).Involucres and bracteoles characters were mapped onto the phylogeny to analyze the sequence of inflorescence trait evolution.In all analyses,species with showy involucres and bracteoles formed the most derived clade,while ancestral Tacca had small and plain involucres and short bracteoles,namely less conspicuous inflorescence structures.Two of the species with the most elaborate inflorescence morphologies (T.chantrieri in southeast China and T.integrifolia in Tibet),are predominantly self-pollinated,indicating that these conspicuous floral displays have other functions rather than pollinator attraction.We hypothesize that the motile bracteoles and involucres may facilitate selfing; display photosynthesis in the dim understory,and protect flowers from herbivory.

  9. Refining the Y chromosome phylogeny with southern African sequences.

    Barbieri, Chiara; Hübner, Alexander; Macholdt, Enrico; Ni, Shengyu; Lippold, Sebastian; Schröder, Roland; Mpoloka, Sununguko Wata; Purps, Josephine; Roewer, Lutz; Stoneking, Mark; Pakendorf, Brigitte

    2016-05-01

    The recent availability of large-scale sequence data for the human Y chromosome has revolutionized analyses of and insights gained from this non-recombining, paternally inherited chromosome. However, the studies to date focus on Eurasian variation, and hence the diversity of early-diverging branches found in Africa has not been adequately documented. Here, we analyze over 900 kb of Y chromosome sequence obtained from 547 individuals from southern African Khoisan- and Bantu-speaking populations, identifying 232 new sequences from basal haplogroups A and B. We identify new clades in the phylogeny, an older age for the root, and substantially older ages for some individual haplogroups. Furthermore, while haplogroup B2a is traditionally associated with the spread of Bantu speakers, we find that it probably also existed in Khoisan groups before the arrival of Bantu speakers. Finally, there is pronounced variation in branch length between major haplogroups; in particular, haplogroups associated with Bantu speakers have significantly longer branches. Technical artifacts cannot explain this branch length variation, which instead likely reflects aspects of the demographic history of Bantu speakers, such as recent population expansion and an older average paternal age. The influence of demographic factors on branch length variation has broader implications both for the human Y phylogeny and for similar analyses of other species. PMID:27043341

  10. Phylogeny and biogeography of the fruit doves (Aves: Columbidae).

    Cibois, Alice; Thibault, Jean-Claude; Bonillo, Céline; Filardi, Christopher E; Watling, Dick; Pasquet, Eric

    2014-01-01

    We reconstruct the phylogeny of fruit doves (genus Ptilinopus) and allies with a dense sampling that includes almost all species, based on mitochondrial and nuclear sequence data. We evaluate the most likely biogeographic scenario for the evolution of this group that colonized many islands of the Pacific Ocean. We also investigate the evolution of one of the main plumage character of fruit doves (the color of the crown), and we propose several revisions of the group's systematics. All Ptilinopus taxa formed a monophyletic group that includes two morphologically distinct genera, Alectroenas and Drepanoptila, confirming a previous result found with less species and genes. The divergence time analysis suggests that the basal divergences within Ptilinopus dated to the Early Oligocene, and the biogeographic analysis indicates that fruit doves originated most probably from the proto New Guinea region. The earliest dispersals from the New Guinea region to Oceania occurred with the colonization of New Caledonia and Fiji. A large group of Polynesian species (Central and Eastern), as well as the three taxa found in Micronesia and four species from the Guinean-Moluccan region, form the "purpuratus" clade, the largest diversification of fruit doves within Oceania, which also has a New Guinean origin. However, the eastbound colonization of fruit doves was not associated with a significant increase of their diversification rate. Overall, the Melanesian region did not act as a cradle for fruit doves, in contrast to the New Guinea region which is found as the ancestral area for several nodes within the phylogeny. PMID:24012584

  11. Morphology and Phylogeny of Neoscytalidium orchidacearum sp. nov. (Botryosphaeriaceae)

    Huang, Shi-Ke; Tangthirasunun, Narumon; Phillips, Alan J. L.; Dai, Dong-Qin; Wanasinghe, Dhanushka N.; Wen, Ting-Chi; Bahkali, Ali H.; Hyde, Kevin D.

    2016-01-01

    A coelomycete with characters resembling the asexual morphs in the family Botryosphaeriaceae was isolated from a fallen leaf of an orchid collected in Thailand. Morphological and phylogenetic analyses placed the strain in Neoscytalidium. Phylogenetic relationships among Neoscytalidium species were inferred by analyzing internal transcribed spacers and large subunit of rRNA sequence data and indicate that our strain is a new species, which is introduced and illustrated herein as Neoscytalidium orchidacearum sp. nov.

  12. A new phylogeny and environmental DNA insight into paramyxids: an increasingly important but enigmatic clade of protistan parasites of marine invertebrates.

    Ward, Georgia M; Bennett, Martyn; Bateman, Kelly; Stentiford, Grant D; Kerr, Rose; Feist, Stephen W; Williams, Suzanne T; Berney, Cedric; Bass, David

    2016-09-01

    Paramyxida is an order of rhizarian protists that parasitise marine molluscs, annelids and crustaceans. They include notifiable pathogens (Marteilia spp.) of bivalves and other taxa of economic significance for shellfish production. The diversity of paramyxids is poorly known, particularly outside of commercially important hosts, and their phylogenetic position is unclear due to their extremely divergent 18S rDNA sequences. However, novel paramyxean lineages are increasingly being detected in a wide range of invertebrate hosts, and interest in the group is growing, marked by the first 'Paramyxean Working Group' Meeting held in Spain in February 2015. We review the diversity, host affiliations, and geographical ranges of all known paramyxids, present a comprehensive phylogeny of the order and clarify its taxonomy. Our phylogenetic analyses confirm the separate status of four genera: Paramarteilia, Marteilioides, Paramyxa and Marteilia. Further, as including M. granula in Marteilia would make the genus paraphyletic we suggest transferring this species to a new genus, Eomarteilia. We present sequence data for Paramyxa nephtys comb. n., a parasite of polychaete worms, providing morphological data for a clade of otherwise environmental sequences, sister to Marteilioides. Light and electron microscopy analyses show strong similarities with both Paramyxa and Paramyxoides, and we further discuss the validity of those two genera. We provide histological and electron microscopic data for Paramarteilia orchestiae, the type species of that genus originally described from the amphipod Orchestia; in situ hybridisation shows that Paramarteilia also infects crab species. We present, to our knowledge, the first known results of a paramyxid-specific environmental DNA survey of environmental (filtered water, sediment, etc.) and organismally-derived samples, revealing new lineages and showing that paramyxids are associated with a wider range of hosts and habitat types than previously

  13. Fungal community analysis in the deep-sea sediments of the Pacific Ocean assessed by comparison of ITS, 18S and 28S ribosomal DNA regions

    Xu, Wei; Luo, Zhu-Hua; Guo, Shuangshuang; Pang, Ka-Lai

    2016-03-01

    We investigated the diversity of fungal communities in 6 different deep-sea sediment samples of the Pacific Ocean based on three different types of clone libraries, including internal transcribed spacer (ITS), 18S rDNA, and 28S rDNA regions. A total of 1978 clones were generated from 18 environmental clone libraries, resulting in 140 fungal operational taxonomic units (OTUs), including 18 OTUs from ITS, 44 OTUs from 18S rDNA, and 78 OTUs from 28S rDNA gene primer sets. The majority of the recovered sequences belonged to diverse phylotypes of the Ascomycota and Basidiomycota. Additionally, our study revealed a total of 46 novel fungal phylotypes, which showed low similarities (<97%) with available fungal sequences in the GenBank, including a novel Zygomycete lineage, suggesting possible new fungal taxa occurring in the deep-sea sediments. The results suggested that 28S rDNA is an efficient target gene to describe fungal community in deep-sea environment.

  14. The effective expression of xylanase gene in Candida utilis by 18S rDNA targeted homologous recombination in pGLR9K.

    Wei, Wang; Hong-Lan, Yang; HuiFang, Bao; Daoyuan, Zhang; Qi-mu-ge, Shan; Woof, Andrew J

    2010-07-01

    In order to test whether 18S rDNA can influence positively xylanase gene effective expression in the yeast of Candida utilis, a targeting vector pGLR9K-XA was constructed by adding an interested gene xynA from Streptomyces olivaceoviridis into the vector pGLR9K which is constructed by ourselves. pGLR9K contains the 18S rDNA, GAP promoter and CYH resistance gene sequence, all of which is from C. utilis. Then the vector pGLR9K-XA was transformed into C. utilis. To test the vector and transformed system, PCR, Southern blot and DNS methods were used. The results showed that xylanase gene can be detected in the chromosome DNA of recombinant C. utilis and the enzyme activity of xylanase is up to 60 IU ml(-1) in the study. It is suggested that this system can be used to express exogenous genes in C. utilis as a bioreactors. This is the first report that xylanase gene was expressed in C. utilis. PMID:19731075

  15. Molecular phylogeny of the bivalve superfamily Galeommatoidea (Heterodonta, Veneroida reveals dynamic evolution of symbiotic lifestyle and interphylum host switching

    Goto Ryutaro

    2012-09-01

    Full Text Available Abstract Background Galeommatoidea is a superfamily of bivalves that exhibits remarkably diverse lifestyles. Many members of this group live attached to the body surface or inside the burrows of other marine invertebrates, including crustaceans, holothurians, echinoids, cnidarians, sipunculans and echiurans. These symbiotic species exhibit high host specificity, commensal interactions with hosts, and extreme morphological and behavioral adaptations to symbiotic life. Host specialization to various animal groups has likely played an important role in the evolution and diversification of this bivalve group. However, the evolutionary pathway that led to their ecological diversity is not well understood, in part because of their reduced and/or highly modified morphologies that have confounded traditional taxonomy. This study elucidates the taxonomy of the Galeommatoidea and their evolutionary history of symbiotic lifestyle based on a molecular phylogenic analysis of 33 galeommatoidean and five putative galeommatoidean species belonging to 27 genera and three families using two nuclear ribosomal genes (18S and 28S ribosomal DNA and a nuclear (histone H3 and mitochondrial (cytochrome oxidase subunit I protein-coding genes. Results Molecular phylogeny recovered six well-supported major clades within Galeommatoidea. Symbiotic species were found in all major clades, whereas free-living species were grouped into two major clades. Species symbiotic with crustaceans, holothurians, sipunculans, and echiurans were each found in multiple major clades, suggesting that host specialization to these animal groups occurred repeatedly in Galeommatoidea. Conclusions Our results suggest that the evolutionary history of host association in Galeommatoidea has been remarkably dynamic, involving frequent host switches between different animal phyla. Such an unusual pattern of dynamic host switching is considered to have resulted from their commensalistic lifestyle, in

  16. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  17. Echinothurioid phylogeny and the phylogenetic significance of Kamptosoma (Echinoidea: Echinodermata)

    Mooi, Rich; Constable, Heather; Lockhart, Susanne; Pearse, John

    2004-07-01

    The Echinothurioida is an unusual group of regular sea urchins that are characterized by soft, flexible tests and in some cases, hoof-shaped spines used for locomotion across soft, deep-sea sediments. As far as is known, all species are armed with venom-bearing spines that have been known to cause serious injury in humans. There are 50 species of echinothurioids arranged in 11 extant genera. Their fossil record is very poor, being limited to two additional fossil taxa (one of which is only tentatively considered an echinothurioid), two assigned to extant taxa, and three of more dubious affinity. With very few exceptions, only disjointed plates are preserved—and those very rarely. Today, echinothurioids are found around the globe from as far north as the Arctic Circle and as far south as Antarctica, with a bathymetric distribution ranging from inshore on coral reefs to depths of almost 5000 m. The majority of species are characteristic of the deep sea, and consequently little is known about these urchins. Many are known only from type and associated material. Their fragile tests, deep benthic habitat, and rarity make it difficult to develop a complete picture of their morphology, and as we demonstrate, breakage of the test can lead to misinterpretations of plate architecture in some taxa. The sole Antarctic species, Kamptosoma asterias, is usually considered an echinothurioid, but its unusual morphology has made its position difficult to ascertain. In addition, previous genus-level phylogenies do not test the monophyly of the genera, and some studies even suggest that the echinothurioids themselves do not constitute a monophyletic group. This study focuses on finding a species level phylogeny of the echinothurioids in order to perform these tests, and to place the enigmatic Kamptosoma in a phylogenetic context that determines whether it is indeed an echinothurioid, and if so, to which clade it is most closely related. The present analysis surveys ambulacral

  18. Multigenic phylogeny and analysis of tree incongruences in Triticeae (Poaceae

    Guilhaumon Claire

    2011-06-01

    Full Text Available Abstract Background Introgressive events (e.g., hybridization, gene flow, horizontal gene transfer and incomplete lineage sorting of ancestral polymorphisms are a challenge for phylogenetic analyses since different genes may exhibit conflicting genealogical histories. Grasses of the Triticeae tribe provide a particularly striking example of incongruence among gene trees. Previous phylogenies, mostly inferred with one gene, are in conflict for several taxon positions. Therefore, obtaining a resolved picture of relationships among genera and species of this tribe has been a challenging task. Here, we obtain the most comprehensive molecular dataset to date in Triticeae, including one chloroplastic and 26 nuclear genes. We aim to test whether it is possible to infer phylogenetic relationships in the face of (potentially large-scale introgressive events and/or incomplete lineage sorting; to identify parts of the evolutionary history that have not evolved in a tree-like manner; and to decipher the biological causes of gene-tree conflicts in this tribe. Results We obtain resolved phylogenetic hypotheses using the supermatrix and Bayesian Concordance Factors (BCF approaches despite numerous incongruences among gene trees. These phylogenies suggest the existence of 4-5 major clades within Triticeae, with Psathyrostachys and Hordeum being the deepest genera. In addition, we construct a multigenic network that highlights parts of the Triticeae history that have not evolved in a tree-like manner. Dasypyrum, Heteranthelium and genera of clade V, grouping Secale, Taeniatherum, Triticum and Aegilops, have evolved in a reticulated manner. Their relationships are thus better represented by the multigenic network than by the supermatrix or BCF trees. Noteworthy, we demonstrate that gene-tree incongruences increase with genetic distance and are greater in telomeric than centromeric genes. Together, our results suggest that recombination is the main factor

  19. Pyvolve: A Flexible Python Module for Simulating Sequences along Phylogenies.

    Stephanie J Spielman

    Full Text Available We introduce Pyvolve, a flexible Python module for simulating genetic data along a phylogeny using continuous-time Markov models of sequence evolution. Easily incorporated into Python bioinformatics pipelines, Pyvolve can simulate sequences according to most standard models of nucleotide, amino-acid, and codon sequence evolution. All model parameters are fully customizable. Users can additionally specify custom evolutionary models, with custom rate matrices and/or states to evolve. This flexibility makes Pyvolve a convenient framework not only for simulating sequences under a wide variety of conditions, but also for developing and testing new evolutionary models. Pyvolve is an open-source project under a FreeBSD license, and it is available for download, along with a detailed user-manual and example scripts, from http://github.com/sjspielman/pyvolve.

  20. Pyvolve: A Flexible Python Module for Simulating Sequences along Phylogenies.

    Spielman, Stephanie J; Wilke, Claus O

    2015-01-01

    We introduce Pyvolve, a flexible Python module for simulating genetic data along a phylogeny using continuous-time Markov models of sequence evolution. Easily incorporated into Python bioinformatics pipelines, Pyvolve can simulate sequences according to most standard models of nucleotide, amino-acid, and codon sequence evolution. All model parameters are fully customizable. Users can additionally specify custom evolutionary models, with custom rate matrices and/or states to evolve. This flexibility makes Pyvolve a convenient framework not only for simulating sequences under a wide variety of conditions, but also for developing and testing new evolutionary models. Pyvolve is an open-source project under a FreeBSD license, and it is available for download, along with a detailed user-manual and example scripts, from http://github.com/sjspielman/pyvolve. PMID:26397960

  1. Linguistic phylogenies support back-migration from Beringia to Asia.

    Mark A Sicoli

    Full Text Available Recent arguments connecting Na-Dene languages of North America with Yeniseian languages of Siberia have been used to assert proof for the origin of Native Americans in central or western Asia. We apply phylogenetic methods to test support for this hypothesis against an alternative hypothesis that Yeniseian represents a back-migration to Asia from a Beringian ancestral population. We coded a linguistic dataset of typological features and used neighbor-joining network algorithms and Bayesian model comparison based on Bayes factors to test the fit between the data and the linguistic phylogenies modeling two dispersal hypotheses. Our results support that a Dene-Yeniseian connection more likely represents radiation out of Beringia with back-migration into central Asia than a migration from central or western Asia to North America.

  2. Phylogeny and evolution of Perezia (Asteraceae: Mutisieae: Nassauviinae)

    Beryl B. SIMPSON; Mary T. K. ARROYO; Sandra SIPE; Marta DIAS de MORAES; Joshua McDILL

    2009-01-01

    A molecular phylogenetic analysis of most of the species of Perezia reveals that, as traditionally defined, the genus is not monophyletic with two species more closely related to Nassauvia than to Perezia. In addition, our results show that Burkartia (Perezia) lanigera is related to Acourtia and is the only member of that clade in South America. The remaining species are monophyletic and show a pattern of an early split between a western temperate and an eastern subtropical clade of species. Within the western clade, the phylogeny indicates a pattern of diversification that proceeded from southern, comparatively low-elevation habitats to southern high-elevation habitats, and ultimately into more northern high-elevation habitats. The most derived clades are found in the high central Andes, where significant radiation has occurred.

  3. Future trypanosomatid phylogenies: refined homologies, supertrees and networks

    Stothard JR

    2000-01-01

    Full Text Available There has been good progress in inferring the evolutionary relationships within trypanosomes from DNA data as until relatively recently, many relationships have remained rather speculative. Ongoing molecular studies have provided data that have adequately shown Trypanosoma to be monophyletic and, rather surprisingly, that there are sharply contrasting levels of genetic variation within and between the major trypanosomatid groups. There are still, however, areas of research that could benefit from further development and resolution that broadly fall upon three questions. Are the current statements of evolutionary homology within ribosomal small sub-unit genes in need of refinement? Can the published phylograms be expanded upon to form `supertrees' depicting further relationships? Does a bifurcating tree structure impose an untenable dogma upon trypanosomatid phylogeny where hybridisation or reticulate evolutionary steps have played a part? This article briefly addresses these three questions and, in so doing, hopes to stimulate further interest in the molecular evolution of the group.

  4. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

    2011-03-14

    Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

  5. Inference of Tumor Phylogenies with Improved Somatic Mutation Discovery

    Salari, Raheleh

    2013-01-01

    Next-generation sequencing technologies provide a powerful tool for studying genome evolution during progression of advanced diseases such as cancer. Although many recent studies have employed new sequencing technologies to detect mutations across multiple, genetically related tumors, current methods do not exploit available phylogenetic information to improve the accuracy of their variant calls. Here, we present a novel algorithm that uses somatic single nucleotide variations (SNVs) in multiple, related tissue samples as lineage markers for phylogenetic tree reconstruction. Our method then leverages the inferred phylogeny to improve the accuracy of SNV discovery. Experimental analyses demonstrate that our method achieves up to 32% improvement for somatic SNV calling of multiple related samples over the accuracy of GATK\\'s Unified Genotyper, the state of the art multisample SNV caller. © 2013 Springer-Verlag.

  6. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  7. Phylogeny and biogeography of the carnivorous plant family Sarraceniaceae.

    Ellison, Aaron M; Butler, Elena D; Hicks, Emily Jean; Naczi, Robert F C; Calie, Patrick J; Bell, Charles D; Davis, Charles C

    2012-01-01

    The carnivorous plant family Sarraceniaceae comprises three genera of wetland-inhabiting pitcher plants: Darlingtonia in the northwestern United States, Sarracenia in eastern North America, and Heliamphora in northern South America. Hypotheses concerning the biogeographic history leading to this unusual disjunct distribution are controversial, in part because genus- and species-level phylogenies have not been clearly resolved. Here, we present a robust, species-rich phylogeny of Sarraceniaceae based on seven mitochondrial, nuclear, and plastid loci, which we use to illuminate this family's phylogenetic and biogeographic history. The family and genera are monophyletic: Darlingtonia is sister to a clade consisting of Heliamphora+Sarracenia. Within Sarracenia, two clades were strongly supported: one consisting of S. purpurea, its subspecies, and S. rosea; the other consisting of nine species endemic to the southeastern United States. Divergence time estimates revealed that stem group Sarraceniaceae likely originated in South America 44-53 million years ago (Mya) (highest posterior density [HPD] estimate = 47 Mya). By 25-44 (HPD = 35) Mya, crown-group Sarraceniaceae appears to have been widespread across North and South America, and Darlingtonia (western North America) had diverged from Heliamphora+Sarracenia (eastern North America+South America). This disjunction and apparent range contraction is consistent with late Eocene cooling and aridification, which may have severed the continuity of Sarraceniaceae across much of North America. Sarracenia and Heliamphora subsequently diverged in the late Oligocene, 14-32 (HPD = 23) Mya, perhaps when direct overland continuity between North and South America became reduced. Initial diversification of South American Heliamphora began at least 8 Mya, but diversification of Sarracenia was more recent (2-7, HPD = 4 Mya); the bulk of southeastern United States Sarracenia originated co-incident with Pleistocene glaciation, <3 Mya

  8. Phylogeny of Gobioidei and the origin of European gobies

    Ainhoa Agorreta

    2015-11-01

    Full Text Available The percomorph order Gobioidei comprises over 2200 species worldwide distributed that occupy most freshwater, brackish and marine environments, and show a spectacular variety in morphology, ecology, and behaviour. However, phylogenetic relationships among many gobioid groups still remain poorly understood. Such is the case of Gobiidae, a rapidly radiating lineage that encompass an unusually high diversity of species (nearly 2000, including the largely endemic European species whose origin and ancestry remain uncertain. The resolution and accuracy of previous molecular phylogenetic studies has been limited due to the use of only a few (generally mitochondrial molecular markers and/or the absence of representatives of several key lineages. Our study (built on Agorreta et al. 2013 is the first to include multiple nuclear and mitochondrial genes for nearly 300 terminal taxa representing the vast diversity of gobioid lineages. We have used this information to reconstruct a robust phylogeny of Gobioidei, and we are now investigating the historical biogeography and diversification times of European gobies with a time-calibrated molecular phylogeny. Robustness of the inferred phylogenetic trees is significantly higher than that of previous studies, hence providing the most compelling molecular phylogenetic hypotheses for Gobioidei thus far. The family Eleotrididae branches off the gobioid tree after the Rhyacichthyidae + Odontobutidae clade followed by the Butidae as the sister-group of the Gobiidae. Several monophyletic groups are identified within the two major Gobiidae subclades, the gobionelline-like and the gobiine-like gobiids. The European gobies cluster in three distinct lineages (Pomatoschistus-, Aphia-, and Gobius-lineages, each with different affinities with gobiids from the Indo-Pacific and perhaps the New World. Our ongoing more-detailed study on European gobies will reveal whether their origin is related to vicariant events linked to the

  9. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    Ostergaard, P; Phan, H; Johansen, L B;

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

  10. Can phylogeny predict chemical diversity and potential medicinal activity of plants? A case study of Amaryllidaceae

    Rønsted, Nina; Symonds, Matthew RE; Birkholm, Trine;

    2012-01-01

    Background: During evolution, plants and other organisms have developed a diversity of chemical defences, leading to the evolution of various groups of specialized metabolites selected for their endogenous biological function. A correlation between phylogeny and biosynthetic pathways could offer ...

  11. Evolutionary history of tree squirrels (Rodentia, Sciurini) based on multilocus phylogeny reconstruction

    Pečnerová, P.; Martínková, Natália

    2012-01-01

    Roč. 41, č. 3 (2012), s. 211-219. ISSN 0300-3256 Institutional research plan: CEZ:AV0Z60930519 Keywords : phylogeny * Sciurus * biogeography * colonisation Subject RIV: EG - Zoology Impact factor: 2.793, year: 2012

  12. PFR²: a curated database of planktonic foraminifera 18S ribosomal DNA as a resource for studies of plankton ecology, biogeography and evolution.

    Morard, Raphaël; Darling, Kate F; Mahé, Frédéric; Audic, Stéphane; Ujiié, Yurika; Weiner, Agnes K M; André, Aurore; Seears, Heidi A; Wade, Christopher M; Quillévéré, Frédéric; Douady, Christophe J; Escarguel, Gilles; de Garidel-Thoron, Thibault; Siccha, Michael; Kucera, Michal; de Vargas, Colomban

    2015-11-01

    Planktonic foraminifera (Rhizaria) are ubiquitous marine pelagic protists producing calcareous shells with conspicuous morphology. They play an important role in the marine carbon cycle, and their exceptional fossil record serves as the basis for biochronostratigraphy and past climate reconstructions. A major worldwide sampling effort over the last two decades has resulted in the establishment of multiple large collections of cryopreserved individual planktonic foraminifera samples. Thousands of 18S rDNA partial sequences have been generated, representing all major known morphological taxa across their worldwide oceanic range. This comprehensive data coverage provides an opportunity to assess patterns of molecular ecology and evolution in a holistic way for an entire group of planktonic protists. We combined all available published and unpublished genetic data to build PFR(2), the Planktonic foraminifera Ribosomal Reference database. The first version of the database includes 3322 reference 18S rDNA sequences belonging to 32 of the 47 known morphospecies of extant planktonic foraminifera, collected from 460 oceanic stations. All sequences have been rigorously taxonomically curated using a six-rank annotation system fully resolved to the morphological species level and linked to a series of metadata. The PFR(2) website, available at http://pfr2.sb-roscoff.fr, allows downloading the entire database or specific sections, as well as the identification of new planktonic foraminiferal sequences. Its novel, fully documented curation process integrates advances in morphological and molecular taxonomy. It allows for an increase in its taxonomic resolution and assures that integrity is maintained by including a complete contingency tracking of annotations and assuring that the annotations remain internally consistent. PMID:25828689

  13. Triploblastic relationships with emphasis on the acoelomates and the position of Gnathostomulida, Cycliophora, Plathelminthes, and Chaetognatha: a combined approach of 18S rDNA sequences and morphology.

    Giribet, G; Distel, D L; Polz, M; Sterrer, W; Wheeler, W C

    2000-09-01

    Triploblastic relationships were examined in the light of molecular and morphological evidence. Representatives for all triploblastic "phyla" (except Loricifera) were represented by both sources of phylogenetic data. The 18S ribosomal (rDNA) sequence data for 145 terminal taxa and 276 morphological characters coded for 36 supraspecific taxa were combined in a total evidence regime to determine the most consistent picture of triploblastic relationships for these data. Only triploblastic taxa are used to avoid rooting with distant outgroups, which seems to happen because of the extreme distance that separates diploblastic from triploblastic taxa according to the 18S rDNA data. Multiple phylogenetic analyses performed with variable analysis parameters yield largely inconsistent results for certain groups such as Chaetognatha, Acoela, and Nemertodermatida. A normalized incongruence length metric is used to assay the relative merit of the multiple analyses. The combined analysis having the least character incongruence yields the following scheme of relationships of four main clades: (1) Deuterostomia [((Echinodermata + Enteropneusta) (Cephalochordata (Urochordata + Vertebrata)))]; (2) Ecdysozoa [(((Priapulida + Kinorhyncha) (Nematoda + Nematomorpha)) ((Onychophora + Tardigrada) Arthropoda))]; (3) Trochozoa [((Phoronida + Brachiopoda) (Entoprocta (Nemertea (Sipuncula (Mollusca (Pogonophora (Echiura + Annelida)))))))]; and (4) Platyzoa [((Gnathostomulida (Cycliophora + Syndermata)) (Gastrotricha + Plathelminthes))]. Chaetognatha, Nemertodermatida, and Bryozoa cannot be assigned to any one of these four groups. For the first time, a data analysis recognizes a clade of acoelomates, the Platyzoa (sensu Cavalier-Smith, Biol. Rev. 73:203-266, 1998). Other relationships that corroborate some morphological analyses are the existence of a clade that groups Gnathostomulida + Syndermata (= Gnathifera), which is expanded to include the enigmatic phylum Cycliophora, as sister group

  14. A phylogeny and revised classification of Squamata, including 4161 species of lizards and snakes

    Pyron, R. Alexander; Burbrink, Frank T.; Wiens, John J.

    2013-01-01

    Background The extant squamates (>9400 known species of lizards and snakes) are one of the most diverse and conspicuous radiations of terrestrial vertebrates, but no studies have attempted to reconstruct a phylogeny for the group with large-scale taxon sampling. Such an estimate is invaluable for comparative evolutionary studies, and to address their classification. Here, we present the first large-scale phylogenetic estimate for Squamata. Results The estimated phylogeny contains 4161 species...

  15. Molecular phylogeny of Toxoplasmatinae: comparison between inferences based on mitochondrial and apicoplast genetic sequences

    Michelle Klein Sercundes; Samantha Yuri Oshiro Branco Valadas; Lara Borges Keid; Tricia Maria Ferreira Souza Oliveira; Helena Lage Ferreira; Ricardo Wagner Almeida Vitor; Fábio Gregori; Rodrigo Martins Soares

    2016-01-01

    Abstract Phylogenies within Toxoplasmatinae have been widely investigated with different molecular markers. Here, we studied molecular phylogenies of the Toxoplasmatinae subfamily based on apicoplast and mitochondrial genes. Partial sequences of apicoplast genes coding for caseinolytic protease (clpC) and beta subunit of RNA polymerase (rpoB), and mitochondrial gene coding for cytochrome B (cytB) were analyzed. Laboratory-adapted strains of the closely related parasites Sarcocystis falcatula ...

  16. Primary and secondary structures of Tetrahymena and aphid 5.8S rRNAs: structural features of 5.8S rRNA which interacts with the 28S rRNA containing the hidden break.

    Fujiwara, H.; H. Ishikawa

    1982-01-01

    The Tetrahymena 5.8S rRNA is 154 nucleotides long, the shortest so far reported except for the split 5.8S rRNAs of Diptera (m5.8S plus 2S rRNA). In this molecule several nucleotides are deleted in the helix e (GC-rich stem) region. Upon constructing the secondary structure in accordance with "burp-gun" model, the Tetrahymena 5.8S rRNA forms a wide-open "muzzle" of the terminal regions due to both extra nucleotides and several unpaired bases. The aphid 5.8S rRNA consists of 161 nucleotides and...

  17. Exploring microbial diversity and taxonomy using SSU rRNA hypervariable tag sequencing.

    Susan M Huse

    2008-11-01

    Full Text Available Massively parallel pyrosequencing of hypervariable regions from small subunit ribosomal RNA (SSU rRNA genes can sample a microbial community two or three orders of magnitude more deeply per dollar and per hour than capillary sequencing of full-length SSU rRNA. As with full-length rRNA surveys, each sequence read is a tag surrogate for a single microbe. However, rather than assigning taxonomy by creating gene trees de novo that include all experimental sequences and certain reference taxa, we compare the hypervariable region tags to an extensive database of rRNA sequences and assign taxonomy based on the best match in a Global Alignment for Sequence Taxonomy (GAST process. The resulting taxonomic census provides information on both composition and diversity of the microbial community. To determine the effectiveness of using only hypervariable region tags for assessing microbial community membership, we compared the taxonomy assigned to the V3 and V6 hypervariable regions with the taxonomy assigned to full-length SSU rRNA sequences isolated from both the human gut and a deep-sea hydrothermal vent. The hypervariable region tags and full-length rRNA sequences provided equivalent taxonomy and measures of relative abundance of microbial communities, even for tags up to 15% divergent from their nearest reference match. The greater sampling depth per dollar afforded by massively parallel pyrosequencing reveals many more members of the "rare biosphere" than does capillary sequencing of the full-length gene. In addition, tag sequencing eliminates cloning bias and the sequences are short enough to be completely sequenced in a single read, maximizing the number of organisms sampled in a run while minimizing chimera formation. This technique allows the cost-effective exploration of changes in microbial community structure, including the rare biosphere, over space and time and can be applied immediately to initiatives, such as the Human Microbiome Project.

  18. A human genome-wide library of local phylogeny predictions for whole-genome inference problems

    Schwartz Russell

    2008-08-01

    Full Text Available Abstract Background Many common inference problems in computational genetics depend on inferring aspects of the evolutionary history of a data set given a set of observed modern sequences. Detailed predictions of the full phylogenies are therefore of value in improving our ability to make further inferences about population history and sources of genetic variation. Making phylogenetic predictions on the scale needed for whole-genome analysis is, however, extremely computationally demanding. Results In order to facilitate phylogeny-based predictions on a genomic scale, we develop a library of maximum parsimony phylogenies within local regions spanning all autosomal human chromosomes based on Haplotype Map variation data. We demonstrate the utility of this library for population genetic inferences by examining a tree statistic we call 'imperfection,' which measures the reuse of variant sites within a phylogeny. This statistic is significantly predictive of recombination rate, shows additional regional and population-specific conservation, and allows us to identify outlier genes likely to have experienced unusual amounts of variation in recent human history. Conclusion Recent theoretical advances in algorithms for phylogenetic tree reconstruction have made it possible to perform large-scale inferences of local maximum parsimony phylogenies from single nucleotide polymorphism (SNP data. As results from the imperfection statistic demonstrate, phylogeny predictions encode substantial information useful for detecting genomic features and population history. This data set should serve as a platform for many kinds of inferences one may wish to make about human population history and genetic variation.

  19. Strength and Regulation of Seven rRNA Promoters in Escherichia coli.

    Michihisa Maeda

    Full Text Available The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed.

  20. A yeast transcription system for the 5S rRNA gene.

    Keulen, H.; Thomas, D. Y.

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA gen...

  1. Oligonucleotide Fingerprinting of rRNA Genes for Analysis of Fungal Community Composition

    Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

    2002-01-01

    Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones d...

  2. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    Cangelosi, G A; Brabant, W H

    1997-01-01

    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA prob...

  3. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  4. TaxMan: a server to trim rRNA reference databases and inspect taxonomic coverage

    Brandt, B. W.; Bonder, M. J.; Huse, S.M.; Zaura, E.

    2012-01-01

    Amplicon sequencing of the hypervariable regions of the small subunit ribosomal RNA gene is a widely accepted method for identifying the members of complex bacterial communities. Several rRNA gene sequence reference databases can be used to assign taxonomic names to the sequencing reads using BLAST, USEARCH, GAST or the RDP classifier. Next-generation sequencing methods produce ample reads, but they are short, currently ∼100-450 nt (depending on the technology), as compared to the full rRNA g...

  5. In Vivo Effect of NusB and NusG on rRNA Transcription Antitermination

    Torres, Martha; Balada, Joan-Miquel; Zellars, Malcolm; Squires, Craig; Squires, Catherine L.

    2004-01-01

    Similarities between lambda and rRNA transcription antitermination have led to suggestions that they involve the same Nus factors. However, direct in vivo confirmation that rRNA antitermination requires all of the lambda Nus factors is lacking. We have therefore analyzed the in vivo role of NusB and NusG in rRNA transcription antitermination and have established that both are essential for it. We used a plasmid test system in which reporter gene mRNA was measured to monitor rRNA antiterminato...

  6. Morphology and phylogenies of two hypotrichous brackish-water ciliates from China, Neourostylopsis orientalis n. sp. and Protogastrostyla sterkii (Wallengren, 1900) n. comb., with establishment of a new genus Neourostylopsis n. gen. (Protista, Ciliophora, Hypotrichia).

    Chen, Xiangrui; Shao, Chen; Liu, Xihan; Huang, Jie; Al-Rasheid, Khaled A S

    2013-03-01

    This paper investigates the morphology, infraciliature and small-subunit (SSU) rRNA gene sequences of two hypotrichous ciliates, Neourostylopsis orientalis n. sp., and Protogastrostyla sterkii (Wallengren, 1900) n. comb. (basionym Gastrostyla sterkii), collected from coastal waters in southern China. Neourostylopsis orientalis n. sp. is diagnosed mainly by the arrangement of brownish cortical granules, the numbers of adoral membranelles and frontal and transverse cirri and the characteristics of its midventral cirral pairs. The SSU rRNA gene phylogeny strongly supports the establishment of the new genus Neourostylopsis n. gen., which is characterized mainly by the following features: frontal and transverse cirri clearly differentiated, buccal cirri present, two frontoterminal cirri, midventral complex composed of midventral pairs only and not exceeding the halfway point of the cell, more than one row of marginal cirri on each side which derive from individual anlagen within each parental row, caudal cirri lacking. Thus, two new combinations are required: Neourostylopsis songi (Lei et al., 2005) n. comb., and Neourostylopsis flavicana (Wang et al., 2011) n. comb. Additionally, improved diagnoses for both Metaurostylopsis and Apourostylopsis are supplied in this study. Protogastrostyla sterkii (Wallengren, 1900) n. comb. differs from the similar congener Protogastrostyla pulchra mainly in body shape, ratio of buccal field to body length in vivo and molecular data. Based on the present studies, we conclude that the estuarine population of P. pulchra collected by J. Gong and others [Gong et al., J Eukaryot Microbiol (2007) 54, 468-478] is a population of P. sterkii. PMID:23355699

  7. The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

    Hori, H; Sawada, M.; Osawa, S; Murao, K; Ishikura, H

    1981-01-01

    The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

  8. Methyltransferase Erm(37) Slips on rRNA to Confer Atypical Resistance in Mycobacterium tuberculosis

    Madsen, Ch. T.; Jakobsen, L.; Buriánková, Karolína; Doucet-Populaire, F.; Perdonet, J. L.; Douthwaite, S.

    2005-01-01

    Roč. 280, č. 47 (2005), s. 38942-38947. ISSN 0021-9258 R&D Projects: GA ČR GA310/03/0292 Institutional research plan: CEZ:AV0Z50200510 Keywords : methyltransferase erm * mycobacterium tuberculosis * rRNA Subject RIV: EE - Microbiology, Virology Impact factor: 5.854, year: 2005

  9. An alternative strategy for bacterial ribosome synthesis: Bacillus subtilis rRNA transcription regulation

    Krásný, Libor; Gourse, Richard. L.

    2004-01-01

    Roč. 23, č. 22 (2004), s. 4473-4483. ISSN 0261-4189 Grant ostatní: National Institutes of Health(US) RO1 GM37048 Institutional research plan: CEZ:AV0Z5052915 Keywords : B. subtilis , GTP concentrations, rRNA transcription Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 10.492, year: 2004

  10. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    reveals increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits......The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea and...... chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...

  11. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    van Wezel, G P; Krab, I M; Douthwaite, S; Bibb, M J; Vijgenboom, E; Bosch, L

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, correspondi...

  12. Supramolecular hydrogel of kanamycin selectively sequesters 16S rRNA

    Yang, Zhimou; Kuang, Yi; Li, Xinming; Zhou, Ning; Zhang, Ye; Xu, Bing

    2012-01-01

    As the first example of hydrogelator derived from aminoglycoside antibiotics, the hydrogel of kanamycin indicates that the hydrogel of aminoglycosides preserve the specific interaction with their macromolecular targets (e.g., 16S rRNA), thus illustrating a simple approach to explore and identify possible biological targets of supramolecular nanofibers/hydrogels.

  13. EmtA, a rRNA methyltransferase conferring high-level evernimicin resistance

    Mann, P. A.; Xiong, L.; Mankin, A. S.; Chau, A. S.; Najarian, D. J.; Mendrick, C. A.; Cramer, C. A.; Aarestrup, Frank Møller; Hare, R. S.; Black, T. A.; McNicholas, P. M.

    2001-01-01

    unique to the 23S rRNA extracted from resistant ribosomes. The pause corresponded to methylation of residue G2470 (Escherichia coli numbering). RNA footprinting revealed that G2470 is located within the evernimicin-binding site on the ribosome, thus providing an explanation for the reduced binding of the...

  14. Oral microbiome profiles: 16S rRNA pyrosequencing and microarray assay comparison.

    Jiyoung Ahn

    Full Text Available OBJECTIVES: The human oral microbiome is potentially related to diverse health conditions and high-throughput technology provides the possibility of surveying microbial community structure at high resolution. We compared two oral microbiome survey methods: broad-based microbiome identification by 16S rRNA gene sequencing and targeted characterization of microbes by custom DNA microarray. METHODS: Oral wash samples were collected from 20 individuals at Memorial Sloan-Kettering Cancer Center. 16S rRNA gene survey was performed by 454 pyrosequencing of the V3-V5 region (450 bp. Targeted identification by DNA microarray was carried out with the Human Oral Microbe Identification Microarray (HOMIM. Correlations and relative abundance were compared at phylum and genus level, between 16S rRNA sequence read ratio and HOMIM hybridization intensity. RESULTS: The major phyla, Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, and Fusobacteria were identified with high correlation by the two methods (r = 0.70∼0.86. 16S rRNA gene pyrosequencing identified 77 genera and HOMIM identified 49, with 37 genera detected by both methods; more than 98% of classified bacteria were assigned in these 37 genera. Concordance by the two assays (presence/absence and correlations were high for common genera (Streptococcus, Veillonella, Leptotrichia, Prevotella, and Haemophilus; Correlation = 0.70-0.84. CONCLUSION: Microbiome community profiles assessed by 16S rRNA pyrosequencing and HOMIM were highly correlated at the phylum level and, when comparing the more commonly detected taxa, also at the genus level. Both methods are currently suitable for high-throughput epidemiologic investigations relating identified and more common oral microbial taxa to disease risk; yet, pyrosequencing may provide a broader spectrum of taxa identification, a distinct sequence-read record, and greater detection sensitivity.

  15. An 18S ribosomal DNA barcode for the study of Isomermis lairdi, a parasite of the blackfly Simulium damnosum s.l.

    Crainey, J L; Wilson, M D; Post, R J

    2009-09-01

    The mermithid parasite, Isomermis lairdi Mondet, Poinar & Bernadou (Nematoda: Mermithidae), is known to have a major impact on populations of Simulium damnosum s.l. Theobald (Diptera: Simuliidae) and on their efficiency as vectors of Onchocerca volvulus (Leuckart) (Nematoda: Filarioidea). However, the value of I. lairdi and other mermithid parasites as potential means of integrated vector control has not been fully realized. This is partly because traditional taxonomic approaches have been insufficient for describing and analysing important aspects of their biology and host range. In total, rDNA barcode sequences have been obtained from over 70 I. lairdi mermithids found parasitizing S. damnosum s.l. larvae in three different rivers. No two sequences were found to vary by more than 0.5%, and cytospecies identification of mermithid hosts revealed that I. lairdi with identical rDNA barcodes can parasitize multiple cytoforms of the S. damnosum complex, including S. squamosum (Enderlein). Phylogenetic analysis using a partial sequence from the 18S ribosomal DNA barcode, grouped I. lairdi in a monophyletic group with Gastromermis viridis Welch (Nematoda: Mermithidae) and Isomermis wisconsinensis Welch (Nematoda: Mermithidae). PMID:19712154

  16. Bioactivity and phylogeny of the marine bacterial genus Pseudoalteromonas

    Vynne, Nikolaj Grønnegaard

    -associated strains were significantly more likely to possess stable antibacterial activity and be pigmented. Pseudoalteromonas strains are known as prolific producers of bioactive secondary metabolites; hence screening the global strain collection for production of novel antibiotics was initiated. Novel quinolone...... was obtained during the research cruise “Galathea 3”, which circumnavigated the Earth while screening marine bacteria for the ability to inhibit Vibrio anguillarum 90-11-287. Pseudoalteromonas strains were one of the most frequently isolated genera. The Pseudoalteromonas strains were evaluated for...... was not unequivocally reflected in the secondary metabolite profile, possibly due to the limited resolving power of the 16S rRNA gene. The species P. luteoviolacea showed an interesting pattern indicative of phylotype specific antibiotic production strains. Detailed phylogenetic analysis of an...

  17. A mitogenomic phylogeny and genetic history of sable (Martes zibellina).

    Malyarchuk, Boris; Derenko, Miroslava; Denisova, Galina

    2014-10-15

    We assessed phylogeny of sable (Martes zibellina, Linnaeus, 1758) by sequence analysis of nearly complete, new mitochondrial genomes in 36 specimens from different localities in northern Eurasia (Primorye, Khabarovsk and Krasnoyarsk regions, the Kamchatka Peninsula, the Kuril Islands and the Urals). Phylogenetic analysis of mtDNA sequences demonstrates that two clades, A and BC, radiated about 200-300 thousandyears ago (kya) according to results of Bayesian molecular clock and RelTime analyses of different mitogenome alignments (nearly complete mtDNA sequences, protein-coding region, and synonymous sites), while the age estimates of clades A, B and C fall within the Late Pleistocene (~50-140 kya). Bayesian skyline plots (BSPs) of sable population size change based on analysis of nearly complete mtDNAs show an expansion around 40 kya in the warm Karganian time, without a decline of population size around the Last Glacial Maximum (21 kya). The BSPs based on synonymous clock rate indicate that M. zibellina experienced demographic expansions later, approximately 22 kya. The A2a clade that colonized Kamchatka ~23-50 kya (depending on the mutation rate used) survived the last glaciation there as demonstrated by the BSP analysis. In addition, we have found evidence of positive selection acting at ND4 and cytochrome b genes, thereby suggesting adaptive evolution of the A2a clade in Kamchatka. PMID:25110108

  18. Robust markers reflecting phylogeny and taxonomy of rhizobia.

    Yan Ming Zhang

    Full Text Available Genomic ANI (Average Nucleotide Identity has been found to be able to replace DNA-DNA hybridization in prokaryote taxonomy. The ANI of each of the core genes that has a phylogeny congruent with the reference species tree of rhizobia was compared to the genomic ANI. This allowed us to identify three housekeeping genes (SMc00019-truA-thrA whose ANI reflected the intraspecies and interspecies genomic ANI among rhizobial strains, revealing an ANI gap (≥2% between the inter- and intra-species comparisons. The intraspecies (96% and interspecies (94% ANI boundaries calculated from three genes (SMc00019-truA-thrA provided a criterion for bacterial species definition and confirmed 621/629 of known interspecies relationships within Bradyrhizobium, Mesorhizobium, Sinorhizobium and Rhizobium. Some widely studied strains should be renamed. The SMc00019-truA-thrA ANI also correlates well with the genomic ANI of strains in Agrobacterium, Methylobacterium, Ralstonia, Rhodopseudomonas, Cupriavidus and Burkholderia, suggesting their wide applicability in other bacteria.

  19. Shedding light on vampires: the phylogeny of vampyrellid amoebae revisited.

    Sebastian Hess

    Full Text Available With the advent of molecular phylogenetic techniques the polyphyly of naked filose amoebae has been proven. They are interspersed in several supergroups of eukaryotes and most of them already found their place within the tree of life. Although the 'vampire amoebae' have attracted interest since the middle of the 19th century, the phylogenetic position and even the monophyly of this traditional group are still uncertain. In this study clonal co-cultures of eight algivorous vampyrellid amoebae and the respective food algae were established. Culture material was characterized morphologically and a molecular phylogeny was inferred using SSU rDNA sequence comparisons. We found that the limnetic, algivorous vampyrellid amoebae investigated in this study belong to a major clade within the Endomyxa Cavalier-Smith, 2002 (Cercozoa, grouping together with a few soil-dwelling taxa. They split into two robust clades, one containing species of the genus Vampyrella Cienkowski, 1865, the other containing the genus Leptophrys Hertwig & Lesser, 1874, together with terrestrial members. Supported by morphological data these clades are designated as the two families Vampyrellidae Zopf, 1885, and Leptophryidae fam. nov. Furthermore the order Vampyrellida West, 1901 was revised and now corresponds to the major vampyrellid clade within the Endomyxa, comprising the Vampyrellidae and Leptophryidae as well as several environmental sequences. In the light of the presented phylogenetic analyses morphological and ecological aspects, the feeding strategy and nutritional specialization within the vampyrellid amoebae are discussed.

  20. Bayesian Inference of Reticulate Phylogenies under the Multispecies Network Coalescent.

    Wen, Dingqiao; Yu, Yun; Nakhleh, Luay

    2016-05-01

    The multispecies coalescent (MSC) is a statistical framework that models how gene genealogies grow within the branches of a species tree. The field of computational phylogenetics has witnessed an explosion in the development of methods for species tree inference under MSC, owing mainly to the accumulating evidence of incomplete lineage sorting in phylogenomic analyses. However, the evolutionary history of a set of genomes, or species, could be reticulate due to the occurrence of evolutionary processes such as hybridization or horizontal gene transfer. We report on a novel method for Bayesian inference of genome and species phylogenies under the multispecies network coalescent (MSNC). This framework models gene evolution within the branches of a phylogenetic network, thus incorporating reticulate evolutionary processes, such as hybridization, in addition to incomplete lineage sorting. As phylogenetic networks with different numbers of reticulation events correspond to points of different dimensions in the space of models, we devise a reversible-jump Markov chain Monte Carlo (RJMCMC) technique for sampling the posterior distribution of phylogenetic networks under MSNC. We implemented the methods in the publicly available, open-source software package PhyloNet and studied their performance on simulated and biological data. The work extends the reach of Bayesian inference to phylogenetic networks and enables new evolutionary analyses that account for reticulation. PMID:27144273

  1. Phylogeny-aware identification and correction of taxonomically mislabeled sequences.

    Kozlov, Alexey M; Zhang, Jiajie; Yilmaz, Pelin; Glöckner, Frank Oliver; Stamatakis, Alexandros

    2016-06-20

    Molecular sequences in public databases are mostly annotated by the submitting authors without further validation. This procedure can generate erroneous taxonomic sequence labels. Mislabeled sequences are hard to identify, and they can induce downstream errors because new sequences are typically annotated using existing ones. Furthermore, taxonomic mislabelings in reference sequence databases can bias metagenetic studies which rely on the taxonomy. Despite significant efforts to improve the quality of taxonomic annotations, the curation rate is low because of the labor-intensive manual curation process. Here, we present SATIVA, a phylogeny-aware method to automatically identify taxonomically mislabeled sequences ('mislabels') using statistical models of evolution. We use the Evolutionary Placement Algorithm (EPA) to detect and score sequences whose taxonomic annotation is not supported by the underlying phylogenetic signal, and automatically propose a corrected taxonomic classification for those. Using simulated data, we show that our method attains high accuracy for identification (96.9% sensitivity/91.7% precision) as well as correction (94.9% sensitivity/89.9% precision) of mislabels. Furthermore, an analysis of four widely used microbial 16S reference databases (Greengenes, LTP, RDP and SILVA) indicates that they currently contain between 0.2% and 2.5% mislabels. Finally, we use SATIVA to perform an in-depth evaluation of alternative taxonomies for Cyanobacteria. SATIVA is freely available at https://github.com/amkozlov/sativa. PMID:27166378

  2. Molecular phylogeny of the Drosophila melanogaster species subgroup.

    Ko, Wen-Ya; David, Ryan M; Akashi, Hiroshi

    2003-11-01

    Although molecular and phenotypic evolution have been studied extensively in Drosophila melanogaster and its close relatives, phylogenetic relationships within the D. melanogaster species subgroup remain unresolved. In particular, recent molecular studies have not converged on the branching orders of the D. yakuba-D. teissieri and D. erecta-D. orena species pairs relative to the D. melanogaster-D. simulans-D. mauritiana-D. sechellia species complex. Here, we reconstruct the phylogeny of the melanogaster species subgroup using DNA sequence data from four nuclear genes. We have employed "vectorette PCR" to obtain sequence data for orthologous regions of the Alcohol dehydrogenase (Adh), Alcohol dehydrogenase related (Adhr), Glucose dehydrogenase (Gld), and rosy (ry) genes (totaling 7164 bp) from six melanogaster subgroup species (D. melanogaster, D. simulans, D. teissieri, D. yakuba, D. erecta, and D. orena) and three species from subgroups outside the melanogaster species subgroup [D. eugracilis (eugracilis subgroup), D. mimetica (suzukii subgroup), and D. lutescens (takahashii subgroup)]. Relationships within the D. simulans complex are not addressed. Phylogenetic analyses employing maximum parsimony, neighbor-joining, and maximum likelihood methods strongly support a D. yakuba-D. teissieri and D. erecta-D. orena clade within the melanogaster species subgroup. D. eugracilis is grouped closer to the melanogaster subgroup than a D. mimetica-D. lutescens clade. This tree topology is supported by reconstructions employing simple (single parameter) and more complex (nonreversible) substitution models. PMID:14738315

  3. Genomes-based phylogeny of the genus Xanthomonas

    Rodriguez-R Luis M

    2012-03-01

    Full Text Available Abstract Background The genus Xanthomonas comprises several plant pathogenic bacteria affecting a wide range of hosts. Despite the economic, industrial and biological importance of Xanthomonas, the classification and phylogenetic relationships within the genus are still under active debate. Some of the relationships between pathovars and species have not been thoroughly clarified, with old pathovars becoming new species. A change in the genus name has been recently suggested for Xanthomonas albilineans, an early branching species currently located in this genus, but a thorough phylogenomic reconstruction would aid in solving these and other discrepancies in this genus. Results Here we report the results of the genome-wide analysis of DNA sequences from 989 orthologous groups from 17 Xanthomonas spp. genomes available to date, representing all major lineages within the genus. The phylogenetic and computational analyses used in this study have been automated in a Perl package designated Unus, which provides a framework for phylogenomic analyses which can be applied to other datasets at the genomic level. Unus can also be easily incorporated into other phylogenomic pipelines. Conclusions Our phylogeny agrees with previous phylogenetic topologies on the genus, but revealed that the genomes of Xanthomonas citri and Xanthomonas fuscans belong to the same species, and that of Xanthomonas albilineans is basal to the joint clade of Xanthomonas and Xylella fastidiosa. Genome reduction was identified in the species Xanthomonas vasicola in addition to the previously identified reduction in Xanthomonas albilineans. Lateral gene transfer was also observed in two gene clusters.

  4. The phylogeny and evolutionary history of tyrannosauroid dinosaurs

    Brusatte, Stephen L.; Carr, Thomas D.

    2016-02-01

    Tyrannosauroids—the group of carnivores including Tyrannosaurs rex—are some of the most familiar dinosaurs of all. A surge of recent discoveries has helped clarify some aspects of their evolution, but competing phylogenetic hypotheses raise questions about their relationships, biogeography, and fossil record quality. We present a new phylogenetic dataset, which merges published datasets and incorporates recently discovered taxa. We analyze it with parsimony and, for the first time for a tyrannosauroid dataset, Bayesian techniques. The parsimony and Bayesian results are highly congruent, and provide a framework for interpreting the biogeography and evolutionary history of tyrannosauroids. Our phylogenies illustrate that the body plan of the colossal species evolved piecemeal, imply no clear division between northern and southern species in western North America as had been argued, and suggest that T. rex may have been an Asian migrant to North America. Over-reliance on cranial shape characters may explain why published parsimony studies have diverged and filling three major gaps in the fossil record holds the most promise for future work.

  5. Phylogeny and Classification of Prunus sensu lato (Rosaceae)

    Shuo Shi; Jinlu Li; Jiahui Sun; Jing Yu; Shiliang Zhou

    2013-01-01

    The classification of the economically important genus Prunus L. sensu lato (s.l.) is controversial due to the high levels of convergent or the parallel evolution of morphological characters. In the present study, phylogenetic analyses of fifteen main segregates of Prunus s.l. represented by eighty-four species were conducted with maximum parsimony and Bayesian approaches using twelve chloroplast regions (atpB-rbcL, matK, ndhF, psbA-trnH, rbcL, rpL16, rpoC1, rps16, trnS-G, trnL, trnL-F and ycf1) and three nuclear genes (ITS, s6pdh and SbeI) to explore their infrageneric relationships. The results of these analyses were used to develop a new, phylogeny-based classification of Prunus s.l. Our phylogenetic reconstructions resolved three main clades of Prunus s.l. with strong supports. We adopted a broad-sensed genus, Prunus, and recognised three subgenera corresponding to the three main clades: subgenus Padus, subgenus Cerasus and subgenus Prunus. Seven sections of subgenus Prunus were recognised. The dwarf cherries, which were previously assigned to subgenus Cerasus, were included in this subgenus Prunus. One new section name, Prunus L. subgenus Prunus section Persicae (T. T. Yü&L. T. Lu) S. L. Zhou and one new species name, Prunus tianshanica (Pojarkov) S. Shi, were proposed.

  6. A unified phylogeny-based nomenclature for histone variants

    Talbert Paul B

    2012-06-01

    Full Text Available Abstract Histone variants are non-allelic protein isoforms that play key roles in diversifying chromatin structure. The known number of such variants has greatly increased in recent years, but the lack of naming conventions for them has led to a variety of naming styles, multiple synonyms and misleading homographs that obscure variant relationships and complicate database searches. We propose here a unified nomenclature for variants of all five classes of histones that uses consistent but flexible naming conventions to produce names that are informative and readily searchable. The nomenclature builds on historical usage and incorporates phylogenetic relationships, which are strong predictors of structure and function. A key feature is the consistent use of punctuation to represent phylogenetic divergence, making explicit the relationships among variant subtypes that have previously been implicit or unclear. We recommend that by default new histone variants be named with organism-specific paralog-number suffixes that lack phylogenetic implication, while letter suffixes be reserved for structurally distinct clades of variants. For clarity and searchability, we encourage the use of descriptors that are separate from the phylogeny-based variant name to indicate developmental and other properties of variants that may be independent of structure.

  7. Phylogeny and disjunct distribution: evolution of Saintpaulia (Gesneriaceae).

    Möller, M; Cronk, Q C

    1997-12-22

    The molecular phylogeny of African violets (Saintpaulia H. Wendl.), based on ribosomal DNA internal transcribed spacer (ITS) sequences, follows the disjunct biogeography of the genus. Sequence analysis by parsimony of 19 accessions, representing 17 currently recognized Saintpaulia species, resulted in four trees of 182 steps. The first major division is between S. goetzeana, from the Uluguru Mts, Tanzania, and the rest of the genus. The basal position of S. goetzeana, and its putative primitive characters, may indicate an Uluguru origin for Saintpaulia and subsequent colonization of the more northerly mountains. Of the remainder, S. teitensis, from the Teita Hills of Kenya, is sister taxon to the other species (which occur mainly in the Usambara Mts of north-east Tanzania). A group of nine Usambaran species that we call the 'ionantha complex' show minimal ITS genetic differentiation and are also taxonomically critical. Species diversity in the Usambara Mts appears to be the result of rapid, recent (possibly Pleistocene) radiation. This study reveals the limitations of ITS sequences for elucidating the radiation of poorly differentiated species (the ionantha complex). However, the molecular data strongly suggest that conservation of the Uluguru and Teita populations is essential for the protection of the full range of diversity within the genus. PMID:9447739

  8. Phylogeny and Biogeography of Cyanobacteria and Their Produced Toxins

    Agostinho Antunes

    2013-11-01

    Full Text Available Phylogeny is an evolutionary reconstruction of the past relationships of DNA or protein sequences and it can further be used as a tool to assess population structuring, genetic diversity and biogeographic patterns. In the microbial world, the concept that everything is everywhere is widely accepted. However, it is much debated whether microbes are easily dispersed globally or whether they, like many macro-organisms, have historical biogeographies. Biogeography can be defined as the science that documents the spatial and temporal distribution of a given taxa in the environment at local, regional and continental scales. Speciation, extinction and dispersal are proposed to explain the generation of biogeographic patterns. Cyanobacteria are a diverse group of microorganisms that inhabit a wide range of ecological niches and are well known for their toxic secondary metabolite production. Knowledge of the evolution and dispersal of these microorganisms is still limited, and further research to understand such topics is imperative. Here, we provide a compilation of the most relevant information regarding these issues to better understand the present state of the art as a platform for future studies, and we highlight examples of both phylogenetic and biogeographic studies in non-symbiotic cyanobacteria and cyanotoxins.

  9. Nucleolin is required for DNA methylation state and the expression of rRNA gene variants in Arabidopsis thaliana.

    Frédéric Pontvianne

    2010-11-01

    Full Text Available In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1. Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre-rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis.

  10. Molecular phylogeny and character evolution in terete-stemmed Andean opuntias (Cactaceae-Opuntioideae).

    Ritz, C M; Reiker, J; Charles, G; Hoxey, P; Hunt, D; Lowry, M; Stuppy, W; Taylor, N

    2012-11-01

    The cacti of tribe Tephrocacteae (Cactaceae-Opuntioideae) are adapted to diverse climatic conditions over a wide area of the southern Andes and adjacent lowlands. They exhibit a range of life forms from geophytes and cushion-plants to dwarf shrubs, shrubs or small trees. To confirm or challenge previous morphology-based classifications and molecular phylogenies, we sampled DNA sequences from the chloroplast trnK/matK region and the nuclear low copy gene phyC and compared the resulting phylogenies with previous data gathered from nuclear ribosomal DNA sequences. The here presented chloroplast and nuclear low copy gene phylogenies were mutually congruent and broadly coincident with the classification based on gross morphology and seed micro-morphology and anatomy. Reconstruction of hypothetical ancestral character states suggested that geophytes and cushion-forming species probably evolved several times from dwarf shrubby precursors. We also traced an increase of embryo size at the expense of the nucellus-derived storage tissue during the evolution of the Tephrocacteae, which is thought to be an evolutionary advantage because nutrients are then more rapidly accessible for the germinating embryo. In contrast to these highly concordant phylogenies, nuclear ribosomal DNA data sampled by a previous study yielded conflicting phylogenetic signals. Secondary structure predictions of ribosomal transcribed spacers suggested that this phylogeny is strongly influenced by the inclusion of paralogous sequence probably arisen by genome duplication during the evolution of this plant group. PMID:22877645

  11. Estimating trait-dependent speciation and extinction rates from incompletely resolved phylogenies.

    FitzJohn, Richard G; Maddison, Wayne P; Otto, Sarah P

    2009-12-01

    Species traits may influence rates of speciation and extinction, affecting both the patterns of diversification among lineages and the distribution of traits among species. Existing likelihood approaches for detecting differential diversification require complete phylogenies; that is, every extant species must be present in a well-resolved phylogeny. We developed 2 likelihood methods that can be used to infer the effect of a trait on speciation and extinction without complete phylogenetic information, generalizing the recent binary-state speciation and extinction method. Our approaches can be used where a phylogeny can be reasonably assumed to be a random sample of extant species or where all extant species are included but some are assigned only to terminal unresolved clades. We explored the effects of decreasing phylogenetic resolution on the ability of our approach to detect differential diversification within a Bayesian framework using simulated phylogenies. Differential diversification caused by an asymmetry in speciation rates was nearly as well detected with only 50% of extant species phylogenetically resolved as with complete phylogenetic knowledge. We demonstrate our unresolved clade method with an analysis of sexual dimorphism and diversification in shorebirds (Charadriiformes). Our methods allow for the direct estimation of the effect of a trait on speciation and extinction rates using incompletely resolved phylogenies. PMID:20525612

  12. Bilaterian phylogeny: a broad sampling of 13 nuclear genes provides a new Lophotrochozoa phylogeny and supports a paraphyletic basal acoelomorpha.

    Paps, Jordi; Baguñà, Jaume; Riutort, Marta

    2009-10-01

    During the past decade, great progress has been made in clarifying the relationships among bilaterian animals. Studies based on a limited number of markers established new hypotheses such as the existence of three superclades (Deuterostomia, Ecdysozoa, and Lophotrochozoa) but left major questions unresolved. The data sets used to the present either bear few characters for many taxa (i.e., the ribosomal genes) or present many characters but lack many phyla (such as recent phylogenomic approaches) failing to provide definitive answers for all the regions of the bilaterian tree. We performed phylogenetic analyses using a molecular matrix with a high number of characters and bilaterian phyla. This data set is built from 13 genes (8,880 bp) belonging to 90 taxa from 27 bilaterian phyla. Probabilistic analyses robustly support the three superclades, the monophyly of Chordata, a spiralian clade including Brachiozoa, the basal position of a paraphyletic Acoelomorpha, and point to an ecdysozoan affiliation for Chaetognatha. This new phylogeny not only agrees with most classical molecular results but also provides new insights into the relationships between lophotrochozoans and challenges the results obtained using high-throughput strategies, highlighting the problems associated with the current trend to increase gene number rather than taxa. PMID:19602542

  13. The ITS1-5.8S-ITS2 sequence region in the Musaceae: structure, diversity and use in molecular phylogeny.

    Eva Hřibová

    Full Text Available Genes coding for 45S ribosomal RNA are organized in tandem arrays of up to several thousand copies and contain 18S, 5.8S and 26S rRNA units separated by internal transcribed spacers ITS1 and ITS2. While the rRNA units are evolutionary conserved, ITS show high level of interspecific divergence and have been used frequently in genetic diversity and phylogenetic studies. In this work we report on the structure and diversity of the ITS region in 87 representatives of the family Musaceae. We provide the first detailed information on ITS sequence diversity in the genus Musa and describe the presence of more than one type of ITS sequence within individual species. Both Sanger sequencing of amplified ITS regions and whole genome 454 sequencing lead to similar phylogenetic inferences. We show that it is necessary to identify putative pseudogenic ITS sequences, which may have negative effect on phylogenetic reconstruction at lower taxonomic levels. Phylogenetic reconstruction based on ITS sequence showed that the genus Musa is divided into two distinct clades--Callimusa and Australimusa and Eumusa and Rhodochlamys. Most of the intraspecific banana hybrids analyzed contain conserved parental ITS sequences, indicating incomplete concerted evolution of rDNA loci. Independent evolution of parental rDNA in hybrids enables determination of genomic constitution of hybrids using ITS. The observation of only one type of ITS sequence in some of the presumed interspecific hybrid clones warrants further study to confirm their hybrid origin and to unravel processes leading to evolution of their genomes.

  14. Anonymous nuclear markers data supporting species tree phylogeny and divergence time estimates in a cactus species complex in South America.

    Perez, Manolo F; Carstens, Bryan C; Rodrigues, Gustavo L; Moraes, Evandro M

    2016-03-01

    Supportive data related to the article "Anonymous nuclear markers reveal taxonomic incongruence and long-term disjunction in a cactus species complex with continental-island distribution in South America" (Perez et al., 2016) [1]. Here, we present pyrosequencing results, primer sequences, a cpDNA phylogeny, and a species tree phylogeny. PMID:26900589

  15. RAD-seq derived genome-wide nuclear markers resolve the phylogeny of tunas.

    Díaz-Arce, Natalia; Arrizabalaga, Haritz; Murua, Hilario; Irigoien, Xabier; Rodríguez-Ezpeleta, Naiara

    2016-09-01

    Although species from the genus Thunnus include some of the most commercially important and most severely overexploited fishes, the phylogeny of this genus is still unresolved, hampering evolutionary and traceability studies that could help improve conservation and management strategies for these species. Previous attempts based on mitochondrial and nuclear markers were unsuccessful in inferring a congruent and reliable phylogeny, probably due to mitochondrial introgression events and lack of enough phylogenetically informative markers. Here we infer the first genome-wide nuclear marker-based phylogeny of tunas using restriction site associated DNA sequencing (RAD-seq) data. Our results, derived from phylogenomic inferences obtained from 128 nucleotide matrices constructed using alternative data assembly procedures, support a single Thunnus evolutionary history that challenges previous assumptions based on morphological and molecular data. PMID:27286653

  16. Efficient Enumeration of the Directed Binary Perfect Phylogenies from Incomplete Data

    Kiyomi, Masashi; Saitoh, Toshiki

    2012-01-01

    We study a character-based phylogeny reconstruction problem when an incomplete set of data is given. More specifically, we consider the situation under the directed perfect phylogeny assumption with binary characters in which for some species the states of some characters are missing. Our main object is to give an efficient algorithm to enumerate (or list) all perfect phylogenies that can be obtained when the missing entries are completed. While a simple branch-and-bound algorithm (B&B) shows a theoretically good performance, we propose another approach based on a zero-suppressed binary decision diagram (ZDD). Experimental results on randomly generated data exhibit that the ZDD approach outperforms B&B. We also prove that counting the number of phylogenetic trees consistent with a given data is #P-complete, thus providing an evidence that an efficient random sampling seems hard.

  17. Sequence-Length Requirement of Distance-Based Phylogeny Reconstruction: Breaking the Polynomial Barrier

    Roch, Sebastien

    2009-01-01

    We introduce a new distance-based phylogeny reconstruction technique which provably achieves, at sufficiently short branch lengths, a polylogarithmic sequence-length requirement -- improving significantly over previous polynomial bounds for distance-based methods. The technique is based on an averaging procedure that implicitly reconstructs ancestral sequences. In the same token, we extend previous results on phase transitions in phylogeny reconstruction to general time-reversible models. More precisely, we show that in the so-called Kesten-Stigum zone (roughly, a region of the parameter space where ancestral sequences are well approximated by ``linear combinations'' of the observed sequences) sequences of length $\\poly(\\log n)$ suffice for reconstruction when branch lengths are discretized. Here $n$ is the number of extant species. Our results challenge, to some extent, the conventional wisdom that estimates of evolutionary distances alone carry significantly less information about phylogenies than full sequ...

  18. Genome-based phylogeny of dsDNA viruses by a novel alignment-free method.

    Gao, Yang; Luo, Liaofu

    2012-01-15

    Sequence alignment is not directly applicable to whole genome phylogeny since several events such as rearrangements make full length alignments impossible. Here, a novel alignment-free method derived from the standpoint of information theory is proposed and used to construct the whole-genome phylogeny for a population of viruses from 13 viral families comprising 218 dsDNA viruses. The method is based on information correlation (IC) and partial information correlation (PIC). We observe that (i) the IC-PIC tree segregates the population into clades, the membership of each is remarkably consistent with biologist's systematics only with little exceptions; (ii) the IC-PIC tree reveals potential evolutionary relationships among some viral families; and (iii) the IC-PIC tree predicts the taxonomic positions of certain "unclassified" viruses. Our approach provides a new way for recovering the phylogeny of viruses, and has practical applications in developing alignment-free methods for sequence classification. PMID:22100880

  19. RAD-seq derived genome-wide nuclear markers resolve the phylogeny of tunas

    Díaz-Arce, Natalia

    2016-06-07

    Although species from the genus Thunnus include some of the most commercially important and most severely overexploited fishes, the phylogeny of this genus is still unresolved, hampering evolutionary and traceability studies that could help improve conservation and management strategies for these species. Previous attempts based on mitochondrial and nuclear markers were unsuccessful in inferring a congruent and reliable phylogeny, probably due to mitochondrial introgression events and lack of enough phylogenetically informative markers. Here we infer the first genome-wide nuclear marker-based phylogeny of tunas using restriction site associated DNA sequencing (RAD-seq) data. Our results, derived from phylogenomic inferences obtained from 128 nucleotide matrices constructed using alternative data assembly procedures, support a single Thunnus evolutionary history that challenges previous assumptions based on morphological and molecular data.

  20. Whole genome association mapping by incompatibilities and local perfect phylogenies

    Besenbacher Søren

    2006-10-01

    Full Text Available Abstract Background With current technology, vast amounts of data can be cheaply and efficiently produced in association studies, and to prevent data analysis to become the bottleneck of studies, fast and efficient analysis methods that scale to such data set sizes must be developed. Results We present a fast method for accurate localisation of disease causing variants in high density case-control association mapping experiments with large numbers of cases and controls. The method searches for significant clustering of case chromosomes in the "perfect" phylogenetic tree defined by the largest region around each marker that is compatible with a single phylogenetic tree. This perfect phylogenetic tree is treated as a decision tree for determining disease status, and scored by its accuracy as a decision tree. The rationale for this is that the perfect phylogeny near a disease affecting mutation should provide more information about the affected/unaffected classification than random trees. If regions of compatibility contain few markers, due to e.g. large marker spacing, the algorithm can allow the inclusion of incompatibility markers in order to enlarge the regions prior to estimating their phylogeny. Haplotype data and phased genotype data can be analysed. The power and efficiency of the method is investigated on 1 simulated genotype data under different models of disease determination 2 artificial data sets created from the HapMap ressource, and 3 data sets used for testing of other methods in order to compare with these. Our method has the same accuracy as single marker association (SMA in the simplest case of a single disease causing mutation and a constant recombination rate. However, when it comes to more complex scenarios of mutation heterogeneity and more complex haplotype structure such as found in the HapMap data our method outperforms SMA as well as other fast, data mining approaches such as HapMiner and Haplotype Pattern Mining (HPM

  1. Global diversity and phylogeny of the Asteroidea (Echinodermata.

    Christopher L Mah

    Full Text Available Members of the Asteroidea (phylum Echinodermata, popularly known as starfish or sea stars, are ecologically important and diverse members of marine ecosystems in all of the world's oceans. We present a comprehensive overview of diversity and phylogeny as they have figured into the evolution of the Asteroidea from Paleozoic to the living fauna. Living post-Paleozoic asteroids, the Neoasteroidea, are morphologically separate from those in the Paleozoic. Early Paleozoic asteroid faunas were diverse and displayed morphology that foreshadowed later living taxa. Preservation presents significant difficulties, but fossil occurrence and current accounts suggests a diverse Paleozoic fauna, which underwent extinction around the Permian-Triassic interval was followed by re-diversification of at least one surviving lineage. Ongoing phylogenetic classification debates include the status of the Paxillosida and the Concentricycloidea. Fossil and molecular evidence has been and continues to be part of the ongoing evolution of asteroid phylogenetic research. The modern lineages of asteroids include the Valvatacea, the Forcipulatacea, the Spinlosida, and the Velatida. We present an overview of diversity in these taxa, as well as brief notes on broader significance, ecology, and functional morphology of each. Although much asteroid taxonomy is stable, many new taxa remain to be discovered with many new species currently awaiting description. The Goniasteridae is currently one of the most diverse families within the Asteroidea. New data from molecular phylogenetics and the advent of global biodiversity databases, such as the World Asteroidea Database (http://www.marinespecies.org/Asteroidea/ present important new springboards for understanding the global biodiversity and evolution of asteroids.

  2. Forelimb-hindlimb developmental timing changes across tetrapod phylogeny

    Selwood Lynne

    2007-10-01

    Full Text Available Abstract Background Tetrapods exhibit great diversity in limb structures among species and also between forelimbs and hindlimbs within species, diversity which frequently correlates with locomotor modes and life history. We aim to examine the potential relation of changes in developmental timing (heterochrony to the origin of limb morphological diversity in an explicit comparative and quantitative framework. In particular, we studied the relative time sequence of development of the forelimbs versus the hindlimbs in 138 embryos of 14 tetrapod species spanning a diverse taxonomic, ecomorphological and life-history breadth. Whole-mounts and histological sections were used to code the appearance of 10 developmental events comprising landmarks of development from the early bud stage to late chondrogenesis in the forelimb and the corresponding serial homologues in the hindlimb. Results An overall pattern of change across tetrapods can be discerned and appears to be relatively clade-specific. In the primitive condition, as seen in Chondrichthyes and Osteichthyes, the forelimb/pectoral fin develops earlier than the hindlimb/pelvic fin. This pattern is either retained or re-evolved in eulipotyphlan insectivores (= shrews, moles, hedgehogs, and solenodons and taken to its extreme in marsupials. Although exceptions are known, the two anurans we examined reversed the pattern and displayed a significant advance in hindlimb development. All other species examined, including a bat with its greatly enlarged forelimbs modified as wings in the adult, showed near synchrony in the development of the fore and hindlimbs. Conclusion Major heterochronic changes in early limb development and chondrogenesis were absent within major clades except Lissamphibia, and their presence across vertebrate phylogeny are not easily correlated with adaptive phenomena related to morphological differences in the adult fore- and hindlimbs. The apparently conservative nature of this

  3. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment.

    Kwasniewska, Jolanta; Jaskowiak, Joanna

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  4. A renaissance for the pioneering 16S rRNA gene

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  5. Rapid identification of Renibacterium salmoninarum using an oligonucleotide probe complementary to 16S rRNA.

    Mattsson, J G; Gersdorf, H; Jansson, E; Hongslo, T; Göbel, U B; Johansson, K E

    1993-02-01

    Bacterial kidney disease in salmonid fish is caused by the slow-growing Gram-positive rod, Renibacterium salmoninarum. The partial sequence of 16S rRNA from R. salmoninarum was determined and compared with published bacterial 16S rRNA sequences. From this sequence information, a 30-bases-long oligonucleotide was designed and used as a specific probe for identification of R. salmoninarum in filter hybridization experiments. Strong specific hybridization signals were observed for all strains of R. salmoninarum tested. Furthermore, no cross-hybridization could be seen against 22 other bacterial species, among them other salmonid fish pathogens. The detection limit for the probe in direct filter hybridization by the dot-blot technique was 2.5 x 10(4) bacteria. It was also possible to detect R. salmoninarum in clinical samples by direct filter hybridization. PMID:8455640

  6. Characterization of the nuclear ribosomal DNA units and phylogeny of Beta L. wild forms and cultivated beets.

    Santoni, S; Bervillé, A

    1992-03-01

    The nuclear rDNA units of species belonging to the genus Beta were characterized using heterologous probes of flax (entire unit and 25S) and sunflower (6.1-kb Eco fragment containing the 18S, the entire intergenic spacer (IGS) and a small piece of the 25S). The physical maps of one species from each section of the genus was constructed by localization of the EcoRI, BamHI, HindIII, KpnI and SacI restriction sites. For each species a single individual was used to obtain total DNA. The major unit length is 11 kb, but variant length units at 10.4, 10.7 and 11.3 kb were found as minor forms. However, some individuals carried the 10.4-kb or the 10.7-kb variant length unit as the major form. For the variant length units of one species the restriction sites were conserved, so that the variation in length occurred in the IGS. The EcoRI fragment corresponding to the intergenic spacer appeared to be the best indicator of variation. The variable sequence in the IGS sometimes generated new restriction sites for the Corollinae and mainly, did so, for the Vulgares relative to the Procumbentes. The variable sites were able, to differentiate the three sections and species within the sections. Corollinae species belong to two different groups according to the absence or the presence of the BamHI (B4) site. The Vulgares species contain several unit types. We proposed that all the unit types derived from a unique unit, V-11-2.3, by unequal crossing-overs or conversion. We also supposed a homogenization mechanism because we found individuals homogeneous for every unit type. Among the cultivated beets, all the root beets contain only one rDNA unit type, V-11-2.9. Thus, we supposed that the common unit type of cultivated beets either brings a physiological advantage or is strictly linked to a favorable allele. It is likely that the rDNA unit of B. maritima were eliminated from sugar beet by the breeding process since they were not recovered. Whatever the process, we deduced that all the

  7. Direct ribosome isolation from soil to extract bacterial rRNA for community analysis.

    Felske, A; B. Engelen; Nübel, U; Backhaus, H

    1996-01-01

    A simple method that combines an adapted ribosome isolation method and a common RNA extraction step has been developed for selective recovery of intact rRNA from natural microbial communities in soil. After mechanical cell lysis, ribosomes are separated by centrifugation steps, avoiding massive humic acid contamination and RNA degradation. The protocol accommodates the complex composition of soils by blocking adsorbing surfaces and humic acids with polyvinylpyrrolidone and bovine serum albumi...

  8. New bioinformatic tools for analysis of nucleotide modifications in eukaryotic rRNA

    Piekna-Przybylska, Dorota; Decatur, Wayne A.; Fournier, Maurille J.

    2007-01-01

    This report presents a valuable new bioinformatics package for research on rRNA nucleotide modifications in the ribosome, especially those created by small nucleolar RNA:protein complexes (snoRNPs). The interactive service, which is not available elsewhere, enables a user to visualize the positions of pseudouridines, 2′-O-methylations, and base methylations in three-dimensional space in the ribosome and also in linear and secondary structure formats of ribosomal RNA. Our tools provide additio...

  9. rRNA genes from the lower chordate Herdmania momus: structural similarity with higher eukaryotes.

    Degnan, B M; Yan, J.; Hawkins, C J; Lavin, M F

    1990-01-01

    Ascidians, primitive chordates that have retained features of the likely progenitors to all vertebrates, are a useful model to study the evolutionary relationship of chordates to other animals. We have selected the well characterized ribosomal RNA (rRNA) genes to investigate this relationship, and we describe here the cloning and characterization of an entire ribosomal DNA (rDNA) tandem repeat unit from a lower chordate, the ascidian Herdmania momus. rDNA copy number and considerable sequence...

  10. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    Haltiner, M M; Smale, S T; Tjian, R

    1986-01-01

    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this...

  11. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    Mohammad Bagher Javadi Nobandegani; Halimi Mohd Saud; Wong Mui Yun

    2015-01-01

    Phosphate solubilizing bacteria (PSB) can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang) oil palm field (University Putra Malaysia). Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta sub...

  12. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    Anna eKiryk

    2013-11-01

    Full Text Available Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer´s disease (AD and may play a role in dementia. Moreover aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3 and dentate gyrus. Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that thirty-six transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the dentate gyrus a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving

  13. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  14. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness.

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan

    2016-06-01

    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general. PMID:26119842

  15. 基于核18S rDNA和叶绿体trnK序列鉴定姜黄属植物%Authentication of Curcuma species (Zingiberaceae)based on nuclear 18S rDNA and plastid trnK sequences

    曹晖; 佐佐木阳平; 伏见裕利; 小松かつ子

    2010-01-01

    姜科(Zingiberaceae)姜黄属(Curcuma)多种植物的根茎或块根如莪术(Curcumae Rhizoma)、姜黄(Curcumae Longae Rhizoma)、郁金(Curcumae Radix)等为常用中药,莪术为蓬莪术Curcuma phaeocaulis Val.、广西莪术C. kwangsinensis S.G Lee et C.F. Liang和温莪术C. wenyujin Y.H.Chen et C.Ling根茎,具有行气破血、消积化食等功效;姜黄为姜黄C. longa L.根茎,具有行气破血、通经止痛等功效;郁金为莪术及姜黄块根,具有活血化瘀、行气止痛、利胆等功效.此3类药材常有混用,而且姜黄属植物鉴别主要基于新鲜状态,依赖腊叶标本较难鉴别.本研究通过分子系统学和生物信息学手段对姜黄属18种植物核糖体RNA小亚基基因(18S rRNA)和叶绿体赖氨酸tRNA基因(trnK)进行PCR直接测序,获得这2个基因的完整序列,以1种姜花属(Hedychium)和2种姜属(Zingiber)植物为外类群分析比较其序列变异,用PAUP法建立了18种姜黄属植物的亲缘关系.所得结果显示,18S rDNA序列长度1810 bp,trnK为2696~2703 bp.姜黄属植物基因种间变异范围为0~0.05%(18S rDNA)和0~0.19%(trnK),在种一级水平单系分化上得到100%bootstrap确证.18种姜黄属植物18S rDNA序列仅有1个变异位点,在系统树上广西莪术C. kwangsiensis和莪术C. zedoaria日本居群与其他16种形成分化.trnK基因序列可变区在2个trnK外显子与matK内含子之间,共有3个DNA插入/缺失,包括1个8-bp的缺失重复序列和1个4-bp、1个14-bp插入重复序列;5个单核苷酸多态性(SNPs)位点,trnK序列存在明显的种间基因条形码(DNAbarcoding).研究结果表明分子系统学可以作为姜黄属植物亲缘关系研究的重要手段,为部分姜黄属植物的种属归并提供了分子依据,trnK基因序列可变区作为DNA条形码候选基因可用于鉴定姜黄属植物及其药材.

  16. rRNA Binding Sites and the Molecular Mechanism of Action of the Tetracyclines.

    Chukwudi, Chinwe U

    2016-08-01

    The tetracycline antibiotics are known to be effective in the treatment of both infectious and noninfectious disease conditions. The 16S rRNA binding mechanism currently held for the antibacterial action of the tetracyclines does not explain their activity against viruses, protozoa that lack mitochondria, and noninfectious conditions. Also, the mechanism by which the tetracyclines selectively inhibit microbial protein synthesis against host eukaryotic protein synthesis despite conservation of ribosome structure and functions is still questionable. Many studies have investigated the binding of the tetracyclines to the 16S rRNA using the small ribosomal subunit of different bacterial species, but there seems to be no agreement between various reports on the exact binding site on the 16S rRNA. The wide range of activity of the tetracyclines against a broad spectrum of bacterial pathogens, viruses, protozoa, and helminths, as well as noninfectious conditions, indicates a more generalized effect on RNA. In the light of recent evidence that the tetracyclines bind to various synthetic double-stranded RNAs (dsRNAs) of random base sequences, suggesting that the double-stranded structures may play a more important role in the binding of the tetracyclines to RNA than the specific base pairs, as earlier speculated, it is imperative to consider possible alternative binding modes or sites that could help explain the mechanisms of action of the tetracyclines against various pathogens and disease conditions. PMID:27246781

  17. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  18. Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome

    Carlos; W; Nossa; William; E; Oberdorf; Jφrn; A; Aas; Bruce; J; Paster; Todd; Z; DeSantis; Eoin; L; Brodie; Daniel; Malamud; Michael; A; Poles

    2010-01-01

    AIM:To design and validate broad-range 16S rRNA primers for use in high throughput sequencing to classify bacteria isolated from the human foregut microbiome.METHODS:A foregut microbiome dataset was constructed using 16S rRNA gene sequences obtained from oral,esophageal,and gastric microbiomes produced by Sanger sequencing in previous studies represented by 219 bacterial species.Candidate primers evaluated were from the European rRNA database.To assess the effect of sequence length on accuracy of classifica...

  19. Primary and secondary structure of 5.8S rRNA from the silkgland of Bombyx mori.

    Fujiwara, H.; Kawata, Y.; H. Ishikawa

    1982-01-01

    Nucleotide sequence of 5.8S rRNA of the silkworm, Bombyx mori has been determined by gel sequencing methods. The 5.8S rRNA was the longest so far reported, with the 5'-terminal sequence several nucleotides longer than those of the other organisms. Upon constructing the secondary structure in accordance with the "burp gun" model (12), the Bombyx 5.8S rRNA formed a wide-open "muzzle" due to several unpaired bases at the ends. The overall structure also appeared less stable with less G . C pairs...

  20. First molecular phylogeny of the subfamily Polycerinae (Mollusca, Nudibranchia, Polyceridae)

    Palomar, Gemma; Pola, Marta; Garcia-Vazquez, Eva

    2014-03-01

    The subfamily Polycerinae includes four genera with around 46 species described to date. This subfamily is characterized by a limaciform body, which may have simple tentacular processes on the margin of the oral veil. Phylogenetic relationships between the genera of the subfamily Polycerinae (Polyceridae) have not yet been studied, and therefore, the only available information is based on morphological descriptions. The present study reports the first phylogenetic analysis of Polycerinae based on the mitochondrial genes cytochrome oxidase subunit I and the large ribosomal subunit (16S rRNA) using maximum likelihood and Bayesian methods. Our results showed that Polycerinae is monophyletic, but the relationships within the subfamily as well as within Polycera remain unresolved. A key finding of this study is that there are clearly two sympatric species of Polycera present in South Africa: Polycera capensis Quoy and Gaimard, 1824 also found in Australia and an undescribed Polycera sp. On the other hand, the studied specimens of the genus Gymnodoris were clustered within Polycerinae, reopening the problem of the systematic position of this genus. Additional genes and species of Polycerinae and Gymnodoris would provide more information and probably fully resolve this situation.

  1. An efficient rRNA removal method for RNA sequencing in GC-rich bacteria

    Peano Clelia

    2013-01-01

    Full Text Available Abstract Background Next generation sequencing (NGS technologies have revolutionized gene expression studies and functional genomics analysis. However, further improvement of RNA sequencing protocols is still desirable, in order to reduce NGS costs and to increase its accuracy. In bacteria, a major problem in RNA sequencing is the abundance of ribosomal RNA (rRNA, which accounts for 95-98% of total RNA and can therefore hinder sufficient coverage of mRNA, the main focus of transcriptomic studies. Thus, efficient removal of rRNA is necessary to achieve optimal coverage, good detection sensitivity and reliable results. An additional challenge is presented by microorganisms with GC-rich genomes, in which rRNA removal is less efficient. Results In this work, we tested two commercial kits for rRNA removal, either alone or in combination, on Burkholderia thailandensis. This bacterium, chosen as representative of the important Burkholderia genus, which includes both pathogenic and environmental bacteria, has a rather large (6.72 Mb and GC-rich (67.7% genome. Each enriched mRNA sample was sequenced through paired-end Illumina GAIIx run in duplicate, yielding between 10 and 40 million reads. We show that combined treatment with both kits allows an mRNA enrichment of more than 238-fold, enabling the sequencing of almost all (more than 90% B. thailandensis transcripts from less than 10 million reads, without introducing any bias in mRNA relative abundance, thus preserving differential expression profile. Conclusions The mRNA enrichment protocol presented in this work leads to an increase in detection sensitivity up to 770% compared to total RNA; such increased sensitivity allows for a corresponding reduction in the number of sequencing reads necessary for the complete analysis of whole transcriptome expression profiling. Thus we can conclude that the MICROBExpress/Ovation combined rRNA removal method could be suitable for RNA sequencing of whole

  2. Sequence alignment, mutual information, and dissimilarity measures for constructing phylogenies.

    Orion Penner

    Full Text Available BACKGROUND: Existing sequence alignment algorithms use heuristic scoring schemes based on biological expertise, which cannot be used as objective distance metrics. As a result one relies on crude measures, like the p- or log-det distances, or makes explicit, and often too simplistic, a priori assumptions about sequence evolution. Information theory provides an alternative, in the form of mutual information (MI. MI is, in principle, an objective and model independent similarity measure, but it is not widely used in this context and no algorithm for extracting MI from a given alignment (without assuming an evolutionary model is known. MI can be estimated without alignments, by concatenating and zipping sequences, but so far this has only produced estimates with uncontrolled errors, despite the fact that the normalized compression distance based on it has shown promising results. RESULTS: We describe a simple approach to get robust estimates of MI from global pairwise alignments. Our main result uses algorithmic (Kolmogorov information theory, but we show that similar results can also be obtained from Shannon theory. For animal mitochondrial DNA our approach uses the alignments made by popular global alignment algorithms to produce MI estimates that are strikingly close to estimates obtained from the alignment free methods mentioned above. We point out that, due to the fact that it is not additive, normalized compression distance is not an optimal metric for phylogenetics but we propose a simple modification that overcomes the issue of additivity. We test several versions of our MI based distance measures on a large number of randomly chosen quartets and demonstrate that they all perform better than traditional measures like the Kimura or log-det (resp. paralinear distances. CONCLUSIONS: Several versions of MI based distances outperform conventional distances in distance-based phylogeny. Even a simplified version based on single letter Shannon

  3. Taxonomy and phylogeny of two species of the genus Deviata (Protista, Ciliophora) from China, with description of a new soil form, Deviata parabacilliformis sp. nov.

    Li, Fengchao; Lv, Zhao; Yi, Zhenzhen; Al-Farraj, Saleh A; Al-Rasheid, Khaled A S; Shao, Chen

    2014-11-01

    The morphology and morphogenesis of a soil hypotrichous ciliate, Deviata parabacilliformis sp. nov., isolated from northern China, were investigated. D. parabacilliformis measures about 75-210 × 25-60 µm in vivo, with an elongate and flexible body. It possesses one right marginal row, two to four left marginal rows and three dorsal kineties. The main morphogenetic features of D. parabacilliformis are: (i) the oral primordium originates de novo; (ii) anlage IV of the opisthe originates from parental frontoventral row V, anlage V originates de novo, and anlage VI forms from frontoventral row VI; and (iii) anlage I of the proter originates from the anterior portion of the parental paroral, anlage II originates from the buccal cirrus, anlage III originates from the parabuccal cirri, anlage IV originates from parental frontoventral row IV and anlage V forms from the anterior of parental frontoventral row VI. The morphology of an edaphic population of another species of the genus Deviata, Deviata bacilliformis (Gelei 1954) Eigner 1995, was also investigated. This work also provides the first record of SSU rRNA gene sequences for species of the genus Deviata. Molecular phylogenetic analysis suggests that Deviata is not monophyletic, and its position is poorly resolved due to weak phylogenetic signal of the 18S marker in the Stichotrichida. PMID:25139418

  4. Phylogeny and relationship of some isoetalean spores from the Devonian to the present

    Bek, Jiří; Drábková, J.; Dašková, Jiřina; Chitaley, S.

    Prague : National Museum, 2006. s. 13-13. ISBN 80-7036-198-0. [European Palaeobotany- Palynology Conference /7./. 06.09.2006-11.09.2006, Prague] R&D Projects: GA AV ČR IAA3013902 Institutional research plan: CEZ:AV0Z30130516 Keywords : Isoetes * Polysporia * phylogeny * in situ spores * Palaeozoic Subject RIV: EF - Botanics

  5. Diversity and phylogeny of insect trypanosomatids: all that is hidden shall be revealed

    Maslov, D. A.; Votýpka, Jan; Yurchenko, V.; Lukeš, Julius

    2013-01-01

    Roč. 29, č. 1 (2013), s. 43-52. ISSN 1471-4922 R&D Projects: GA ČR GA204/09/1667 Institutional support: RVO:60077344 Keywords : biodiversity * Kinetoplastea * insect trypanosomatids * monoxenous parasites * phylogeny * taxonomy * Trypanosomatidae Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.217, year: 2013

  6. Phylogeny of some vespertilionid bats from Western Africa, Senegal - comparison of molecular and cytogenetic approach

    Koubínová, D.; Irwin, N.; Hulva, P.; Zima, Jan

    Vilnius: Gamtos tyrimu centras, 2011 - (Hutson, A.; Lina, P.). s. 73-74 ISBN 978-9986-443-55-1. [European Bat Research Symposium /12./. 22.08.2011-26.08.2011, Vilnius] Institutional research plan: CEZ:AV0Z60930519 Keywords : bats * phylogeny * Senegal Subject RIV: EG - Zoology

  7. Phantoms of Gondwana?-phylogeny of the spider subfamily Mynogleninae (Araneae: Linyphiidae)

    Frick, Holger; Scharff, Nikolaj

    2014-01-01

    This is the first genus-level phylogeny of the subfamily Mynogleninae. It is based on 190 morphological characters scored for 44 taxa: 37 mynoglenine taxa (ingroup) representing 15 of the 17 known genera and seven outgroup taxa representing the subfamilies Stemonyphantinae, Linyphiinae (Linyphiin...

  8. Reconstructing the phylogeny of aphids (Hemiptera: Aphididae) using DNA of the obligate symbiont Buchnera aphidicola

    Nováková, Eva; Hypša, Václav; Klein, J.; Foottit, R. G.; von Dohlen, C.D.; Moran, N. A.

    2013-01-01

    Roč. 68, č. 1 (2013), s. 42-54. ISSN 1055-7903 R&D Projects: GA ČR GD206/09/H026 Institutional support: RVO:60077344 Keywords : Aphid * Evolution * Buchnera * Phylogeny * Informative markers Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.018, year: 2013

  9. Site specific rates of mitochondrial genomes and the phylogeny of eutheria

    Honeycutt Rodney L

    2007-01-01

    Full Text Available Abstract Background Traditionally, most studies employing data from whole mitochondrial genomes to diagnose relationships among the major lineages of mammals have attempted to exclude regions that potentially complicate phylogenetic analysis. Components generally excluded are 3rd codon positions of protein-encoding genes, the control region, rRNAs, tRNAs, and the ND6 gene (encoded on the opposite strand. We present an approach that includes all the data, with the exception of the control region. This approach is based on a site-specific rate model that accommodates excessive homoplasy and that utilizes secondary structure as a reference for proper alignment of rRNAs and tRNAs. Results Mitochondrial genomic data for 78 eutherian mammals, 8 metatherians, and 3 monotremes were analyzed with a Bayesian analysis and our site specific rate model. The resultant phylogeny revealed strong support for most nodes and was highly congruent with more recent phylogenies based on nuclear DNA sequences. In addition, many of the conflicting relationships observed by earlier mitochondrial-based analyses were resolved without need for the exclusion of large subsets of the data. Conclusion Rather than exclusion of data to minimize presumed noise associated with non-protein encoding genes in the mitochondrial genome, our results indicate that selection of an appropriate model that accommodates rate heterogeneity across data partitions and proper treatment of RNA genes can result in a mitochondrial genome-based phylogeny of eutherian mammals that is reasonably congruent with recent phylogenies derived from nuclear genes.

  10. Molecular phylogeny of anoplocephalid tapeworms (Cestoda: Anoplocephalidae) infecting humans and non-human primates

    Doležalová, J.; Vallo, Peter; Petrželková, Klára Judita; Foitová, I.; Nurcahyo, W.; Mudakikwa, A.; Hashimoto, C.; Jirků, M.; Lukeš, J.; Scholz, T.; Modrý, D.

    2015-01-01

    Roč. 142, č. 10 (2015), s. 1278-1289. ISSN 0031-1820 R&D Projects: GA ČR GA524/06/0264; GA ČR GA206/09/0927 Institutional support: RVO:68081766 Keywords : Bertiella * Anoplocephala * phylogeny * primates * zoonotic potential Subject RIV: EG - Zoology Impact factor: 2.560, year: 2014

  11. Advances Achieved on Studies of East Asian mtDNA Phylogeny

    2006-01-01

    @@ Agroup of geneticists at the CAS Kunming Institute of Zoology (KIZ)succeeded in advancing out knowledge on the East Asian phylogeny of human mitochondrial DNA (mtDNA). Their work, which was finished by Dr. Kong Qingpeng under the guidance of ZHANG Yaping, was published by the journal Human Molecular Genetics.

  12. Relationship of Individual and Group Change: Ontogeny and Phylogeny in Biology.

    Gould, Steven Jay

    1984-01-01

    Considers the issue of parallels between ontogeny and phylogeny from an historical perspective. Discusses such parallels in relationship to two ontogenetic principles concerning recapitulation and sequence of stages. Differentiates between Piaget's use of the idea of recapitulation and Haeckel's biogenetic law. (Author/RH)

  13. A phylogeny-based revision of the family Luciferidae (Crustacea: Decapoda)

    Vereshchaka, Alexander L.; Olesen, Jørgen; Lunina, Anastasia A.

    2016-01-01

    Luciferidae is a family of peculiar and widely distributed shrimps with an unclear systematic position and uncertain internal phylogeny. We undertook a phylogenetic analysis of Luciferidae based on 169 morphological characters (147 binary, 22 multistate). Several characters were based on scanning...

  14. A multi gene sequence-based phylogeny of the Musaceae (banana) family

    Christelová, Pavla; Valárik, Miroslav; Hřibová, Eva; De Langhe, E.; Doležel, Jaroslav

    2011-01-01

    Roč. 11, č. 103 (2011), s. 1-13. ISSN 1471-2148 R&D Projects: GA AV ČR IAA600380703 Institutional research plan: CEZ:AV0Z50380511 Keywords : MOLECULAR PHYLOGENY * FLOWERING PLANTS * RIBOSOMAL DNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.521, year: 2011

  15. Punctuated Equilibrium Behavior and Zipf's Law in the Stochastic Branching Process Model of Phylogeny

    Matsumoto, T.; Aizawa, Y.

    1999-11-01

    A stochastic branching process model of phylogeny with niche space and interactions among species is considered. For an intermediate interaction range, the time series of diversity has long periods of stasis divided by periods of rapid increase. The concept of monophyletic size is introduced, and it is shown that the size distribution obeys Zipf's law.

  16. A molecular phylogeny of the Lecanora varia group, including a new species from western North America

    Pérez-Ortega, J.; Spribille, T.; Palice, Zdeněk; Elix, J. A.; Printzen, C.

    2010-01-01

    Roč. 9, č. 4 (2010), s. 523-535. ISSN 1617-416X R&D Projects: GA AV ČR(CZ) KJB600050635 Institutional research plan: CEZ:AV0Z60050516 Keywords : ITS * phylogeny * Lecanoraceae Subject RIV: EF - Botanics Impact factor: 1.266, year: 2010

  17. Towards a new paradigm in mayfly phylogeny (Ephemeroptera): combined analysis of morphological and molecular data

    Ogden, T. H.; Gattolliat, J. L.; Sartori, M.; Staniczek, A. H.; Soldán, Tomáš; Whiting, M. F.

    2009-01-01

    Roč. 34, č. 4 (2009), s. 616-634. ISSN 0307-6970 R&D Projects: GA AV ČR 1QS500070505 Institutional research plan: CEZ:AV0Z50070508 Keywords : Ephemeroptera * phylogeny * morfological a molecular data Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.467, year: 2009

  18. Some Histories of Molecular Evolution: Amniote Phylogeny, Vertebrate Eye Lens Evolution, and the Prion Gene

    Rheede, T. van

    2004-01-01

    In this thesis, the principles of molecular evolution and phylogeny are introduced in Chapter 1, while the subsequent chapters deal with the three topics mentioned in the title. Part I: Birds, reptiles and mammals are Amniota, organisms that have an amnion during their embryonal development. Even th

  19. Does phylogeny explain the host choice behaviour of potential biological control agents for Brassicaceae weeds?

    Four invasive Brassicaceae are currently being studied for biological control at the CABI Centre in Switzerland. A phylogenetic approach to host testing has so far been hampered by the fact that the evolutionary relationships of taxa within the Brassicaceae were unclear. Recently, a new phylogeny of...

  20. Phylogeny of the ascomycetous yeasts and the renaming of Pichia anomala to Wickerhamomyces anomalus

    Pichia anomala was reclassified as Wickerhamomyces anomalus following multigene phylogenetic analysis. In this review, the phylogeny of the ascomycetous yeasts is discussed, with emphasis on the genus Pichia. The genus, as defined from phenotype, had nearly 100 assigned species, but the number of ...

  1. Phylogeny, Morphology, and Metabolic and Invasive Capabilities of Epicellular Fish Coccidium Goussia janae

    Dogga, S.K.; Bartošová-Sojková, Pavla; Lukeš, Julius; Soldati-Favre, D.

    2015-01-01

    Roč. 166, č. 6 (2015), s. 659-676. ISSN 1434-4610 R&D Projects: GA ČR GBP505/12/G112 Institutional support: RVO:60077344 Keywords : Apicomplexa * Coccidia * Goussia janae * phylogeny * ultrastructure * invasion * central carbon metabolism. Subject RIV: EG - Zoology Impact factor: 3.045, year: 2014

  2. Diversity of insect trypanosomatids assessed from the spliced leader RNA and 5S rRNA genes and intergenic regions

    Podlipaev, Sergei; Sturm, N. R.; Fiala, Ivan; Fernandes, O.; Westenberger, S. J.; Dollet, M.; Campbell, D. A.; Lukeš, Julius

    2004-01-01

    Roč. 51, č. 3 (2004), s. 283-290. ISSN 1066-5234 Grant ostatní: European Community(XE) QLK 2-CT-2001-01810 Institutional research plan: CEZ:AV0Z6022909 Keywords : Kinetoplastida * phylogeny * Trypanosomatidae Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.403, year: 2004

  3. Species identification and profiling of complex microbial communities using shotgun Illumina sequencing of 16S rRNA amplicon sequences.

    Ong, SH; Kukkillaya, VU; Wilm, A; Lay, C; Ho, EX; Low, L; Hibberd, ML; Nagarajan, N.

    2013-01-01

    The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequenc...

  4. Intervening Sequences in rrl Genes and Fragmentation of 23S rRNA in Genera of the Family Enterobacteriaceae

    Pronk, Loes M; Sanderson, Kenneth E.

    2001-01-01

    Intervening sequences (IVSs) in the rrl genes for 23S rRNA are transcribed but later removed by RNase III without religation during RNA processing, leading to fragmented rRNA. We examined about 240 strains of the family Enterobacteriaceae for presence of IVSs using PCR. No IVSs were detected in strains belonging to Escherichia, Shigella, Enterobacter, Erwinia, Ewingella, Hafnia, Kluyvera, Morganella, Pantoea, or Serratia. Previously unreported IVSs were detected in Klebsiella oxytoca, Citroba...

  5. Transcriptional down-regulation and rRNA cleavage in Dictyostelium discoideum mitochondria during Legionella pneumophila infection.

    Chenyu Zhang

    Full Text Available Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial

  6. A Well-Resolved Phylogeny of the Trees of Puerto Rico Based on DNA Barcode Sequence Data

    Muscarella, Robert; Uriarte, María; Erickson, David L.; Swenson, Nathan G.; Zimmerman, Jess K.; Kress, W. John

    2014-01-01

    Background The use of phylogenetic information in community ecology and conservation has grown in recent years. Two key issues for community phylogenetics studies, however, are (i) low terminal phylogenetic resolution and (ii) arbitrarily defined species pools. Methodology/principal findings We used three DNA barcodes (plastid DNA regions rbcL, matK, and trnH-psbA) to infer a phylogeny for 527 native and naturalized trees of Puerto Rico, representing the vast majority of the entire tree flora of the island (89%). We used a maximum likelihood (ML) approach with and without a constraint tree that enforced monophyly of recognized plant orders. Based on 50% consensus trees, the ML analyses improved phylogenetic resolution relative to a comparable phylogeny generated with Phylomatic (proportion of internal nodes resolved: constrained ML = 74%, unconstrained ML = 68%, Phylomatic = 52%). We quantified the phylogenetic composition of 15 protected forests in Puerto Rico using the constrained ML and Phylomatic phylogenies. We found some evidence that tree communities in areas of high water stress were relatively phylogenetically clustered. Reducing the scale at which the species pool was defined (from island to soil types) changed some of our results depending on which phylogeny (ML vs. Phylomatic) was used. Overall, the increased terminal resolution provided by the ML phylogeny revealed additional patterns that were not observed with a less-resolved phylogeny. Conclusions/significance With the DNA barcode phylogeny presented here (based on an island-wide species pool), we show that a more fully resolved phylogeny increases power to detect nonrandom patterns of community composition in several Puerto Rican tree communities. Especially if combined with additional information on species functional traits and geographic distributions, this phylogeny will (i) facilitate stronger inferences about the role of historical processes in governing the assembly and

  7. A well-resolved phylogeny of the trees of Puerto Rico based on DNA barcode sequence data.

    Robert Muscarella

    Full Text Available The use of phylogenetic information in community ecology and conservation has grown in recent years. Two key issues for community phylogenetics studies, however, are (i low terminal phylogenetic resolution and (ii arbitrarily defined species pools.We used three DNA barcodes (plastid DNA regions rbcL, matK, and trnH-psbA to infer a phylogeny for 527 native and naturalized trees of Puerto Rico, representing the vast majority of the entire tree flora of the island (89%. We used a maximum likelihood (ML approach with and without a constraint tree that enforced monophyly of recognized plant orders. Based on 50% consensus trees, the ML analyses improved phylogenetic resolution relative to a comparable phylogeny generated with Phylomatic (proportion of internal nodes resolved: constrained ML = 74%, unconstrained ML = 68%, Phylomatic = 52%. We quantified the phylogenetic composition of 15 protected forests in Puerto Rico using the constrained ML and Phylomatic phylogenies. We found some evidence that tree communities in areas of high water stress were relatively phylogenetically clustered. Reducing the scale at which the species pool was defined (from island to soil types changed some of our results depending on which phylogeny (ML vs. Phylomatic was used. Overall, the increased terminal resolution provided by the ML phylogeny revealed additional patterns that were not observed with a less-resolved phylogeny.With the DNA barcode phylogeny presented here (based on an island-wide species pool, we show that a more fully resolved phylogeny increases power to detect nonrandom patterns of community composition in several Puerto Rican tree communities. Especially if combined with additional information on species functional traits and geographic distributions, this phylogeny will (i facilitate stronger inferences about the role of historical processes in governing the assembly and composition of Puerto Rican forests, (ii provide insight into

  8. A fungal phylogeny based on 42 complete genomes derived from supertree and combined gene analysis

    Stajich Jason E

    2006-11-01

    Full Text Available Abstract Background To date, most fungal phylogenies have been derived from single gene comparisons, or from concatenated alignments of a small number of genes. The increase in fungal genome sequencing presents an opportunity to reconstruct evolutionary events using entire genomes. As a tool for future comparative, phylogenomic and phylogenetic studies, we used both supertrees and concatenated alignments to infer relationships between 42 species of fungi for which complete genome sequences are available. Results A dataset of 345,829 genes was extracted from 42 publicly available fungal genomes. Supertree methods were employed to derive phylogenies from 4,805 single gene families. We found that the average consensus supertree method may suffer from long-branch attraction artifacts, while matrix representation with parsimony (MRP appears to be immune from these. A genome phylogeny was also reconstructed from a concatenated alignment of 153 universally distributed orthologs. Our MRP supertree and concatenated phylogeny are highly congruent. Within the Ascomycota, the sub-phyla Pezizomycotina and Saccharomycotina were resolved. Both phylogenies infer that the Leotiomycetes are the closest sister group to the Sordariomycetes. There is some ambiguity regarding the placement of Stagonospora nodurum, the sole member of the class Dothideomycetes present in the dataset. Within the Saccharomycotina, a monophyletic clade containing organisms that translate CTG as serine instead of leucine is evident. There is also strong support for two groups within the CTG clade, one containing the fully sexual species Candida lusitaniae, Candida guilliermondii and Debaryomyces hansenii, and the second group containing Candida albicans, Candida dubliniensis, Candida tropicalis, Candida parapsilosis and Lodderomyces elongisporus. The second major clade within the Saccharomycotina contains species whose genomes have undergone a whole genome duplication (WGD, and their close

  9. Renibacterium salmoninarum isolates from different sources possess two highly conserved copies of the rRNA operon .

    Grayson, T H; Alexander, S M; Cooper, L F; Gilpin, M L

    2000-07-01

    The nucleotide sequences of the rRNA genes and the 5' flanking region were determined for R. salmoninarum ATCC 33209T from overlapping products generated by PCR amplification from the genomic DNA. Comparison of the sequences with rRNA genes from a variety of bacteria demonstrated the close relatedness between R. salmoninarum and the high G+C group of the actinobacteria, in particular, Arthrobacter species. A regulatory element within the 5' leader of the rRNA operon was identical to an element, CL2, described for mycobacteria. PCR, DNA sequence analysis, and DNA hybridisation were performed to examine variation between isolates from diverse sources which represented the four 16S-23S rRNA intergenic spacer sequevars previously described for R. salmoninarum. Two 23S-5S rRNA intergenic spacer sequevars of identical length were found. DNA hybridisation using probes complementary to 23S rDNA and 16S rDNA identified two rRNA operons which were identical or nearly identical amongst 40 isolates sourced from a variety of countries. PMID:11016696

  10. Genealogical analyses of multiple loci of litostomatean ciliates (Protista, Ciliophora, Litostomatea).

    Vd'ačný, Peter; Bourland, William A; Orsi, William; Epstein, Slava S; Foissner, Wilhelm

    2012-11-01

    The class Litostomatea is a highly diverse ciliate taxon comprising hundreds of free-living and endocommensal species. However, their traditional morphology-based classification conflicts with 18S rRNA gene phylogenies indicating (1) a deep bifurcation of the Litostomatea into Rhynchostomatia and Haptoria+Trichostomatia, and (2) body polarization and simplification of the oral apparatus as main evolutionary trends in the Litostomatea. To test whether 18S rRNA molecules provide a suitable proxy for litostomatean evolutionary history, we used eighteen new ITS1-5.8S rRNA-ITS2 region sequences from various free-living litostomatean orders. These single- and multiple-locus analyses are in agreement with previous 18S rRNA gene phylogenies, supporting that both 18S rRNA gene and ITS region sequences are effective tools for resolving phylogenetic relationships among the litostomateans. Despite insertions, deletions and mutational saturations in the ITS region, the present study shows that ITS1 and ITS2 molecules can be used to infer phylogenetic relationships not only at species level but also at higher taxonomic ranks when their secondary structure information is utilized to aid alignment. PMID:22789763

  11. Phylogeny of parasitic parabasalia and free-living relatives inferred from conventional markers vs. Rpb1, a single-copy gene.

    Shehre-Banoo Malik

    Full Text Available BACKGROUND: Parabasalia are single-celled eukaryotes (protists that are mainly comprised of endosymbionts of termites and wood roaches, intestinal commensals, human or veterinary parasites, and free-living species. Phylogenetic comparisons of parabasalids are typically based upon morphological characters and 18S ribosomal RNA gene sequence data (rDNA, while biochemical or molecular studies of parabasalids are limited to a few axenically cultivable parasites. These previous analyses and other studies based on PCR amplification of duplicated protein-coding genes are unable to fully resolve the evolutionary relationships of parabasalids. As a result, genetic studies of Parabasalia lag behind other organisms. PRINCIPAL FINDINGS: Comparing parabasalid EF1α, α-tubulin, enolase and MDH protein-coding genes with information from the Trichomonas vaginalis genome reveals difficulty in resolving the history of species or isolates apart from duplicated genes. A conserved single-copy gene encodes the largest subunit of RNA polymerase II (Rpb1 in T. vaginalis and other eukaryotes. Here we directly sequenced Rpb1 degenerate PCR products from 10 parabasalid genera, including several T. vaginalis isolates and avian isolates, and compared these data by phylogenetic analyses. Rpb1 genes from parabasalids, diplomonads, Parabodo, Diplonema and Percolomonas were all intronless, unlike intron-rich homologs in Naegleria, Jakoba and Malawimonas. CONCLUSIONS/SIGNIFICANCE: The phylogeny of Rpb1 from parasitic and free-living parabasalids, and conserved Rpb1 insertions, support Trichomonadea, Tritrichomonadea, and Hypotrichomonadea as monophyletic groups. These results are consistent with prior analyses of rDNA and GAPDH sequences and ultrastructural data. The Rpb1 phylogenetic tree also resolves species- and isolate-level relationships. These findings, together with the relative ease of Rpb1 isolation, make it an attractive tool for evaluating more extensive

  12. Molecular Infectious Disease Epidemiology: Survival Analysis and Algorithms Linking Phylogenies to Transmission Trees.

    Kenah, Eben; Britton, Tom; Halloran, M Elizabeth; Longini, Ira M

    2016-04-01

    Recent work has attempted to use whole-genome sequence data from pathogens to reconstruct the transmission trees linking infectors and infectees in outbreaks. However, transmission trees from one outbreak do not generalize to future outbreaks. Reconstruction of transmission trees is most useful to public health if it leads to generalizable scientific insights about disease transmission. In a survival analysis framework, estimation of transmission parameters is based on sums or averages over the possible transmission trees. A phylogeny can increase the precision of these estimates by providing partial information about who infected whom. The leaves of the phylogeny represent sampled pathogens, which have known hosts. The interior nodes represent common ancestors of sampled pathogens, which have unknown hosts. Starting from assumptions about disease biology and epidemiologic study design, we prove that there is a one-to-one correspondence between the possible assignments of interior node hosts and the transmission trees simultaneously consistent with the phylogeny and the epidemiologic data on person, place, and time. We develop algorithms to enumerate these transmission trees and show these can be used to calculate likelihoods that incorporate both epidemiologic data and a phylogeny. A simulation study confirms that this leads to more efficient estimates of hazard ratios for infectiousness and baseline hazards of infectious contact, and we use these methods to analyze data from a foot-and-mouth disease virus outbreak in the United Kingdom in 2001. These results demonstrate the importance of data on individuals who escape infection, which is often overlooked. The combination of survival analysis and algorithms linking phylogenies to transmission trees is a rigorous but flexible statistical foundation for molecular infectious disease epidemiology. PMID:27070316

  13. The role of human ribosomal proteins in the maturation of rRNA and ribosome production

    Robledo, Sara; Rachel A Idol; Crimmins, Dan L.; Ladenson, Jack H.; Mason, Philip J.; Bessler, Monica

    2008-01-01

    Production of ribosomes is a fundamental process that occurs in all dividing cells. It is a complex process consisting of the coordinated synthesis and assembly of four ribosomal RNAs (rRNA) with about 80 ribosomal proteins (r-proteins) involving more than 150 nonribosomal proteins and other factors. Diamond Blackfan anemia (DBA) is an inherited red cell aplasia caused by mutations in one of several r-proteins. How defects in r-proteins, essential for proliferation in all cells, lead to a hum...

  14. Structures of nucleolus and transcription sites of rRNA genes in rat liver cells

    2000-01-01

    We observed the ultrastructure of nucleolus in rat liver cells by conventional electronmicroscopy, and employed cytochemistry NAMA-Ur DNA specific stain method to analyze the distributionand position of nucleolar DNA in situ. The results showed that nucleolar DNA of rat livercells comes from nucleolus-associated chromatin, and continuously extends in the dense fibrillarcomponent (DFC) of nucleolus, localizes at the periphery of fibrillar center (FC) and in DFC. Furthermore,by employing anti-DNA/RNA hybrid antibodies, we directly and selectively labeled transcriptionsites of rRNA genes and testified that localization of transcription sites not only to DFC butalso to the periphery of FC.

  15. Altered features in the secondary structure of Vicia faba 5.8s rRNA.

    Nazar, R N; Wildeman, A G

    1981-01-01

    We have re-examined the nucleotide sequence of Vicia faba (broad bean) 5.8S rRNA using partial chemical degradation and a new approach to high temperature (65-80 degrees C) sequencing gels. The results indicate that the secondary structure was not completely disrupted in previous studies (Tanaka, Y., Dyer, T.A. and Brownlee, G.G. (1980) Nucleic Acid Res. 8, 1259-1272) and explain ambiguities between the nucleotide sequence and T1 ribonuclease digests. Despite this revision, estimates in the s...

  16. Functional interactions within 23S rRNA involving the peptidyltransferase center

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S r...... chloramphenicol. Introduction of the domain II deletion into these double-mutation constructs gives rise to erythromycin resistance. The results are interpreted as indicating that position 2032 interacts with the peptidyltransferase loop and that there is a functional connection between domains II and V....

  17. Evolution of green plants as deduced from 5S rRNA sequences

    Hori, Hiroshi; Lim, Byung-Lak; OSAWA, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land pl...

  18. Negative in vitro selection identifies the rRNA recognition motif for ErmE methyltransferase

    Nielsen, A K; Douthwaite, S; Vester, B

    1999-01-01

    the adjacent single-stranded region around A2058. An RNA transcript of 72 nt that displays this motif functions as an efficient substrate for the ErmE methyltransferase. Pools of degenerate RNAs were formed by doping 34-nt positions that extend over and beyond the putative Erm recognition motif within...... contained substitutions at single sites, and these are confined to 12 nucleotide positions. These nucleotides, corresponding to A2051-A2060, C2611, and A2614 in 23S rRNA, presumably comprise the RNA recognition motif for ErmE methyltransferase. The structure formed by these nucleotides is highly conserved...

  19. 灰飞虱类酵母型共生菌18S rDNA序列变异及系统发生%Phylogenetic Relationships and Evolution of Yeast-like Symbionts of the Small Brown Planthoppers Based on Partial 18S rDNA Sequences

    严健; 邓可京; 曹清玉; 邵红光; 沈大棱

    2000-01-01

    分离纯化了云南楚雄、宁夏银川、北京通县、上海七宝镇、四川西昌5个地区的灰飞虱体内类酵母型共生菌(Yeast-like Symbionts, YLS),并对其18S rDNA的约600bp的序列进行了测定.结合已有的序列,构建了不同宿主的YLS的分子系统树.结果表明,灰飞虱的YLS属于子囊菌亚门Pyrenomycetes纲,与此纲的H. chrysospermus亲缘关系最近.我国各地区及日本的灰飞虱体内YLS可能是同一种的不同地理群体,不同的YLS在其宿主分化后才选择了不同的宿主,之后与其宿主长期共同进化、共同适应.

  20. Complete chloroplast genome sequences of Drimys, Liriodendron, andPiper: Implications for the phylogeny of magnoliids and the evolution ofGC content

    Zhengqiu, C.; Penaflor, C.; Kuehl, J.V.; Leebens-Mack, J.; Carlson, J.; dePamphilis, C.W.; Boore, J.L.; Jansen, R.K.

    2006-06-01

    the inverted repeat due to the presence of rRNA genes and lowest in the small single copy region where most NADH genes are located. Phylogenetic analyses using maximum parsimony and maximum likelihood methods were performed on DNA sequences of 61 protein-coding genes. Trees from both analyses provided strong support for the monophyly of magnoliids and two strongly supported groups were identified, the Canellales/Piperales and the Laurales/Magnoliales. The phylogenies also provided moderate to strong support for the basal position of Amborella, and a sister relationship of magnoliids to a clade that includes monocots and eudicots. The complete sequences of three magnoliid chloroplast genomes provide new data from the largest basal angiosperm clade. Evolutionary comparisons of these new genome sequences, combined with other published angiosperm genome, confirm that GC content is unevenly distributed across the genome by location, codon position, and functional group. Furthermore, phylogenetic analyses provide the strongest support so far for the hypothesis that the magnoliids are sister to a large clade that includes both monocots and eudicots.

  1. GENE 16S RRNA SEQUENCE PHYLOGENETIC ANALYSIS OF LYSINE PRODUCERS STRAINS

    G. S. Andriiash

    2014-12-01

    Full Text Available The phylogenetic relationships of strainsproducers of essential amino acids of aspartate family Brevibacterium sp. UCM Ac-674 (Brevibacterium sp. 90, Brevibacterium sp. IMV Ac-5004 (Brevibacterium sp. 90H, Brevibacterium sp. UCM Ac-675 (Brevibacterium sp. E531, mutant strain Brevibacterium sp. IMV B-7447 from the «Collections strains and lines of plants for food and agricultural biotechnology SO “Institute for Food Biotechnology and Genomics” of National Academy of Sciences of Ukraine were investigated. The affiliation strain Brevibacterium sp. IMV B-7447 to the genus Brevibacterium within the sequences of the genes based on 16S rRNA was confirmed. The dendogram of phylogenetic relationships of studied strains and related strains Brevibacterium from database GenBank was constructed. It was shown that by the criterion of homology gene sequences based on 16S rRNA the investigated strains-producers belong to three phylogenetic groups. It was established that the mutant strain Brevibacterium sp. ІMV B-7447 has no analogues in the database GenBank.

  2. Phylogeny of species and cytotypes of mole rats (Spalacidae) in Turkey inferred from mitochondrial cytochrome b gene sequencees

    Kandemir, I.; Sozen, M.; Matur, F.; Kankilic, T.; Martínková, Natália; Colak, F.; Ozkurt, S. O.; Colak, E.

    2012-01-01

    Roč. 61, č. 1 (2012), s. 25-33. ISSN 0139-7893 Institutional support: RVO:68081766 Keywords : Nannospalax * molecular phylogeny * chromosomal form * Anatolia * Thrace Subject RIV: EG - Zoology Impact factor: 0.494, year: 2012

  3. Localization of ribosomal genes in three Pimelodus species (Siluriformes, Pimelodidae of the São Francisco River: 5S genes as species markers and conservation of the 18S rDNA sites

    Caroline Garcia

    2008-01-01

    Full Text Available Pimelodidae is one of the most representative of Neotropical catfish families. However, these fish are still poorly studied in terms of cytogenetics, especially regarding the application of more accurate techniques such as the chromosomal localization of ribosomal genes. In the present work, fluorescent in situ hybridization with 5S and 18S rDNA probes was employed for rDNA site mapping in Pimelodus sp., P. fur and P. maculatus from the São Francisco River in the Três Marias municipality - MG. The results from the application of the 18S probe confirmed the previous data obtained by silver nitrate staining, identifying a simple nucleolar organizing region system for these species. However, the labeling results from the 5S rDNA probe demonstrated a difference in the number and localization of these sites between the analyzed species. The obtained data allowed inferences on the possible processes involved in the karyotypic evolution of this genus.

  4. Analysis of the Precursor rRNA Fractions of Rapidly Growing Mycobacteria: Quantification by Methods That Include the Use of a Promoter (rrnA P1) as a Novel Standard†

    Menéndez, María del Carmen; Rebollo, María José; Núñez, María del Carmen; Cox, Robert A.; García, María Jesús

    2005-01-01

    Mycobacterial species are able to control rRNA production through variations in the number and strength of promoters controlling their rrn operons. Mycobacterium chelonae and M. fortuitum are members of the rapidly growing mycobacterial group. They carry a total of five promoters each, encoded, respectively, by one and two rrn operons per genome. Quantification of precursor rrn transcriptional products (pre-rrn) has allowed detection of different promoter usage during cell growth. Bacteria growing in several culture media with different nutrient contents were compared. Balanced to stationary phases were analyzed. Most promoters were found to be used at different levels depending on the stage of bacterial growth and the nutrient content of the culture medium. Some biological implications are discussed. Sequences of the several promoters showed motifs that could be correlated to their particular level of usage. A product corresponding to the first rrnA promoter in both species, namely, rrnA P1, was found to contribute at a low and near-constant level to pre-rRNA synthesis, regardless of the culture medium used and the stage of growth analyzed. This product was used as a standard to quantitate rRNA gene expression by real-time PCR when M. fortuitum infected macrophages. It was shown that this bacterium actively synthesizes rRNA during the course of infection and that one of its rrn operons is preferentially used under such conditions. PMID:15629925

  5. Changes in rRNA levels during stress invalidates results from mRNA blotting: Fluorescence in situ rRNA hybridization permits renormalization for estimation of cellular mRNA levels

    Hansen, M.C.; Nielsen, A.K.; Molin, Søren; Hammer, Karin; Kilstrup, Mogens

    2001-01-01

    experiments, in which mRNA levels routinely are normalized to a fixed amount of extracted total RNA. The cellular levels of specific mRNA species were estimated using a renormalization with the total RNA content per cell. By a combination of fluorescence in situ rRNA hybridization, which estimates the...... relative level of rRNA per cell, and slot blotting to rRNA probes, which estimates the level of rRNA per extracted total RNA, the amount of RNA per cell was calculated in a series of heat shock experiments with the gram-positive bacterium Lactococcus lactis. It was found that the level of rRNA per cell......Regulation of gene expression can be analyzed by a number of different techniques. Some techniques monitor the level of specific mRNA directly, and others monitor indirectly by determining the level of enzymes encoded by the mRNA. Each method has its own inherent way of normalization. When results...

  6. Molecular phylogeny of beetle associated diplogastrid nematodes suggests host switching rather than nematode-beetle coevolution

    Sommer Ralf J

    2009-08-01

    Full Text Available Abstract Background Nematodes are putatively the most species-rich animal phylum. They have various life styles and occur in a variety of habitats, ranging from free-living nematodes in aquatic or terrestrial environments to parasites of animals and plants. The rhabditid nematode Caenorhabditis elegans is one of the most important model organisms in modern biology. Pristionchus pacificus of the family of the Diplogastridae has been developed as a satellite model for comparison to C. elegans. The Diplogastridae, a monophyletic clade within the rhabditid nematodes, are frequently associated with beetles. How this beetle-association evolved and whether beetle-nematode coevolution occurred is still elusive. As a prerequisite to answering this question a robust phylogeny of beetle-associated Diplogastridae is needed. Results Sequences for the nuclear small subunit ribosomal RNA and for 12 ribosomal protein encoding nucleotide sequences were collected for 14 diplogastrid taxa yielding a dataset of 5996 bp of concatenated aligned sequences. A molecular phylogeny of beetle-associated diplogastrid nematodes was established by various algorithms. Robust subclades could be demonstrated embedded in a phylogenetic tree topology with short internal branches, indicating rapid ancestral divergences. Comparison of the diplogastrid phylogeny to a comprehensive beetle phylogeny revealed no major congruence and thus no evidence for a long-term coevolution. Conclusion Reconstruction of the phylogenetic history of beetle-associated Diplogastridae yields four distinct subclades, whose deep phylogenetic divergence, as indicated by short internal branch lengths, shows evidence for evolution by successions of ancient rapid radiation events. The stem species of the Diplogastridae existed at the same time period when the major radiations of the beetles occurred. Comparison of nematode and beetle phylogenies provides, however, no evidence for long-term coevolution of

  7. Complete mitochondrial genome of Bugula neritina (Bryozoa, Gymnolaemata, Cheilostomata): phylogenetic position of Bryozoa and phylogeny of lophophorates within the Lophotrochozoa

    Jang Kuem; Hwang Ui

    2009-01-01

    Abstract Background The phylogenetic position of Bryozoa is one of the most controversial issues in metazoan phylogeny. In an attempt to address this issue, the first bryozoan mitochondrial genome from Flustrellidra hispida (Gymnolaemata, Ctenostomata) was recently sequenced and characterized. Unfortunately, it has extensive gene translocation and extremely reduced size. In addition, the phylogenies obtained from the result were conflicting, so they failed to assign a reliable phylogenetic po...

  8. Studies in phylogeny and biosystematics of bees: The bee genus Andrena (Andrenidae) and the tribe Anthophorini (Apidae) (Insecta: Hymenoptera: Apoidea)

    Dubitzky, Andreas

    2006-01-01

    Zusammenfassung In der vorliegenden Arbeit wurde die Phylogenie der kurzzungigen Bienengattung Andrena, sowie die der langzungigen Bienentribus Anthophorini unter besonderer Berücksichtigung der Gattung Habropoda untersucht. Mit ca. 1500 gültig beschriebenen Arten weltweit stellt die holarktische Bienengattung Andrena (Sandbienen) die größte Bienengattung überhaupt dar. Die Phylogenie dieser Gattung ist bislang nur unzureichend erforscht worden. So beschränkten sich frühere Untersuchun...

  9. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-01-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  10. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes.

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-06-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  11. Skoulekia meningialis n. gen., n. sp. (Digenea: Aporocotylidae Odhner, 1912) a parasite surrounding the brain of the Mediterranean common two-banded seabream Diplodus vulgaris (Geoffroy Saint-Hilaire, 1817) (Teleostei: Sparidae): description, molecular phylogeny, habitat and pathology.

    Alama-Bermejo, Gema; Montero, Francisco Esteban; Raga, Juan Antonio; Holzer, Astrid Sibylle

    2011-01-01

    This study describes a new aporocotylid genus and species, Skoulekia meningialis n. gen., n. sp. which was detected in the ectomeningeal veins surrounding the optic lobes of the brain of the common two-banded seabream Diplodus vulgaris (Geoffroy Saint-Hilaire, 1817) from the Gulf of Valencia (Mediterranean Sea). A detailed morphological description of S. meningialis is provided, including drawings, measurements and scanning electron microscopy images as well as a phylogenetic study of S. meningialis and closely related taxa using DNA sequence data obtained from whole ITS2 and partial 18S and 28S rDNA regions. Morphology as well as molecular phylogeny strongly support the erection of a new genus and demonstrate its close relationship with the genera Psettarium (Goto & Ozaki, 1930) and Pearsonellum Overstreet & Køie, 1989. Skoulekia is the second aporocotylid genus described in the Sparidae, a family including economical important fishes. In contrast to the majority of the aporocotylids, which inhabit the heart or the blood vessels of the gills, S. meningialis inhabits the ectomeningeal veins surrounding the optic lobes. Eggs were found trapped within the gill vessels. Normally, blood fluke pathology is almost exclusively related to the eggs. However, in the case of S. meningialis, main histopathological alterations were related to the adult blood flukes which were found to cause mild localised meningitis. PMID:20950706

  12. Phylogeny and resistance profiles of HIV-1 POL sequences from rectal biopsies and blood

    Katzenstein, Terese Lea; Petersen, A B; Storgaard, M;

    2010-01-01

    The phylogeny and resistance profiles of human immunodeficiency virus type 1 (HIV-1) protease (PR) and reverse transcriptase (RT) sequences were compared among six patients with HIV-1 who had received numerous treatments. RNA and DNA fractions were obtained from concurrent blood and rectal biopsy...... acquired during earlier treatment regimens were detected in the sequences obtained from the rectal samples and in the PBMCs in several of the patients. Also, differences in the resistance profiles were observed between anatomical sites and between RNA and DNA fractions. Thus, a single sample probably will...... not be representative of the HIV-1 archived in different sites. Both the resistance profile and phylogeny of HIV-1 often differed in sequences obtained from RNA and DNA from the same site. These findings suggest that additional information regarding the antiviral resistance profile of the patient...

  13. Molecular phylogeny and evidence for an adaptive radiation of geophagine cichlids from South America (Perciformes: Labroidei).

    López-Fernández, Hernán; Honeycutt, Rodney L; Winemiller, Kirk O

    2005-01-01

    Nucleotide sequences from the mitochondrial ND4 gene and the nuclear RAG2 gene were used to derive the most extensive molecular phylogeny to date for the Neotropical cichlid subfamily Geophaginae. Previous hypotheses of relationships were tested in light of these new data and a synthesis of all existing molecular information was provided. Novel phylogenetic findings included support for : (1) a 'Big Clade' containing the genera Geophagus sensu lato, Gymnogeophagus, Mikrogeophagus, Biotodoma, Crenicara, and Dicrossus; (2) a clade including the genera Satanoperca, Apistogramma, Apistogrammoides, and Taeniacara; and (3) corroboration for Kullander's clade Acarichthyini. ND4 demonstrated saturation effects at the third code position and lineage-specific rate heterogeneity, both of which influenced phylogeny reconstruction when only equal weighted parsimony was employed. Both branch lengths and internal branch tests revealed extremely short basal nodes that add support to the idea that geophagine cichlids have experienced an adaptive radiation sensu Schluter that involved ecomorphological specializations and life history diversification. PMID:15579395

  14. Molecular biological analysis of genotyping and phylogeny of severe acute respiratory syndrome associated coronavirus

    王志刚; 李兰娟; 罗芸; 张俊彦; 王敏雅; 程苏云; 张严峻; 王晓萌; 卢亦愚; 吴南屏; 梅玲玲; 王赞信

    2004-01-01

    Background SARS-CoV is the causative agent of severe acute respiratory syndrome (SARS) which has been associated with outbreaks of SARS in Guangdong, Hong Kong and Beijing of China, and other regions worldwide. SARS-CoV from human has shown some variations but its origin is still unknown. The genotyping and phylogeny of SARS-CoV were analyzed and reported in this paper. Methods Full or partial genomes of 44 SARS-CoV strains were collected from GenBank. The genotype, single nucleotide polymorphism and phylogeny of these SARS-CoV strains were analyzed by molecular biological, bioinformatic and epidemiological methods. Conclusion The results mentioned above suggest that SARS-CoV is responding to host immunological pressures and experiencing variation which provide clues, information and evidence of molecular biology for the clinical pathology, vaccine developing and epidemic investigation.

  15. Phylogeny of the owlet-nightjars (Aves: Aegothelidae) based on mitochondrial DNA sequence

    Dumbacher, J.P.; Pratt, T.K.; Fleischer, R.C.

    2003-01-01

    The avian family Aegothelidae (Owlet-nightjars) comprises nine extant species and one extinct species, all of which are currently classified in a single genus, Aegotheles. Owlet-nightjars are secretive nocturnal birds of the South Pacific. They are relatively poorly studied and some species are known from only a few specimens. Furthermore, their confusing morphological variation has made it difficult to cluster existing specimens unambiguously into hierarchical taxonomic units. Here we sample all extant owlet-nightjar species and all but three currently recognized subspecies. We use DNA extracted primarily from museum specimens to obtain mitochondrial gene sequences and construct a molecular phylogeny. Our phylogeny suggests that most species are reciprocally monophyletic, however A. albertisi appears paraphyletic. Our data also suggest splitting A. bennettii into two species and splitting A. insignis and A. tatei as suggested in another recent paper. ?? 2003 Elsevier Science (USA). All rights reserved.

  16. Phylogeny of cooperatively breeding cuckoos (Cuculidae, Crotophaginae) based on mitochondrial gene sequences

    Hughes, Janice M.

    2003-05-01

    The Crotophaginae is a subfamily of New World cuckoos comprising the monotypic genus Guira and three ani species ( Crotophaga). All exhibit a rare form of cooperative breeding known as plural female joint-nesting, whereby two or more females lay eggs in a single nest. I reconstructed the phylogeny of Crotophaginae using the mitochondrial genes cytochrome oxidase I, II, and III, ATPase 6 and 8, and cytochrome b. The subfamily was monophyletic, implying a single origin of cooperative breeding in New World cuckoos. Crotophaga was also monophyletic with Guira as its sister taxon. Within Crotophaga, the smooth-billed ( C. ani) and groove-billed ( C. sulcirostris) anis formed the internal clade with the greater ani ( C. major) basal to this pair. This phylogeny is consistent with differences in reproductive patterns and social organization exhibited by crotophagine cuckoos, and will serve as a framework for future study of the evolution of cooperative breeding in this subfamily.

  17. Thuniopsis: A New Orchid Genus and Phylogeny of the Tribe Arethuseae (Orchidaceae.

    Lin Li

    Full Text Available An investigation of a questionable orchid led to the discovery of a new genus and species Thuniopsis cleistogama, endemic to Yunnan province, China. It is characterized by having a subglobose corm, a spike-like (racemose inflorescence, half opened and spurless flowers, a collar-shaped stigma and subglobose capsules. Based on DNA sequence data from three gene regions (nuclear ribosomal ITS, chloroplast matK and trnL, we investigated its phylogenetic position within the tribe Arethuseae. Phylogenies using maximum likelihood and Bayesian inference support the recognition of Thuniopsis as a distinct genus, and suggest its close relationship to the genera Bletilla, Dilochia, and Thunia. The new genus is circumscribed and a description and illustrations of the new species are provided. The phylogenetic relationships among the genera in Arethuseae are accessed. Moreover, our phylogeny also shed light on the phylogenetic positions of several genera which, to date, remain uncertain.

  18. Tracing phylogeny through proteins of the layers of the eye lens nucleus.

    Smith, A C

    1982-01-01

    1. In accordance with the concept that ontogeny recapitulates phylogeny, it was hypothesized that the proteins in the eye lens nucleus increase in antiquity with depth of layer and so can be used to reconstruct the phylogenetic past. 2. This hypothesis was tested by analyzing electrophoretic patterns of proteins from solubilized nuclear lens layers of three tuna species with well-studied phylogenies. The tuna species are the albacore, Thunnus alalunga; yellowfin, T. albacares; and skipjack, Katsuwonus pelamis. 3. The electrophoretic patterns fitted a scheme that is in agreement with major phylogenetic beliefs about these species. Additionally, the patterns seemed to indicate that (a) the skipjack diverged later (although to a lesser degree) from a common ancestor than did the other two tuna species, and (b) the albacore is more closely related to the skipjack than is the yellowfin. 4. It is concluded that electrophoretic analysis of proteins from nuclear lens layers is a promising new tool for tracing phylogenetic relationships. PMID:7083823

  19. A molecular phylogeny of Hypnales (Bryophyta inferred from ITS2 sequence-structure data

    Wolf Matthias

    2010-11-01

    Full Text Available Abstract Background Hypnales comprise over 50% of all pleurocarpous mosses. They provide a young radiation complicating phylogenetic analyses. To resolve the hypnalean phylogeny, it is necessary to use a phylogenetic marker providing highly variable features to resolve species on the one hand and conserved features enabling a backbone analysis on the other. Therefore we used highly variable internal transcribed spacer 2 (ITS2 sequences and conserved secondary structures, as deposited with the ITS2 Database, simultaneously. Findings We built an accurate and in parts robustly resolved large scale phylogeny for 1,634 currently available hypnalean ITS2 sequence-structure pairs. Conclusions Profile Neighbor-Joining revealed a possible hypnalean backbone, indicating that most of the hypnalean taxa classified as different moss families are polyphyletic assemblages awaiting taxonomic changes.

  20. Multi-State Perfect Phylogeny Mixture Deconvolution and Applications to Cancer Sequencing

    El-Kebir, Mohammed; Satas, Gryte; Oesper, Layla; Raphael, Benjamin J

    2016-01-01

    The reconstruction of phylogenetic trees from mixed populations has become important in the study of cancer evolution, as sequencing is often performed on bulk tumor tissue containing mixed populations of cells. Recent work has shown how to reconstruct a perfect phylogeny tree from samples that contain mixtures of two-state characters, where each character/locus is either mutated or not. However, most cancers contain more complex mutations, such as copy-number aberrations, that exhibit more t...

  1. Phylogeny of the Southeast Asian freshwater fish genus Pangio (Cypriniformes, Cobitidae)

    Bohlen, Jörg; Šlechtová, Vendula; Tan, H. H.; Britz, R.

    2011-01-01

    Roč. 61, č. 3 (2011), s. 854-865. ISSN 1055-7903 R&D Projects: GA ČR GA206/05/2556; GA ČR GA206/08/0637; GA AV ČR IAA600450508; GA MŠk LC06073 Institutional research plan: CEZ:AV0Z50450515 Keywords : pangio * eel loaches * phylogeny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.609, year: 2011

  2. Phylogeny and sequence variability of the Sarcocystis singaporensis Zaman and Colley, (1975) 1976 ssrDNA

    Šlapeta, Jan Roger; Kyselová, Iveta; Richardson, A. O.; Modrý, David; Lukeš, Julius

    2002-01-01

    Roč. 88, č. 9 (2002), s. 810-815. ISSN 0932-0113 R&D Projects: GA ČR GA524/00/P015; GA AV ČR KSK6005114 Institutional research plan: CEZ:AV0Z6022909 Keywords : Sarcocystis * phylogeny * ssrDNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 1.046, year: 2002

  3. “What’s in a Name?” The Taxonomy & Phylogeny of Early Homo

    Galway-Witham, Julia Katrina Reitz

    2016-01-01

    Hominin systematics, encompassing both taxonomy and phylogeny (Strait, 2013), has significant implications for how the evolution of species and traits are understood and communicated. Following a recent influx of fossils (e.g., Brown et al., 2004; Lordkipanidze et al., 2013; Villmoare et al., 2015a; Berger et al., 2015) the amount of diversity in fossil morphology has increased correspondingly. As researchers do not yet approach diversity in a uniform manner, the literature has been flooded w...

  4. Molecular phylogeny of anoplocephalid tapeworms (Cestoda: Anoplocephalidae) infecting humans and non-human primates

    Doležalová, J.; Vallo, P.; Petrželková, Klára Judita; Foitová, I.; Nurcahyo, W.; Mudakikwa, A.; Hashimoto, C.; Jirků, Milan; Lukeš, Julius; Scholz, Tomáš; Modrý, David

    2015-01-01

    Roč. 142, č. 10 (2015), s. 1278-1289. ISSN 0031-1820 R&D Projects: GA MŠk(CZ) EE2.3.30.0032; GA ČR GA206/09/0927 Institutional support: RVO:60077344 Keywords : Bertiella * Anoplocephala * phylogeny * primates * zoonotic potential Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 2.560, year: 2014

  5. A Tale That Morphology Fails to Tell: A Molecular Phylogeny of Aeolidiidae (Aeolidida, Nudibranchia, Gastropoda)

    Carmona, Leila; Pola, Marta; Gosliner, Terrence M.; Cervera, Juan Lucas

    2013-01-01

    Aeolidida is one of the largest clades of nudibranchs with at least 560 known species. However, its systematics has not been studied in a comprehensive manner. Phylogenetic analyses of larger clades such as Nudibranchia or Cladobranchia have usually included a poor sample of aeolids. Furthermore, phylogenetic studies at the family or generic level in Aeolidida are a few and far between. The first molecular phylogeny of the aeolid family Aeolidiidae is presented here. This study, the most comp...

  6. Molecular phylogeny and biogeography of the Neotropical cichlid fish tribe Cichlasomatini (Teleostei: Cichlidae: Cichlasomatinae)

    Musilová, Zuzana; Říčan, Oldřich; Janko, Karel; Novák, J.

    2008-01-01

    Roč. 46, - (2008), s. 659-672. ISSN 1055-7903 R&D Projects: GA MŠk LC06073 Grant ostatní: GA UK(CZ) 182/2004/B-BIO; GA UK(CZ) 139407 Institutional research plan: CEZ:AV0Z50450515 Keywords : molecular phylogeny * Cichlids * south America Subject RIV: EG - Zoology Impact factor: 3.871, year: 2008

  7. The evolutionary history of Mimosa (Leguminosae): toward a phylogeny of the sensitive plants

    Simon, M. F.; Grether, R.; L.P. de Queiroz; Särkinen, T E; Dutra, V F; HUGHES, C E

    2011-01-01

    Premise of the study: Large genera provide remarkable opportunities to investigate patterns of morphological evolution and historical biogeography in plants. A molecular phylogeny of the species-rich and morphologically and ecologically diverse genus Mimosa was generated to evaluate its infrageneric classification, reconstruct the evolution of a set of morphological characters, and establish the relationships of Old World species to the rest of the genus. • Methods: We used trnD-trnT plastid ...

  8. Evidence of host specificity and congruence between phylogenies of bitterling and freshwater mussels

    Liu, H.-Z.; Zhu, Y.-R.; Smith, C.; Reichard, Martin

    2006-01-01

    Roč. 45, č. 3 (2006), s. 428-434. ISSN 1021-5506 Grant ostatní: NSFC(CN) 30470237; NSFC(CN) 40432003; Innovation Program of the Chinese Academy of Sciences(CN) KZCX3-SW-126 Institutional research plan: CEZ:AV0Z60930519 Keywords : bitterling * host specificity * coevolution * phylogeny Subject RIV: EG - Zoology Impact factor: 0.943, year: 2006 http://zoolstud.sinica.edu.tw/Journals/45.3/428.pdf

  9. Phylogeny of all major groups of cetaceans based on DNA sequences from three mitochondrial genes

    Milinkovitch, M C; Meyer., A; Powell, J R

    1994-01-01

    Traditionally, living cetaceans (order Cetacea) are classified into two highly distinct suborders: the echolocating toothed whales, Odontoceti, and the filter-feeding baleen whales, Mysticeti. A molecular phylogeny based on 1,352 base pairs of two mitochondrial ribosomal gene segments and the mitochondrial cytochrome b gene for all major groups of cetaceans contradicts this long-accepted taxonomic subdivision. One group of toothed whales, the sperm whales, is more closely related to the morph...

  10. Seven new dolphin mitochondrial genomes and a time-calibrated phylogeny of whales

    Zhou Kaiya; Xu Shixia; Brandley Matthew C; Xiong Ye; Yang Guang

    2009-01-01

    Abstract Background The phylogeny of Cetacea (whales) is not fully resolved with substantial support. The ambiguous and conflicting results of multiple phylogenetic studies may be the result of the use of too little data, phylogenetic methods that do not adequately capture the complex nature of DNA evolution, or both. In addition, there is also evidence that the generic taxonomy of Delphinidae (dolphins) underestimates its diversity. To remedy these problems, we sequenced the complete mitocho...

  11. Actinobase: Database on molecular diversity, phylogeny and biocatalytic potential of salt tolerant alkaliphilic actinomycetes

    Sharma, Amit K; Gohel, Sangeeta; Singh, Satya P.

    2012-01-01

    Actinobase is a relational database of molecular diversity, phylogeny and biocatalytic potential of haloalkaliphilic actinomycetes. The main objective of this data base is to provide easy access to range of information, data storage, comparison and analysis apart from reduced data redundancy, data entry, storage, retrieval costs and improve data security. Information related to habitat, cell morphology, Gram reaction, biochemical characterization and molecular features would allow researchers...

  12. Maternal Phylogeny of a Newly-Found Yak Population in China

    Deqiang Zou; Lei Zhang; Lu Li; Yi Ai; Hongwen Zhao; Changxiu Fu; Shanrong Li; Yongli Wen; Tserang Donko Mipam

    2012-01-01

    The Jinchuan yak is a new yak population identified in Sichuan, China. This population has a special anatomical characteristic: an additional pair of ribs compared with other yak breeds. The genetic structure of this population is unknown. In the present study, we investigated the maternal phylogeny of this special yak population using the mitochondrial DNA variation. A total of 23 Jinchuan yaks were sequenced for a 823-bp fragment of D-loop control region and three individuals were sequenced...

  13. Phylogeny and evolution of ontogeny of the family Oxytomidae Ichikawa, 1958 (Mollusca: Bivalvia)

    Lutikov, O. A.; Temkin, I. E.; Shurygin, B. N.

    2010-08-01

    We described ontogenies and reconstructed morphogeneses of hinges in some supraspecific taxa of the bivalve family Oxytomidae Ichikawa, 1958 from the Mesozoic of Russia. The phylogeny of the family is reconstructed using evolutionary and cladistic methods. The appearance of the endemic genus Arctotis Bodylevsky, 1960 in the epicontinental seas of Siberia can be explained in terms of gradual transformations of the ligament and byssal apparatus in the Northern Siberian members of Praemeleagrinella Lutikov et Shurygin, 2009 and Praearctotis Lutikov et Shurygin, 2009.

  14. PHY·FI: fast and easy online creation and manipulation of phylogeny color figures

    Fredslund Jakob

    2006-06-01

    Full Text Available Abstract Background The need to depict a phylogeny, or some other kind of abstract tree, is very frequently experienced by researchers from a broad range of biological and computational disciplines. Thousands of papers and talks include phylogeny figures, and often during everyday work, one would like to quickly get a graphical display of, e.g., the phylogenetic relationship between a set of sequences as calculated by an alignment program such as ClustalW or the phylogenetic package Phylip. A wealth of software tools capable of tree drawing exists; most are comprehensive packages that also perform various types of analysis, and hence they are available only for download and installing. Some online tools exist, too. Results This paper presents an online tool, PHY·FI, which encompasses all the qualities of existing online programs and adds functionality to hopefully eliminate the need for post-processing the phylogeny figure in some other general-purpose graphics program. PHY·FI is versatile, easy-to-use and fast, and supports comprehensive graphical control, several download image formats, and the possibility of dynamically collapsing groups of nodes into named subtrees (e.g. "Primates". The user can create a color figure from any phylogeny, or other kind of tree, represented in the widely used parenthesized Newick format. Conclusion PHY·FI is fast and easy to use, yet still offers full color control, tree manipulation, and several image formats. It does not require any downloading and installing, and thus any internet user regardless of computer skills, and computer platform, can benefit from it. PHY·FI is free for all and is available from this web address: http://cgi-www.daimi.au.dk/cgi-chili/phyfi/go

  15. Intraspecific Phylogeny of the Korean Water Deer, Hydropotes inermis argyropus (Artiodactyla, Cervidae)

    Kim, Hye Ri; Kim, Eui Kyung; Jeon, Mi Gyung; Park, Yung Chul

    2015-01-01

    The water deer, Hydropotes inermis (Cervidae), is native to China and Korea and has two subspecies of the Chinese water deer (Hydropotes inermis inermis) and Korean water deer (Hydropotes inermis argyropus). To date, only the Korean water deer has been reported in South Korea. In this study, however, an intraspecific phylogeny and haplotype analysis based on mitochondrial cytochrome oxidase I indicated that both Korean and Chinese water deer are found in South Korea. The populations of the tw...

  16. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    Recht, M I; Douthwaite, S; Dahlquist, K D;

    1999-01-01

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  17. Mapping important nucleotides in the peptidyl transferase centre of 23 S rRNA using a random mutagenesis approach

    Porse, B T; Garrett, R A

    1995-01-01

    Random mutations were generated in the lower half of the peptidyl transferase loop in domain V of 23 S rRNA from Escherichia coli using a polymerase chain reaction (PCR) approach, a rapid procedure for identifying mutants and a plasmid-based expression system. The effects of 21 single......-site mutations, at 18 different positions, on cell growth, mutant rRNA incorporation into ribosomes and peptidyl transferase activity of the mutant ribosomes were analysed. The general importance of the whole region for the peptidyl transferase centre was emphasized by the finding that 14 of the mutants were...... sick, or very sick, when ribosomes containing chromosomal-encoded 23 S rRNA were inhibited by erythromycin, and all except one of these exhibited low levels of peptidyl transferase activity in their mutated ribosomes. Two mutations, psi 2580-->C and U2584-->G that both yielded inactive ribosomes were...

  18. 16S rRNA gene sequencing as a tool to study microbial populations in foods and process environments

    Buschhardt, Tasja; Hansen, Tina Beck; Bahl, Martin Iain; Asser Hansen, Martin; Abu Al-Soud, Waleed; Aabo, Søren

    and their role in food safety. During method optimization, we have identified several factors which distort the characterization of microbial populations, including DNA extraction methods, DNA polymerases, and most importantly the analyzed fragment of the 16S rRNA gene. Methods: This study...... culture methods as cross reference. Results: Taxonomic assignments and abundances of sequences in the total community and in the Enterobacteriaceae subpopulation were affected by the 16S rRNA gene variable region, DNA extraction methods, and polymerases chosen. However, community compositions were very......Introduction: Methodological constraints during culturing and biochemical testing have left the true microbiological diversity of foods and process environments unexplored. Culture-independent molecular methods, such as 16S rRNA gene sequencing, may provide deeper insight into microbial communities...

  19. 16S rRNA amplicon sequencing dataset for conventionalized and conventionally raised zebrafish larvae.

    Davis, Daniel J; Bryda, Elizabeth C; Gillespie, Catherine H; Ericsson, Aaron C

    2016-09-01

    Data presented here contains metagenomic analysis regarding the sequential conventionalization of germ-free zebrafish embryos. Zebrafish embryos that underwent a germ-free sterilization process immediately after fertilization were promptly exposed to and raised to larval stage in conventional fish water. At 6 days postfertilization (dpf), these "conventionalized" larvae were compared to zebrafish larvae that were raised in conventional fish water never undergoing the initial sterilization process. Bacterial 16S rRNA amplicon sequencing was performed on DNA isolated from homogenates of the larvae revealing distinct microbiota variations between the two groups. The dataset described here is also related to the research article entitled "Microbial modulation of behavior and stress responses in zebrafish larvae" (Davis et al., 2016) [1]. PMID:27508247

  20. Multi-site-specific 16S rRNA methyltransferase RsmF from Thermus thermophilus

    Demirci, Hasan; Larsen, Line H G; Hansen, Trine;

    2010-01-01

    Cells devote a significant effort toward the production of multiple modified nucleotides in rRNAs, which fine tune the ribosome function. Here, we report that two methyltransferases, RsmB and RsmF, are responsible for all four 5-methylcytidine (m(5)C) modifications in 16S rRNA of Thermus...... thermophilus. Like Escherichia coli RsmB, T. thermophilus RsmB produces m(5)C967. In contrast to E. coli RsmF, which introduces a single m(5)C1407 modification, T. thermophilus RsmF modifies three positions, generating m(5)C1400 and m(5)C1404 in addition to m(5)C1407. These three residues are clustered near...

  1. A robust phylogeny among major lineages of the East African cichlids.

    Takahashi, Tetsumi; Sota, Teiji

    2016-07-01

    The huge monophyletic group of the East African cichlid radiations (EAR) consists of thousands of species belonging to 12-14 tribes; the number of tribes differs among studies. Many studies have inferred phylogenies of EAR tribes using various genetic markers. However, these phylogenies partly contradict one another and can have weak statistic support. In this study, we conducted maximum-likelihood (ML) phylogenetic analyses using restriction site-associated DNA (RAD) sequences and propose a new robust phylogenetic hypothesis among Lake Tanganyika cichlid fishes, which cover most EAR tribes. Data matrices can vary in size and contents depending on the strategies used to process RAD sequences. Therefore, we prepared 23 data matrices with various processing strategies. The ML phylogenies inferred from 15 large matrices (2.0×10(6) to 1.1×10(7) base pairs) resolved every tribe as a monophyletic group with 100% bootstrap support and shared the same topology regarding relationships among the tribes. Most nodes among the tribes were supported by 100% bootstrap values, and the bootstrap support for the other node varied among the 15 ML trees from 70% to 100%. These robust ML trees differ partly in topology from those in earlier studies, and these phylogenetic relationships have important implications for the tribal classification of EAR. PMID:27068840

  2. Multi-locus fossil-calibrated phylogeny of Atheriniformes (Teleostei, Ovalentaria).

    Campanella, Daniela; Hughes, Lily C; Unmack, Peter J; Bloom, Devin D; Piller, Kyle R; Ortí, Guillermo

    2015-05-01

    Phylogenetic relationships among families within the order Atheriniformes have been difficult to resolve on the basis of morphological evidence. Molecular studies so far have been fragmentary and based on a small number taxa and loci. In this study, we provide a new phylogenetic hypothesis based on sequence data collected for eight molecular markers for a representative sample of 103 atheriniform species, covering 2/3 of the genera in this order. The phylogeny is calibrated with six carefully chosen fossil taxa to provide an explicit timeframe for the diversification of this group. Our results support the subdivision of Atheriniformes into two suborders (Atherinopsoidei and Atherinoidei), the nesting of Notocheirinae within Atherinopsidae, and the monophyly of tribe Menidiini, among others. We propose taxonomic changes for Atherinopsoidei, but a few weakly supported nodes in our phylogeny suggests that further study is necessary to support a revised taxonomy of Atherinoidei. The time-calibrated phylogeny was used to infer ancestral habitat reconstructions to explain the current distribution of marine and freshwater taxa. Based on these results, the current distribution of Atheriniformes is likely due to widespread marine dispersal along the margins of continents, infrequent trans-oceanic dispersal, and repeated invasion of freshwater habitats. This conclusion is supported by post-Gondwanan divergence times among families within the order, and a high probability of a marine ancestral habitat. PMID:25769409

  3. Does a tree-like phylogeny only exist at the tips in the prokaryotes?

    Creevey, Christopher J; Fitzpatrick, David A; Philip, Gayle K; Kinsella, Rhoda J; O'Connell, Mary J; Pentony, Melissa M; Travers, Simon A; Wilkinson, Mark; McInerney, James O

    2004-12-22

    The extent to which prokaryotic evolution has been influenced by horizontal gene transfer (HGT) and therefore might be more of a network than a tree is unclear. Here we use supertree methods to ask whether a definitive prokaryotic phylogenetic tree exists and whether it can be confidently inferred using orthologous genes. We analysed an 11-taxon dataset spanning the deepest divisions of prokaryotic relationships, a 10-taxon dataset spanning the relatively recent gamma-proteobacteria and a 61-taxon dataset spanning both, using species for which complete genomes are available. Congruence among gene trees spanning deep relationships is not better than random. By contrast, a strong, almost perfect phylogenetic signal exists in gamma-proteobacterial genes. Deep-level prokaryotic relationships are difficult to infer because of signal erosion, systematic bias, hidden paralogy and/or HGT. Our results do not preclude levels of HGT that would be inconsistent with the notion of a prokaryotic phylogeny. This approach will help decide the extent to which we can say that there is a prokaryotic phylogeny and where in the phylogeny a cohesive genomic signal exists. PMID:15615680

  4. Reconciling molecular phylogeny, morphological divergence and classification of Madagascan narrow-mouthed frogs (Amphibia: Microhylidae).

    Scherz, Mark D; Vences, Miguel; Rakotoarison, Andolalao; Andreone, Franco; Köhler, Jörn; Glaw, Frank; Crottini, Angelica

    2016-07-01

    A recent study clarified several aspects of microhylid phylogeny by combining DNA sequences from Sanger sequencing and anchored phylogenomics, although numerous aspects of tree topology proved highly susceptible to data partition and chosen model. Although the phylogenetic results of the study were in conflict with previous publications, the authors made several changes to the taxonomy of Madagascar's cophyline microhylids. We re-analyzed part of their data together with our own molecular and morphological data. Based on a supermatrix of 11 loci, we propose a new phylogeny of the Cophylinae, and discuss it in the context of a newly generated osteological dataset. We found several sample misidentifications, partially explaining their deviant results, and propose to resurrect the genera Platypelis and Stumpffia from the synonymy of Cophyla and Rhombophryne, respectively. We provide support for the previous genus-level taxonomy of this subfamily, and erect a new genus, Anilany gen. nov., in order to eliminate paraphyly of Stumpffia and to account for the osteological differences observed among these groups. Deep nodes in our phylogeny remain poorly supported, and future works will certainly refine our classification, but we are confident that these will not produce large-scale rearrangements. PMID:27085671

  5. Phylogeny of economically important insect pests that infesting several crops species in Malaysia

    Ghazali, Siti Zafirah; Zain, Badrul Munir Md.; Yaakop, Salmah

    2014-09-01

    This paper reported molecular data on insect pests of commercial crops in Peninsular Malaysia. Fifteen insect pests (Metisa plana, Calliteara horsefeldii, Cotesia vestalis, Bactrocera papayae, Bactrocera carambolae, Bactrocera latifrons, Conopomorpha cramella, Sesamia inferens, Chilo polychrysa, Rhynchophorus vulneratus, and Rhynchophorus ferrugineus) of nine crops were sampled (oil palm, coconut, paddy, cocoa, starfruit, angled loofah, guava, chili and mustard) and also four species that belong to the fern's pest (Herpetogramma platycapna) and storage and rice pests (Tribolium castaneum, Oryzaephilus surinamensis and Cadra cautella). The presented phylogeny summarized the initial phylogenetic hypothesis, which concerning by implementation of the economically important insect pests. In this paper, phylogenetic relationships among 39 individuals of 15 species that belonging to three orders under 12 genera were inferred from DNA sequences of mitochondrial marker, cytochrome oxidase subunit I (COI) and nuclear marker, ribosomal DNA 28S D2 region. The phylogenies resulted from the phylogenetic analyses of both genes are relatively similar, but differ in the sequence of evolution. Interestingly, this most recent molecular data of COI sequences data by using Bayesian Inference analysis resulted a more-resolved phylogeny that corroborated with traditional hypotheses of holometabolan relationships based on traditional hypotheses of holometabolan relationships and most of recently molecular study compared to 28S sequences. This finding provides the information on relationships of pests species, which infested several crops in Malaysia and also estimation on Holometabola's order relationships. The identification of the larval stages of insect pests could be done accurately, without waiting the emergence of adults and supported by the phylogenetic tree.

  6. Molecular phylogeny of Toxoplasmatinae: comparison between inferences based on mitochondrial and apicoplast genetic sequences

    Michelle Klein Sercundes

    2016-03-01

    Full Text Available Abstract Phylogenies within Toxoplasmatinae have been widely investigated with different molecular markers. Here, we studied molecular phylogenies of the Toxoplasmatinae subfamily based on apicoplast and mitochondrial genes. Partial sequences of apicoplast genes coding for caseinolytic protease (clpC and beta subunit of RNA polymerase (rpoB, and mitochondrial gene coding for cytochrome B (cytB were analyzed. Laboratory-adapted strains of the closely related parasites Sarcocystis falcatula and Sarcocystis neurona were investigated, along with Neospora caninum, Neospora hughesi, Toxoplasma gondii (strains RH, CTG and PTG, Besnoitia akodoni, Hammondia hammondiand two genetically divergent lineages of Hammondia heydorni. The molecular analysis based on organellar genes did not clearly differentiate between N. caninum and N. hughesi, but the two lineages of H. heydorni were confirmed. Slight differences between the strains of S. falcatula and S. neurona were encountered in all markers. In conclusion, congruent phylogenies were inferred from the three different genes and they might be used for screening undescribed sarcocystid parasites in order to ascertain their phylogenetic relationships with organisms of the family Sarcocystidae. The evolutionary studies based on organelar genes confirm that the genusHammondia is paraphyletic. The primers used for amplification of clpC and rpoB were able to amplify genetic sequences of organisms of the genus Sarcocystisand organisms of the subfamily Toxoplasmatinae as well.

  7. Molecular phylogeny of Toxoplasmatinae: comparison between inferences based on mitochondrial and apicoplast genetic sequences.

    Sercundes, Michelle Klein; Valadas, Samantha Yuri Oshiro Branco; Keid, Lara Borges; Oliveira, Tricia Maria Ferreira Souza; Ferreira, Helena Lage; Vitor, Ricardo Wagner de Almeida; Gregori, Fábio; Soares, Rodrigo Martins

    2016-01-01

    Phylogenies within Toxoplasmatinae have been widely investigated with different molecular markers. Here, we studied molecular phylogenies of the Toxoplasmatinae subfamily based on apicoplast and mitochondrial genes. Partial sequences of apicoplast genes coding for caseinolytic protease (clpC) and beta subunit of RNA polymerase (rpoB), and mitochondrial gene coding for cytochrome B (cytB) were analyzed. Laboratory-adapted strains of the closely related parasites Sarcocystis falcatula and Sarcocystis neurona were investigated, along with Neospora caninum, Neospora hughesi, Toxoplasma gondii (strains RH, CTG and PTG), Besnoitia akodoni, Hammondia hammondiand two genetically divergent lineages of Hammondia heydorni. The molecular analysis based on organellar genes did not clearly differentiate between N. caninum and N. hughesi, but the two lineages of H. heydorni were confirmed. Slight differences between the strains of S. falcatula and S. neurona were encountered in all markers. In conclusion, congruent phylogenies were inferred from the three different genes and they might be used for screening undescribed sarcocystid parasites in order to ascertain their phylogenetic relationships with organisms of the family Sarcocystidae. The evolutionary studies based on organelar genes confirm that the genus Hammondia is paraphyletic. The primers used for amplification of clpC and rpoB were able to amplify genetic sequences of organisms of the genus Sarcocystisand organisms of the subfamily Toxoplasmatinae as well. PMID:27007245

  8. Molecular phylogeny and evolution of Scomber (Teleostei: Scombridae) based on mitochondrial and nuclear DNA sequences

    CHENG Jiao; GAO Tianxiang; MIAO Zhenqing; YANAGIMOTO Takashi

    2011-01-01

    A molecular phylogenetic analysis of the genus Scomber was conducted based on mitochondrial (COI, Cyt b and control region) and nuclear (5S rDNA) DNA sequence data in multigene perspective. A variety of phylogenetic analytic methods were used to clarify the current taxonomic classification and to assess phylogenetic relationships and the evolutionary history of this genus. The present study produced a well-resolved phylogeny that strongly supported the monophyly of Scomber. We confirmed that S. japonicus and S. colias were genetically distinct. Although morphologically and ecologically similar to S. colias, the molecular data showed that S. japonicus has a greater molecular affinity with S. australasicus, which conflicts with the traditional taxonomy. This phyiogenetic pattern was corroborated by the mtDNA data, but incompletely by the nuclear DNA data. Phylogenetic concordance between the mitochondrial and nuclear DNA regions for the basal nodes supports an Atlantic origin for Scomber. The present-day geographic ranges of the species were compared with the resultant molecular phylogeny derived from partition Bayesian analyses of the combined data sets to evaluate possible dispersal routes of the genus. The present-day geographic distribution of Scomber species might be best ascribed to multiple dispersal events. In addition, our results suggest that phylogenies derived from multiple genes and long sequences exhibited improved phylogenetic resolution, from which we conclude that the phylogenetic reconstruction is a reliable representation of the evolutionary history of Scomber.

  9. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    Junko Obata

    Full Text Available While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating.

  10. Phylogenetic relationships of Arthrospira strains inferred from 16S rRNA gene and cpcBA-IGS sequences

    Chi-Yong Ahn

    2012-06-01

    Full Text Available Arthrospira platensis and Arthrospira maxima are species of cyanobacteria used in health foods, animal feed, food additives, and fine chemicals. This study conducted a comparison of the 16S rRNA gene and cpcBA-intergenic spacer (cpcBA-IGS sequences in Arthrospira strains from culture collections around the world. A cluster analysis divided the 10 Arthrospira strains into two main genotypic clusters, designated I and II, where Group I contained A. platensis SAG 86.79, UTEX 2340, A. maxima KCTC AG30054, and SAG 49.88, while Group II contained A. platensis PCC 9108, NIES 39, NIES 46, and SAG 257.80. However, although A. platensis PCC 9223 belonged to Group II-2 based on its cpcBA-IGS sequence, this strain also belonged to Group I based on its 16S rRNA gene sequence. Phylogenetic analyses based on the 16S rRNA gene and cpcBA-IGS sequences showed no division between A. platensis and A. maxima, plus the 16S rRNA gene and cpcBAIGS sequence clusters did not indicate any well-defined geographical distribution, instead overlapping in a rather interesting way. Therefore, the current study supports some previous conclusions based on 16S rRNA gene and cpcBA-IGS sequences, which found that Arthrospira taxa are monophyletic. However, when compared with 16S rRNA sequences, cpcBA-IGS sequences may be better suited to resolve close relationships and intraspecies variability.

  11. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Nathan D. Olson

    2015-03-01

    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  12. Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus

    Verma Mansi; Lal Devi; Lal Rup

    2011-01-01

    Abstract Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplemen...

  13. Single Nucleotide Polymorphism of SSU rRNA Gene among ‎Plasmodium Knowlesi Isolates of Sabah

    Fread Anderios; Daw Khin Saw Naing; Zaw Lin

    2012-01-01

    ackground: ‎The advent of PCR (Polymerase Chain Reaction) assays helped in correctly identifying ‎Plasmodium knowlesi, which was previously misdiagnosed by microscopy as Plasmodium ‎malarie in Sabah, Malaysia. The PCR-based diagnosis of P. knowlesi in Sabah is currently using a ‎set of oligonucleotide primers namely Pmk8 and Pmk9 that target one of the parasite’s small ‎subunit rRNA (SSU rRNA) genes. PCR also helped in discovering a variant form of P. malariae ‎which has a deletion of 19 bp ...

  14. Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

    Dron, M; Rahire, M; Rochaix, J D

    1982-01-01

    The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stre...

  15. The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis

    Cole, J. R.; Chai, B.; Farris, R. J.; Wang, Q; Kulam, S. A.; McGarrell, D. M.; Garrity, G M; Tiedje, J M

    2004-01-01

    The Ribosomal Database Project (RDP-II) provides the research community with aligned and annotated rRNA gene sequences, along with analysis services and a phylogenetically consistent taxonomic framework for these data. Updated monthly, these services are made available through the RDP-II website (http://rdp.cme.msu.edu/). RDP-II release 9.21 (August 2004) contains 101 632 bacterial small subunit rRNA gene sequences in aligned and annotated format. High-throughput tools for initial taxonomic p...

  16. Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up- and downshift

    Jydegaard-Axelsen, A.M.; Aaes-Jorgensen, A.; Koch, A.G.; Stoumann Jensen, J.; Knochel, S.

    2005-01-01

    Cell morphology, rRNA content, and growth were examined for Listeria monocytogenes LO28 and EGD, respectively, grown in brain-heart infusion (BHI) and on slices of sausage at 10degreesC in 100% CO2, 100% N-2, and air. In CO2, filamentous cells were formed by both strains on sausage slices and by L...... unchanged. On sausage slices, the number of colony forming units also increased rapidly for both strains in response to CO2 downshift. Large variations in rRNA content of individual cells were observed in the tested scenarios. The results demonstrate the risk of underestimating the number of infectious...

  17. Assessing the Fecal Microbiota: An Optimized Ion Torrent 16S rRNA Gene-Based Analysis Protocol

    Foroni, Elena; Duranti, Sabrina; Turroni, Francesca; Lugli, Gabriele Andrea; Sanchez, Borja; Martín, Rebeca; Gueimonde, Miguel; van Sinderen, Douwe; Margolles, Abelardo; Ventura, Marco

    2013-01-01

    Assessing the distribution of 16S rRNA gene sequences within a biological sample represents the current state-of-the-art for determination of human gut microbiota composition. Advances in dissecting the microbial biodiversity of this ecosystem have very much been dependent on the development of novel high-throughput DNA sequencing technologies, like the Ion Torrent. However, the precise representation of this bacterial community may be affected by the protocols used for DNA extraction as well as by the PCR primers employed in the amplification reaction. Here, we describe an optimized protocol for 16S rRNA gene-based profiling of the fecal microbiota. PMID:23869230

  18. Molecular genetic monitoring of bacterial communities in manzala lake, egypt, based on 16S rRNA gene analysis

    El Saied, H.E.

    2007-01-01

    A first molecular genetic study on the diversity of bacterial communities at Manzala Lake, Egypt, was determined by culture-independent 16S rRNA gene analysis. Bulk DNAs were extracted from water and sediment at two different sampling sites namely; Bashtir and Genka, in the lake. The 16S rRNA gene was positively amplified by polymerase chain reaction (PCR) from bulk DNA of each sample, cloned and sequenced. The sequence analysis of one hundred clones from each clone library obtained number of...

  19. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

    Manal Helal

    Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

  20. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.

    2011-01-01

    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stab...