WorldWideScience

Sample records for 18s ribosomal rna

  1. Phylogenetic relationships within the Mysidae (Crustacea, Peracarida, Mysida) based on nuclear 18S ribosomal RNA sequences

    Remerie, T.; Bulckaen, B.; Calderon, J; Deprez, T.; Mees, J.; J. Vanfleteren; Vanreusel, A.; Vierstraete, A; Vincx, M.; Wittmann, K.J.; Wooldridge, T.

    2005-01-01

    Species of the order Mysida (Crustacea, Peracarida) are shrimp-like animals that occur in vast numbers in coastal regions of the world. The order Mysida comprises 1053 species and 165 genera. The present study covers 25 species of the well-defined Mysidae, the most speciose family within the order Mysida. 18S rRNA sequence analysis confirms that the subfamily Siriellinae is monophyletic. On the other hand the subfamily Gastrosaccinae is paraphyletic and the subfamily Mysinae, represented in t...

  2. Translation by ribosome shunting on adenovirus and hsp70 mRNAs facilitated by complementarity to 18S rRNA

    Yueh, Andrew; Schneider, Robert J.

    2000-01-01

    Translation initiation on eukaryotic mRNAs involves 40S ribosome association with mRNA caps (m7GpppN), mediated by initiation factor eIF4F. 40S eukaryotic ribosomes and initiation factors undergo 5′ scanning to the initiation codon, with no known role for complementarity between eukaryotic 18S rRNA and the 5′ noncoding region of mRNAs. We demonstrate that the 5′ noncoding region of human adenovirus late mRNAs, known as the tripartite leader, utilizes a striking complementarity to 18S rRNA to ...

  3. The complete nucleotide sequence of the rat 18S ribosomal RNA gene and comparison with the respective yeast and frog genes.

    Torczynski, R; Bollon, A P; Fuke, M

    1983-01-01

    The complete nucleotide sequence of the rat 18S ribosomal RNA gene has been determined. A comparison of the rat 18S ribosomal RNA gene sequence with the known sequences of yeast and frog revealed three conserved (stable) regions, two unstable regions, and three large inserts. (A,T) leads to (G,C) changes were more frequent than (G,C) leads to (A,T) changes for three comparisons (yeast leads to frog, frog leads to rat, and yeast leads to rat). GC pairs were inserted preferentially over AT pair...

  4. A local role for the small ribosomal subunit primary binder rpS5 in final 18S rRNA processing in yeast.

    Andreas Neueder

    Full Text Available In vivo depletion of the yeast small ribosomal subunit (SSU protein S5 (rpS5 leads to nuclear degradation of nascent SSUs and to a perturbed global assembly state of the SSU head domain. Here, we report that rpS5 plays an additional local role at the head/platform interface in efficient SSU maturation. We find that yeast small ribosomal subunits which incorporated an rpS5 variant lacking the seven C-terminal amino acids have a largely assembled head domain and are exported to the cytoplasm. On the other hand, 3' processing of 18S rRNA precursors is inhibited in these ribosomal particles, although they associate with the putative endonuclease Nob1p and other late acting 40S biogenesis factors. We suggest that the SSU head component rpS5 and platform components as rpS14 are crucial constituents of a highly defined spatial arrangement in the head-platform interface of nascent SSUs, which is required for efficient processing of the therein predicted SSU rRNA 3' end. Positioning of rpS5 in nascent SSUs, including its relative orientation towards platform components in the head-platform cleft, will depend on the general assembly and folding state of the head domain. Therefore, the suggested model can explain 18S precursor rRNA 3' processing phenotypes observed in many eukaryotic SSU head assembly mutants.

  5. Wide genetic variations at 18S ribosomal RNA locus of Cyclospora cayetanensis isolated from Egyptian patients using high resolution melting curve.

    Hussein, Eman M; El-Moamly, Amal A; Mahmoud, Moushira A; Ateek, Nayera S

    2016-07-01

    A variable clinical picture of cyclosporiasis including gastrointestinal tract (GIT) symptomatic or asymptomatic beside extraintestinal consequences suggests a possibility of heterogenicity of Cyclospora cayetanensis. The present work aimed to explore the possibility of genetic variation of C. cayetanensis using high-resolution melting (HRM) curve of polymerase chain reaction (PCR) amplified 18S rRNA genes. DNAs extracted from the stool samples of 70 cyclosporiasis patients were amplified and scanned by PCR/HRM curve. The results showed that there are four different genotypic profiles of C. cayetanensis with presence of mixed ones. Although Tm of all profiles was within the same range, they were discerned by plotting of the temperature-shifted florescence difference between normalized melting curves (dF/dT). Genotypic profile I was found alone in 40 % of patients and mixed with genotypic profile II and/or III in 25.7 % of patients, followed by genotypic profile II in 14.3 % then genotypic profile III and IV (10 % each). A significant relation was found between genotypic profiles and GIT symptomatic status as profile I and profile II were mostly detected in patients with acute GIT symptoms without or with chronic illness, respectively, while profile IV cases only were GIT asymptomatic. Statistical significance relations between genotypic profiles and age, gender, residence and oocyst shape index were determined. In conclusion, PCR/HRM proved a wide variation on C. cayetanensis genes that could be reflected on its pathogenic effects and explaining the variability of the clinical manifestations presented by cyclosporiasis patients. PMID:27041342

  6. Systematics of Chaetognatha under the light of molecular data, using duplicated ribosomal 18S DNA sequences.

    Papillon, Daniel; Perez, Yvan; Caubit, Xavier; Le Parco, Yannick

    2006-03-01

    While the phylogenetic position of Chaetognatha has became central to the question of early bilaterian evolution, the internal systematics of the phylum are still not clear. The phylogenetic relationships of the chaetognaths were investigated using newly obtained small subunit ribosomal RNA nuclear 18S (SSU rRNA) sequences from 16 species together with 3 sequences available in GenBank. As previously shown with the large subunit ribosomal RNA 28S gene, two classes of Chaetognatha SSU rRNA gene can be identified, suggesting a duplication of the whole ribosomal cluster; allowing the rooting of one class of genes by another in phylogenetic analyses. Maximum Parsimony, Maximum Likelihood and Bayesian analyses of the molecular data, and statistical tests showed (1) that there are three main monophyletic groups: Sagittidae/Krohnittidae, Spadellidae/Pterosagittidae, and Eukrohniidae/Heterokrohniidae, (2) that the group of Aphragmophora without Pterosagittidae (Sagittidae/Krohnittidae) is monophyletic, (3) the Spadellidae/Pterosagittidae and Eukrohniidae/Heterokrohniidae families are very likely clustered, (4) the Krohnittidae and Pterosagittidae groups should no longer be considered as families as they are included in other groups designated as families, (5) suborder Ctenodontina is not monophyletic and the Flabellodontina should no longer be considered as a suborder, and (6) the Syngonata/Chorismogonata and the Monophragmophora/Biphragmophora hypotheses are rejected. Such conclusions are considered in the light of morphological characters, several of which are shown to be prone to homoplasy. PMID:16434216

  7. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  8. 16S/18S ribosomal DNA clone library analysis of rumen microbial diversity

    The rumen contains a complex ecosystem where billions of bacteria, archaea, protozoa and fungi reside. This diverse microbiota is well adapted to live in the rumen and play an important role in the digestion of feed and nutrient supply to the host in the form of microbial protein and volatile fatty acids. It is estimated that the rumen microbial population consists of about 106 protozoa/ml, 103-107 fungi/ml, 1010 bacteria/ml, and 109 methanogens/ml. To better understand the complex relationships in the rumen, it is necessary to gain an insight into the diversity of the rumen microbes and how the quantity and composition of rumen micro-organisms are altered by a number of different host factors such as age, genetics and diet. In the past, the diversity of micro-organisms from the digestive tracts of domesticated ruminants has been identified by classical microbiological techniques. However, given the fastidious growth requirements of rumen micro-organisms, it is reasonable to concede that the culture-dependent methods may select against some species, or taxonomic groups, leading researchers to underestimate the microbial diversity that is actually present in the rumen. In fact, it has been speculated that 90% of micro-organisms in nature have escaped traditional cultivation methods. Therefore, a major challenge in microbial ecology has been to assess the diversity and structure of natural microbial communities. The field of molecular biology has advanced with many innovative technological breakthroughs. The ability to extract and to isolate high-molecular weight DNA from rumen digesta, PCR amplify genes from specific microbial groups and obtain gene sequence data is now a routine event. The small subunit ribosomal RNA (SSU-rRNA) gene, called 16S in prokaryotes and 18S in eukaryotes, is the most widely used molecular marker to presumptively identify morphologically indistinguishable species, to infer their phylogenetic relationships, and to elucidate microbial

  9. Molecular epidemiology of Plasmodium species prevalent in Yemen based on 18 s rRNA

    A Azazy Ahmed

    2010-11-01

    Full Text Available Abstract Background Malaria is an endemic disease in Yemen and is responsible for 4.9 deaths per 100,000 population per year and 43,000 disability adjusted life years lost. Although malaria in Yemen is caused mainly by Plasmodium falciparum and Plasmodium vivax, there are no sequence data available on the two species. This study was conducted to investigate the distribution of the Plasmodium species based on the molecular detection and to study the molecular phylogeny of these parasites. Methods Blood samples from 511 febrile patients were collected and a partial region of the 18 s ribosomal RNA (18 s rRNA gene was amplified using nested PCR. From the 86 positive blood samples, 13 Plasmodium falciparum and 4 Plasmodium vivax were selected and underwent cloning and, subsequently, sequencing and the sequences were subjected to phylogenetic analysis using the neighbor-joining and maximum parsimony methods. Results Malaria was detected by PCR in 86 samples (16.8%. The majority of the single infections were caused by P. falciparum (80.3%, followed by P. vivax (5.8%. Mixed infection rates of P. falciparum + P. vivax and P. falciparum + P. malariae were 11.6% and 2.3%, respectively. All P. falciparum isolates were grouped with the strain 3D7, while P. vivax isolates were grouped with the strain Salvador1. Phylogenetic trees based on 18 s rRNA placed the P. falciparum isolates into three sub-clusters and P. vivax into one cluster. Sequence alignment analysis showed 5-14.8% SNP in the partial sequences of the 18 s rRNA of P. falciparum. Conclusions Although P. falciparum is predominant, P. vivax, P. malariae and mixed infections are more prevalent than has been revealed by microscopy. This overlooked distribution should be considered by malaria control strategy makers. The genetic polymorphisms warrant further investigation.

  10. Gene cloning of the 18S rRNA of an ancient viable moss from the permafrost of northeastern Siberia

    Marsic, Damien; Hoover, Richard B.; Gilichinsky, David A.; Ng, Joseph D.

    1999-12-01

    A moss plant dating as much as 40,000 years old was collected from the permafrost of the Kolyma Lowlands of Northeastern Siberia. The plant tissue was revived and cultured for the extraction of its genomic DNA. Using the polymerase chain reaction technique, the 18S ribosomal RNA gene was cloned and its sequence studied. Comparative sequence analysis of the cloned ribosomal DNA to other known 18S RNA showed very high sequence identity and was revealed to be closest to the moss specie, Aulacomnium turgidum. The results of this study also show the ability of biological organisms to rest dormant in deep frozen environments where they can be revived and cultured under favorable conditions. This is significant in the notion that celestial icy bodies can be media to preserve biological function and genetic material during long term storage or transport.

  11. Inhibition of deoxyribonucleic acid transcription by ultraviolet irradiation in mammalian cells: determination of the transcriptional linkage of the 18S and 28S ribosomal ribonucleic acid genes

    The inhibition of deoxyribonucleic acid (DNA) transcription in mammalian cells by ultraviolet irradiation has been studied. The reduction in the rates and the amounts of total ribonucleic acid (RNA) synthesis and of 18S, 28S, and 45S ribosomal RNA (rRNA) synthesis, in tissue cultured mouse L cells, were examined as functions of ultraviolet dose and time after ultraviolet irradiation. Total RNA synthesis in the ultraviolet irradiated L cell was found to decrease as a function of ultraviolet dose. The rates of synthesis for the 18S and 28S rRNAs and the 45S precursor RNA decreased exponentially with ultraviolet dose; the respective D37 values were 310 erg/mm2, 130 erg/mm2, and 90 erg/mm2. Ultraviolet inactivation kinetics of rRNA synthesis in HeLa cells indicated that, as in L cells, each 45S rRNA transcriptional unit has its own promotor, and that the 18S rRNA cistron is promotor proximal and the 28S rRNA cistron is promotor distal. All of the above findings support the hypothesis that irradiation of mammalian cells with ultraviolet light causes the formation of lesions on the DNA templates which result in premature termination of transcription. (U.S.)

  12. Viral IRES RNA structures and ribosome interactions

    Kieft, Jeffrey S.

    2008-01-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide ‘cap’ on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IR...

  13. Viral IRES RNA structures and ribosome interactions.

    Kieft, Jeffrey S

    2008-06-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide 'cap' on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES-ribosome complexes are revealing the structural basis of viral IRES' 'hijacking' of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  14. Nucleolar dominance and ribosomal RNA gene silencing

    Tucker, Sarah; Vitins, Alexa; Pikaard, Craig S.

    2010-01-01

    Nucleolar dominance is an epigenetic phenomenon that occurs in genetic hybrids and describes the expression of 45S rRNA genes inherited from one progenitor due to the silencing of the other progenitor’s rRNA genes. Nucleolar dominance is a manifestation of rRNA gene dosage control, which also occurs in non-hybrids, regulating the number of active rRNA genes according to the cellular demand for ribosomes and protein synthesis. Ribosomal RNA gene silencing involves changes in DNA methylation an...

  15. An updated 18S rRNA phylogeny of tunicates based on mixture and secondary structure models

    Shenkar Noa

    2009-08-01

    Full Text Available Abstract Background Tunicates have been recently revealed to be the closest living relatives of vertebrates. Yet, with more than 2500 described species, details of their evolutionary history are still obscure. From a molecular point of view, tunicate phylogenetic relationships have been mostly studied based on analyses of 18S rRNA sequences, which indicate several major clades at odds with the traditional class-level arrangements. Nonetheless, substantial uncertainty remains about the phylogenetic relationships and taxonomic status of key groups such as the Aplousobranchia, Appendicularia, and Thaliacea. Results Thirty new complete 18S rRNA sequences were acquired from previously unsampled tunicate species, with special focus on groups presenting high evolutionary rate. The updated 18S rRNA dataset has been aligned with respect to the constraint on homology imposed by the rRNA secondary structure. A probabilistic framework of phylogenetic reconstruction was adopted to accommodate the particular evolutionary dynamics of this ribosomal marker. Detailed Bayesian analyses were conducted under the non-parametric CAT mixture model accounting for site-specific heterogeneity of the evolutionary process, and under RNA-specific doublet models accommodating the occurrence of compensatory substitutions in stem regions. Our results support the division of tunicates into three major clades: 1 Phlebobranchia + Thaliacea + Aplousobranchia, 2 Appendicularia, and 3 Stolidobranchia, but the position of Appendicularia could not be firmly resolved. Our study additionally reveals that most Aplousobranchia evolve at extremely high rates involving changes in secondary structure of their 18S rRNA, with the exception of the family Clavelinidae, which appears to be slowly evolving. This extreme rate heterogeneity precluded resolving with certainty the exact phylogenetic placement of Aplousobranchia. Finally, the best fitting secondary-structure and CAT-mixture models

  16. 3-Nitropropionic acid modifies neurotrophin mRNA expression in the mouse striatum:18S-rRNA is a reliable control gene for studies of the striatum

    S.Espíndola; A Vilches-Flores; E.Hernández-Echeagaray

    2012-01-01

    Objective The aim of the present study was to determine the changes in the mRNA levels ofneurotrophins and their receptors in the striatal tissue of mice treated with 3-nitropropionic acid (3-NP).Methods At 1 and 48 h after the last drug administration,the mRNA expression of nerve growth factor,brain-derived neurotrophic factor,neurotrophin-3 and neurotrophin-4/5 as well as their receptors p75,TrkA,TrkB and TrkC,was evaluated using semi-quantitative (semi-Q) and real-time RT-PCR.β-actin mRNA and ribosomal 18S (18S rRNA) were tested as internal controls.Results 3-NP treatment did not affect mRNA expression of all neurotrophins and their respective receptors equally.Also,differences in neurotrophin and receptor mRNA expression were observed between semi-Q and real-time RT-PCR.Real-time RT-PCR was more accurate in evaluating the mRNA expression of the neurotrophins than semi-Q,and 18S rRNA was more reliable than β-actin as an internal control.Conclusion Neurotrophins and their receptors expression is differentially affected by neuronal damage produced by inhibition of mitochondrial respiration with 3-NP treatment in low,sub-chronic doses in vivo.

  17. Investigation of molluscan phylogeny on the basis of 18S rRNA sequences.

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1996-12-01

    The 18S rRNA sequences of 12 molluscs, representing the extant classes Gastropoda, Bivalvia, Polyplacophora, Scaphopoda, and Caudofoveata, were determined and compared with selected known 18S rRNA sequences of Metazoa, including other Mollusca. These data do not provide support for a close relationship between Platyhelminthes (Turbellaria) and Mollusca, but rather suggest that the latter group belongs to a clade of eutrochozoan coelomates. The 18S rRNA data fail to recover molluscan, bivalve, or gastropod monophyly. However, the branching pattern of the eutrochozoan phyla and classes is unstable, probably due to the explosive Cambrian radiation during which these groups arose. Similarly, the 18S rRNA data do not provide a reliable signal for the molluscan interclass relationships. Nevertheless, we obtained strong preliminary support for phylogenetic inferences at more restricted taxonomic levels, such as the monophyly of Polyplacophora, Caenogastropoda, Euthyneura, Heterodonta, and Arcoida. PMID:8952075

  18. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    He, Kaiyu [Department of Microbiology and Molecular Genetics (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Zhou, Hui-Ren [Food Science and Human Nutrition (United States); Pestka, James J., E-mail: pestka@msu.edu [Department of Microbiology and Molecular Genetics (United States); Food Science and Human Nutrition (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States)

    2012-11-15

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  19. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  20. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae

    Victor Manuel Gomez-Rodriguez

    2013-08-01

    Full Text Available Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in A. tequilana Weber, 1902 ‘Azul’, A. cupreata Trelease et Berger, 1915 and A. angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH was used for physical mapping of 5S and 18S ribosomal DNA (rDNA. All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  1. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  2. Structure of a mitochondrial ribosome with minimal RNA

    Sharma, Manjuli R.; Booth, Timothy M.; Simpson, Larry; Maslov, Dmitri A.; Agrawal, Rajendra K.

    2009-01-01

    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show th...

  3. Nonenzymatic microorganism identification based on ribosomal RNA

    Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.

    1999-11-01

    Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.

  4. 18S rRNA suggests that Entoprocta are protostomes, unrelated to Ectoprocta

    Mackey, L.Y.; Winnepenninckx, B.; Wachter, R.; Backeljau, T.; Emschermann, P.; Garey, J.R.

    1996-01-01

    The Ento- and Ectoprocta are sometimes placed together in the Bryozoa, which have variously been regarded as proto- or deuterostomes. However, Entoprocta have also been allied to the pseudocoelomates, while Ectoprocta are often united with the Brachiopoda and Phoronida in the (super)phylum Lophophorata. Hence, the phylogenetic relationships of these taxa are still much debated. We determined complete 18S rRNA sequences of two entoprocts, an ectoproct, an inarticulate brachiopod, a phoronid, t...

  5. Evolutionary History of the Chaetognaths Inferred from Actin and 18S-28S rRNA Paralogous Genes

    J.P. Casanova

    2006-01-01

    Full Text Available The chaetognaths constitute a small and enigmatic phylum of marine invertebrates whose phylogenetic affinities remain uncertain. Our phylogenetical investigations inferred from partial paralogous 18S-28S rRNA genes suggest that the event resulting in the presence of two classes of rRNA genes would have occurred at approximately 300-400 million years and prior to the radiation of extant chaetognath, whereas the taxon, according to both molecular and paleontological data, would be dated from at least the Early Cambrian. These divergent rRNA genes could be the result of a whole ribosomal cluster duplication or of an allopolyploid event during a crisis period, since, the fossil are lacking posterioly to the post-Carboniferous period (c.a., 300 million years. In addition, actin phylogeny evidenced that the cytoplasmic chaetognath actin clustered with the cytoplasmic insect actins, while the muscular chaetognath actins are placed basal to all muscular vertebrate actins. The present study suggests that the gene conversion mechanisms could be inefficient in this taxon; this could explain the conservation of extremely divergent paralogous sequences in the chaetognath genomes which could be correlated to the difficulties to identify a sister group between chaetognaths and other taxa among metazoans.

  6. Characterization of Hydrocortisone Biometabolites and 18S rRNA Gene in Chlamydomonas reinhardtii Cultures

    Seyed Bagher Mosavi-Azam

    2008-10-01

    Full Text Available A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1. This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25ºC for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17b-Dihydroxyandrost-4-en-3-one (2, 11b-hydroxyandrost-4-en-3,17-dione (3, 11b,17a,20b,21-tetrahydroxypregn-4-en-3-one (4 and prednisolone (5 were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  7. Molecular systematics of Volvocales (Chlorophyceae, Chlorophyta) based on exhaustive 18S rRNA phylogenetic analyses.

    Nakada, Takashi; Misawa, Kazuharu; Nozaki, Hisayoshi

    2008-07-01

    The taxonomy of Volvocales (Chlorophyceae, Chlorophyta) was traditionally based solely on morphological characteristics. However, because recent molecular phylogeny largely contradicts the traditional subordinal and familial classifications, no classification system has yet been established that describes the subdivision of Volvocales in a manner consistent with the phylogenetic relationships. Towards development of a natural classification system at and above the generic level, identification and sorting of hundreds of sequences based on subjective phylogenetic definitions is a significant step. We constructed an 18S rRNA gene phylogeny based on 449 volvocalean sequences collected using exhaustive BLAST searches of the GenBank database. Many chimeric sequences, which can cause fallacious phylogenetic trees, were detected and excluded during data collection. The results revealed 21 strongly supported primary clades within phylogenetically redefined Volvocales. Phylogenetic classification following PhyloCode was proposed based on the presented 18S rRNA gene phylogeny along with the results of previous combined 18S and 26S rRNA and chloroplast multigene analyses. PMID:18430591

  8. Details of gastropod phylogeny inferred from 18S rRNA sequences.

    Winnepenninckx, B; Steiner, G; Backeljau, T; De Wachter, R

    1998-02-01

    Some generally accepted viewpoints on the phylogenetic relationships within the molluscan class Gastropoda are reassessed by comparing complete 18S rRNA sequences. Phylogenetic analyses were performed using the neighbor-joining and maximum parsimony methods. The previously suggested basal position of Archaeogastropoda, including Neritimorpha and Vetigastropoda, in the gastropod clade is confirmed. The present study also provides new molecular evidence for the monophyly of both Caenogastropoda and Euthyneura (Pulmonata and Opisthobranchia), making Prosobranchia paraphyletic. The relationships within Caenogastropoda and Euthyneura data turn out to be very unstable on the basis of the present 18S rRNA sequences. The present 18S rRNA data question, but are insufficient to decide on, muricacean (Neogastropoda), neotaenioglossan, pulmonate, or stylommatophoran monophyly. The analyses also focus on two systellommatophoran families, namely, Veronicellidae and Onchidiidae. It is suggested that Systellommatophora are not a monophyletic unit but, due to the lack of stability in the euthyneuran clade, their affinity to either Opisthobranchia or Pulmonata could not be determined. PMID:9479694

  9. Regulating the Ribosome: A Spotlight on RNA Dark Matter

    Lintner, Nathanael G.; Cate, Jamie H. D.

    2014-01-01

    In this issue Pircher et al.(2014) show that an abundant ribosome-associated 18-nt noncoding RNA (ncRNA),derived from the open reading frame of an mRNA,acts directly on the ribosome and regulates global translation levels in response to hypertonic shock.

  10. Structure of a mitochondrial ribosome with minimal RNA.

    Sharma, Manjuli R; Booth, Timothy M; Simpson, Larry; Maslov, Dmitri A; Agrawal, Rajendra K

    2009-06-16

    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show that (i) the overall structure of the Lmr is considerably more porous, (ii) the topology of the intersubunit space is significantly different, with fewer intersubunit bridges, but more tunnels, and (iii) several of the functionally-important rRNA regions, including the alpha-sarcin-ricin loop, have different relative positions within the structure. Furthermore, the major portions of the mRNA channel, the tRNA passage, and the nascent polypeptide exit tunnel contain Lmr-specific proteins, suggesting that the mechanisms for mRNA recruitment, tRNA interaction, and exiting of the nascent polypeptide in Lmr must differ markedly from the mechanisms deduced for ribosomes in other organisms. Our study identifies certain structural features that are characteristic solely of mitochondrial ribosomes and other features that are characteristic of both mitochondrial and chloroplast ribosomes (i.e., organellar ribosomes). PMID:19497863

  11. ITS-2 and 18S rRNA gene phylogeny of Aplysinidae (Verongida, Demospongiae).

    Schmitt, Susanne; Hentschel, Ute; Zea, Sven; Dandekar, Thomas; Wolf, Matthias

    2005-03-01

    18S ribosomal DNA and internal transcribed spacer 2 (ITS-2) full-length sequences, each of which was sequenced three times, were used to construct phylogenetic trees with alignments based on secondary structures, in order to elucidate genealogical relationships within the Aplysinidae (Verongida). The first poriferan ITS-2 secondary structures are reported. Altogether 11 Aplysina sponges and 3 additional sponges (Verongula gigantea, Aiolochroia crassa, Smenospongia aurea) from tropical and subtropical oceans were analyzed. Based on these molecular studies, S. aurea, which is currently affiliated with the Dictyoceratida, should be reclassified to the Verongida. Aplysina appears as monophyletic. A soft form of Aplysina lacunosa was separated from other Aplysina and stands at a basal position in both 18S and ITS-2 trees. Based on ITS-2 sequence information, the Aplysina sponges could be distinguished into a single Caribbean-Eastern Pacific cluster and a Mediterranean cluster. The species concept for Aplysina sponges as well as a phylogenetic history with a possibly Tethyan origin is discussed. PMID:15871043

  12. An overview of pre-ribosomal RNA processing in eukaryotes

    Henras, Anthony K.; Plisson-Chastang, Célia; O'Donohue, Marie-Françoise; Chakraborty, Anirban; Gleizes, Pierre-Emmanuel

    2014-01-01

    Ribosomal RNAs are the most abundant and universal noncoding RNAs in living organisms. In eukaryotes, three of the four ribosomal RNAs forming the 40S and 60S subunits are borne by a long polycistronic pre-ribosomal RNA. A complex sequence of processing steps is required to gradually release the mature RNAs from this precursor, concomitant with the assembly of the 79 ribosomal proteins. A large set of trans-acting factors chaperone this process, including small nucleolar ribonucleoparticles. ...

  13. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)

    Stenger, B.L.S.; Clark, M.E.; Kváč, Martin; Khan, E.; Giddings, C.W.; Dyer, N.W.; Schultz, J.L.; McEvoy, J.M.

    2015-01-01

    Roč. 32, JUN 2015 (2015), s. 113-123. ISSN 1567-1348 R&D Projects: GA MŠk(CZ) LH11061 Institutional support: RVO:60077344 Keywords : Cryptosporidium * Paralogy * 18S rRNA * 18S rDNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 3.015, year: 2014

  14. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. PMID:26789074

  15. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)1

    Stenger, Brianna L.S.; Clark, Mark E.; Kváč, Martin; Khan, Eakalak; Giddings, Catherine W.; Dyer, Neil W.; Schultz, Jessie L.; McEvoy, John M.

    2015-01-01

    Cryptosporidium is an apicomplexan parasite that causes the disease cryptosporidiosis in humans, livestock, and other vertebrates. Much of the knowledge on Cryptosporidium diversity is derived from 18S rRNA gene (18S rDNA) phylogenies. Eukaryote genomes generally have multiple 18S rDNA copies that evolve in concert, which is necessary for the accurate inference of phylogenetic relationships. However, 18S rDNA copies in some genomes evolve by a birth-and-death process that can result in sequen...

  16. Structural and Functional Studies of Ribosome-inactivating Proteins and Ribosomal RNA

    LIU Wangyi; ZHANG Jinsong; LIU Renshui; HE Wenjun; LING Jun

    2007-01-01

    @@ A plant's ribosome-inactivating proteins (RIPs) are a group of toxic proteins. Theoretically, they can be employed as a tool enzyme in the exploration of the structure and function of the ribosomal RNA; in practical application, they can be used as an insecticide in agriculture, for preparation of immuno-toxic protein to kill cancer cells or against viral infection in medicine.

  17. Nematode 18S rRNA gene is a reliable tool for environmental biosafety assessment of transgenic banana in confined field trials.

    Nakacwa, R; Kiggundu, A; Talwana, H; Namaganda, J; Lilley, C; Tushemereirwe, W; Atkinson, H

    2013-10-01

    Information on relatedness in nematodes is commonly obtained by DNA sequencing of the ribosomal internal transcribed spacer region. However, the level of diversity at this locus is often insufficient for reliable species differentiation. Recent findings suggest that the sequences of a fragment of the small subunit nuclear ribosomal DNA (18S rRNA or SSU), identify genera of soil nematodes and can also distinguish between species in some cases. A database of soil nematode genera in a Ugandan soil was developed using 18S rRNA sequences of individual nematodes from a GM banana confined field trial site at the National Agricultural Research Laboratories, Kawanda in Uganda. The trial was planted to evaluate transgenic bananas for resistance to black Sigatoka disease. Search for relatedness of the sequences gained with entries in a public genomic database identified a range of 20 different genera and sometimes distinguished species. Molecular markers were designed from the sequence information to underpin nematode faunal analysis. This approach provides bio-indicators for disturbance of the soil environment and the condition of the soil food web. It is being developed to support environmental biosafety analysis by detecting any perturbance by transgenic banana or other GM crops on the soil environment. PMID:23661261

  18. Eukaryotic ribosomes that lack a 5.8S RNA

    Vossbrinck, C. R.; Woese, C. R.

    1986-01-01

    The 5.8S ribosomal RNA is believed to be a universal eukaryotic characteristic. It has no (size) counterpart among the prokaryotes, although its sequence is homologous with the first 150 or so nucleotides of the prokaryotic large subunit (23S) ribosomal RNA. An exception to this rule is reported here. The microsporidian Vairimorpha necatrix is a eukaryote that has no 5.8S rRNA. As in the prokaryotes, it has a single large subunit rRNA, whose 5-prime region corresponds to the 5.8S rRNA.

  19. Translation with frameshifting of ribosome along mRNA transcript

    Li, Jingwei

    2015-01-01

    Translation is an important process for prokaryotic and eukaryotic cells to produce necessary proteins for cell growth. Numerious experiments have been performed to explore the translational properties. Diverse models have also been developed to determine the biochemical mechanism of translation. However, to simplify the majority of the existing models, the frameshifting of ribosome along the mRNA transcript is neglected, which actually occurs in real cells and has been extensively experimentally studied. The frameshifting of ribosome evidently influences the efficiency and speed of translation, considering that the peptide chains synthesized by shifted ribosomes will not fold into functional proteins and will degrade rapidly. In this study, a theoretical model is presented to describe the translational process based on the model for totally asymmetric simple exclusion process. In this model, the frameshifting of the ribosome along the mRNA transcript and the attachment/detachment of the ribosome to/from the ...

  20. An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5 ' UTRs and its implications for eukaryotic gene translation regulation

    Pánek, J. (Josef); Kolář, M. (Michal); Vohradský, J; Valášek, L. (Leoš)

    2013-01-01

    There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computat...

  1. The role of human ribosomal proteins in the maturation of rRNA and ribosome production

    Robledo, Sara; Rachel A Idol; Crimmins, Dan L.; Ladenson, Jack H.; Mason, Philip J.; Bessler, Monica

    2008-01-01

    Production of ribosomes is a fundamental process that occurs in all dividing cells. It is a complex process consisting of the coordinated synthesis and assembly of four ribosomal RNAs (rRNA) with about 80 ribosomal proteins (r-proteins) involving more than 150 nonribosomal proteins and other factors. Diamond Blackfan anemia (DBA) is an inherited red cell aplasia caused by mutations in one of several r-proteins. How defects in r-proteins, essential for proliferation in all cells, lead to a hum...

  2. Hierarchical RNA Processing Is Required for Mitochondrial Ribosome Assembly.

    Rackham, Oliver; Busch, Jakob D; Matic, Stanka; Siira, Stefan J; Kuznetsova, Irina; Atanassov, Ilian; Ermer, Judith A; Shearwood, Anne-Marie J; Richman, Tara R; Stewart, James B; Mourier, Arnaud; Milenkovic, Dusanka; Larsson, Nils-Göran; Filipovska, Aleksandra

    2016-08-16

    The regulation of mitochondrial RNA processing and its importance for ribosome biogenesis and energy metabolism are not clear. We generated conditional knockout mice of the endoribonuclease component of the RNase P complex, MRPP3, and report that it is essential for life and that heart and skeletal-muscle-specific knockout leads to severe cardiomyopathy, indicating that its activity is non-redundant. Transcriptome-wide parallel analyses of RNA ends (PARE) and RNA-seq enabled us to identify that in vivo 5' tRNA cleavage precedes 3' tRNA processing, and this is required for the correct biogenesis of the mitochondrial ribosomal subunits. We identify that mitoribosomal biogenesis proceeds co-transcriptionally because large mitoribosomal proteins can form a subcomplex on an unprocessed RNA containing the 16S rRNA. Taken together, our data show that RNA processing links transcription to translation via assembly of the mitoribosome. PMID:27498866

  3. Filling a gap in the phylogeny of flatworms: relationships within the Rhabdocoela (Platyhelminthes), inferred from 18S ribosomal DNA sequences

    Willems, Wim; Walberg, A.; Jondelius, U.; Littlewood, D.; Backeljau, T.; Schockaert, Ernest; Artois, Tom

    2006-01-01

    The phylogeny of the Rhabdocoela, a species-rich taxon of free-living flatworms, is reconstructed based on complete 18S rDNA sequences. The analysis includes 62 rhabdocoels and 102 representatives of all major flatworm taxa. In total, 46 new sequences are used, 41 of them from rhabdocoel species, five from proseriates. Phylogenetic analysis was performed using maximum parsimony and Bayesian inference. Clade support was evaluated with parsimony jackknifing, Bremer support indice...

  4. The utility of diversity profiling using Illumina 18S rRNA gene amplicon deep sequencing to detect and discriminate Toxoplasma gondii among the cyst-forming coccidia.

    Cooper, Madalyn K; Phalen, David N; Donahoe, Shannon L; Rose, Karrie; Šlapeta, Jan

    2016-01-30

    Next-generation sequencing (NGS) has the capacity to screen a single DNA sample and detect pathogen DNA from thousands of host DNA sequence reads, making it a versatile and informative tool for investigation of pathogens in diseased animals. The technique is effective and labor saving in the initial identification of pathogens, and will complement conventional diagnostic tests to associate the candidate pathogen with a disease process. In this report, we investigated the utility of the diversity profiling NGS approach using Illumina small subunit ribosomal RNA (18S rRNA) gene amplicon deep sequencing to detect Toxoplasma gondii in previously confirmed cases of toxoplasmosis. We then tested the diagnostic approach with species-specific PCR genotyping, histopathology and immunohistochemistry of toxoplasmosis in a Risso's dolphin (Grampus griseus) to systematically characterise the disease and associate causality. We show that the Euk7A/Euk570R primer set targeting the V1-V3 hypervariable region of the 18S rRNA gene can be used as a species-specific assay for cyst-forming coccidia and discriminate T. gondii. Overall, the approach is cost-effective and improves diagnostic decision support by narrowing the differential diagnosis list with more certainty than was previously possible. Furthermore, it supplements the limitations of cryptic protozoan morphology and surpasses the need for species-specific PCR primer combinations. PMID:26801593

  5. Taxonomy of the genus Rhexinema (Ulvophyceae) based on phylogeny of the 18S rRNA and morphology

    Caisová, Lenka

    2009-01-01

    Roč. 48, č. 4 (2009), s. 15-15. ISSN 0031-8884. [International Phycological Congress /9./. 02.08.2009-08.08.2009, Tokyo] Institutional research plan: CEZ:AV0Z60050516 Keywords : Rhexinema * 18S rRNA * morphology Subject RIV: EF - Botanics

  6. Structural Insights into tRNA Dynamics on the Ribosome

    Xabier Agirrezabala

    2015-04-01

    Full Text Available High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation.

  7. Structural Insights into tRNA Dynamics on the Ribosome.

    Agirrezabala, Xabier; Valle, Mikel

    2015-01-01

    High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation. PMID:25941930

  8. Structural Insights into tRNA Dynamics on the Ribosome

    Xabier Agirrezabala; Mikel Valle

    2015-01-01

    High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation.

  9. Phylogeny of the sundews, Drosera (Droseraceae), based on chloroplast rbcL and nuclear 18S ribosomal DNA Sequences.

    Rivadavia, Fernando; Kondo, Katsuhiko; Kato, Masahiro; Hasebe, Mitsuyasu

    2003-01-01

    The sundew genus Drosera consists of carnivorous plants with active flypaper traps and includes nearly 150 species distributed mainly in Australia, Africa, and South America, with some Northern Hemisphere species. In addition to confused intrageneric classification of Drosera, the intergeneric relationships among the Drosera and two other genera in the Droseraceae with snap traps, Dionaea and Aldrovanda, are problematic. We conducted phylogenetic analyses of DNA sequences of the chloroplast rbcL gene for 59 species of Drosera, covering all sections except one. These analyses revealed that five of 11 sections, including three monotypic sections, are polyphyletic. Combined rbcL and 18S rDNA sequence data were used to infer phylogenetic relationships among Drosera, Dionaea, and Aldrovanda. This analysis revealed that all Drosera species form a clade sister to a clade including Dionaea and Aldrovanda, suggesting that the snap traps of Aldrovanda and Dionaea are homologous despite their morphological differences. MacClade reconstructions indicated that multiple episodes of aneuploidy occurred in a clade that includes mainly Australian species, while the chromosome numbers in the other clades are not as variable. Drosera regia, which is native to South Africa, and most species native to Australia, were clustered basally, suggesting that Drosera originated in Africa or Australia. The rbcL tree indicates that Australian species expanded their distribution to South America and then to Africa. Expansion of distribution to the Northern Hemisphere from the Southern Hemispere occurred in a few different lineages. PMID:21659087

  10. PCR amplification of a multi-copy mitochondrial gene (cox3) improves detection of Cytauxzoon felis infection as compared to a ribosomal gene (18S).

    Schreeg, Megan E; Marr, Henry S; Griffith, Emily H; Tarigo, Jaime L; Bird, David M; Reichard, Mason V; Cohn, Leah A; Levy, Michael G; Birkenheuer, Adam J

    2016-07-30

    Cytauxzoon felis is a tick-transmitted protozoan parasite that infects felids. Clinical disease caused by acute C. felis infection rapidly progresses in domestic cats, leading to high morbidity and mortality. Accurately diagnosing cytauxzoonosis as soon as possible during acute infection would allow for earlier initiation of antiprotozoal therapy which could lead to higher survival rates. Molecular detection of parasite rRNA genes (18S) by PCR has previously been shown to be a sensitive method of diagnosing C. felis infections. Based on evidence from related apicomplexan species, we hypothesized that C. felis mitochondrial genes would exist at higher copy numbers than 18S and would be a more sensitive diagnostic target. In this study we have designed a PCR assay targeting the C. felis mitochondrial gene cytochrome c oxidase subunit III (cox3). Herein we demonstrate that (1) the cox3 PCR can detect as low as 1 copy of DNA target and can detect C. felis in samples with known mitochondrial sequence heterogeneity, (2) cox3 copy number is increased relative to 18S in blood and tissue samples from acutely infected cats, and (3) the cox3 PCR is more sensitive than 18S PCR for detection of C. felis during early infections. PMID:27369587

  11. Interaction of tRNA with Eukaryotic Ribosome

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  12. Visualization of ribosomal RNA operon copy number distribution

    DasGupta Indrani; Wu Martin; Rastogi Rajat; Fox George E

    2009-01-01

    Abstract Background Results of microbial ecology studies using 16S rRNA sequence information can be deceiving due to differences in rRNA operon copy number and genome size of the detected organisms. It therefore will be useful for investigators to have a better understanding of how these two parameters differ in various organism types. In this study, the number of ribosomal operons and genome size were separately mapped onto a Bacterial phylogenetic tree. Results A representative Bacterial tr...

  13. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  14. Epigeneitc silencing of ribosomal RNA genes by Mybbp1a

    Tan Bertrand

    2012-06-01

    Full Text Available Abstract Background Transcription of the ribosomal RNA gene repeats by Pol I occurs in the nucleolus and is a fundamental step in ribosome biogenesis and protein translation. Due to tight coordination between ribosome biogenesis and cell proliferation, transcription of rRNA and stable maintenance of rDNA clusters are thought to be under intricate control by intercalated mechanisms, particularly at the epigenetic level. Methods and Results Here we identify the nucleolar protein Myb-binding protein 1a (Mybbp1a as a novel negative regulator of rRNA expression. Suppression of rDNA transcription by Mybbp1a was linked to promoter regulation as illustrated by its binding to the chromatin around the hypermethylated, inactive rDNA gene promoters. Our data further showed that downregulation of Mybbp1a abrogated the local DNA methylation levels and histone marks associated with gene silencing, and altered the promoter occupancy of various factors such UBF and HDACs, consequently leading to elevated rRNA expression. Mechanistically, we propose that Mybbp1a maintains rDNA repeats in a silenced state while in association with the negative epigenetic modifiers HDAC1/2. Conclusions Results from our present work reveal a previously unrecognized co-repressor role of Mybbp1a in rRNA expression. They are further consistent with the scenario that Mybbp1a is an integral constituent of the rDNA epigenetic regulation that underlies the balanced state of rDNA clusters.

  15. PFR²: a curated database of planktonic foraminifera 18S ribosomal DNA as a resource for studies of plankton ecology, biogeography and evolution.

    Morard, Raphaël; Darling, Kate F; Mahé, Frédéric; Audic, Stéphane; Ujiié, Yurika; Weiner, Agnes K M; André, Aurore; Seears, Heidi A; Wade, Christopher M; Quillévéré, Frédéric; Douady, Christophe J; Escarguel, Gilles; de Garidel-Thoron, Thibault; Siccha, Michael; Kucera, Michal; de Vargas, Colomban

    2015-11-01

    Planktonic foraminifera (Rhizaria) are ubiquitous marine pelagic protists producing calcareous shells with conspicuous morphology. They play an important role in the marine carbon cycle, and their exceptional fossil record serves as the basis for biochronostratigraphy and past climate reconstructions. A major worldwide sampling effort over the last two decades has resulted in the establishment of multiple large collections of cryopreserved individual planktonic foraminifera samples. Thousands of 18S rDNA partial sequences have been generated, representing all major known morphological taxa across their worldwide oceanic range. This comprehensive data coverage provides an opportunity to assess patterns of molecular ecology and evolution in a holistic way for an entire group of planktonic protists. We combined all available published and unpublished genetic data to build PFR(2), the Planktonic foraminifera Ribosomal Reference database. The first version of the database includes 3322 reference 18S rDNA sequences belonging to 32 of the 47 known morphospecies of extant planktonic foraminifera, collected from 460 oceanic stations. All sequences have been rigorously taxonomically curated using a six-rank annotation system fully resolved to the morphological species level and linked to a series of metadata. The PFR(2) website, available at http://pfr2.sb-roscoff.fr, allows downloading the entire database or specific sections, as well as the identification of new planktonic foraminiferal sequences. Its novel, fully documented curation process integrates advances in morphological and molecular taxonomy. It allows for an increase in its taxonomic resolution and assures that integrity is maintained by including a complete contingency tracking of annotations and assuring that the annotations remain internally consistent. PMID:25828689

  16. The effect of trichloroethylene and acrylonitrile on RNA and ribosome synthesis and ribosome content in Saccharomyces cells.

    Lochmann, E R; Ehrlich, W; Mangir, M

    1984-04-01

    The effects of trichloroethylene (TCE) and acrylonitrile (ACN) on growth, RNA synthesis, ribosome synthesis, and ribosome content were tested in yeast cells. TCE causes a delay of the growth of a cell culture (prolongation of the lag phase), but does not cause inhibition. Cells exposed to increasing concentrations of ACN show increasing damage, so that, at a certain point of the growth curve, cell division stops altogether. Similar results were obtained when RNA synthesis was investigated: After treatment with TCE, the maximum RNA synthesis of the cell culture was retarded, but subsequently reached the same level as the untreated control cells. In the presence of ACN, however, the rate of RNA synthesis was lowered with increasing ACN concentrations. The same effect was observed upon investigation of ribosome synthesis: Whereas TCE produces only a slight effect, treatment with increasing concentrations of ACN leads to a substantial decrease in ribosome synthesis, and finally to total inhibition. Parallel to this, the content of free and membrane-bound ribosomes is diminished. Obviously, the decrease in ribosome content is caused not only by an inhibition of ribosome synthesis, but also by a degradation of existing ribosomes, as well as by induction of a ribosome-associated RNase. PMID:6714140

  17. An 18S ribosomal DNA barcode for the study of Isomermis lairdi, a parasite of the blackfly Simulium damnosum s.l.

    Crainey, J L; Wilson, M D; Post, R J

    2009-09-01

    The mermithid parasite, Isomermis lairdi Mondet, Poinar & Bernadou (Nematoda: Mermithidae), is known to have a major impact on populations of Simulium damnosum s.l. Theobald (Diptera: Simuliidae) and on their efficiency as vectors of Onchocerca volvulus (Leuckart) (Nematoda: Filarioidea). However, the value of I. lairdi and other mermithid parasites as potential means of integrated vector control has not been fully realized. This is partly because traditional taxonomic approaches have been insufficient for describing and analysing important aspects of their biology and host range. In total, rDNA barcode sequences have been obtained from over 70 I. lairdi mermithids found parasitizing S. damnosum s.l. larvae in three different rivers. No two sequences were found to vary by more than 0.5%, and cytospecies identification of mermithid hosts revealed that I. lairdi with identical rDNA barcodes can parasitize multiple cytoforms of the S. damnosum complex, including S. squamosum (Enderlein). Phylogenetic analysis using a partial sequence from the 18S ribosomal DNA barcode, grouped I. lairdi in a monophyletic group with Gastromermis viridis Welch (Nematoda: Mermithidae) and Isomermis wisconsinensis Welch (Nematoda: Mermithidae). PMID:19712154

  18. The effect of secondary compounds on the rumen microbial population structure measured by 16S rRNA and 18S rRNA

    Full text: Plant secondary compounds in the forages have an important role in determining forage quality. A method for evaluating their effects on microbial population structure was carried out using the in vitro gas syringe system followed by extraction of RNA and gel separation of 16S rRNA and 18S rRNA. Quantification of 16S rRNA and 18S rRNA bands indicated the prokaryote and eukaryote populations, respectively. Five types of plant materials, i.e. Nothopanax scutellarium (Mangkokan) leaves, Morinda citrifolia (Mengkudu) fruit, Sapindus rarak (lerak) fruit and two types of Sesbania sesban leaves (hgh saponin and low saponin) were tested and Pennisetum purpureum (rumput gajah, Indonesian name) was used as a control roughage. Presence of saponin in these plant materials was determined qualitatively by thin layer chromatography. Eukaryote population was found to be significantly affected by the above plant materials. Both types of S. sesban leaves caused total elimination of eukaryotes. S. rarak reduced both eukaryote and prokaryote populations. The observed inhibition of eukaryote population might be due to the presence of saponin in these plant materials. In another experiment, a methanol extract of S. rarak which contained saponin was included and its effect on in vitro fermentation of P. purpureum was evaluated. The results showed that at higher levels of inclusion of S. rarak methanol extract, eukaroytes were totally eliminated. Comparison was made between microbial mass calculated based on difference between apparent undigested residue and true undigested residue and microbial mass calculations based on 16S rRNA and 18S rRNA. Microbial mass calculated by difference method was much higher than the microbial mass calculated on the basis of 16S rRNA and 18S rRNA. The quantification of RNA can be a useful and rapid technique for an accurate assessment of the effect of new forage materials on the microbial population structure. Other parameters from in vitro

  19. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    Martins Cesar

    2010-01-01

    Full Text Available Abstract Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s occurring in 39.6% of the analyzed individuals (both male and female were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement.

  20. Limitations of metazoan 18S rRNA sequence data : implications for reconstructing a phylogeny of the animal kingdom and inferring the reality of the cambrian explosion

    Abouheif, Ehab; Zardoya, Rafael; Meyer, Axel

    1998-01-01

    We document the phylogenetic behavior of the 18S rRNA molecule in 67 taxa from 28 metazoan phyla and assess the effects of among-site rate variation on reconstructing phylogenies of the animal kingdom. This empirical assessment was undertaken to clarify further the limits of resolution of the 18S rRNA gene as a phylogenetic marker and to address the question of whether 18S rRNA phylogenies can be used as a source of evidence to infer the reality of a Cambrian explosion. A notable degree of am...

  1. Structures of the Bacterial Ribosome in Classical and Hybrid States of tRNA Binding

    Dunkle, Jack A.; Wang, Leyi; Feldman, Michael B.; Pulk, Arto; Chen, Vincent B.; Kapral, Gary J.; Noeske, Jonas; Richardson, Jane S.; Blanchard, Scott C.; Cate, Jamie H. Doudna (Cornell); (UCB); (Duke)

    2011-09-06

    During protein synthesis, the ribosome controls the movement of tRNA and mRNA by means of large-scale structural rearrangements. We describe structures of the intact bacterial ribosome from Escherichia coli that reveal how the ribosome binds tRNA in two functionally distinct states, determined to a resolution of {approx}3.2 angstroms by means of x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit site. The structures help to explain how the ratchet-like motion of the two ribosomal subunits contributes to the mechanisms of translocation, termination, and ribosome recycling.

  2. Heritability and Variability in Ribosomal RNA Genes of Vicia faba

    Rogers, Scott O; Bendich, Arnold J.

    1987-01-01

    We have compared the restriction patterns and copy numbers of ribosomal RNA genes (rDNA) between and within individuals of Vicia faba . While the EcoRI blot-hybridization patterns changed only after one to two generations, copy number changes were found among different tissues of the same plant. Copy number differences among individuals in the population were as great as 95-fold, whereas as much as a 12-fold variation was seen among tissues of the same plant. Among individual F1 progeny from ...

  3. Phylogenetic analysis of the spider mite sub-family Tetranychinae (Acari: Tetranychidae based on the mitochondrial COI gene and the 18S and the 5' end of the 28S rRNA genes indicates that several genera are polyphyletic.

    Tomoko Matsuda

    Full Text Available The spider mite sub-family Tetranychinae includes many agricultural pests. The internal transcribed spacer (ITS region of nuclear ribosomal RNA genes and the cytochrome c oxidase subunit I (COI gene of mitochondrial DNA have been used for species identification and phylogenetic reconstruction within the sub-family Tetranychinae, although they have not always been successful. The 18S and 28S rRNA genes should be more suitable for resolving higher levels of phylogeny, such as tribes or genera of Tetranychinae because these genes evolve more slowly and are made up of conserved regions and divergent domains. Therefore, we used both the 18S (1,825-1,901 bp and 28S (the 5' end of 646-743 bp rRNA genes to infer phylogenetic relationships within the sub-family Tetranychinae with a focus on the tribe Tetranychini. Then, we compared the phylogenetic tree of the 18S and 28S genes with that of the mitochondrial COI gene (618 bp. As observed in previous studies, our phylogeny based on the COI gene was not resolved because of the low bootstrap values for most nodes of the tree. On the other hand, our phylogenetic tree of the 18S and 28S genes revealed several well-supported clades within the sub-family Tetranychinae. The 18S and 28S phylogenetic trees suggest that the tribes Bryobiini, Petrobiini and Eurytetranychini are monophyletic and that the tribe Tetranychini is polyphyletic. At the genus level, six genera for which more than two species were sampled appear to be monophyletic, while four genera (Oligonychus, Tetranychus, Schizotetranychus and Eotetranychus appear to be polyphyletic. The topology presented here does not fully agree with the current morphology-based taxonomy, so that the diagnostic morphological characters of Tetranychinae need to be reconsidered.

  4. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.

    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina

    2016-05-15

    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis. PMID:27084467

  5. Recovery from ultraviolet light-induced depression of ribosomal RNA synthesis in normal human, xeroderma pigmentosum and cockayne syndrome cells

    The rate of ribosomal RNA (rRNA) synthesis was analyzed at different times after ultraviolet light (UV) irradiation in normal human, xeroderma pigmentosum (XP) and Cockayne syndrome (CS) cells. In normal cells, the rate of rRNA synthesis, as measured by the incorporation of 3H-uridine into 18S and 28S rRNAs, decreased immediately after UV irradiation to about half of that of unirradiated cells, and then recovered significantly at 24h after UV. However, the rate of synthesis continued to decrease during post-UV incubation in XP cells belonging to groups A, D, E, F and G, as well as in CS cells of groups A and B. In contrast, group C XP cells showed a slight recovery at 24h after UV, suggesting that they have the capacity to repair UV lesions in rRNA genes. (author)

  6. Footprinting of ribosomal RNA genes by transcription initiation factor and RNA polymerase I.

    Bateman, E.; Iida, C T; Kownin, P; Paule, M R

    1985-01-01

    The binding of a species-specific transcription initiation factor (TIF) and purified RNA polymerase I to the promoter region of the 39S ribosomal RNA gene from Acanthamoeba were studied by using DNase I "footprinting." Conditions were chosen such that the footprints obtained could be correlated with the transcriptional activity of the TIF-containing fractions used and that the labeled DNA present would itself serve as a template for transcription. The transcription factor binds upstream from ...

  7. 16S ribosomal RNA methylation: emerging resistance mechanism against aminoglycosides.

    Doi, Yohei; Arakawa, Yoshichika

    2007-07-01

    Methylation of 16S ribosomal RNA (rRNA) has recently emerged as a new mechanism of resistance against aminoglycosides among gram-negative pathogens belonging to the family Enterobacteriaceae and glucose-nonfermentative microbes, including Pseudomonas aeruginosa and Acinetobacter species. This event is mediated by a newly recognized group of 16S rRNA methylases, which share modest similarity to those produced by aminoglycoside-producing actinomycetes. Their presence confers a high level of resistance to all parenterally administered aminoglycosides that are currently in clinical use. The responsible genes are mostly located on transposons within transferable plasmids, which provides them with the potential to spread horizontally and may in part explain the already worldwide distribution of this novel resistance mechanism. Some of these organisms have been found to coproduce extended-spectrum beta-lactamases or metallo-beta-lactamases, contributing to their multidrug-resistant phenotypes. A 2-tiered approach, consisting of disk diffusion tests followed by confirmation with polymerase chain reaction, is recommended for detection of 16S rRNA methylase-mediated resistance. PMID:17554708

  8. Mimicking Ribosomal Unfolding of RNA Pseudoknot in a Protein Channel.

    Zhang, Xinyue; Xu, Xiaojun; Yang, Zhiyu; Burcke, Andrew J; Gates, Kent S; Chen, Shi-Jie; Gu, Li-Qun

    2015-12-23

    Pseudoknots are a fundamental RNA tertiary structure with important roles in regulation of mRNA translation. Molecular force spectroscopic approaches such as optical tweezers can track the pseudoknot's unfolding intermediate states by pulling the RNA chain from both ends, but the kinetic unfolding pathway induced by this method may be different from that in vivo, which occurs during translation and proceeds from the 5' to 3' end. Here we developed a ribosome-mimicking, nanopore pulling assay for dissecting the vectorial unfolding mechanism of pseudoknots. The pseudoknot unfolding pathway in the nanopore, either from the 5' to 3' end or in the reverse direction, can be controlled by a DNA leader that is attached to the pseudoknot at the 5' or 3' ends. The different nanopore conductance between DNA and RNA translocation serves as a marker for the position and structure of the unfolding RNA in the pore. With this design, we provided evidence that the pseudoknot unfolding is a two-step, multistate, metal ion-regulated process depending on the pulling direction. Most notably, unfolding in both directions is rate-limited by the unzipping of the first helix domain (first step), which is Helix-1 in the 5' → 3' direction and Helix-2 in the 3' → 5' direction, suggesting that the initial unfolding step in either pulling direction needs to overcome an energy barrier contributed by the noncanonical triplex base-pairs and coaxial stacking interactions for the tertiary structure stabilization. These findings provide new insights into RNA vectorial unfolding mechanisms, which play an important role in biological functions including frameshifting. PMID:26595106

  9. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  10. An RNA-binding complex involved in ribosome biogenesis contains a protein with homology to tRNA CCA-adding enzyme.

    Jinzhong Lin

    2013-10-01

    Full Text Available A multitude of proteins and small nucleolar RNAs transiently associate with eukaryotic ribosomal RNAs to direct their modification and processing and the assembly of ribosomal proteins. Utp22 and Rrp7, two interacting proteins with no recognizable domain, are components of the 90S preribosome or the small subunit processome that conducts early processing of 18S rRNA. Here, we determine the cocrystal structure of Utp22 and Rrp7 complex at 1.97 Å resolution and the NMR structure of a C-terminal fragment of Rrp7, which is not visible in the crystal structure. The structure reveals that Utp22 surprisingly resembles a dimeric class I tRNA CCA-adding enzyme yet with degenerate active sites, raising an interesting evolutionary connection between tRNA and rRNA processing machineries. Rrp7 binds extensively to Utp22 using a deviant RNA recognition motif and an extended linker. Functional sites on the two proteins were identified by structure-based mutagenesis in yeast. We show that Rrp7 contains a flexible RNA-binding C-terminal tail that is essential for association with preribosomes. RNA-protein crosslinking shows that Rrp7 binds at the central domain of 18S rRNA and shares a neighborhood with two processing H/ACA snoRNAs snR30 and snR10. Depletion of snR30 prevents the stable assembly of Rrp7 into preribosomes. Our results provide insight into the evolutionary origin and functional context of Utp22 and Rrp7.

  11. Visualization of ribosomal RNA operon copy number distribution

    DasGupta Indrani

    2009-09-01

    Full Text Available Abstract Background Results of microbial ecology studies using 16S rRNA sequence information can be deceiving due to differences in rRNA operon copy number and genome size of the detected organisms. It therefore will be useful for investigators to have a better understanding of how these two parameters differ in various organism types. In this study, the number of ribosomal operons and genome size were separately mapped onto a Bacterial phylogenetic tree. Results A representative Bacterial tree was constructed using 31 marker genes found in 578 bacterial genome sequences. Organism names are displayed on the trees using graduations of color such that similar colors indicate similar numbers of operons or genome size. The resulting images provide an intuitive understanding of how copy number and genome size vary in different Bacterial phyla. Conclusion Once the phylogenetic position of a novel organism is known the number of rRNA operons, and to a lesser extent the genome size, can be estimated by examination of the colored maps. Further detail can then be obtained for members of relevant taxa from the rrnDB database.

  12. Mechanism of translocation: relative arrangement of tRNA and mRNA on the ribosome.

    Matzke, A J; Barta, A; Kuechler, E

    1980-01-01

    AcPhe-tRNAPhe from yeast can be photocross-linked to poly(U) on Escherichia coli ribosomes. The photoreaction occurs at the wybutine base situated next to the 3' side of the anticodon. The kinetics and efficiency of crosslinking of AcPhe-Phe-tRNA are the same at both the acceptor site and the peptidyl site. Therefore, the orientation of wybutine with respect to the mRNA is similar in both the pretranslocational and posttranslocational states. AcPhe-Phe-tRNA crosslinked at the acceptor site ca...

  13. Controlling translation elongation efficiency: tRNA regulation of ribosome flux on the mRNA.

    Gorgoni, Barbara; Marshall, Elizabeth; McFarland, Matthew R; Romano, M Carmen; Stansfield, Ian

    2014-02-01

    Gene expression can be regulated by a wide variety of mechanisms. One example concerns the growing body of evidence that the protein-production rate can be regulated at the level of translation elongation by controlling ribosome flux across the mRNA. Variations in the abundance of tRNA molecules cause different rates of translation of their counterpart codons. This, in turn, produces a variable landscape of translational rate across each and every mRNA, with the dynamic formation and deformation of ribosomal queues being regulated by both tRNA availability and the rates of translation initiation and termination. In the present article, a range of examples of tRNA control of gene expression are reviewed, and the use of mathematical modelling to develop a predictive understanding of the consequences of that regulation is discussed and explained. These findings encourage a view that predicting the protein-synthesis rate of each mRNA requires a holistic understanding of how each stage of translation, including elongation, contributes to the overall protein-production rate. PMID:24450645

  14. Direct ribosome isolation from soil to extract bacterial rRNA for community analysis.

    Felske, A; B. Engelen; Nübel, U; Backhaus, H

    1996-01-01

    A simple method that combines an adapted ribosome isolation method and a common RNA extraction step has been developed for selective recovery of intact rRNA from natural microbial communities in soil. After mechanical cell lysis, ribosomes are separated by centrifugation steps, avoiding massive humic acid contamination and RNA degradation. The protocol accommodates the complex composition of soils by blocking adsorbing surfaces and humic acids with polyvinylpyrrolidone and bovine serum albumi...

  15. Structural Basis for Ribosome Recruitment and Manipulation by a Viral IRES RNA

    Pfingsten, Jennifer S; Costantino, David A.; Kieft, Jeffrey S.

    2006-01-01

    Canonical cap-dependent translation initiation requires a large number of protein factors that act in a stepwise assembly process. In contrast, internal ribosomal entry sites (IRESs) are cis-acting RNAs that in some cases completely supplant these factors by recruiting and activating the ribosome using a single structured RNA. Here we present the crystal structures of the ribosome-binding domain from a Dicistroviridae intergenic region IRES at 3.1 angstrom resolution, providing a view of the ...

  16. Localization of ribosomal genes in three Pimelodus species (Siluriformes, Pimelodidae of the São Francisco River: 5S genes as species markers and conservation of the 18S rDNA sites

    Caroline Garcia

    2008-01-01

    Full Text Available Pimelodidae is one of the most representative of Neotropical catfish families. However, these fish are still poorly studied in terms of cytogenetics, especially regarding the application of more accurate techniques such as the chromosomal localization of ribosomal genes. In the present work, fluorescent in situ hybridization with 5S and 18S rDNA probes was employed for rDNA site mapping in Pimelodus sp., P. fur and P. maculatus from the São Francisco River in the Três Marias municipality - MG. The results from the application of the 18S probe confirmed the previous data obtained by silver nitrate staining, identifying a simple nucleolar organizing region system for these species. However, the labeling results from the 5S rDNA probe demonstrated a difference in the number and localization of these sites between the analyzed species. The obtained data allowed inferences on the possible processes involved in the karyotypic evolution of this genus.

  17. Localization of ribosomal genes in three Pimelodus species (Siluriformes, Pimelodidae) of the São Francisco River: 5S genes as species markers and conservation of the 18S rDNA sites

    Caroline Garcia; Orlando Moreira Filho

    2008-01-01

    Pimelodidae is one of the most representative of Neotropical catfish families. However, these fish are still poorly studied in terms of cytogenetics, especially regarding the application of more accurate techniques such as the chromosomal localization of ribosomal genes. In the present work, fluorescent in situ hybridization with 5S and 18S rDNA probes was employed for rDNA site mapping in Pimelodus sp., P. fur and P. maculatus from the São Francisco River in the Três Marias municipality - MG...

  18. Translation by polysome: theory of ribosome profile on a single mRNA transcript

    Sharma, Ajeet K

    2011-01-01

    The process of polymerizing a protein by a ribosome, using a messenger RNA (mRNA) as the corresponding template, is called {\\it translation}. Ribosome may be regarded as a molecular motor for which the mRNA template serves also as the track. Often several ribosomes may translate the same (mRNA) simultaneously. The ribosomes bound simultaneously to a single mRNA transcript are the members of a polyribosome (or, simply, {\\it polysome}). Experimentally measured {\\it polysome profile} gives the distribution of polysome {\\it sizes}. Recently a breakthrough in determining the instantaneous {\\it positions} of the ribosomes on a given mRNA track has been achieved and the technique is called {\\it ribosome profiling} \\cite{ingolia10,guo10}. Motivated by the success of these techniques, we have studied the spatio-temporal organization of ribosomes by extending a theoretical model that we have reported elsewhere \\cite{sharma11}. This extended version of our model incorporates not only (i) mechano-chemical cycle of indivi...

  19. “Silencing the ribosomal locus of Saccharomyces cerevisiae: role of RNA polymerase I transcription and chromatin acetylation”

    Cesarini, Elisa

    2011-01-01

    During my PhD I investigated the transcriptional silencing occurring at the ribosomal DNA of Saccharomyces cerevisiae. In yeast the ribosomal locus (rDNA) is transcribed with high efficiency by RNA polymerase I (Pol I) and III to synthetize ribosomal RNAs. It has been discovered that RNA polymerase Pol II (Pol II) can also transcribe the ribosomal locus, at low level, starting from cryptic promoters and generating non coding RNAs (ncRNAs). ncRNA transcription leads to genome...

  20. Localization of 18S ribosomal genes in suckermouth armoured catfishes Loricariidae (Teleostei, Siluriformes with discussion on the Ag-NOR evolution

    Anderson Alves

    2012-09-01

    Full Text Available The family Loricariidae with about 690 species divided into six subfamilies, is one of the world’s largest fish families. Cytogenetic studies conducted in the family showed that among 90 species analyzed the diploid number ranges from 2n=38 in Ancistrus sp. to 2n=96 in Hemipsilichthys gobio Luetken, 1874. In the present study, fluorescence in situ hybridization (FISH was employed to determine the chromosomal localization of the 18S rDNA gene in four suckermouth armoured catfishes: Kronichthys lacerta (Nichols, 1919, Pareiorhaphis splendens (Bizerril, 1995, Liposarcus multiradiatus (Hancock, 1828 and Hypostomus prope plecostomus (Linnaeus, 1758. All species analyzed showed one chromosome pair with 18S rDNA sequences, as observed in the previous Ag-NORs analyses. The presence of size and numerical polymorphism was observed and discussed, with proposing a hypothesis of the Ag-NOR evolution in Loricariidae.

  1. Modeling of ribosome dynamics on a ds-mRNA under an external load

    Shakiba, Bahareh; Dayeri, Maryam; Mohammad-Rafiee, Farshid

    2016-07-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to the recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force and the translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  2. Modeling of Ribosome Dynamics on a ds-mRNA under an External Load

    Shakiba, Bahareh; Mohammad-Rafiee, Farshid

    2016-01-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force, and translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  3. Translation Initiation is Controlled by RNA Folding Kinetics via a Ribosome Drafting Mechanism.

    Espah Borujeni, Amin; Salis, Howard M

    2016-06-01

    RNA folding plays an important role in controlling protein synthesis as well as other cellular processes. Existing models have focused on how RNA folding energetics control translation initiation rate under equilibrium conditions but have largely ignored the effects of nonequilibrium RNA folding. We introduce a new mechanism, called "ribosome drafting", that explains how a mRNA's folding kinetics and the ribosome's binding rate collectively control its translation initiation rate. During cycles of translation, ribosome drafting emerges whenever successive ribosomes bind to a mRNA faster than the mRNA can refold, maintaining it in a nonequilibrium state with an acceleration of protein synthesis. Using computational design, time-correlated single photon counting, and expression measurements, we demonstrate that slow-folding and fast-folding RNA structures with equivalent folding energetics can vary protein synthesis rates by 1000-fold. We determine the necessary conditions for ribosome drafting by characterizing mRNAs with rationally designed ribosome binding rates, folding kinetics, and folding energetics, confirming the predictions of a nonequilibrium Markov model of translation. Our results have widespread implications, illustrating how competitive folding and assembly kinetics can shape the gene expression machinery's sequence-structure-function relationship inside cells. PMID:27199273

  4. Ribosome collisions and Translation efficiency: Optimization by codon usage and mRNA destabilization

    Mitarai, Namiko; Sneppen, Kim; Pedersen, Steen

    2008-01-01

    collisions and queues are inevitable consequences of a stochastic translation mechanism that reduce the translation efficiency substantially on natural mRNAs. The cells minimize collisions by having its mRNAs being unstable and by a highly selected codon usage in the start of the mRNA. The cost of m......Individual mRNAs are translated by multiple ribosomes that initiate translation with an interval of a few seconds. The ribosome speed is codon dependent, and ribosome queuing has been suggested to explain specific data for translation of some mRNAs in vivo. By modeling the stochastic translation...... process as a traffic problem, we here analyze conditions and consequences of collisions and queuing. The model allowed us to determine the on-rate (0.8 to 1.1 initiations/s) and the time (1 s) the preceding ribosome occludes initiation for Escherichia coli lacZ mRNA in vivo. We find that ribosome...

  5. Transcription-independent role for human mitochondrial RNA polymerase in mitochondrial ribosome biogenesis

    Surovtseva, Yulia V; Shadel, Gerald S.

    2013-01-01

    Human mitochondrial RNA polymerase, POLRMT, is required for mitochondrial DNA (mtDNA) transcription and forms initiation complexes with human mitochondrial transcription factor B2 (h-mtTFB2). However, POLRMT also interacts with the paralogue of h-mtTFB2, h-mtTFB1, which is a 12S ribosomal RNA methyltransferase required for small (28S) mitochondrial ribosome subunit assembly. Herein, we show that POLRMT associates with h-mtTFB1 in 28S mitochondrial ribosome complexes that are stable in the abs...

  6. Hyperaccurate and error-prone ribosomes exploit distinct mechanisms during tRNA selection

    Zaher, Hani S.; Green, Rachel

    2010-01-01

    Escherichia coli strains displaying hyper-accurate (restrictive) and ribosomal ambiguity (ram) phenotypes have long been associated with alterations in rpsL and rpsD/rpsE, respectively. Crystallographic evidence shows the ribosomal proteins S12 and S4/S5 (corresponding to these genes) to be located in separate regions of the small ribosomal subunit that are important for domain-closure thought to take place during tRNA selection. Mechanistically, the process of tRNA selection is separated int...

  7. Fungal community analysis in the deep-sea sediments of the Pacific Ocean assessed by comparison of ITS, 18S and 28S ribosomal DNA regions

    Xu, Wei; Luo, Zhu-Hua; Guo, Shuangshuang; Pang, Ka-Lai

    2016-03-01

    We investigated the diversity of fungal communities in 6 different deep-sea sediment samples of the Pacific Ocean based on three different types of clone libraries, including internal transcribed spacer (ITS), 18S rDNA, and 28S rDNA regions. A total of 1978 clones were generated from 18 environmental clone libraries, resulting in 140 fungal operational taxonomic units (OTUs), including 18 OTUs from ITS, 44 OTUs from 18S rDNA, and 78 OTUs from 28S rDNA gene primer sets. The majority of the recovered sequences belonged to diverse phylotypes of the Ascomycota and Basidiomycota. Additionally, our study revealed a total of 46 novel fungal phylotypes, which showed low similarities (<97%) with available fungal sequences in the GenBank, including a novel Zygomycete lineage, suggesting possible new fungal taxa occurring in the deep-sea sediments. The results suggested that 28S rDNA is an efficient target gene to describe fungal community in deep-sea environment.

  8. Yeast 18 S rRNA Is Directly Involved in the Ribosomal Response to Stringent AUG Selection during Translation Initiation

    Nemoto, N.; Singh, Ch. R.; Udagawa, T.; Wang, S.; Thorson, E.; Winter, Z.; Ohira, T.; Li, M.; Valášek, Leoš; Brown, S. J.; Asano, K.

    2010-01-01

    Roč. 285, č. 42 (2010), s. 32200-32212. ISSN 0021-9258 Institutional research plan: CEZ:AV0Z50200510 Keywords : START CODON SELECTION * SACCHAROMYCES - CEREVISIAE * IN-VIVO Subject RIV: EE - Microbiology, Virology Impact factor: 5.328, year: 2010

  9. Multiplex RT-PCR detection of Cucumber mosaic virus subgroups and Tobamoviruses infecting Tomato using 18S rRNA as an internal control

    Shaoning Chen; Hao Gu; Xiaoming Wang; Jishuang Chen; Weimin Zhu

    2011-01-01

    A multiplex reverse-transcription polymerase chain reaction (RT-PCR) protocol was developed for simultaneous detection and discrimination of subgroups of Cucumber mosaic virus (CMV), including its satellite RNA, Tomato mosaic virus (ToMV) and Tobacco mosaic virus (TMV),using 18S rRNA as an internal control.Species- and subgroups-specific primers designed to differentiate CMV subgroups Ⅰ and Ⅱ, ToMV and TMV, were assessed using the cDNA clones of viral genomes, CMV satellite RNA and 18S rRNA gene from tomato (Solanum lycopersicum L.) or tobacco (Nicotiana tobacum).Using total RNA extracted from artificial mixture of tomato leaf tissues infected by each virus, the reaction components and cycling parmeters were optimized and a multiplex RT-PCR procedure was established.Six fragments of 704, 593, 512, 421,385, 255 bp, specific to CMV subgroup ll, CMV subgroup I, ToMV, TMV, satellite RNA and 18S rRNA, respectively, were sinultaneously amplified.The sensitivity of the multiplex RT-PCR method for detecting CMV was 100 times higher than that of double-antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA).This method was successfully used for field detection.Among 141 samples collected from East China through tomato growth seasons, 106 single infections with one of the above isolates were detected and 13 mixed infections were found.The results showed the potential use of this method for investigating the epidemiology of viral diseases infecting tomato.

  10. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  11. RNA-DNA differences in human mitochondria restore ancestral form of 16S ribosomal RNA.

    Bar-Yaacov, Dan; Avital, Gal; Levin, Liron; Richards, Allison L; Hachen, Naomi; Rebolledo Jaramillo, Boris; Nekrutenko, Anton; Zarivach, Raz; Mishmar, Dan

    2013-11-01

    RNA transcripts are generally identical to the underlying DNA sequences. Nevertheless, RNA-DNA differences (RDDs) were found in the nuclear human genome and in plants and animals but not in human mitochondria. Here, by deep sequencing of human mitochondrial DNA (mtDNA) and RNA, we identified three RDD sites at mtDNA positions 295 (C-to-U), 13710 (A-to-U, A-to-G), and 2617 (A-to-U, A-to-G). Position 2617, within the 16S rRNA, harbored the most prevalent RDDs (>30% A-to-U and ∼15% A-to-G of the reads in all tested samples). The 2617 RDDs appeared already at the precursor polycistrone mitochondrial transcript. By using traditional Sanger sequencing, we identified the A-to-U RDD in six different cell lines and representative primates (Gorilla gorilla, Pongo pigmaeus, and Macaca mulatta), suggesting conservation of the mechanism generating such RDD. Phylogenetic analysis of more than 1700 vertebrate mtDNA sequences supported a thymine as the primate ancestral allele at position 2617, suggesting that the 2617 RDD recapitulates the ancestral 16S rRNA. Modeling U or G (the RDDs) at position 2617 stabilized the large ribosomal subunit structure in contrast to destabilization by an A (the pre-RDDs). Hence, these mitochondrial RDDs are likely functional. PMID:23913925

  12. Genetic variation and identification of cultivated Fallopia multiflora and its wild relatives by using chloroplast matK and 18S rRNA gene sequences.

    Yan, Ping; Pang, Qi-Hua; Jiao, Xu-Wen; Zhao, Xuan; Shen, Yan-Jing; Zhao, Shu-Jin

    2008-10-01

    FALLOPIA MULTIFLORA (Thunb.) Harald . has been widely and discriminatingly used in China for the study and treatment of anemia, swirl, deobstruent, pyrosis, insomnia, amnesia, atheroma and also for regulating immune functions. However, there is still confusion about the herbal drug's botanical origins and the phylogenetic relationship between the cultivars and the wild relatives. In order to develop an efficient method for identification, a molecular analysis was performed based on 18 S rRNA gene and partial MATK gene sequences. The 18 S rRNA gene sequences of F. MULTIFLORA were 1809 bp in length and were highly conserved, indicating that the cultivars and the wild F. MULTIFLORA have the same botanical origin. Based on our 18 S rRNA gene sequences analysis, F. MULTIFLORA could be easily distinguished at the DNA level from adulterants and some herbs with similar components. The MATK gene partial sequences were found to span 1271 bp. The phylogenetic relation of F. MULTIFLORA based on the MATK gene showed that all samples in this paper were divided into four clades. The sequences of the partial MATK gene had many permutations, which were related to the geographical distributions of the samples. MATK gene sequences provided valuable information for the identification of F. MULTIFLORA. New taxonomic information could be obtained to authenticate the botanical origin of the F. MULTIFLORA, the species and the medicines made of it. PMID:18759218

  13. Phylogenetic position of the yeast-like symbiotes of Tagosodes orizicolus (Homoptera: Delphacidae) based on 18S ribosomal DNA partial sequences.

    Xet-Mull, Ana M; Quesada, Tania; Espinoza, Ana M

    2004-09-01

    Tagosodes orizicolus Muir (Homoptera: Delphacidae), the endemic delphacid species of tropical America carries yeast-like symbiotes (YLS) in the abdominal fat bodies and the ovarial tissues, like other rice planthoppers of Asia. These YLS are obligate symbiotes, which are transmitted transovarially, and maintain a mutualistic relationship with the insect host. This characteristic has made in vitro culture and classification of YLS rather difficult using conventional methods. Nevertheless, microorganisms of similar characteristics have been successfully classified by using molecular taxonomy. In the present work, the YLS of Tagosodes orizicolus (YLSTo) were purified on Percoll gradients, and specific segments of 18S rDNA were amplified by PCR, cloned and sequenced. Sequences were aligned by means of the CLUSTAL V (DNASTAR) program; phylogenetic trees were constructed with the Phylogeny Inference Package (PHYLIP), showing that YLSTo belong to the fungi class Pyrenomycetes, phylum Ascomycota. Similarities between 98% and 100% were observed among YLS of the rice delphacids Tagosodes orizicolus, Nilaparvata lugens, Laodelphax striatellus and Sogatella fur cifera, and between 89.8% and 90.8% when comparing the above to YLS of the aphid Hamiltonaphis styraci. These comparisons revealed that delphacid YLS are a highly conserved monophyletic group within the Pyrenomycetes and are closely related to Hypomyces chrysospermus. PMID:17361570

  14. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A; Gwerder, Myriam; Gutsche, Katrin; Altmeyer, Matthias; Jungmichel, Stephanie; Toledo Lazaro, Luis Ignacio; Fink, Daniel; Rask, Maj-Britt; Grøfte, Merete; Lukas, Claudia; Nielsen, Michael L; Smerdon, Stephen J; Lukas, Jiri; Stucki, Manuel

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient recrui...

  15. Ribosome-associated Asc1/RACK1 is required for endonucleolytic cleavage induced by stalled ribosome at the 3′ end of nonstop mRNA

    Ikeuchi, Ken; Inada, Toshifumi

    2016-01-01

    Dom34-Hbs1 stimulates degradation of aberrant mRNAs lacking termination codons by dissociating ribosomes stalled at the 3′ ends, and plays crucial roles in Nonstop Decay (NSD) and No-Go Decay (NGD). In the dom34Δ mutant, nonstop mRNA is degraded by sequential endonucleolytic cleavages induced by a stalled ribosome at the 3′ end. Here, we report that ribosome-associated Asc1/RACK1 is required for the endonucleolytic cleavage of nonstop mRNA by stalled ribosome at the 3′ end of mRNA in dom34Δ mutant cells. Asc1/RACK1 facilitates degradation of truncated GFP-Rz mRNA in the absence of Dom34 and exosome-dependent decay. Asc1/RACK1 is required for the sequential endonucleolytic cleavages by the stalled ribosome in the dom34Δ mutant, depending on its ribosome-binding activity. The levels of peptidyl-tRNA derived from nonstop mRNA were elevated in dom34Δasc1Δ mutant cells, and overproduction of nonstop mRNA inhibited growth of mutant cells. E3 ubiquitin ligase Ltn1 degrades the arrest products from truncated GFP-Rz mRNA in dom34Δ and dom34Δasc1Δ mutant cells, and Asc1/RACK1 represses the levels of substrates for Ltn1-dependent degradation. These indicate that ribosome-associated Asc1/RACK1 facilitates endonucleolytic cleavage of nonstop mRNA by stalled ribosomes and represses the levels of aberrant products even in the absence of Dom34. We propose that Asc1/RACK1 acts as a fail-safe in quality control for nonstop mRNA. PMID:27312062

  16. Disruption of ribosome assembly in yeast blocks cotranscriptional pre-rRNA processing and affects the global hierarchy of ribosome biogenesis.

    Talkish, Jason; Biedka, Stephanie; Jakovljevic, Jelena; Zhang, Jingyu; Tang, Lan; Strahler, John R; Andrews, Philip C; Maddock, Janine R; Woolford, John L

    2016-06-01

    In higher eukaryotes, pre-rRNA processing occurs almost exclusively post-transcriptionally. This is not the case in rapidly dividing yeast, as the majority of nascent pre-rRNAs are processed cotranscriptionally, with cleavage at the A2 site first releasing a pre-40S ribosomal subunit followed by release of a pre-60S ribosomal subunit upon transcription termination. Ribosome assembly is driven in part by hierarchical association of assembly factors and r-proteins. Groups of proteins are thought to associate with pre-ribosomes cotranscriptionally during early assembly steps, whereas others associate later, after transcription is completed. Here we describe a previously uncharacterized phenotype observed upon disruption of ribosome assembly, in which normally late-binding proteins associate earlier, with pre-ribosomes containing 35S pre-rRNA. As previously observed by many other groups, we show that disruption of 60S subunit biogenesis results in increased amounts of 35S pre-rRNA, suggesting that a greater fraction of pre-rRNAs are processed post-transcriptionally. Surprisingly, we found that early pre-ribosomes containing 35S pre-rRNA also contain proteins previously thought to only associate with pre-ribosomes after early pre-rRNA processing steps have separated maturation of the two subunits. We believe the shift to post-transcriptional processing is ultimately due to decreased cellular division upon disruption of ribosome assembly. When cells are grown under stress or to high density, a greater fraction of pre-rRNAs are processed post-transcriptionally and follow an alternative processing pathway. Together, these results affirm the principle that ribosome assembly occurs through different, parallel assembly pathways and suggest that there is a kinetic foot-race between the formation of protein binding sites and pre-rRNA processing events. PMID:27036125

  17. Utility of 18S rDNA and ITS sequences as population markers for Lepeophtheirus salmonis (Copepoda: Caligidae) parasitising Atlantic salmon (Salmo salar) in Scotland

    Shinn, A.P.; Banks, B.A.; Tange, N.; Bron, J.E.; Sommerville, C.; Aoki, T.; Wootten, R.

    2000-01-01

    Genetic differentiation within the salmon louse Lepeophtheirus salmonis (Krøyer, 1837), was investigated by the sequencing of specific nucleotide regions. Partial sequences of the 18S ribosomal RNA gene and the ribosomal internal transcribed spacer (ITS-1) region from single sea lice were amplified

  18. Accommodation of tmRNA-SmpB into stalled ribosomes: a cryo-EM study.

    Weis, Felix; Bron, Patrick; Rolland, Jean-Paul; Thomas, Daniel; Felden, Brice; Gillet, Reynald

    2010-02-01

    In eubacteria, translation of defective messenger RNAs (mRNAs) produces truncated polypeptides that stall on the ribosome. A quality control mechanism referred to as trans-translation is performed by transfer-messenger RNA (tmRNA), a specialized RNA acting as both a tRNA and an mRNA, associated with small protein B (SmpB). So far, a clear view of the structural movements of both the protein and RNA necessary to perform accommodation is still lacking. By using a construct containing the tRNA-like domain as well as the extended helix H2 of tmRNA, we present a cryo-electron microscopy study of the process of accommodation. The structure suggests how tmRNA and SmpB move into the ribosome decoding site after the release of EF-Tu.GDP. While two SmpB molecules are bound per ribosome in a preaccommodated state, our results show that during accommodation the SmpB protein interacting with the small subunit decoding site stays in place while the one interacting with the large subunit moves away. Relative to canonical translation, an additional movement is observed due to the rotation of H2. This suggests that the larger movement required to resume translation on a tmRNA internal open reading frame starts during accommodation. PMID:20038631

  19. Research Techniques Made Simple: Bacterial 16S Ribosomal RNA Gene Sequencing in Cutaneous Research.

    Jo, Jay-Hyun; Kennedy, Elizabeth A; Kong, Heidi H

    2016-03-01

    Skin serves as a protective barrier and also harbors numerous microorganisms collectively comprising the skin microbiome. As a result of recent advances in sequencing (next-generation sequencing), our understanding of microbial communities on skin has advanced substantially. In particular, the 16S ribosomal RNA gene sequencing technique has played an important role in efforts to identify the global communities of bacteria in healthy individuals and patients with various disorders in multiple topographical regions over the skin surface. Here, we describe basic principles, study design, and a workflow of 16S ribosomal RNA gene sequencing methodology, primarily for investigators who are not familiar with this approach. This article will also discuss some applications and challenges of 16S ribosomal RNA sequencing as well as directions for future development. PMID:26902128

  20. Mutations in the leader region of ribosomal RNA operons cause structurally defective 30 S ribosomes as revealed by in vivo structural probing.

    Balzer, M; Wagner, R

    1998-02-27

    The biogenesis of functional ribosomes is regulated in a very complex manner, involving different proteins and RNA molecules. RNAs are not only essential components of both ribosomal subunits but also transiently interacting factors during particle formation. In eukaryotes snoRNAs act as molecular chaperones to assist maturation, modification and assembly. In a very similar way highly conserved leader sequences of bacterial rRNA operons are involved in the correct formation of 30 S ribosomal subunits. Certain mutations in the rRNA leader region cause severe growth defects due to malfunction of ribosomes which are assembled from such transcription units. To understand how the leader sequences act to facilitate the formation of the correct 30 S subunits we performed in vivo chemical probing to assess structural differences between ribosomes assembled either from rRNA transcribed from wild-type operons or from operons which contain mutations in the rRNA leader region. Cells transformed with plasmids containing the respective rRNA operons were reacted with dimethylsulphate (DMS). Ribosomes were isolated by sucrose gradient centrifugation and modified nucleotides within the 16 S rRNA were identified by primer extension reaction. Structural differences between ribosomes from wild-type and mutant rRNA operons occur in several clusters within the 16 S rRNA secondary structure. The most prominent differences are located in the central domain including the universally conserved pseudoknot structure which connects the 5', the central and the 3' domain of 16 S rRNA. Two other clusters with structural differences fall in the 5' domain where the leader had been shown to interact with mature 16 S rRNA and within the ribosomal protein S4 binding site. The other differences in structure are located in sites which are also known as sites for the action of several antibiotics. The data explain the functional defects of ribosomes from rRNA operons with leader mutations and help to

  1. A Long Noncoding RNA on the Ribosome Is Required for Lifespan Extension

    Paul B. Essers

    2015-01-01

    Full Text Available The biogenesis of ribosomes and their coordination of protein translation consume an enormous amount of cellular energy. As such, it has been established that the inhibition of either process can extend eukaryotic lifespan. Here, we used next-generation sequencing to compare ribosome-associated RNAs from normal strains of Caenorhabditis elegans to those carrying the life-extending daf-2 mutation. We found a long noncoding RNA (lncRNA, transcribed telomeric sequence 1 (tts-1, on ribosomes of the daf-2 mutant. Depleting tts-1 in daf-2 mutants increases ribosome levels and significantly shortens their extended lifespan. We find tts-1 is also required for the longer lifespan of the mitochondrial clk-1 mutants but not the feeding-defective eat-2 mutants. In line with this, the clk-1 mutants express more tts-1 and fewer ribosomes than the eat-2 mutants. Our results suggest that the expression of tts-1 functions in different longevity pathways to reduce ribosome levels in a way that promotes life extension.

  2. Development of 18S rRNA-targeted oligonucleotide probes for specific detection of Hartmannella and Naegleria in Legionella-positive environmental samples.

    Grimm, D; Ludwig, W F; Brandt, B C; Michel, R; Schleifer, K H; Hacker, J; Steinert, M

    2001-04-01

    Aquatic protozoa are natural hosts of the human pathogen Legionella pneumophila. The fluorescence labeled 16S rRNA-targeted oligonucleotide probe LEGPNE1 has recently been shown to specifically detect extracellular legionellae as well as intracellular legionellae parasitizing protozoa. In this study we designed oligonucleotide probes which are complementary to distinct regions of the 18S rRNA of the Legionella host organisms of the genera Hartmannella and Naegleria. The specificity of the probes, HART498 and NAEG1088, was tested by in situ hybridization of various laboratory reference strains. In order to evaluate the fluorescent probes for environmental studies three selected Legionella-positive cold water habitats were examined for the presence of these protozoa. Traditional culture methods followed by morphological identification revealed an almost consistent presence of Naegleria spp. in cold water habitats. Other protozoa species including Acanthamoeba spp., Echinamoeba spp., Hartmannella spp., Platyamoeba placida, Saccamoeba spp., Thecamoeba quadrilineata, and Vexillifera spp. were found sporadically. Concomitant analysis of the pH, conductivity and temperature of the water samples revealed no preference of Legionella or the respective protozoa for certain environmental conditions. The specificity of the newly designed 18S rRNA probes demonstrates that they are valuable and rapid tools for the identification of culturable environmental protozoa. PMID:11403402

  3. Cultivation-independent analysis reveals a shift in ciliate 18S rRNA gene diversity in a polycyclic aromatic hydrocarbon-polluted soil

    Lara, Enrique; Berney, Cédric; Harms, Hauke; Chatzinotas, Antonis

    2010-01-01

    Using cultivation-independent methods the ciliate communities of a clay-rich soil with a 90-year record of pollution by polycyclic aromatic hydrocarbons (PAH) (4.5 g kg−1 PAH) were compared with that of a nonpolluted soil collected in its vicinity and with similar properties. A ciliate-specific set of 18S rRNA gene targeting primers was designed and used to amplify DNA extracted from both soils (surface and 20 cm depth). Four clone libraries were generated with PCR products that covered an 18...

  4. Impact of P-Site tRNA and antibiotics on ribosome mediated protein folding: studies using the Escherichia coli ribosome.

    Surojit Mondal

    Full Text Available BACKGROUND: The ribosome, which acts as a platform for mRNA encoded polypeptide synthesis, is also capable of assisting in folding of polypeptide chains. The peptidyl transferase center (PTC that catalyzes peptide bond formation resides in the domain V of the 23S rRNA of the bacterial ribosome. Proper positioning of the 3' -CCA ends of the A- and P-site tRNAs via specific interactions with the nucleotides of the PTC are crucial for peptidyl transferase activity. This RNA domain is also the center for ribosomal chaperoning activity. The unfolded polypeptide chains interact with the specific nucleotides of the PTC and are released in a folding competent form. In vitro transcribed RNA corresponding to this domain (bDV RNA also displays chaperoning activity. RESULTS: The present study explores the effects of tRNAs, antibiotics that are A- and P-site PTC substrate analogs (puromycin and blasticidin and macrolide antibiotics (erythromycin and josamycin on the chaperoning ability of the E. coli ribosome and bDV RNA. Our studies using mRNA programmed ribosomes show that a tRNA positioned at the P-site effectively inhibits the ribosome's chaperoning function. We also show that the antibiotic blasticidin (that mimics the interaction between 3'-CCA end of P/P-site tRNA with the PTC is more effective in inhibiting ribosome and bDV RNA chaperoning ability than either puromycin or the macrolide antibiotics. Mutational studies of the bDV RNA could identify the nucleotides U2585 and G2252 (both of which interact with P-site tRNA to be important for its chaperoning ability. CONCLUSION: Both protein synthesis and their proper folding are crucial for maintenance of a functional cellular proteome. The PTC of the ribosome is attributed with both these abilities. The silencing of the chaperoning ability of the ribosome in the presence of P-site bound tRNA might be a way to segregate these two important functions.

  5. Early life stress inhibits expression of ribosomal RNA in the developing hippocampus.

    Lan Wei

    Full Text Available Children that are exposed to abuse or neglect show abnormal hippocampal function. However, the developmental mechanisms by which early life stress (ELS impairs normal hippocampal development have not been elucidated. Here we propose that exposure to ELS blunts normal hippocampal growth by inhibiting the availability of ribosomal RNA (rRNA. In support of this hypothesis, we show that the normal mouse hippocampus undergoes a growth-spurt during the second week of life, followed by a gradual decrease in DNA and RNA content that persists into adulthood. This developmental pattern is associated with accelerated ribosomal RNA (rRNA synthesis during the second week of life, followed by a gradual decline in rRNA levels that continue into adulthood. Levels of DNA methylation at the ribosomal DNA (rDNA promoter are lower during the second week of life compared to earlier development or adulthood. Exposure to brief daily separation (BDS, a mouse model of early life stress, increased DNA methylation at the ribosomal DNA promoter, decreased rRNA levels, and blunted hippocampal growth during the second week of life. Exposure to acute (3 hrs maternal separation decreased rRNA and increased DNA methylation at the rDNA proximal promoter, suggesting that exposure to stress early in life can rapidly regulate the availability of rRNA levels in the developing hippocampus. Given the critical role that rRNA plays in supporting normal growth and development, these findings suggest a novel molecular mechanism to explain how stress early in life impairs hippocampus development in the mouse.

  6. Ribosome collisions and translation efficiency: optimization by codon usage and mRNA destabilization.

    Mitarai, Namiko; Sneppen, Kim; Pedersen, Steen

    2008-09-26

    Individual mRNAs are translated by multiple ribosomes that initiate translation with an interval of a few seconds. The ribosome speed is codon dependent, and ribosome queuing has been suggested to explain specific data for translation of some mRNAs in vivo. By modeling the stochastic translation process as a traffic problem, we here analyze conditions and consequences of collisions and queuing. The model allowed us to determine the on-rate (0.8 to 1.1 initiations/s) and the time (1 s) the preceding ribosome occludes initiation for Escherichia coli lacZ mRNA in vivo. We find that ribosome collisions and queues are inevitable consequences of a stochastic translation mechanism that reduce the translation efficiency substantially on natural mRNAs. The cells minimize collisions by having its mRNAs being unstable and by a highly selected codon usage in the start of the mRNA. The cost of mRNA breakdown is offset by the concomitant increase in translation efficiency. PMID:18619977

  7. Identification of the methyltransferase targeting C2499 in Deinococcus radiodurans 23S ribosomal RNA

    Nielsen, Julie Mundus; Flyvbjerg, Karen Freund; Kirpekar, Finn

    2016-01-01

    The bacterium Deinococcus radiodurans-like all other organisms-introduces nucleotide modifications into its ribosomal RNA. We have previously found that the bacterium contains a Carbon-5 methylation on cytidine 2499 of its 23S ribosomal RNA, which is so far the only modified version of cytidine 2...

  8. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Michelle S Lewis

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  9. Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli 23S ribosomal RNA

    Douthwaite, S

    1992-01-01

    Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli ribosomes has been compared by chemical footprinting. The protection afforded by both drugs is limited to the peptidyl transferase loop of 23S rRNA. Under conditions of stoichiometric binding at 1 mM drug concentration...... in vitro, both drugs strongly protect 23S rRNA bases A2058 and A2451 from dimethyl sulphate and G2505 from kethoxal modification; G2061 is also weakly protected from kethoxal. The modification patterns differ in that A2059 is additionally protected by clindamycin but not by lincomycin. The affinity...... of the two drugs for the ribosome, estimated by footprinting, is approximately the same, giving Kdiss values of 5 microM for lincomycin and 8 microM for clindamycin. The results show that in vitro the drugs are equally potent in blocking their ribosomal target site. Their inhibitory effects on...

  10. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  11. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling

    Jones, Joshua D.; Chung, Betty Y.-W.; Siddell, Stuart G.; Brierley, Ian

    2016-01-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global “snap-shot” of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  12. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  13. 罗氏沼虾18S rRNA基因生物素标记探针的制备及应用%Preparation and application of the biotin-labeled probe of 18S rRNA gene in Macrobrachium rosenbergii

    高风英; 叶星; 白俊杰; 吴锐全; 劳海华; 简清; 罗建仁

    2005-01-01

    Probes are essential for study of gene expression and regulation. In this study, a method was established to prepare the biotin-labeled probe for 18S rRNA gene of freshwater prawn, Macrobrachium rosenbergii. And the labeled method was used to produce a lysozyme gene probe, then applied in analysis of lysozyme gene expression. Primers were designed according to the nucleotide sequences of 18S rRNA of Decalxxta in order to isolate the 18S rRNA gene sequences of M. rosenbergii. Total genomic DNA was isolated from hepatopancreas of the freshwater prawn. A specific DNA fragment with desired size was amplified by PCR using the total DNA as templates. The DNA fragment was inserted into pGEM-T Easy vector and sequenced. The result of BLAST and alignment analysis confirmed that the DNA fragment isolated was the 18S rRNA gene of M. rosenbergii, which was 418 nt in length.Biotin-labeled probe of the 18S rRNA was then produced by PCR using the recombinant plasmid as templates. The biotin-21-dTTP and the non-labeled dNTP were added to the PCR reaction system. Ratio of the biotin-21-dTTP and the non-labeled dTFP was 3 to 1.The yield of the labeled probe is 300 ng·μL-1. The detection limit of the probe is 60 pg. A biotin-labeled probe of lysozyme gene was prepared by the same label method, and the yield of the lysozyme gene probe is 500 ng·μL-1. These biotin-labeled probes were applied in Northern dot blotting analysis of tissue distribution of lysoyzme mRNA of M. rosenbergii. Signals were scanned and quantified by Analysis System of Biology Image. The signal intensity ratio of the lysozyme to 18S rRNA represents the relative expression level of lysozyme mRNA. The results showed that the lysozyme mRNA existed in all the tissues checked, including eye,muscle, gill, hepatopancreas, haemocytes and intestine. But lysoyzme mRNA levels varied among different tissues. The highest level was found in the intestine, and the second was in the hepatopancreas and the lowest was in the

  14. Molecular analysis of 18S rRNA gene of Cryptosporidium parasites from patients living in Iran, Malawi, Nigeria and Vietnam.

    Ghaffari, Salman; Kalantari, Narges

    2012-01-01

    Cryptosporidium species are one of the most common causes of gastrointestinal infection in humans around the world. This study has aimed to investigate the hyper variable region of the 18S rRNA gene in Cryptosporidium for exact parasite identification. DNA was extracted from 26 fecal samples from which initially Cryptosporidium oocysts were identified by Ziehl-Neelsen acid-fast , Auramine phenol and ELISA techniques. Nested PCR, targeting the most polymorphic region of the 18S rRNA gene and genotyping was performed by restriction endonuclease digestion of the PCR product followed by nucleotide sequencing and phylogenic analysis. Among 26 isolates analyzed, three species of Cryptosporidium were identified; 38.5% of the isolates were C. hominis while 53.8% of the isolates were C. parvum and 7.7% of the isolates were C. meleagridis, which the last two species have the potentially zoonotic transmission. The only 11T subtype of C. hominis was demonstrated. These strains clustered distinctly into either human or animal origin regardless of the geographical origin, age, or immunity status of the patients. In summary, this work is the first report of C. meleagridis infecting human in Iran. Moreover, it suggested that multi-locus study of Cryptosporidium species in developing countries would be necessary to determine the extent of transmission of cryptosporidiosis in the populations. PMID:24551771

  15. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Hori, H.; Osawa, S; Murao, K.; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.

  16. An unusual mechanism for EF-Tu activation during tmRNA-mediated ribosome rescue

    Miller, Mickey R; Buskirk, Allen R.

    2014-01-01

    When ribosomes are stalled on truncated mRNAs in prokaryotes, they are rescued by the tmRNA/SmpB complex. It has been unclear how EF-Tu is activated by this complex. This manuscript analyzes this problem, and the results indicate that the normal EF-Tu GTPase cycle does not appear to apply in this specialized situation.

  17. Intragenomic sequence variation at the ITS1 - ITS2 region and at the 18S and 28S nuclear ribosomal DNA genes of the New Zealand mud snail, Potamopyrgus antipodarum (Hydrobiidae: mollusca)

    Hoy, Marshal S.; Rodriguez, Rusty J.

    2013-01-01

    Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.                   

  18. The human insulin receptor mRNA contains a functional internal ribosome entry segment

    Spriggs, Keith A.; Cobbold, Laura C.; Ridley, Simon H.; Coldwell, Mark; Bottley, Andrew; Bushell, Martin; Willis, Anne E.; Siddle, Kenneth

    2009-01-01

    Regulation of mRNA translation is an important mechanism determining the level of expression of proteins in eukaryotic cells. Translation is most commonly initiated by cap-dependent scanning, but many eukaryotic mRNAs contain internal ribosome entry segments (IRESs), providing an alternative means of initiation capable of independent regulation. Here, we show by using dicistronic luciferase reporter vectors that the 5'-UTR of the mRNA encoding human insulin receptor (hIR) contains a functiona...

  19. Competing pathways control host resistance to virus via tRNA modification and programmed ribosomal frameshifting

    Maynard, Nathaniel D.; Macklin, Derek N.; Kirkegaard, Karla; Covert, Markus W

    2012-01-01

    Viral infection depends on a complex interplay between host and viral factors. Here, we link host susceptibility to viral infection to a network encompassing sulfur metabolism, tRNA modification, competitive binding, and programmed ribosomal frameshifting (PRF). We first demonstrate that the iron-sulfur cluster biosynthesis pathway in Escherichia coli exerts a protective effect during lambda phage infection, while a tRNA thiolation pathway enhances viral infection. We show that tRNALys uridin...

  20. RNA structure-based ribosome recruitment: Lessons from the Dicistroviridae intergenic region IRESes

    Pfingsten, Jennifer S; Kieft, Jeffrey S.

    2008-01-01

    In eukaryotes, the canonical process of initiating protein synthesis on an mRNA depends on many large protein factors and the modified nucleotide cap on the 5′ end of the mRNA. However, certain RNA sequences can bypass the need for these proteins and cap, using an RNA structure-based mechanism called internal initiation of translation. These RNAs are called internal ribosome entry sites (IRESes), and the cap-independent initiation pathway they support is critical for successful infection by m...

  1. An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5 ' UTRs and its implications for eukaryotic gene translation regulation

    Pánek, Josef; Kolář, Michal; Vohradský, Jiří; Valášek, Leoš

    2013-01-01

    Roč. 41, č. 16 (2013), s. 7625-7634. ISSN 0305-1048 R&D Projects: GA ČR(CZ) GBP305/12/G034 Institutional support: RVO:61388971 ; RVO:68378050 Keywords : 80S RIBOSOME * UNTRANSLATED REGION * ANGSTROM RESOLUTION Subject RIV: CE - Biochemistry Impact factor: 8.808, year: 2013

  2. RNA structure-based ribosome recruitment: lessons from the Dicistroviridae intergenic region IRESes.

    Pfingsten, Jennifer S; Kieft, Jeffrey S

    2008-07-01

    In eukaryotes, the canonical process of initiating protein synthesis on an mRNA depends on many large protein factors and the modified nucleotide cap on the 5' end of the mRNA. However, certain RNA sequences can bypass the need for these proteins and cap, using an RNA structure-based mechanism called internal initiation of translation. These RNAs are called internal ribosome entry sites (IRESes), and the cap-independent initiation pathway they support is critical for successful infection by many viruses of medical and economic importance. In this review, we briefly describe and compare mechanistic and structural groups of viral IRES RNAs, focusing on those IRESes that are capable of direct ribosome recruitment using specific RNA structures. We then discuss in greater detail some recent advances in our understanding of the intergenic region IRESes of the Dicistroviridae, which use the most streamlined ribosome-recruitment mechanism yet discovered. By combining these findings with knowledge of canonical translation and the behavior of other IRESes, mechanistic models of this RNA structure-based process are emerging. PMID:18515544

  3. Can we estimate bacterial growth rates from ribosomal RNA content?

    Kemp, P.F.

    1995-12-31

    Several studies have demonstrated a strong relationship between the quantity of RNA in bacterial cells and their growth rate under laboratory conditions. It may be possible to use this relationship to provide information on the activity of natural bacterial communities, and in particular on growth rate. However, if this approach is to provide reliably interpretable information, the relationship between RNA content and growth rate must be well-understood. In particular, a requisite of such applications is that the relationship must be universal among bacteria, or alternately that the relationship can be determined and measured for specific bacterial taxa. The RNA-growth rate relationship has not been used to evaluate bacterial growth in field studies, although RNA content has been measured in single cells and in bulk extracts of field samples taken from coastal environments. These measurements have been treated as probable indicators of bacterial activity, but have not yet been interpreted as estimators of growth rate. The primary obstacle to such interpretations is a lack of information on biological and environmental factors that affect the RNA-growth rate relationship. In this paper, the available data on the RNA-growth rate relationship in bacteria will be reviewed, including hypotheses regarding the regulation of RNA synthesis and degradation as a function of growth rate and environmental factors; i.e. the basic mechanisms for maintaining RNA content in proportion to growth rate. An assessment of the published laboratory and field data, the current status of this research area, and some of the remaining questions will be presented.

  4. Rapid identification of Helicoverpa armigera and Helicoverpa zea (Lepidoptera: Noctuidae) using ribosomal RNA internal transcribed spacer 1.

    Perera, Omaththage P; Allen, Kerry C; Jain, Devendra; Purcell, Matthew; Little, Nathan S; Luttrell, Randall G

    2015-01-01

    Rapid identification of invasive species is crucial for deploying management strategies to prevent establishment. Recent Helicoverpa armigera (Hübner) invasions and subsequent establishment in South America has increased the risk of this species invading North America. Morphological similarities make differentiation of H. armigera from the native Helicoverpa zea (Boddie) difficult. Characteristics of adult male genitalia and nucleotide sequence differences in mitochondrial DNA are two of the currently available methods to differentiate these two species. However, current methods are likely too slow to be employed as rapid detection methods. In this study, conserved differences in the internal transcribed spacer 1 (ITS1) of the ribosomal RNA genes were used to develop species-specific oligonucleotide primers that amplified ITS1 fragments of 147 and 334 bp from H. armigera and H. zea, respectively. An amplicon (83 bp) from a conserved region of 18S ribosomal RNA subunit served as a positive control. Melting temperature differences in ITS1 amplicons yielded species-specific dissociation curves that could be used in high resolution melt analysis to differentiate the two Helicoverpa species. In addition, a rapid and inexpensive procedure for obtaining amplifiable genomic DNA from a small amount of tissue was identified. Under optimal conditions, the process was able to detect DNA from one H. armigera leg in a pool of 25 legs. The high resolution melt analysis combined with rapid DNA extraction could be used as an inexpensive method to genetically differentiate large numbers of H. armigera and H. zea using readily available reagents. PMID:26516166

  5. Avian malaria in captive psittacine birds: detection by microscopy and 18S rRNA gene amplification.

    Belo, N O; Passos, L F; Júnior, L M C; Goulart, C E; Sherlock, T M; Braga, E M

    2009-03-01

    A cross-sectional survey was conducted to estimate the occurrence of malaria infection among captive psittacine birds (n=127) from three zoological gardens in Brazil. Malaria infection was evaluated by the association of direct examination of blood smears with amplification of the 18SSU rRNA gene of the Plasmodium genus, demonstrating an overall occurrence of 36%. Most infected bird species were Amazona aestiva (28/73), Ara ararauna (6/10), and Amazona amazonica (3/10). The low parasitemias observed among the infected birds suggest a chronic infection. The sequence analyses of 10 isolates indicate a potential occurrence of four distinct Plasmodium lineages. These findings provide new data on malarial infection in captive psittacine birds, and emphasize the need for better control of importation and exportation of these birds. PMID:18937986

  6. RNase II is important for A-site mRNA cleavage during ribosome pausing

    Garza-Sánchez, Fernando; Shoji, Shinichiro; Fredrick, Kurt; Hayes, Christopher S.

    2009-01-01

    In Escherichia coli, translational arrest can elicit cleavage of codons within the ribosomal A site. This A-site mRNA cleavage is independent of RelE, and has been proposed to be an endonucleolytic activity of the ribosome. Here, we show that the 3′→5′ exonuclease RNase II plays an important role in RelE-independent A-site cleavage. Instead of A-site cleavage, translational pausing in ΔRNase II cells produces transcripts that are truncated +12 and +28 nucleotides downstream of the A-site codo...

  7. Validation of two ribosomal RNA removal methods for microbial metatranscriptomics

    He, Shaomei; Wurtzel, Omri; Singh, Kanwar; Froula, Jeff L; Yilmaz, Suzan; Tringe, Susannah G; Wang, Zhong; Chen, Feng; Lindquist, Erika A; Sorek, Rotem; Hugenholtz, Philip

    2010-10-01

    The predominance of rRNAs in the transcriptome is a major technical challenge in sequence-based analysis of cDNAs from microbial isolates and communities. Several approaches have been applied to deplete rRNAs from (meta)transcriptomes, but no systematic investigation of potential biases introduced by any of these approaches has been reported. Here we validated the effectiveness and fidelity of the two most commonly used approaches, subtractive hybridization and exonuclease digestion, as well as combinations of these treatments, on two synthetic five-microorganism metatranscriptomes using massively parallel sequencing. We found that the effectiveness of rRNA removal was a function of community composition and RNA integrity for these treatments. Subtractive hybridization alone introduced the least bias in relative transcript abundance, whereas exonuclease and in particular combined treatments greatly compromised mRNA abundance fidelity. Illumina sequencing itself also can compromise quantitative data analysis by introducing a G+C bias between runs.

  8. Effect of secondary compounds in forages on rumen micro-organisms quantified by 16S and 18S rRNA

    A gas syringe method was used to evaluate the effect of secondary compounds from plant materials on in vitro fermentation products and microbial biomass. The experiment used Pennisetum purpureum, Morinda citrifolia fruit, Nothopanax scutellarium leaves, Sesbania sesban LS (low saponins type), Sesbania sesban HS (high saponins type) and Sapindus rarak fruit as substrates. The incubation was conducted with and without polyethylene glycol 6000 (PEG) addition for 24 hours. Gas production and short-chain fatty acids (SCFA) were analysed. Prokaryotic and eukaryotic concentrations were measured by quantifying 16S and 18S rRNA. The percentage increase in gas production due to PEG was very small (<5%) for all plant materials, which indicated that the biological effect of tannin in these plant materials is limited. TLC analysis revealed that all materials contained saponin, but only S. rarak, followed by S. sesban, contained a high diversity of saponins. S. sesban gave the highest (234 ml/g) while S. rarak gave the lowest gas production (115 ml/g). S. rarak gave the lowest SCFA production (3.57 mmole/g) and also the lowest ratio of acetate to propionate (1.76), indicating a change in pattern of SCFA production. Total elimination of eukaryotic concentration was evident from the absence of the 18S rRNA band when S. rarak and S. sesban were used as sole substrates. S. rarak also reduced the prokaryotic concentration. To use S. rarak as a defaunating agent without affecting prokaryotes, a crude saponin extract was prepared from S. rarak for further experiment. Different concentrations of crude saponins in a methanol extract of S. rarak fruit dissolved in rumen buffer were added to a substrate consisting of elephant grass and wheat bran (7:3 w/w). Microbial biomass yield was quantified by gravimetry and using rRNA as a marker. Addition of crude saponin extract from S. rarak to a high-roughage diet increased microbial biomass (MB) yield to 1.07 and 1.14 times MB yield of the

  9. Reconstruction of ribosomal RNA genes from metagenomic data.

    Lu Fan

    Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.

  10. Nutritional and growth control of ribosomal protein mRNA and rRNA in Neurospora crassa.

    Cujec, T P; Tyler, B M

    1996-01-01

    The effects of changing growth rates on the levels of 40S pre-rRNA and two r-protein mRNAs were examined to gain insight into the coordinate transcriptional regulation of ribosomal genes in the ascomycete fungus Neurospora crassa. Growth rates were varied either by altering carbon nutritional conditions, or by subjecting the isolates to inositol-limiting conditions. During carbon up- or down-shifts, r-protein mRNA levels were stoichiometrically coordinated. Changes in 40S pre-rRNA levels para...

  11. [Precursors of ribosomal RNA in freely suspended callus cells of parsley (Petroselinum sativum)].

    Richter, G

    1973-03-01

    Six high molecular weight, rapidly labelled RNA species were detected in freely suspended callus cells of Petroselinum sativum by means of isotope labelling and electrophoretic separation in agarose-polyacrylamide gels. On the basis of their migration in the latter the RNA species were calculated to have the following molecular weights: 2.9×10(6), 2,4×10(6), 1.9×10(6), 1.4×10(6), 1.0×10(6) and 0.75×10(6) daltons. Thus they can clearly be distinguished from the two ribosomal RNA species (1.3×10(6) and 0.7×10(6) daltons). During incubation of the cells with [(3)H]methyl-methionine as a methyl donator all six components incorporated radioactivity rapidly. With [(3)H]nucleosides or [(3)H]orotic acid as precursors the 2.9×10(6) and the 2.4×10(6) daltons RNA were labelled within 10 min, while the other high molecular weight species appeared after about 20 min of labelling.Prolongation to 45-120 min resulted in accumulation of radioactivity preferentially in the 1.4×10(6) and 0.75×10(6) daltons RNA and in the ribosomal RNA species. The results of cell fractionation experiments provide evidence that these rapidly labelled high molecular weight RNA species are synthesized in the cell nucleus. The kinetics of their synthesis together with the other data obtained strongly support the suggestion that these RNA species function as precursors in the processing of ribosomal RNA. The possible mechanism of this process is discussed. PMID:24468848

  12. Unusual transcription termination of the ribosomal RNA genes in Ascaris lumbricoides.

    Müller, E; Neuhaus, H; Tobler, H; Müller, F.

    1990-01-01

    We studied termination of transcription of the ribosomal RNA genes in Ascaris lumbricoides, the first representative in the phylum of nemathelminthes analysed so far. RNase protection experiments in vivo reveal that the 3' end of the precursor rRNA coincides with the end of mature 26S rRNA. Promoter-containing miniplasmids are able to direct unique 3' end formation in vitro at a site identical to that observed in vivo, whereas deletion of these sequences abolishes 3' end formation throughout ...

  13. Ribosomal RNA gene sequences confirm that protistan endoparasite of larval cod Gadus morhua is Ichthyodinium sp

    Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne; Støttrup, Josianne; Buchmann, Kurt

    2010-01-01

    An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested to be...... related to Ichthyodinium chabelardi, a dinoflagellate-like protist that parasitizes yolk sacs of embryos and larvae of a variety of fish species. Comparison of a 1535 bp long fragment of the SSU rRNA gene of the cod endoparasite showed absolute identify with I. chabelardi, demonstrating that the 2...

  14. Protist 18S rRNA gene Sequence Analysis Reveals Multiple Sources of Organic Matter Contributing to Turbidity Maxima of the Columbia River Estuary

    Herfort, Lydie; Peterson, Tawnya D.; McCue, Lee Ann; Zuber, Peter A.

    2011-10-05

    The Columbia River estuary is traditionally considered a detritus-based ecosystem fueled in summer by organic matter (OM) from expired freshwater diatoms. Since Estuarine Turbidity Maxima (ETM) are sites of accumulation and transformation of this phytoplankton-derived OM, to further characterize the ETM protist assemblage, we collected in August 2007 bottom waters throughout an ETM event, as well as surface water during the peak of bottom turbidity, and performed biogeochemical, microscopic and molecular (18S rRNA gene clone libraries) analyses. These data confirmed that the majority of the particulate OM in ETMs is derived from chlorophyll a-poor particulate organic carbon tagged by DNA too damaged to be detected by molecular analysis.

  15. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Milbury Coren A

    2010-09-01

    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  16. Structure and Function of the Ribosomal Frameshifting Pseudoknot RNA from Beet Western Yellow Virus

    Egli, M.; Sarkhel, S.; Minasov, G.; Rich, A.

    2010-03-05

    Many viruses reprogram ribosomes to produce two different proteins from two different reading frames. So-called -1 frameshifting often involves pairwise alignment of two adjacent tRNAs at a 'slippery' sequence in the ribosomal A and P sites such that an overlapping codon is shifted upstream by one base relative to the zero frame. In the majority of cases, an RNA pseudoknot located downstream stimulates this type of frameshift. Crystal structures of the frameshifting RNA pseudoknot from Beet Western Yellow Virus (BWYV) have provided a detailed picture of the tertiary interactions stabilizing this folding motif, including a minor-groove triplex and quadruple-base interactions. The structure determined at atomic resolution revealed the locations of several magnesium ions and provided insights into the role of structured water stabilizing the RNA. Systematic in vitro and in vivo mutational analyses based on the structural results revealed specific tertiary interactions and regions in the pseudoknot that drastically change frameshifting efficiency. Here, we summarize recent advances in our understanding of pseudoknot-mediated ribosomal frameshifting on the basis of the insights gained from structural and functional studies of the RNA pseudoknot from BWYV.

  17. Expanded versions of the 16S and 23S ribosomal RNA mutation databases (16SMDBexp and 23SMDBexp)

    Triman, K L; Peister, A; R. A. Goel

    1998-01-01

    Expanded versions of the Ribosomal RNA Mutation Databases provide lists of mutated positions in 16S and 16S-like ribosomal RNA (16SMDBexp) and 23S and 23S-like ribosomal RNA (23SMDBexp) and the identity of each alteration. Alterations from organisms other than Escherichia coli are reported at positions according to the E.coli numbering system. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation, (ii) whether a mutant pheno...

  18. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    Recht, M I; Douthwaite, S; Dahlquist, K D;

    1999-01-01

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  19. Reduced expression of ribosomal proteins relieves microRNA-mediated repression.

    Janas, Maja M; Wang, Eric; Love, Tara; Harris, Abigail S; Stevenson, Kristen; Semmelmann, Karlheinz; Shaffer, Jonathan M; Chen, Po-Hao; Doench, John G; Yerramilli, Subrahmanyam V B K; Neuberg, Donna S; Iliopoulos, Dimitrios; Housman, David E; Burge, Christopher B; Novina, Carl D

    2012-04-27

    MicroRNAs (miRNAs) regulate physiological and pathological processes by inducing posttranscriptional repression of target messenger RNAs (mRNAs) via incompletely understood mechanisms. To discover factors required for human miRNA activity, we performed an RNAi screen using a reporter cell line of miRNA-mediated repression of translation initiation. We report that reduced expression of ribosomal protein genes (RPGs) dissociated miRNA complexes from target mRNAs, leading to increased polysome association, translation, and stability of miRNA-targeted mRNAs relative to untargeted mRNAs. RNA sequencing of polysomes indicated substantial overlap in sets of genes exhibiting increased or decreased polysomal association after Argonaute or RPG knockdowns, suggesting similarity in affected pathways. miRNA profiling of monosomes and polysomes demonstrated that miRNAs cosediment with ribosomes. RPG knockdowns decreased miRNAs in monosomes and increased their target mRNAs in polysomes. Our data show that most miRNAs repress translation and that the levels of RPGs modulate miRNA-mediated repression of translation initiation. PMID:22541556

  20. Protein-RNA cross-linking in the ribosomes of yeast under oxidative stress.

    Mirzaei, Hamid; Regnier, Fred

    2006-12-01

    Living systems have efficient degradative pathways for dealing with the fact that reactive oxygen species (ROS) derived from cellular metabolism and the environment oxidatively damage proteins and DNA. But aggregation and cross-linking can occur as well, leading to a series of problems including disruption of cellular regulation, mutations, and even cell death. The mechanism(s) by which protein aggregation occurs and the macromolecular species involved are poorly understood. In the study reported here, evidence is provided for a new type of aggregate between proteins and RNA in ribosomes. While studying the effect of oxidative stress induced in the yeast proteome it was noted that ribosomal proteins were widely oxidized. Eighty six percent of the proteins in yeast ribosomes were found to be carbonylated after stressing yeast cell cultures with hydrogen peroxide. Moreover, many of these proteins appeared to be cross-linked based on their coelution patterns during RPC separation. Since they were not in direct contact, it was not clear how this could occur unless it was through the RNA separating them in the ribosome. This was confirmed in a multiple-step process, the first being derivatization of all carbonylated proteins in cell lysates with biotin hydrazide through Schiff base formation. Following reduction of Schiff bases with sodium cyanoborohydride, biotinylated proteins were selected from cell lysates with avidin affinity chromatography. Oxidized proteins thus captured were then selected again using boronate affinity chromatography to capture vicinal diol-containing proteins. This would include proteins cross-linked to an RNA fragment containing a ribose residue with 2',3'-hydroxyl groups. Some glycoproteins would also be selected by this process. LC/MS/MS analyses of tryptic peptides derived from proteins captured by this process along with MASCOT searches resulted in the identification of 37 ribosomal proteins that appear to be cross-linked to RNA

  1. A pathogenic non-coding RNA induces changes in dynamic DNA methylation of ribosomal RNA genes in host plants.

    Martinez, German; Castellano, Mayte; Tortosa, Maria; Pallas, Vicente; Gomez, Gustavo

    2014-02-01

    Viroids are plant-pathogenic non-coding RNAs able to interfere with as yet poorly known host-regulatory pathways and to cause alterations recognized as diseases. The way in which these RNAs coerce the host to express symptoms remains to be totally deciphered. In recent years, diverse studies have proposed a close interplay between viroid-induced pathogenesis and RNA silencing, supporting the belief that viroid-derived small RNAs mediate the post-transcriptional cleavage of endogenous mRNAs by acting as elicitors of symptoms expression. Although the evidence supporting the role of viroid-derived small RNAs in pathogenesis is robust, the possibility that this phenomenon can be a more complex process, also involving viroid-induced alterations in plant gene expression at transcriptional levels, has been considered. Here we show that plants infected with the 'Hop stunt viroid' accumulate high levels of sRNAs derived from ribosomal transcripts. This effect was correlated with an increase in the transcription of ribosomal RNA (rRNA) precursors during infection. We observed that the transcriptional reactivation of rRNA genes correlates with a modification of DNA methylation in their promoter region and revealed that some rRNA genes are demethylated and transcriptionally reactivated during infection. This study reports a previously unknown mechanism associated with viroid (or any other pathogenic RNA) infection in plants providing new insights into aspects of host alterations induced by the viroid infectious cycle. PMID:24178032

  2. Quantitative studies of mRNA recruitment to the eukaryotic ribosome.

    Fraser, Christopher S

    2015-07-01

    The process of peptide bond synthesis by ribosomes is conserved between species, but the initiation step differs greatly between the three kingdoms of life. This is illustrated by the evolution of roughly an order of magnitude more initiation factor mass found in humans compared with bacteria. Eukaryotic initiation of translation is comprised of a number of sub-steps: (i) recruitment of an mRNA and initiator methionyl-tRNA to the 40S ribosomal subunit; (ii) migration of the 40S subunit along the 5' UTR to locate the initiation codon; and (iii) recruitment of the 60S subunit to form the 80S initiation complex. Although the mechanism and regulation of initiation has been studied for decades, many aspects of the pathway remain unclear. In this review, I will focus discussion on what is known about the mechanism of mRNA selection and its recruitment to the 40S subunit. I will summarize how the 43S preinitiation complex (PIC) is formed and stabilized by interactions between its components. I will discuss what is known about the mechanism of mRNA selection by the eukaryotic initiation factor 4F (eIF4F) complex and how the selected mRNA is recruited to the 43S PIC. The regulation of this process by secondary structure located in the 5' UTR of an mRNA will also be discussed. Finally, I present a possible kinetic model with which to explain the process of mRNA selection and recruitment to the eukaryotic ribosome. PMID:25742741

  3. Possible genetic consequences of epigenetic interactions between ribosomal RNA loci in Nicotiana allopolyploids

    Kovařík, Aleš; Nešpor Dadejová, Martina; Lim, K.Y.; Součková Skalická, Kamila; Matyášek, Roman; Grandbastien, M.-A.; Leitch, A.

    Clermont-Ferrand, 2007. s. 1-1. [Réunion du Groupe de travail Cytogénétique & Polyploidie du DGAP. 18.04.2007-20.04.2007, Clermont-Ferrand] R&D Projects: GA ČR(CZ) GA521/07/0116; GA ČR(CZ) GA204/05/0687 Institutional research plan: CEZ:AV0Z50040507 Keywords : allopolyploidy * epigenetic silencing * ribosomal RNA gene Subject RIV: BO - Biophysics

  4. Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

    Patrick O McGowan

    Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.

  5. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region.

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko; Lo Svenningsen, Sine; Sneppen, Kim; Pedersen, Steen

    2011-03-18

    Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described. Here, we characterize a determinant of the functional stability of an mRNA, which is located in the early coding region. Using literature values for the mRNA half-lives of variant lacZ mRNAs in Escherichia coli, we modeled how the ribosome spacing is affected by the translation rate of the individual codons. When comparing the ribosome spacing at various segments of the mRNA to its functional half-life, we found a clear correlation between the functional mRNA half-life and the ribosome spacing in the mRNA region approximately between codon 20 and codon 45. From this finding, we predicted that inserts of slowly translated codons before codon 20 or after codon 45 should shorten or prolong, respectively, the functional mRNA half-life by altering the ribosome density in the important region. These predictions were tested on eight new lacZ variants, and their experimentally determined mRNA half-lives all supported the model. We thus suggest that translation-rate-mediated differences in the spacing between ribosomes in this early coding region is a parameter that determines the mRNAs functional half-life. We present a model that is in accordance with many earlier observations and that allows a prediction of the functional half-life of a given mRNA sequence. PMID:21255584

  6. Phylogenetic relationships of the green alga Volvox carteri deduced from small-subunit ribosomal RNA comparisons.

    Rausch, H; Larsen, N; Schmitt, R

    1989-09-01

    The 1788-nucleotide sequence of the small-subunit ribosomal RNA (srRNA) coding region from the chlorophyte Volvox carteri was determined. The secondary structure bears features typical of the universal model of srRNA, including about 40 helices and a division into four domains. Phylogenetic relationships to 17 other eukaryotes, including two other chlorophytes, were explored by comparing srRNA sequences. Similarity values and the inspection of phylogenetic trees derived by distance matrix methods revealed a close relationship between V. carteri and Chlamydomonas reinhardtii. The results are consistent with the view that these Volvocales, and the third green alga, Nanochlorum eucaryotum, are more closely related to higher plants than to any other major eukaryotic group, but constitute a distinct lineage that has long been separated from the line leading to the higher plants. PMID:2506359

  7. Ribosomal pausing at a frameshifter RNA pseudoknot is sensitive to reading phase but shows little correlation with frameshift efficiency.

    Kontos, H; Napthine, S; Brierley, I

    2001-12-01

    Here we investigated ribosomal pausing at sites of programmed -1 ribosomal frameshifting, using translational elongation and ribosome heelprint assays. The site of pausing at the frameshift signal of infectious bronchitis virus (IBV) was determined and was consistent with an RNA pseudoknot-induced pause that placed the ribosomal P- and A-sites over the slippery sequence. Similarly, pausing at the simian retrovirus 1 gag/pol signal, which contains a different kind of frameshifter pseudoknot, also placed the ribosome over the slippery sequence, supporting a role for pausing in frameshifting. However, a simple correlation between pausing and frameshifting was lacking. Firstly, a stem-loop structure closely related to the IBV pseudoknot, although unable to stimulate efficient frameshifting, paused ribosomes to a similar extent and at the same place on the mRNA as a parental pseudoknot. Secondly, an identical pausing pattern was induced by two pseudoknots differing only by a single loop 2 nucleotide yet with different functionalities in frameshifting. The final observation arose from an assessment of the impact of reading phase on pausing. Given that ribosomes advance in triplet fashion, we tested whether the reading frame in which ribosomes encounter an RNA structure (the reading phase) would influence pausing. We found that the reading phase did influence pausing but unexpectedly, the mRNA with the pseudoknot in the phase which gave the least pausing was found to promote frameshifting more efficiently than the other variants. Overall, these experiments support the view that pausing alone is insufficient to mediate frameshifting and additional events are required. The phase dependence of pausing may be indicative of an activity in the ribosome that requires an optimal contact with mRNA secondary structures for efficient unwinding. PMID:11713298

  8. Exploring accessibility of structural elements of the mammalian 40S ribosomal mRNA entry channel at various steps of translation initiation.

    Sharifulin, Dmitri E; Bartuli, Yulia S; Meschaninova, Maria I; Ven'yaminova, Aliya G; Graifer, Dmitri M; Karpova, Galina G

    2016-10-01

    In this work, we studied how the accessibility of structural elements of the mammalian 40S ribosomal mRNA entry channel, ribosomal protein (rp) uS3 and helix (h) 16 of the 18S rRNA, changes upon the translation initiation. In particular, we examined the accessibility of rp uS3 for binding of unstructured RNAs and of riboses in h16 towards attack with benzoyl cyanide (BzCN) in complexes assembled in rabbit reticulocyte lysate utilizing synthetic oligoribonucleotides as well as full-length and truncated up to the initiation AUG codon hepatitis C virus IRES as model mRNAs. With both mRNA types, the rp uS3 peptide recognizing single-stranded RNAs was shown to become shielded only in those 48S preinitiation complexes (PICs) that contained eIF3j bound to 40S subunit in the area between the decoding site and the mRNA entry channel. Chemical probing with BzCN revealed that h16 in the 48S PICs containing eIF3j or scanning factor DHX29 is strongly shielded; the effect was observed with all the mRNAs used, and h16 remained protected as well in 80S post-initiation complexes lacking these factors. Altogether, the obtained results allowed us to suggest that eIF3j bound at the 48S PICs makes the rp uS3 inaccessible for binding of RNAs and this factor subunit is responsible for the decrease of h16 conformational flexibility; the latter is manifested as reduced accessibility of h16 to BzCN. Thus, our findings provide new insights into how eIF3j is implicated in ensuring the proper conformation of the mRNA entry channel, thereby facilitating mRNA loading. PMID:27346718

  9. Phylogeny and classification of the Litostomatea (Protista, Ciliophora), with emphasis on free-living taxa and the 18S rRNA gene.

    Vd'ačný, Peter; Bourland, William A; Orsi, William; Epstein, Slava S; Foissner, Wilhelm

    2011-05-01

    The class Litostomatea is a highly diverse ciliate taxon comprising hundreds of species ranging from aerobic, free-living predators to anaerobic endocommensals. This is traditionally reflected by classifying the Litostomatea into the subclasses Haptoria and Trichostomatia. The morphological classifications of the Haptoria conflict with the molecular phylogenies, which indicate polyphyly and numerous homoplasies. Thus, we analyzed the genealogy of 53 in-group species with morphological and molecular methods, including 12 new sequences from free-living taxa. The phylogenetic analyses and some strong morphological traits show: (i) body polarization and simplification of the oral apparatus as main evolutionary trends in the Litostomatea and (ii) three distinct lineages (subclasses): the Rhynchostomatia comprising Tracheliida and Dileptida; the Haptoria comprising Lacrymariida, Haptorida, Didiniida, Pleurostomatida and Spathidiida; and the Trichostomatia. The curious Homalozoon cannot be assigned to any of the haptorian orders, but is basal to a clade containing the Didiniida and Pleurostomatida. The internal relationships of the Spathidiida remain obscure because many of them and some "traditional" haptorids form separate branches within the basal polytomy of the order, indicating one or several radiations and convergent evolution. Due to the high divergence in the 18S rRNA gene, the chaeneids and cyclotrichiids are classified incertae sedis. PMID:21333743

  10. Molecular characterization of Cryptosporidium xiaoi in goat kids in Bangladesh by nested PCR amplification of 18S rRNA gene

    AMAM; Zonaed; Siddiki; Sohana; Akter; Mina; Zinat; Farzana; Bibi; Ayesa; Rasel; Das; Mohammad; Alamgir; Hossain

    2015-01-01

    Objective:To investigate the prevalence of Cryptosporidium spp.in goat kids in selected areas of Bangladesh and to elucidate the potential zoonotic hazards.Methods:In the present study,we have used Ziehl-Neelsen staining and nested PCR approach to identify and characterize the Cryptosporidium sp.from diarrhoeic feces of goat kids.A total of 100 diarrhoeic feces samples were collected from Chittagong region in Southern Bangladesh.For nested PCR analysis,specific primers for amplification of 581 base pair fragments of 18 S rRNA gene were used.Results:A total of 15%and 3%samples were found positive in microscopic study and in nested PCR analysis respectively.Phylogenetic analysis of sequence data showed similarity with that of Cryptosporidium xiaoi recorded from sheep and goat.Conclusions:To our knowledge,this is the first report of Cryptosporidium xiaoi responsible for diarrhoea in goat kids in Bangladesh.Further study can highlight their zoonotic significance along with genetic diversity in other host species inside the country.

  11. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko;

    2011-01-01

    codons. When comparing the ribosome spacing at various segments of the mRNA to its functional half-life, we found a clear correlation between the functional mRNA half-life and the ribosome spacing in the mRNA region approximately between codon 20 and codon 45. From this finding, we predicted that inserts......Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described....... Here, we characterize a determinant of the functional stability of an mRNA, which is located in the early coding region. Using literature values for the mRNA half-lives of variant lacZ mRNAs in Escherichia coli, we modeled how the ribosome spacing is affected by the translation rate of the individual...

  12. Human Ribosomal RNA-Derived Resident MicroRNAs as the Transmitter of Information upon the Cytoplasmic Cancer Stress

    2016-01-01

    Dysfunction of ribosome biogenesis induces divergent ribosome-related diseases including ribosomopathy and occasionally results in carcinogenesis. Although many defects in ribosome-related genes have been investigated, little is known about contribution of ribosomal RNA (rRNA) in ribosome-related disorders. Meanwhile, microRNA (miRNA), an important regulator of gene expression, is derived from both coding and noncoding region of the genome and is implicated in various diseases. Therefore, we performed in silico analyses using M-fold, TargetScan, GeneCoDia3, and so forth to investigate RNA relationships between rRNA and miRNA against cellular stresses. We have previously shown that miRNA synergism is significantly correlated with disease and the miRNA package is implicated in memory for diseases; therefore, quantum Dynamic Nexus Score (DNS) was also calculated using MESer program. As a result, seventeen RNA sequences identical with known miRNAs were detected in the human rRNA and termed as rRNA-hosted miRNA analogs (rmiRNAs). Eleven of them were predicted to form stem-loop structures as pre-miRNAs, and especially one stem-loop was completely identical with hsa-pre-miR-3678 located in the non-rDNA region. Thus, these rmiRNAs showed significantly high DNS values, participation in regulation of cancer-related pathways, and interaction with nucleolar RNAs, suggesting that rmiRNAs may be stress-responsible resident miRNAs which transmit stress-tuning information in multiple levels.

  13. Human Ribosomal RNA-Derived Resident MicroRNAs as the Transmitter of Information upon the Cytoplasmic Cancer Stress.

    Yoshikawa, Masaru; Fujii, Yoichi Robertus

    2016-01-01

    Dysfunction of ribosome biogenesis induces divergent ribosome-related diseases including ribosomopathy and occasionally results in carcinogenesis. Although many defects in ribosome-related genes have been investigated, little is known about contribution of ribosomal RNA (rRNA) in ribosome-related disorders. Meanwhile, microRNA (miRNA), an important regulator of gene expression, is derived from both coding and noncoding region of the genome and is implicated in various diseases. Therefore, we performed in silico analyses using M-fold, TargetScan, GeneCoDia3, and so forth to investigate RNA relationships between rRNA and miRNA against cellular stresses. We have previously shown that miRNA synergism is significantly correlated with disease and the miRNA package is implicated in memory for diseases; therefore, quantum Dynamic Nexus Score (DNS) was also calculated using MESer program. As a result, seventeen RNA sequences identical with known miRNAs were detected in the human rRNA and termed as rRNA-hosted miRNA analogs (rmiRNAs). Eleven of them were predicted to form stem-loop structures as pre-miRNAs, and especially one stem-loop was completely identical with hsa-pre-miR-3678 located in the non-rDNA region. Thus, these rmiRNAs showed significantly high DNS values, participation in regulation of cancer-related pathways, and interaction with nucleolar RNAs, suggesting that rmiRNAs may be stress-responsible resident miRNAs which transmit stress-tuning information in multiple levels. PMID:27517048

  14. Sequence and organization of 5S ribosomal RNA-encoding genes of Arabidopsis thaliana.

    Campell, B R; Song, Y; Posch, T E; Cullis, C A; Town, C D

    1992-03-15

    We have isolated a genomic clone containing Arabidopsis thaliana 5S ribosomal RNA (rRNA)-encoding genes (rDNA) by screening an A. thaliana library with a 5S rDNA probe from flax. The clone isolated contains seven repeat units of 497 bp, plus 11 kb of flanking genomic sequence at one border. Sequencing of individual subcloned repeat units shows that the sequence of the 5S rRNA coding region is very similar to that reported for other flowering plants. Four A. thaliana ecotypes were found to contain approx. 1000 copies of 5S rDNA per haploid genome. Southern-blot analysis of genomic DNA indicates that 5S rDNA occurs in long tandem arrays, and shows the presence of numerous restriction-site polymorphisms among the six ecotypes studied. PMID:1348233

  15. A rapid and simple pipeline for synthesis of mRNA-ribosome-V(H)H complexes used in single-domain antibody ribosome display.

    Bencurova, Elena; Pulzova, Lucia; Flachbartova, Zuzana; Bhide, Mangesh

    2015-06-01

    The single-domain antibody (VHH) is a promising building block for a number of antibody-based applications. Ribosome display can successfully be used in the production of VHH. However, the construction of the expression cassette, confirmation of the translation and proper folding of the nascent chain, and the purification of the ribosome complexes, remain cumbersome tasks. Additionally, selection of the most suitable expression system can be challenging. We have designed primers that will amplify virtually all Camelidae VHH. With the help of a double-overlap extension (OE) polymerase chain reaction (PCR) we have fused VHH with the F1 fragment (T7 promoter and species-independent translation sequence) and the F2 fragment (mCherry, Myc-tag, tether, SecM arrest sequence and 3' stem loop) to generate a full-length DNA cassette. OE-PCR generated fragments were incubated directly with cell-free lysates (Leishmania torentolae, rabbit reticulocyte or E. coli) for the synthesis of mRNA-VHH-mCherry-ribosome complexes in vitro. Alternatively, the cassette was ligated in pQE-30 vector and transformed into E. coli to produce ribosome complexes in vivo. The results showed that the same expression cassette could be used to synthesize ribosome complexes with different expression systems. mCherry reporter served to confirm the synthesis and proper folding of the nascent chain, Myc-tag was useful in the rapid purification of ribosome complexes, and combination of the SecM sequence and 3' stem loop made the cassette universal, both for cells-free and E. coli in vivo. This rapid and universal pipeline can effectively be used in antibody ribosome display and VHH production. PMID:25902394

  16. Epigenetic repression of ribosomal RNA transcription by ROCK-dependent aberrant cytoskeletal organization

    Wu, Tse-Hsiang; Kuo, Yuan-Yeh; Lee, Hsiao-Hui; Kuo, Jean-Cheng; Ou, Meng-Hsin; Chang, Zee-Fen

    2016-01-01

    It is known that ribosomal RNA (rRNA) synthesis is regulated by cellular energy and proliferation status. In this study, we investigated rRNA gene transcription in response to cytoskeletal stress. Our data revealed that the cell shape constrained by isotropic but not elongated micropatterns in HeLa cells led to a significant reduction in rRNA transcription dependent on ROCK. Expression of a dominant-active form of ROCK also repressed rRNA transcription. Isotropic constraint and ROCK over-activation led to different types of aberrant F-actin organization, but their suppression effects on rRNA transcription were similarly reversed by inhibition of histone deacetylase (HDAC) or overexpression of a dominant negative form of Nesprin, which shields the signal transmitted from actin filament to the nuclear interior. We further showed that the binding of HDAC1 to the active fraction of rDNA genes is increased by ROCK over-activation, thus reducing H3K9/14 acetylation and suppressing transcription. Our results demonstrate an epigenetic control of active rDNA genes that represses rRNA transcription in response to the cytoskeletal stress. PMID:27350000

  17. 河南猪株旋毛虫18S rRNA基因的同源性序列分析%18S rRNA sequence analysis and construction of phylogenetic tree of Trichinella from swine in Henan Province

    王丽娜; 路国兵; 杨晓东; 高云; 陈晓宁

    2011-01-01

    目的 通过分析18S rRNA基因序列同源性,对河南猪株旋毛虫进行分子鉴定及分类. 方法 收集河南猪株旋毛虫成虫,提取总RNA,反转录合成cDNA,经特异引物扩增获得18S rRNA基因片段.将此目的基因与pMD18-T载体连接,转化大肠埃希菌感受态细胞,阳性克隆经PCR及酶切鉴定后进行序列测定及分析,构建系统发育树. 结果 构建的重组质粒酶切片段大小分别为2 700和1 800 bp,与预期值相符.根据18S rRNA碱基序列构建系统发生树,河南猪株旋毛虫与虫株Trichinella nativa (AY487254.1)的亲缘关系较近,同源性为99.1%. 结论 河南猪株旋毛虫归属于T2.%Objective To identify and classify Trichinella from swine in Henan Province at the molecular level by sequence homology analysis of the 18S rRNA gene. Methods Total RNA was extracted from adult Trichinella collected from swine in Henan. cDNA was obtained by reverse transcription. The 18S rRNA gene was amplified with a specific primer. The fragments of PCR products were ligated to pMD18-T. This was then transformed into E. Coli competent cells. After identification by PCR and restrictive endonuclease digestion, the positive clone was sequenced and analyzed and then a phylogenetic tree was constructed. Results The fragments of the constructed recombinant plasmid were a-bout 2 700 bp and 1 800 bp, which were consistent with expected values. In the phylogenetic tree based on the base sequence of the 18S rRNA gene, Trichinella from swine in Henan Province was the closest relative to T. Nativa (AY487254. 1) with sequence similarity of more than 99. 1%. Conclusion Trichinella from swine in Henan Province was Trichinella nativa (T2).

  18. An approach to analyse the specific impact of rapamycin on mRNA-ribosome association

    Jaquier-Gubler Pascale

    2008-08-01

    Full Text Available Abstract Background Recent work, using both cell culture model systems and tumour derived cell lines, suggests that the differential recruitment into polysomes of mRNA populations may be sufficient to initiate and maintain tumour formation. Consequently, a major effort is underway to use high density microarray profiles to establish molecular fingerprints for cells exposed to defined drug regimes. The aim of these pharmacogenomic approaches is to provide new information on how drugs can impact on the translational read-out within a defined cellular background. Methods We describe an approach that permits the analysis of de-novo mRNA-ribosome association in-vivo during short drug exposures. It combines hypertonic shock, polysome fractionation and high-throughput analysis to provide a molecular phenotype of translationally responsive transcripts. Compared to previous translational profiling studies, the procedure offers increased specificity due to the elimination of the drugs secondary effects (e.g. on the transcriptional read-out. For this pilot "proof-of-principle" assay we selected the drug rapamycin because of its extensively studied impact on translation initiation. Results High throughput analysis on both the light and heavy polysomal fractions has identified mRNAs whose re-recruitment onto free ribosomes responded to short exposure to the drug rapamycin. The results of the microarray have been confirmed using real-time RT-PCR. The selective down-regulation of TOP transcripts is also consistent with previous translational profiling studies using this drug. Conclusion The technical advance outlined in this manuscript offers the possibility of new insights into mRNA features that impact on translation initiation and provides a molecular fingerprint for transcript-ribosome association in any cell type and in the presence of a range of drugs of interest. Such molecular phenotypes defined pre-clinically may ultimately impact on the evaluation of

  19. Sequence and Taxonomy Analysis of Arctium lappa 18S rRNA Gene%牛蒡18S核糖体RNA基因分析和分类学研究

    蔡侃; 孔文刚; 夏红剑; 侯进慧

    2011-01-01

    Arctium lappa 18S rRNA gene was amplified,and a 1636bp DNA were sequenced with its Genbank accession number JF509958.The gene sequence of Arctium lappa 18Sr RNA was analyzed with related species in GenBank.The result shows,Arctium lappa 18S rRNA gene has a high homology with many families within Dicotyledoneae,such as Asteraceae and Caprifoliaceae.This study provides reference for further study of Arctium lappa in molecular level.%扩增牛蒡18S rRNA基因,测序获得1 636bp的DNA序列,GenBank登录号是JF703098。利用牛蒡18S rDNA序列和GenBank相关序列构建系统发育树,结果表明,牛蒡18S rRNA基因与双子叶纲的菊科、忍冬科的一些物种序列相似度高。对在分子水平上牛蒡的研究提供了资料。

  20. Mechanical insights into ribosomal progression overcoming RNA G-quadruplex from periodical translation suppression in cells

    Endoh, Tamaki; Sugimoto, Naoki

    2016-03-01

    G-quadruplexes formed on DNA and RNA can be roadblocks to movement of polymerases and ribosome on template nucleotides. Although folding and unfolding processes of the G-quadruplexes are deliberately studied in vitro, how the mechanical and physical properties of the G-quadruplexes affect intracellular biological systems is still unclear. In this study, mRNAs with G-quadruplex forming sequences located either in the 5‧ untranslated region (UTR) or in the open reading frame (ORF) were constructed to evaluate positional effects of the G-quadruplex on translation suppression in cells. Periodic fluctuation of translation suppression was observed at every three nucleotides within the ORF but not within the 5‧ UTR. The results suggested that difference in motion of ribosome at the 5‧ UTR and the ORF determined the ability of the G-quadruplex structure to act as a roadblock to translation in cells and provided mechanical insights into ribosomal progression to overcome the roadblock.

  1. The trypanosome Pumilio-domain protein PUF7 associates with a nuclear cyclophilin and is involved in ribosomal RNA maturation.

    Droll, Dorothea; Archer, Stuart; Fenn, Katelyn; Delhi, Praveen; Matthews, Keith; Clayton, Christine

    2010-03-19

    Proteins with Pumilio RNA binding domains (Puf proteins) are ubiquitous in eukaryotes. Some Puf proteins bind to the 3'-untranslated regions of mRNAs, acting to repress translation and promote degradation; others are involved in ribosomal RNA maturation. The genome of Trypanosoma brucei encodes eleven Puf proteins whose function cannot be predicted by sequence analysis. We show here that epitope-tagged TbPUF7 is located in the nucleolus, and associated with a nuclear cyclophilin-like protein, TbNCP1. RNAi targeting PUF7 reduced trypanosome growth and inhibited two steps in ribosomal RNA processing. PMID:20153321

  2. The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

    Takaiwa, F; Sugiura, M

    1980-01-01

    The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

  3. Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

    The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library

  4. Label- and amplification-free electrochemical detection of bacterial ribosomal RNA.

    Henihan, Grace; Schulze, Holger; Corrigan, Damion K; Giraud, Gerard; Terry, Jonathan G; Hardie, Alison; Campbell, Colin J; Walton, Anthony J; Crain, Jason; Pethig, Ronald; Templeton, Kate E; Mount, Andrew R; Bachmann, Till T

    2016-07-15

    Current approaches to molecular diagnostics rely heavily on PCR amplification and optical detection methods which have restrictions when applied to point of care (POC) applications. Herein we describe the development of a label-free and amplification-free method of pathogen detection applied to Escherichia coli which overcomes the bottleneck of complex sample preparation and has the potential to be implemented as a rapid, cost effective test suitable for point of care use. Ribosomal RNA is naturally amplified in bacterial cells, which makes it a promising target for sensitive detection without the necessity for prior in vitro amplification. Using fluorescent microarray methods with rRNA targets from a range of pathogens, an optimal probe was selected from a pool of probe candidates identified in silico. The specificity of probes was investigated on DNA microarray using fluorescently labeled 16S rRNA target. The probe yielding highest specificity performance was evaluated in terms of sensitivity and a LOD of 20 pM was achieved on fluorescent glass microarray. This probe was transferred to an EIS end point format and specificity which correlated to microarray data was demonstrated. Excellent sensitivity was facilitated by the use of uncharged PNA probes and large 16S rRNA target and investigations resulted in an LOD of 50 pM. An alternative kinetic EIS assay format was demonstrated with which rRNA could be detected in a species specific manner within 10-40min at room temperature without wash steps. PMID:27016627

  5. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Hyouta eHimeno

    2014-04-01

    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  6. The ribosome triggers the stringent response by RelA via a highly distorted tRNA.

    Agirrezabala, Xabier; Fernández, Israel S; Kelley, Ann C; Cartón, David Gil; Ramakrishnan, Venki; Valle, Mikel

    2013-09-01

    The bacterial stringent response links nutrient starvation with the transcriptional control of genes. This process is initiated by the stringent factor RelA, which senses the presence of deacylated tRNA in the ribosome as a symptom of amino-acid starvation to synthesize the alarmone (p)ppGpp. Here we report a cryo-EM study of RelA bound to ribosomes bearing cognate, deacylated tRNA in the A-site. The data show that RelA on the ribosome stabilizes an unusual distorted form of the tRNA, with the acceptor arm making contact with RelA and far from its normal location in the peptidyl transferase centre. PMID:23877429

  7. Phylogenetic evidence for the acquisition of ribosomal RNA introns subsequent to the divergence of some of the major Tetrahymena groups

    Sogin, M L; Ingold, A; Karlok, M;

    1986-01-01

    Previous work has demonstrated the presence of a self-splicing intron in the large subunit ribosomal RNA coding region in some strains of the ciliate protozoan Tetrahymena. Sequence comparisons of the intron regions from six Tetrahymena species showed these to fall into three homology groups. In an...... attempt to evaluate the evolutionary origins of the intervening sequences, we have now determined complete small subunit ribosomal RNA gene sequences from 13 species of Tetrahymena and the absolute number of nucleotide differences between the sequences was used to construct a phylogenetic tree. This...

  8. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.

    2011-01-01

    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stab...

  9. The human insulin receptor mRNA contains a functional internal ribosome entry segment

    Spriggs, Keith A.; Cobbold, Laura C.; Ridley, Simon H.; Coldwell, Mark; Bottley, Andrew; Bushell, Martin; Willis, Anne E.; Siddle, Kenneth

    2009-01-01

    Regulation of mRNA translation is an important mechanism determining the level of expression of proteins in eukaryotic cells. Translation is most commonly initiated by cap-dependent scanning, but many eukaryotic mRNAs contain internal ribosome entry segments (IRESs), providing an alternative means of initiation capable of independent regulation. Here, we show by using dicistronic luciferase reporter vectors that the 5′-UTR of the mRNA encoding human insulin receptor (hIR) contains a functional IRES. RNAi-mediated knockdown showed that the protein PTB was required for maximum IRES activity. Electrophoretic mobility shift assays confirmed that PTB1, PTB2 and nPTB, but not unr or PTB4, bound to hIR mRNA, and deletion mapping implicated a CCU motif 448 nt upstream of the initiator AUG in PTB binding. The IR-IRES was functional in a number of cell lines, and most active in cells of neuronal origin, as assessed by luciferase reporter assays. The IRES was more active in confluent than sub-confluent cells, but activity did not change during differentiation of 3T3-L1 fibroblasts to adipocytes. IRES activity was stimulated by insulin in sub-confluent cells. The IRES may function to maintain expression of IR protein in tissues such as the brain where mRNA translation by cap-dependent scanning is less effective. PMID:19654240

  10. One step engineering of the small-subunit ribosomal RNA using CRISPR/Cas9.

    Kannan, Krishna; Tsvetanova, Billyana; Chuang, Ray-Yuan; Noskov, Vladimir N; Assad-Garcia, Nacyra; Ma, Li; Hutchison Iii, Clyde A; Smith, Hamilton O; Glass, John I; Merryman, Chuck; Venter, J Craig; Gibson, Daniel G

    2016-01-01

    Bacteria are indispensable for the study of fundamental molecular biology processes due to their relatively simple gene and genome architecture. The ability to engineer bacterial chromosomes is quintessential for understanding gene functions. Here we demonstrate the engineering of the small-ribosomal subunit (16S) RNA of Mycoplasma mycoides, by combining the CRISPR/Cas9 system and the yeast recombination machinery. We cloned the entire genome of M. mycoides in yeast and used constitutively expressed Cas9 together with in vitro transcribed guide-RNAs to introduce engineered 16S rRNA genes. By testing the function of the engineered 16S rRNA genes through genome transplantation, we observed surprising resilience of this gene to addition of genetic elements or helix substitutions with phylogenetically-distant bacteria. While this system could be further used to study the function of the 16S rRNA, one could envision the "simple" M. mycoides genome being used in this setting to study other genetic structures and functions to answer fundamental questions of life. PMID:27489041

  11. One step engineering of the small-subunit ribosomal RNA using CRISPR/Cas9

    Kannan, Krishna; Tsvetanova, Billyana; Chuang, Ray-Yuan; Noskov, Vladimir N.; Assad-Garcia, Nacyra; Ma, Li; Hutchison III, Clyde A.; Smith, Hamilton O.; Glass, John I.; Merryman, Chuck; Venter, J. Craig; Gibson, Daniel G.

    2016-01-01

    Bacteria are indispensable for the study of fundamental molecular biology processes due to their relatively simple gene and genome architecture. The ability to engineer bacterial chromosomes is quintessential for understanding gene functions. Here we demonstrate the engineering of the small-ribosomal subunit (16S) RNA of Mycoplasma mycoides, by combining the CRISPR/Cas9 system and the yeast recombination machinery. We cloned the entire genome of M. mycoides in yeast and used constitutively expressed Cas9 together with in vitro transcribed guide-RNAs to introduce engineered 16S rRNA genes. By testing the function of the engineered 16S rRNA genes through genome transplantation, we observed surprising resilience of this gene to addition of genetic elements or helix substitutions with phylogenetically-distant bacteria. While this system could be further used to study the function of the 16S rRNA, one could envision the “simple” M. mycoides genome being used in this setting to study other genetic structures and functions to answer fundamental questions of life. PMID:27489041

  12. Model of EF4-induced ribosomal state transitions and mRNA translocation

    EF4, a highly conserved protein present in bacteria, mitochondria and chloroplasts, can bind to both the posttranslocation and pretranslocation ribosomal complexes. When binding to the posttranslocation state, it catalyzes backward translocation to a pretranslocation state. When binding to the pretranslocation state, it catalyzes transition to another pretranslocation state that is similar and possibly identical to that resulting from the posttranslocation state bound by EF4, and competes with EF-G to regulate the elongation cycle. However, the molecular mechanism on how EF4 induces state transitions and mRNA translocation remains unclear. Here, we present both the model for state transitions induced by EF4 binding to the posttranslocation state and that by EF4 binding to the pretranslocation state, based on which we study the kinetics of EF4-induced state transitions and mRNA translocation, giving quantitative explanations of the available experimental data. Moreover, we present some predicted results on state transitions and mRNA translocation induced by EF4 binding to the pretranslocation state complexed with the mRNA containing a duplex region. (paper)

  13. Regulation of ribosomal RNA expression across the lifespan is fine-tuned by maternal diet before implantation.

    Denisenko, Oleg; Lucas, Emma S; Sun, Congshan; Watkins, Adam J; Mar, Daniel; Bomsztyk, Karol; Fleming, Tom P

    2016-07-01

    Cells and organisms respond to nutrient deprivation by decreasing global rates of transcription, translation and DNA replication. To what extent such changes can be reversed is largely unknown. We examined the effect of maternal dietary restriction on RNA synthesis in the offspring. Low protein diet fed either throughout gestation or for the preimplantation period alone reduced cellular RNA content across fetal somatic tissues during challenge and increased it beyond controls in fetal and adult tissues after challenge release. Changes in transcription of ribosomal RNA, the major component of cellular RNA, were responsible for this phenotype as evidenced by matching alterations in RNA polymerase I density and DNA methylation at ribosomal DNA loci. Cellular levels of the ribosomal transcription factor Rrn3 mirrored the rRNA expression pattern. In cell culture experiments, Rrn3 overexpression reduced rDNA methylation and increased rRNA expression; the converse occurred after inhibition of Rrn3 activity. These observations define novel mechanism where poor nutrition before implantation irreversibly alters basal rates of rRNA transcription thereafter in a process mediated by rDNA methylation and Rrn3 factor. PMID:27060415

  14. Low levels of ribosomal RNA partly account for the very high photosynthetic phosphorus-use efficiency of Proteaceae species.

    Sulpice, Ronan; Ishihara, Hirofumi; Schlereth, Armin; Cawthray, Gregory R; Encke, Beatrice; Giavalisco, Patrick; Ivakov, Alexander; Arrivault, Stéphanie; Jost, Ricarda; Krohn, Nicole; Kuo, John; Laliberté, Etienne; Pearse, Stuart J; Raven, John A; Scheible, Wolf-Rüdiger; Teste, François; Veneklaas, Erik J; Stitt, Mark; Lambers, Hans

    2014-06-01

    Proteaceae species in south-western Australia occur on phosphorus- (P) impoverished soils. Their leaves contain very low P levels, but have relatively high rates of photosynthesis. We measured ribosomal RNA (rRNA) abundance, soluble protein, activities of several enzymes and glucose 6-phosphate (Glc6P) levels in expanding and mature leaves of six Proteaceae species in their natural habitat. The results were compared with those for Arabidopsis thaliana. Compared with A. thaliana, immature leaves of Proteaceae species contained very low levels of rRNA, especially plastidic rRNA. Proteaceae species showed slow development of the photosynthetic apparatus (‘delayed greening’), with young leaves having very low levels of chlorophyll and Calvin-Benson cycle enzymes. In mature leaves, soluble protein and Calvin-Benson cycle enzyme activities were low, but Glc6P levels were similar to those in A. thaliana. We propose that low ribosome abundance contributes to the high P efficiency of these Proteaceae species in three ways: (1) less P is invested in ribosomes; (2) the rate of growth and, hence, demand for P is low; and (3) the especially low plastidic ribosome abundance in young leaves delays formation of the photosynthetic machinery, spreading investment of P in rRNA. Although Calvin-Benson cycle enzyme activities are low, Glc6P levels are maintained, allowing their effective use. PMID:24895754

  15. Purification and properties of new ribosome-inactivating proteins with RNA N-glycosidase activity.

    Bolognesi, A; Barbieri, L; Abbondanza, A; Falasca, A I; Carnicelli, D; Battelli, M G; Stirpe, F

    1990-11-30

    Ribosome-inactivating proteins (RIPs) similar to those already known (Stirpe & Barbieri (1986) FEBS Lett. 195, 1-8) were purified from the seeds of Asparagus officinalis (two proteins, asparin 1 and 2), of Citrullus colocynthis (two proteins, colocin 1 and 2), of Lychnis chalcedonica (lychnin) and of Manihot palmata (mapalmin), from the roots of Phytolacca americana (pokeweed antiviral protein from roots, PAP-R) and from the leaves of Bryonia dioica (bryodin-L). The two latter proteins can be considered as isoforms, respectively, of previously purified PAP, from the leaves of P. americana, and of bryodin-R, from the roots of B. dioica. All proteins have an Mr at approx, 30,000, and an alkaline isoelectric point. Bryodin-L, colocins, lychnin and mapalmin are glycoproteins. All RIPs inhibit protein synthesis by a rabbit reticulocyte lysate and phenylalanine polymerization by isolated ribosomes and alter rRNA in a similar manner as the A-chain of ricin and related toxins (Endo et al. (1987) J. Biol. Chem. 262, 5908-5912). PMID:2248976

  16. Biodiversity characterization of cellulolytic bacteria present on native Chaco soil by comparison of ribosomal RNA genes.

    Talia, Paola; Sede, Silvana M; Campos, Eleonora; Rorig, Marcela; Principi, Dario; Tosto, Daniela; Hopp, H Esteban; Grasso, Daniel; Cataldi, Angel

    2012-04-01

    Sequence analysis of the 16S ribosomal RNA gene was used to study bacterial diversity of a pristine forest soil and of two cultures of the same soil enriched with cellulolytic bacteria. Our analysis revealed high bacterial diversity in the native soil sample, evidencing at least 10 phyla, in which Actinobacteria, Proteobacteria and Acidobacteria accounted for more than 76% of all sequences. In both enriched samples, members of Proteobacteria were the most frequently represented. The majority of bacterial genera in both enriched samples were identified as Brevundimonas and Caulobacter, but members of Devosia, Sphingomonas, Variovorax, Acidovorax, Pseudomonas, Xanthomonas, Stenotrophomonas, Achromobacter and Delftia were also found. In addition, it was possible to identify cellulolytic taxa such as Acidothermus, Micromonospora, Streptomyces, Paenibacillus and Pseudomonas, which indicates that this ecosystem could be an attractive source for study of novel enzymes for cellulose degradation. PMID:22202170

  17. Competing pathways control host resistance to virus via tRNA modification and programmed ribosomal frameshifting.

    Maynard, Nathaniel D; Macklin, Derek N; Kirkegaard, Karla; Covert, Markus W

    2012-01-01

    Viral infection depends on a complex interplay between host and viral factors. Here, we link host susceptibility to viral infection to a network encompassing sulfur metabolism, tRNA modification, competitive binding, and programmed ribosomal frameshifting (PRF). We first demonstrate that the iron-sulfur cluster biosynthesis pathway in Escherichia coli exerts a protective effect during lambda phage infection, while a tRNA thiolation pathway enhances viral infection. We show that tRNA(Lys) uridine 34 modification inhibits PRF to influence the ratio of lambda phage proteins gpG and gpGT. Computational modeling and experiments suggest that the role of the iron-sulfur cluster biosynthesis pathway in infection is indirect, via competitive binding of the shared sulfur donor IscS. Based on the universality of many key components of this network, in both the host and the virus, we anticipate that these findings may have broad relevance to understanding other infections, including viral infection of humans. PMID:22294093

  18. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

    Ortega, Maya

    2010-01-01

    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  19. Evidence for functional interaction between domains II and V of 23S ribosomal RNA from an erythromycin-resistant mutant

    Douthwaite, S; Prince, J B; Noller, H F

    1985-01-01

    A mutation affording low levels of erythromycin resistance has been obtained by in vitro hydroxylamine mutagenesis of a cloned ribosomal RNA operon from Escherichia coli. The site of the mutational event responsible for antibiotic resistance was localized to the gene region encoding domain II of ...

  20. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  1. The ribosome triggers the stringent response by RelA via a highly distorted tRNA

    Agirrezabala, Xabier; Fernández, Israel S.; Kelley, Ann C.; Cartón, David Gil; Ramakrishnan, Venki; Valle, Mikel

    2013-01-01

    The bacterial stringent response is initiated by RelA and links nutrient starvation with the transcriptional control of genes. Cryo-EM now shows that RelA on the ribosome stabilizes an unusual distorted form of cognate, deacylated tRNA.

  2. The trypanosome Pumilio-domain protein PUF7 associates with a nuclear cyclophilin and is involved in ribosomal RNA maturation

    Droll, Dorothea; Archer, Stuart; Fenn, Katelyn; Delhi, Praveen; Matthews, Keith; Clayton, Christine

    2010-01-01

    Proteins with Pumilio RNA binding domains (Puf proteins) are ubiquitous in eukaryotes. Some Puf proteins bind to the 3′-untranslated regions of mRNAs, acting to repress translation and promote degradation; others are involved in ribosomal RNA maturation. The genome of Trypanosoma brucei encodes eleven Puf proteins whose function cannot be predicted by sequence analysis. We show here that epitope-tagged TbPUF7 is located in the nucleolus, and associated with a nuclear cyclophilin-like protein,...

  3. Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection

    Au, Hilda H.; Cornilescu, Gabriel; Mouzakis, Kathryn D.; Ren, Qian; Burke, Jordan E.; Lee, Seonghoon; Butcher, Samuel E.; Jan, Eric

    2015-01-01

    Viruses use alternate mechanisms to increase the coding capacity of their viral genomes. The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts an RNA structure that can direct translation in 0 and +1 reading frames to produce the viral structural proteins and an overlapping ORFx product. Here we provide structural and biochemical evidence that the PKI domain of the IRES mimics a complete tRNA-like structure to facilitate reading frame selection and allows the viral IR...

  4. Direct relationship between the level of p53 stabilization induced by rRNA synthesis-inhibiting drugs and the cell ribosome biogenesis rate.

    Scala, F; Brighenti, E; Govoni, M; Imbrogno, E; Fornari, F; Treré, D; Montanaro, L; Derenzini, M

    2016-02-25

    Many drugs currently used in chemotherapy work by hindering the process of ribosome biogenesis. In tumors with functional p53, the inhibition of ribosome biogenesis may contribute to the efficacy of this treatment by inducing p53 stabilization. As the level of stabilized p53 is critical for the induction of cytotoxic effects, it seems useful to highlight those cancer cell characteristics that can predict the degree of p53 stabilization following the treatment with inhibitors of ribosome biogenesis. In the present study we exposed a series of p53 wild-type human cancer cell lines to drugs such as actinomycin D (ActD), doxorubicin, 5-fluorouracil and CX-5461, which hinder ribosomal RNA (rRNA) synthesis. We found that the amount of stabilized p53 was directly related to the level of ribosome biogenesis in cells before the drug treatment. This was due to different levels of inactivation of the ribosomal proteins-MDM2 pathway of p53 digestion. Inhibition of rRNA synthesis always caused cell cycle arrest, independent of the ribosome biogenesis rate of the cells, whereas apoptosis occurred only in cells with a high rDNA transcription rate. The level of p53 stabilization induced by drugs acting in different ways from the inhibition of ribosome biogenesis, such as hydroxyurea (HU) and nutlin-3, was independent of the level of ribosome biogenesis in cells and always lower than that occurring after the inhibition of rRNA synthesis. Interestingly, in cells with a low ribosome biogenesis rate, the combined treatment with ActD and HU exerted an additive effect on p53 stabilization. These results indicated that (i) drugs inhibiting ribosome biogenesis may be highly effective in p53 wild-type cancers with a high ribosome biogenesis rate, as they induce apoptotic cell death, and (ii) the combination of drugs capable of stabilizing p53 through different mechanisms may be useful for treating cancers with a low ribosome biogenesis rate. PMID:25961931

  5. A mutation in the 530 loop of Escherichia coli 16S ribosomal RNA causes resistance to streptomycin.

    Melançon, P; Lemieux, C; Brakier-Gingras, L

    1988-01-01

    Oligonucleotide-directed mutagenesis was used to introduce an A to C transversion at position 523 in the 16S ribosomal RNA gene of Escherichia coli rrnB operon cloned in plasmid pKK3535. E. coli cells transformed with the mutated plasmid were resistant to streptomycin. The mutated ribosomes isolated from these cells were not stimulated by streptomycin to misread the message in a poly(U)-directed assay. They were also restrictive to the stimulation of misreading by other error-promoting relate...

  6. Chromosomal organization of the ribosomal RNA genes in the genus Chironomus (Diptera, Chironomidae

    Larisa Gunderina

    2015-05-01

    Full Text Available Chromosomal localization of ribosomal RNA coding genes has been studied by using FISH (fluorescence in situ hybridization in 21 species from the genus Chironomus Meigen, 1803. Analysis of the data has shown intra- and interspecific variation in number and location of 5.8S rDNA hybridization sites in 17 species from the subgenus Chironomus and 4 species from the subgenus Camptochironomus Kieffer, 1914. In the majority of studied species the location of rDNA sites coincided with the sites where active NORs (nucleolus organizer regions were found. The number of hybridization sites in karyotypes of studied chironomids varied from 1 to 6. More than half of the species possessed only one NOR (12 out of 21. Two rDNA hybridization sites were found in karyotypes of five species, three – in two species, and five and six sites – in one species each. NORs were found in all chromosomal arms of species from the subgenus Chironomus with one of them always located on arm G. On the other hand, no hybridization sites were found on arm G in four studied species from the subgenus Camptochironomus. Two species from the subgenus Chironomus – Ch. balatonicus Devai, Wuelker & Scholl, 1983 and Ch. “annularius” sensu Strenzke, 1959 – showed intraspecific variability in the number of hybridization signals. Possible mechanisms of origin of variability in number and location of rRNA genes in the karyotypes of species from the genus Chironomus are discussed.

  7. 8-Methoxypsoralen DNA interstrand cross-linking of the ribosomal RNA genes in Tetrahymena thermophila. Distribution, repair and effect on rRNA synthesis

    Fengquin, X; Nielsen, Henrik; Zhen, W;

    1993-01-01

    The distribution and repair of 8-methoxypsoralen-DNA interstrand cross-links in the ribosomal RNA genes (rDNA) in Tetrahymena thermophila have been studied in vivo by Southern blot analysis. It is found that the cross-links at a density of < or = 1/2 x 10(4) base pairs (bp) are distributed equall...

  8. 多浆旱生植物霸王18SrRNA基因的克隆及序列分析%Cloning and sequence analysis of 18S rRNA gene fragment from succulent xerophyte Zygophyllum xanthoxylum

    胡静; 谢俊仁; 王锁民

    2012-01-01

    In order to reveal the relationship between succulent xerophyte Zygophyllum xanthoxylum and other plants and to provide evidences for the biologically evolution, total DNA was extracted from leaves of Z. xanthoxylurn seedlings, and the 18S rRNA gene was cloned by PCR using general primers and cloned into pGEM-T vector. The positive clone identified by PCR was sequenced. The sequencing result revealed that the 18S rRNA gene fragment from Z. xanthoxylum contains 1808 bp. Homology comparison with other plants 18S rRNA gene sequences in the GenBank showed that it shared over 96% nucleotide sequence homology, so it is concluded that 18S rRNA is very conservative gene in plants. However, Homology matrix and Blast showed that Z. xanthoxylurn shared high similarity (98%) with the identified 18S rRNA in Galearia fili formis , Cnidoscolus aconiti folius and Hevea brasiliensis. Phylogenetic tree analysis indicated that Z. xanthoxylum and Panax notoginseng were most consanguineously grouped.%为探讨多浆旱生植物霸王(Zygophyllum xanthoxylum)的生物进化历程及与其他植物的亲缘关系,本研究以霸王叶基因组DNA为模板,使用通用引物扩增其18SrRNA基因片段,并克隆到pGEM—T载体,阳性克隆经鉴定后进行测序。核苷酸序列分析结果表明,该片段长1808bp,所得序列与GenBank中注册的18SrRNA基因序列的同源性均在96%以上。可见,高等植物18SrRNA的基因非常保守。同源性分析与Blast比较结果表明,霸王与小盘木(Galearia filiformis)、驱虫苋(Cnidoscolus aconitifolius)及橡胶树(Herera brasiliensis)同源性最高。系统进化树分析表明,霸王与三七(Panax notoginseng)的亲缘关系最近。

  9. Designed Regular Tetragon-Shaped RNA-Protein Complexes with Ribosomal Protein L1 for Bionanotechnology and Synthetic Biology.

    Ohno, Hirohisa; Inoue, Tan

    2015-05-26

    RNA nanotechnology has been established by employing the molecular architecture of RNA structural motifs. Here, we report two designed RNA-protein complexes (RNPs) composed of ribosomal protein L1 (RPL1) and its RNA-binding motif that are square-shaped nano-objects. The formation and the shape of the objects were confirmed by gel electrophoresis analysis and atomic force microscopy, respectively. Any protein can be attached to the RNA via a fusion protein with RPL1, indicating that it can be used as a scaffold for loading a variety of functional proteins or for building higher-order structures. In summary, the RNP object will serve as a useful tool in the fields of bionanotechnology and synthetic biology. Moreover, the RNP interaction enhances the RNA stability against nucleases, rendering these complexes stable in cells. PMID:25933202

  10. Engineering the rRNA decoding site of eukaryotic cytosolic ribosomes in bacteria

    Hobbie, S N; Kalapala, S K; Akshay, S.; Bruell, C M; S. Schmidt; Dabow, S; Vasella, A; Sander, P; Böttger, E C

    2007-01-01

    Structural and genetic studies on prokaryotic ribosomes have provided important insights into fundamental aspects of protein synthesis and translational control and its interaction with ribosomal drugs. Comparable mechanistic studies in eukaryotes are mainly hampered by the absence of both high-resolution crystal structures and efficient genetic models. To study the interaction of aminoglycoside antibiotics with selected eukaryotic ribosomes, we replaced the bacterial drug binding site in 16S...

  11. A phylogeny of the Passerida (Aves:Passeriformes) based on mitochondrial 12S ribosomal RNA gene

    Lina Wu; Yanfeng Sun; Juyong Li; Yaqing Li; Yuefeng Wu; and Dongming Li

    2015-01-01

    Background:Passerida is the largest avian radiation within the order Passeriformes. Current understanding of the high-level relationships within Passerida is based on DNA–DNA hybridizations;however, the phylogenetic relationships within this assemblage have been the subject of many debates. Methods:We analyzed the 12S ribosomal RNA gene from 49 species of Passerida, representing 14 currently recognized families, to outline the phylogenetic relationships within this group. Results:Our results identified the monophyly of the three superfamilies in Passerida:Sylvioidea, Muscicapoidea and Passeroidea. However, current delimitation of some species is at variance with our phylogeny estimate. First, the Parus major, which had been placed as a distinct clade sister to Sylvioidea was identified as a member of the super family;second, the genus Regulus was united with the Sturnidae and nested in the Muscicapoidea clade instead of being a clade of Passerida. Conclusion:Our results were consistent with Johansson’s study of the three superfamilies except for the al ocation of two families, Paridae and Regulidae.

  12. Cyanobacterial ribosomal RNA genes with multiple, endonuclease-encoding group I introns

    Turner Seán

    2007-09-01

    Full Text Available Abstract Background Group I introns are one of the four major classes of introns as defined by their distinct splicing mechanisms. Because they catalyze their own removal from precursor transcripts, group I introns are referred to as autocatalytic introns. Group I introns are common in fungal and protist nuclear ribosomal RNA genes and in organellar genomes. In contrast, they are rare in all other organisms and genomes, including bacteria. Results Here we report five group I introns, each containing a LAGLIDADG homing endonuclease gene (HEG, in large subunit (LSU rRNA genes of cyanobacteria. Three of the introns are located in the LSU gene of Synechococcus sp. C9, and the other two are in the LSU gene of Synechococcus lividus strain C1. Phylogenetic analyses show that these introns and their HEGs are closely related to introns and HEGs located at homologous insertion sites in organellar and bacterial rDNA genes. We also present a compilation of group I introns with homing endonuclease genes in bacteria. Conclusion We have discovered multiple HEG-containing group I introns in a single bacterial gene. To our knowledge, these are the first cases of multiple group I introns in the same bacterial gene (multiple group I introns have been reported in at least one phage gene and one prophage gene. The HEGs each contain one copy of the LAGLIDADG motif and presumably function as homodimers. Phylogenetic analysis, in conjunction with their patchy taxonomic distribution, suggests that these intron-HEG elements have been transferred horizontally among organelles and bacteria. However, the mode of transfer and the nature of the biological connections among the intron-containing organisms are unknown.

  13. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    Rosendahl, G; Douthwaite, S

    1993-01-01

    23 S rRNA. Within the ribosome, L11 also interacts with this rRNA region, although the protection effects are subtly different and extend to nucleotide 1098. The pentameric r-protein complex L10.(L12)4 binds to an adjacent site on the rRNA, protecting riboses at positions 1043, 1046 to 1049, 1053 to...... by L10.(L12)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  14. Casein Kinase 2 Associates with Initiation-Competent RNA Polymerase I and Has Multiple Roles in Ribosomal DNA Transcription

    Panova, Tatiana B; Panov, Kostya I.; Russell, Jackie; Zomerdijk, Joost C. B. M.

    2006-01-01

    Mammalian RNA polymerase I (Pol I) complexes contain a number of associated factors, some with undefined regulatory roles in transcription. We demonstrate that casein kinase 2 (CK2) in human cells is associated specifically only with the initiation-competent Pol Iβ isoform and not with Pol Iα. Chromatin immunoprecipitation analysis places CK2 at the ribosomal DNA (rDNA) promoter in vivo. Pol Iβ-associated CK2 can phosphorylate topoisomerase IIα in Pol Iβ, activator upstream binding factor (UB...

  15. The complete nucleotide sequence of a 16S ribosomal RNA gene from a blue-green alga, Anacystis nidulans.

    Tomioka, N; Sugiura, M

    1983-01-01

    The complete nucleotide sequence of a 16S ribosomal RNA gene from a blue-green alga, Anacystis nidulans, has been determined. Its coding region is estimated to be 1,487 base pairs long, which is nearly identical to those reported for chloroplast 16S rRNA genes and is about 4% shorter than that of the Escherichia coli gene. The 16S rRNA sequence of A. nidulans has 83% homology with that of tobacco chloroplast and 74% homology with that of E. coli. Possible stem and loop structures of A. nidulans 16S rRNA sequences resemble more closely those of chloroplast 16S rRNAs than those of E. coli 16S rRNA. These observations support the endosymbiotic theory of chloroplast origin. PMID:6412038

  16. Molecular phylogeny of silk-producing insects based on 16S ribosomal RNA and cytochrome oxidase subunit I genes

    B. Mahendran; S. K. Ghosh; S. C. Kundu

    2006-04-01

    We have examined the molecular-phylogenetic relationships between nonmulberry and mulberry silkwormspecies that belong to the families Saturniidae, Bombycidae and Lasiocampidae using 16S ribosomal RNA (16S rRNA) and cytochrome oxidase subunit I (coxI) gene sequences. Aligned nucleotide sequences of 16S rRNA and coxI from 14 silk-producing species were used for construction of phylogenetic trees by maximum likelihood and maximum parsimony methods. The tree topology on the basis of 16S rRNA supports monophyly for members of Saturniidae and Bombycidae. Weighted parsimony analysis weighted towards transversions relative to transitions (ts, tv4) for coxI resulted in more robust bootstrap support over unweighted parsimony and favours the 16S rRNA tree topology. Combined analysis reflected clear biogeographic pattern, and agrees with morphological and cytological data.

  17. Peptidyl transferase antibiotics perturb the relative positioning of the 3'-terminal adenosine of P/P'-site-bound tRNA and 23S rRNA in the ribosome

    Kirillov, S V; Porse, B T; Garrett, R A

    1999-01-01

    A range of antibiotic inhibitors that act within the peptidyl transferase center of the ribosome were examined for their capacity to perturb the relative positioning of the 3' end of P/P'-site-bound tRNA and the Escherichia coli ribosome. The 3'-terminal adenosines of deacylated tRNA and N......-ribosome complexes. It is concluded that the antibiotics perturb the relative positioning of the 3' end of the P/P'-site-bound tRNA and the peptidyl transferase loop region of 23S rRNA....

  18. A Long Noncoding RNA on the Ribosome Is Required for Lifespan Extension

    Essers, Paul B; Nonnekens, Julie; Goos, Yvonne J; Betist, Marco C; Viester, Marjon D; Mossink, Britt; Lansu, Nico; Korswagen, Hendrik C; Jelier, Rob; Brenkman, Arjan B; MacInnes, Alyson W

    2015-01-01

    The biogenesis of ribosomes and their coordination of protein translation consume an enormous amount of cellular energy. As such, it has been established that the inhibition of either process can extend eukaryotic lifespan. Here, we used next-generation sequencing to compare ribosome-associated RNAs

  19. A transgenic mouse line for collecting ribosome-bound mRNA using the tetracycline transactivator system

    Laurel Drane

    2014-10-01

    Full Text Available Acquiring the gene expression profiles of specific neuronal cell-types is important for understanding their molecular identities. Genome-wide gene expression profiles of genetically defined cell-types can be acquired by collecting and sequencing mRNA that is bound to epitope-tagged ribosomes (TRAP; Translating Ribosome Affinity Purification. Here, we introduce a transgenic mouse model that combines the TRAP technique with the tetracycline transactivator (tTA system by expressing EGFP-tagged ribosomal protein L10a (EGFP-L10a under control of the tetracycline response element (tetO-TRAP. This allows both spatial control of EGFP-L10a expression through cell-type specific tTA expression, as well as temporal regulation by inhibiting transgene expression through the administration of doxycycline. We show that crossing tetO-TRAP mice with transgenic mice expressing tTA under the Camk2a promoter (Camk2a-tTA results in offspring with cell-type specific expression of EGFP-L10a in CA1 pyramidal neurons and medium spiny neurons in the striatum. Co-immunoprecipitation confirmed that EGFP-L10a integrates into a functional ribosomal complex. In addition, collection of ribosome-bound mRNA from the hippocampus yielded the expected enrichment of genes expressed in CA1 pyramidal neurons, as well as a depletion of genes expressed in other hippocampal cell-types. Finally, we show that crossing tetO-TRAP mice with transgenic Fos-tTA mice enables the expression of EGFP-L10a in CA1 pyramidal neurons that are activated during a fear conditioning trial. The tetO-TRAP mouse can be combined with other tTA mouse lines to enable gene expression profiling of a variety of different cell-types.

  20. ColE1 cloning of a ribosomal RNA promoter region from lambdarifsup(d)18 by selection for lambda integration and excision functions

    The expression of the ribosomal RNA gene carried by the lambda transducing phage lambdarifsup(d)18 is shown to be subject to stringent amino acid control. lambdarifsup(d)18 DNA was digested with endonuclease EcoRI and ligated to similarly restricted ColE1 plasmid DNA. Selection for expression of lambda integration and excision gene activity carried by the same DNA fragment results in cloning of the promoter proximal portion of the 16S ribosomal RNA gene. The resulting chimera expresses lambda integration and excision functions as well as encoding the promoter proximal half of a 16S ribosomal RNA gene. The effect of ultraviolet dose on stringent control of phage lambdarifsup(d)18 dependent ribosomal RNA synthesis is included in the investigation. (Auth.)

  1. The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis

    Cole, J. R.; Chai, B.; Farris, R. J.; Wang, Q; Kulam, S. A.; McGarrell, D. M.; Garrity, G M; Tiedje, J M

    2004-01-01

    The Ribosomal Database Project (RDP-II) provides the research community with aligned and annotated rRNA gene sequences, along with analysis services and a phylogenetically consistent taxonomic framework for these data. Updated monthly, these services are made available through the RDP-II website (http://rdp.cme.msu.edu/). RDP-II release 9.21 (August 2004) contains 101 632 bacterial small subunit rRNA gene sequences in aligned and annotated format. High-throughput tools for initial taxonomic p...

  2. NMR structure of the A. aeolicus tmRNA pseudoknot PK1: new insights into the recoding event of the ribosomal trans-translation.

    Nonin-Lecomte, Sylvie; Felden, Brice; Dardel, Frédéric

    2006-01-01

    The transfer-messenger RNA (tmRNA) pseudoknot PK1 is essential for bacterial trans-translation, a ribosomal rescue mechanism. We report the solution structure of PK1 from Aquifex aeolicus, which despite an unprecedented small number of nucleotides and thus an unprecented compact size, displays a very high thermal stability. Several unusual structural features account for these properties and indicate that PK1 belongs to the class of ribosomal frameshift pseudoknots. This suggests a similarity...

  3. Seasonal succession leads to habitat-dependent differentiation in ribosomal RNA:DNA ratios among freshwater lake bacteria

    Vincent J Denef

    2016-04-01

    Full Text Available Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP. Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA gene sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. However, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.

  4. Seasonal Succession Leads to Habitat-Dependent Differentiation in Ribosomal RNA:DNA Ratios among Freshwater Lake Bacteria

    Denef, Vincent J.; Fujimoto, Masanori; Berry, Michelle A.; Schmidt, Marian L.

    2016-01-01

    Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP). Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA gene sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate) water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. However, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors. PMID:27199936

  5. Elongation in translation as a dynamic interaction among the ribosome, tRNA, and elongation factors EF-G and EF-Tu

    Agirrezabala, Xabier; Frank, Joachim

    2009-01-01

    The ribosome is a complex macromolecular machine that translates the message encoded in the messenger RNA and synthesizes polypeptides by linking the individual amino acids carried by the cognate transfer RNAs (tRNAs). The protein elongation cycle, during which the tRNAs traverse the ribosome in a coordinated manner along a path of more than 100 Å, is facilitated by large-scale rearrangements of the ribosome. These rearrangements go hand in hand with conformational changes of tRNA as well as ...

  6. De novo Synthesis and Assembly of rRNA into Ribosomal Subunits during Cold Acclimation in Escherichia coli.

    Piersimoni, Lolita; Giangrossi, Mara; Marchi, Paolo; Brandi, Anna; Gualerzi, Claudio O; Pon, Cynthia L

    2016-04-24

    During the cold adaptation that follows a cold stress, bacterial cells undergo many physiological changes and extensive reprogramming of their gene expression pattern. Bulk gene expression is drastically reduced, while a set of cold shock genes is selectively and transiently expressed. The initial stage of cold acclimation is characterized by the establishment of a stoichiometric imbalance of the translation initiation factors (IFs)/ribosomes ratio that contributes to the preferential translation of cold shock transcripts. Whereas de novo synthesis of the IFs following cold stress has been documented, nothing was known concerning the activity of the rrn operons during the cold acclimation period. In this work, we focus on the expression of the rrn operons and the fate of rRNA after temperature downshift. We demonstrate that in Escherichia coli, rRNA synthesis does not stop during the cold acclimation phase, but continues with greater contribution of the P2 compared to the P1 promoter and all seven rrn operons are active, although their expression levels change with respect to pre-stress conditions. Eight hours after the 37°→10°C temperature downshift, the newly transcribed rRNA represents up to 20% of total rRNA and is preferentially found in the polysomes. However, with respect to the de novo synthesis of the IFs, both rRNA transcription and maturation are slowed down drastically by cold stress, thereby accounting in part for the stoichiometric imbalance of the IFs/ribosomes. Overall, our data indicate that new ribosomes, which are possibly suitable to function at low temperature, are slowly assembled during cold acclimation. PMID:26953262

  7. Activation of ribosomal RNA genes in porcine embryos produced in vitro or by somatic cell nuclear transfer

    Bjerregaard, Bolette; Pedersen, Hanne Gervi; Jakobsen, Anne Sørig;

    2007-01-01

    The onset of ribosomal RNA (rRNA) synthesis occurs during the second half of the third cell cycle, that is, at the four-cell stage, in porcine embryos developed in vivo. In the present study the onset of rRNA synthesis was investigated in porcine embryos produced in vitro (IVP) or by somatic cell...... were equal proportions of transcriptionally active and inactive embryos and essentially all embryos that developed to the 16-cell stage (n = 21) and further to the blastocyst stage (n = 19) contained only transcriptionally active cells. In conclusion, porcine embryos produced in vitro had an......-cell stage (n = 45), 38% of the embryos contained 1-3 nuclei with signs of rRNA transcription, indicating an asynchronous transcription initiation. This pattern continued in the following stages, as 78% (n = 47), 47% (n = 42) and 83% (n = 37) of the embryos revealed a mixture of transcriptionally inactive...

  8. Elongation in translation as a dynamic interaction among the ribosome, tRNA, and elongation factors EF-G and EF-Tu.

    Agirrezabala, Xabier; Frank, Joachim

    2009-08-01

    The ribosome is a complex macromolecular machine that translates the message encoded in the messenger RNA and synthesizes polypeptides by linking the individual amino acids carried by the cognate transfer RNAs (tRNAs). The protein elongation cycle, during which the tRNAs traverse the ribosome in a coordinated manner along a path of more than 100 A, is facilitated by large-scale rearrangements of the ribosome. These rearrangements go hand in hand with conformational changes of tRNA as well as elongation factors EF-Tu and EF-G - GTPases that catalyze tRNA delivery and translocation, respectively. This review focuses on the structural data related to the dynamics of the ribosomal machinery, which are the basis, in conjunction with existing biochemical, kinetic, and fluorescence resonance energy transfer data, of our knowledge of the decoding and translocation steps of protein elongation. PMID:20025795

  9. Effect of ultraviolet irradiation on 30-S ribosomal subunits. Identification of the RNA region crosslinked to protein S7

    The effects of ultraviolet irradiation on Escherichia coli 30-S ribosomal subunits were studied. At the doses of radiation used in this work (0-4.5 x 105 quanta/30-S subunit), only protein S7 was found to be significantly crosslinked to the 16-S RNA. In conditions where 25% of the protein was covalently crosslinked, the ability of the irradiated 30-S subunits to reassociate with 50-S subunits and their activity in polyphenylalanine synthesis decreased strongly. Similar results were obtained by irradiation with a germicide lamp (254 nm) or with a monochromatic ultraviolet light at 248 nm. No additional proteins were crosslinked to the 16-S RNA by irradiating 30-S subunits depleted in protein S1 or 70-S ribosomes. The covalent complex of 16-S RNA and protein S7 was isolated and digested by T1 ribonuclease. The oligonucleotide remaining attached to the crosslinked protein was characterised as A-C-C-U-C-G (position 1261-1266, see the sequence published by Carbon et al. (1979) Eur. J. Biochem. 160, 399-410). Analysis of this fragment suggests that protein S7 was linked to the cytosine at position 1265 in the RNA sequence. (orig.)

  10. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    Poulsen, S M; Karlsson, M; Johansson, L B;

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are...... strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...

  11. Slow formation of stable complexes during coincubation of minimal rRNA and ribosomal protein S4.

    Mayerle, Megan; Bellur, Deepti L; Woodson, Sarah A

    2011-09-23

    Ribosomal protein S4 binds and stabilizes a five-helix junction or five-way junction (5WJ) in the 5' domain of 16S ribosomal RNA (rRNA) and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and 5WJ reorganize their structures. We show that labile S4 complexes rearrange into stable complexes within a few minutes at 42 °C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show that this structural change depends only on 16S residues within the S4 binding site. SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension) chemical probing experiments showed that S4 strongly stabilizes 5WJ and the helix (H) 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in H16 that makes specific contacts with the S4 N-terminal extension, as well as a right-angle motif between H3, H4, and H18, requires a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of H3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  12. Conservation and loss of ribosomal RNA gene sites in diploid and polyploid Fragaria (Rosaceae

    Liu Bo

    2011-11-01

    Full Text Available Abstract Background The genus Fragaria comprises species at ploidy levels ranging from diploid (2n = 2x = 14 to decaploid (2n = 10x = 70. Fluorescence in situ hybridization with 5S and 25S rDNA probes was performed to gather cytogenetic information that illuminates genomic divergence among different taxa at multiple ploidy levels, as well as to explore the evolution of ribosomal RNA genes during polyploidization in Fragaria. Results Root tip cells of diploid taxa were typified by two 5S and six 25S rDNA hybridization signals of varying intensities, providing a baseline for comparisons within the genus. In three exceptional diploid genotypes, F. nilgerrensis (CFRA 1358 and CFRA 1825 and F. vesca 'Yellow Wonder', two 5S but only four 25S rDNA sites were found but with differing site losses. The numbers of 5S and 25S rDNA signals, respectively were three and nine in a triploid F. ×bifera accession, and were four and twelve in three tetraploids, thus occurring in proportional 1.5× and 2× multiples of the typical diploid pattern. In hexaploid F. moschata, a proportional multiple of six 5S rDNA sites was observed, but the number of 25S rDNA sites was one or two less than the proportionate prediction of eighteen. This apparent tendency toward rDNA site loss at higher ploidy was markedly expanded in octoploids, which displayed only two 5S and ten 25S rDNA sites. In the two decaploids examined, the numbers of 5S and 25S rDNA signals, respectively, were four and fifteen in F. virginiana subsp. platypetala, and six and twelve in F. iturupensis. Conclusions Among diploid Fragaria species, a general consistency of rDNA site numbers implies conserved genomic organization, but highly variable 25S signal sizes and intensities and two instances of site loss suggest concurrent high dynamics of rDNA copy numbers among both homologs and non-homologs. General conservation of rDNA site numbers in lower ploidy, but marked site number reductions at higher ploidy

  13. Detection of Aspergillus fumigatus pulmonary fungal infections in mice with 99mTc-labeled MORF oligomers targeting ribosomal RNA

    Purpose: Invasive aspergillosis is a major cause of infectious morbidity and mortality in immunocompromised patients. The fungus Aspergillus fumigatus (A. fumigatus) is the primary causative agent of invasive aspergillosis. However, A. fumigatus infections remain difficult to diagnose particularly in the early stages due to the lack of a rapid, sensitive and specific diagnostic approach. In this study, we investigated 99mTc labeled MORF oligomers targeting fungal ribosomal RNA (rRNA) for the imaging detection of fungal infections. Procedures: Three phosphorodiamidate morpholino (MORF) oligomer (a DNA analogue) probes were designed: AGEN, complementary to a sequence of the fungal 28S ribosomal RNA (rRNA) of Aspergillus, as a genus-specific probe; AFUM, complementary to the 28S rRNA sequence of A. fumigatus, as a fungus species-specific probe; and cMORF, irrelevant to all fungal species, as a control probe. The probes were conjugated with Alexa Fluor 633 carboxylic acid succinimidyl ester (AF633) for fluorescence imaging or with NHS-mercaptoacetyl triglycine (NHS-MAG3) for nuclear imaging with 99mTc and then evaluated in vitro and in vivo. Results: The specific binding of AGEN and AFUM to fungal total RNA was confirmed by dot blot hybridization while specific binding of AGEN and AFUM in fixed and live A. fumigatus was demonstrated by both fluorescent in situ hybridization (FISH) analysis and accumulation in live cells. SPECT imaging of BALB/c mice with pulmonary A. fumigatus infections and administered 99mTc labeled AGEN and AFUM showed immediate and obvious accumulation in the infected lungs, while no significant accumulation of the control 99mTc-cMORF in the infected lung was observed. Compared to non-infected mice, with sacrifice at 1 h, the accumulation of 99mTc-AGEN and 99mTc-AFUM in the lungs of mice infected with A. fumigatus was 2 and 2.7 fold higher respectively. Conclusions: In vivo targeting fungal ribosomal RNA with 99mTc labeled MORF probes AGEN and AFUM

  14. Quinacrine impairs enterovirus 71 RNA replication by preventing binding of polypyrimidine-tract binding protein with internal ribosome entry sites.

    Jianmin Wang

    Full Text Available Since the 1980s, epidemics of enterovirus 71 (EV71 and other enteroviruses have occurred in Asian countries and regions, causing a wide range of human diseases. No effective therapy is available for the treatment of these infections. Internal ribosome entry sites (IRESs are indispensable for the initiation of translation in enteroviruses. Several cellular factors, as well as the ribosome, are recruited to the conserved IRES during this process. Quinacrine intercalates into the RNA architecture and inhibits RNA transcription and protein synthesis, and a recent study showed that quinacrine inhibited encephalomyocarditis virus and poliovirus IRES-mediated translation in vitro without disrupting internal cellular IRES. Here, we report that quinacrine was highly active against EV71, protecting cells from EV71 infection. Replication of viral RNA, expression of viral capsid protein, and production of virus were all strongly inhibited by quinacrine. Interaction of the polypyrimidine tract-binding protein (PTB with the conserved IRES was prevented by quinacrine. Coxsackieviruses and echovirus were also inhibited by quinacrine in cultured cells. These results indicate that quinacrine may serve as a potential protective agent for use in the treatment of patients with chronic enterovirus infection.

  15. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.

    2011-01-01

    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show this structural change depends only on 16S residues within the S4 binding site. SHAPE chemical-probing experiments showed that S4 strongly stabilizes the five-helix junction and helix 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in helix 16 that makes specific contacts with the S4 N-terminal extension, and a right angle motif between helices 3, 4 and 18, require a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of helix 3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  16. Physical Mapping of the 5S Ribosomal RNA Gene in Citreae of Aurantioideae Species using Fluorescence in situ Hybridization

    Yamamoto, Masashi; Asad Asadi Abkenar; Matsumoto, Ryoji; KUBO, Tatsuya; TOMINAGA, Shigeto; ヤマモト, マサシ; マツモト, リョウジ; クボ, タツヤ; トミナガ, シゲト; 山本, 雅史; 松本, 亮司; 久保, 達也; 冨永, 茂人

    2009-01-01

    The location of the 5S ribosomal RNA gene (rDNA) in species from six genera of the Citreae of Aurantioideae was determined using fluorescence in situ hybridization (FISH). A 5S rDNA probe was labeled with biotin-16-dUTP. The probe was detected using a fluorescein isothiocyanate (FITC)-avidin conjugate with chromosomes counterstained with propidium iodide (PI). When the chromosomes were observed under a G filter, PI-stained chromosomes were classified into the following five types based on the...

  17. Genetic Analysis of the Invariant Residue G791 in Escherichia coli 16S rRNA Implicates RelA in Ribosome Function▿

    Kim, Hong-Man; Ryou, Sang-Mi; Song, Woo-Seok; Sim, Se-Hoon; Cha, Chang-Jun; Han, Seung Hyun; Ha, Nam-Chul; Kim, Jae-Hong; BAE, Jeehyeon; Cunningham, Philip R.; Lee, Kangseok

    2009-01-01

    Previous studies identified G791 in Escherichia coli 16S rRNA as an invariant residue for ribosome function. In order to establish the functional role of this residue in protein synthesis, we searched for multicopy suppressors of the mutant ribosomes that bear a G-to-U substitution at position 791. We identified relA, a gene whose product has been known to interact with ribosomes and trigger a stringent response. Overexpression of RelA resulted in the synthesis of approximately 1.5 times more...

  18. Dysfunction in Ribosomal Gene Expression in the Hypothalamus and Hippocampus following Chronic Social Defeat Stress in Male Mice as Revealed by RNA-Seq

    Smagin, Dmitry A.; Kovalenko, Irina L.; Galyamina, Anna G.; Bragin, Anatoly O.; Orlov, Yuriy L.; Natalia N. Kudryavtseva

    2016-01-01

    Chronic social defeat stress leads to the development of anxiety- and depression-like states in male mice and is accompanied by numerous molecular changes in brain. The influence of 21-day period of social stress on ribosomal gene expression in five brain regions was studied using the RNA-Seq database. Most Rps, Rpl, Mprs, and Mprl genes were upregulated in the hypothalamus and downregulated in the hippocampus, which may indicate ribosomal dysfunction following chronic social defeat stress. T...

  19. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA in the Asteraceae family

    Garcia Sònia

    2010-08-01

    Full Text Available Abstract Background In flowering plants and animals the most common ribosomal RNA genes (rDNA organisation is that in which 35S (encoding 18S-5.8S-26S rRNA and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae, a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing, gene copy number (quantitative PCR and chromosomal position (FISH of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases, tribe Gnaphalieae (100% and in the "Heliantheae alliance" (23%. The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic

  20. Slip of grip of a molecular motor on a crowded track: Modeling shift of reading frame of ribosome on RNA template

    Mishra, Bhavya; Chowdhury, Debashish

    2016-01-01

    We develop a stochastic model for the programmed frameshift of ribosomes synthesizing a protein while moving along a mRNA template. Normally the reading frame of a ribosome decodes successive triplets of nucleotides on the mRNA in a step-by-step manner. We focus on the programmed shift of the ribosomal reading frame, forward or backward, by only one nucleotide which results in a fusion protein; it occurs when a ribosome temporarily loses its grip to its mRNA track. Special "slippery" sequences of nucleotides and also downstream secondary structures of the mRNA strand are believed to play key roles in programmed frameshift. Here we explore the role of an hitherto neglected parameter in regulating -1 programmed frameshift. Specifically, we demonstrate that the frameshift frequency can be strongly regulated also by the density of the ribosomes, all of which are engaged in simultaneous translation of the same mRNA, at and around the slippery sequence. Monte Carlo simulations support the analytical predictions obt...

  1. Ribosome recycling induces optimal translation rate at low ribosomal availability

    Marshall, E.; Stansfield, I; Romano, M. C.

    2014-01-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3′ end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called ‘closed-loop’ model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces ...

  2. A pseudouridylation switch in rRNA is implicated in ribosome function during the life cycle of Trypanosoma brucei.

    Chikne, Vaibhav; Doniger, Tirza; Rajan, K Shanmugha; Bartok, Osnat; Eliaz, Dror; Cohen-Chalamish, Smadar; Tschudi, Christian; Unger, Ron; Hashem, Yaser; Kadener, Sebastian; Michaeli, Shulamit

    2016-01-01

    The protozoan parasite Trypanosoma brucei, which causes devastating diseases in humans and animals in sub-Saharan Africa, undergoes a complex life cycle between the mammalian host and the blood-feeding tsetse fly vector. However, little is known about how the parasite performs most molecular functions in such different environments. Here, we provide evidence for the intriguing possibility that pseudouridylation of rRNA plays an important role in the capacity of the parasite to transit between the insect midgut and the mammalian bloodstream. Briefly, we mapped pseudouridines (Ψ) on rRNA by Ψ-seq in procyclic form (PCF) and bloodstream form (BSF) trypanosomes. We detected 68 Ψs on rRNA, which are guided by H/ACA small nucleolar RNAs (snoRNA). The small RNome of both life cycle stages was determined by HiSeq and 83 H/ACAs were identified. We observed an elevation of 21 Ψs modifications in BSF as a result of increased levels of the guiding snoRNAs. Overexpression of snoRNAs guiding modification on H69 provided a slight growth advantage to PCF parasites at 30 °C. Interestingly, these modifications are predicted to significantly alter the secondary structure of the large subunit (LSU) rRNA suggesting that hypermodified positions may contribute to the adaption of ribosome function during cycling between the two hosts. PMID:27142987

  3. Stem–loop structures can effectively substitute for an RNA pseudoknot in −1 ribosomal frameshifting

    Yu, Chien-Hung; Noteborn, Mathieu H.; Pleij, Cornelis W. A.; Olsthoorn, René C. L.

    2011-01-01

    −1 Programmed ribosomal frameshifting (PRF) in synthesizing the gag-pro precursor polyprotein of Simian retrovirus type-1 (SRV-1) is stimulated by a classical H-type pseudoknot which forms an extended triple helix involving base–base and base–sugar interactions between loop and stem nucleotides. Recently, we showed that mutation of bases involved in triple helix formation affected frameshifting, again emphasizing the role of the triple helix in −1 PRF. Here, we investigated the efficiency of ...

  4. The majority of total nuclear-encoded non-ribosomal RNA in a human cell is 'dark matter' un-annotated RNA

    Milos Patrice

    2010-12-01

    Full Text Available Abstract Background Discovery that the transcriptional output of the human genome is far more complex than predicted by the current set of protein-coding annotations and that most RNAs produced do not appear to encode proteins has transformed our understanding of genome complexity and suggests new paradigms of genome regulation. However, the fraction of all cellular RNA whose function we do not understand and the fraction of the genome that is utilized to produce that RNA remain controversial. This is not simply a bookkeeping issue because the degree to which this un-annotated transcription is present has important implications with respect to its biologic function and to the general architecture of genome regulation. For example, efforts to elucidate how non-coding RNAs (ncRNAs regulate genome function will be compromised if that class of RNAs is dismissed as simply 'transcriptional noise'. Results We show that the relative mass of RNA whose function and/or structure we do not understand (the so called 'dark matter' RNAs, as a proportion of all non-ribosomal, non-mitochondrial human RNA (mt-RNA, can be greater than that of protein-encoding transcripts. This observation is obscured in studies that focus only on polyA-selected RNA, a method that enriches for protein coding RNAs and at the same time discards the vast majority of RNA prior to analysis. We further show the presence of a large number of very long, abundantly-transcribed regions (100's of kb in intergenic space and further show that expression of these regions is associated with neoplastic transformation. These overlap some regions found previously in normal human embryonic tissues and raises an interesting hypothesis as to the function of these ncRNAs in both early development and neoplastic transformation. Conclusions We conclude that 'dark matter' RNA can constitute the majority of non-ribosomal, non-mitochondrial-RNA and a significant fraction arises from numerous very long

  5. The Structure of Aquifex aeolicus Ribosomal Protein S8 Reveals a Unique Subdomain That Contributes to Extremely-Tight Association With 16S rRNA

    Menichelli, Elena; Edgcomb, Stephen P.; Recht, Michael I.; Williamson, James R.

    2011-01-01

    The assembly of ribonucleoprotein complexes occurs in a broad range of conditions, but the principles that promote assembly and allow function at high temperature are poorly understood. The ribosomal protein S8 from the hyperthemophilic bacterium Aquifex aeolicus (AS8) is unique in that there is a 41 residue insertion in the consensus S8 sequence. In addition, AS8 exhibits an unusually-high affinity for the 16S ribosomal RNA (rRNA), characterized by a picomolar dissociation constant that is a...

  6. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    The peptidyl transfer site has been localized at the centre of domain V of 23S-like ribosomal RNA (rRNA) primarily on the basis of a chloramphenicol binding site. The implicated region constitutes an unstructured circle in the current secondary structural model which contains several universally....... In addition, a G2502----A transition caused a decreased growth rate, probably due to a partial selection against mutant ribosome incorporation into polysomes, while an A2503----C transversion produced a decreased growth rate and conferred resistance to chloramphenicol. All of the mutant RNAs were...

  7. Complete Sequence Construction of the Highly Repetitive Ribosomal RNA Gene Repeats in Eukaryotes Using Whole Genome Sequence Data.

    Agrawal, Saumya; Ganley, Austen R D

    2016-01-01

    The ribosomal RNA genes (rDNA) encode the major rRNA species of the ribosome, and thus are essential across life. These genes are highly repetitive in most eukaryotes, forming blocks of tandem repeats that form the core of nucleoli. The primary role of the rDNA in encoding rRNA has been long understood, but more recently the rDNA has been implicated in a number of other important biological phenomena, including genome stability, cell cycle, and epigenetic silencing. Noncoding elements, primarily located in the intergenic spacer region, appear to mediate many of these phenomena. Although sequence information is available for the genomes of many organisms, in almost all cases rDNA repeat sequences are lacking, primarily due to problems in assembling these intriguing regions during whole genome assemblies. Here, we present a method to obtain complete rDNA repeat unit sequences from whole genome assemblies. Limitations of next generation sequencing (NGS) data make them unsuitable for assembling complete rDNA unit sequences; therefore, the method we present relies on the use of Sanger whole genome sequence data. Our method makes use of the Arachne assembler, which can assemble highly repetitive regions such as the rDNA in a memory-efficient way. We provide a detailed step-by-step protocol for generating rDNA sequences from whole genome Sanger sequence data using Arachne, for refining complete rDNA unit sequences, and for validating the sequences obtained. In principle, our method will work for any species where the rDNA is organized into tandem repeats. This will help researchers working on species without a complete rDNA sequence, those working on evolutionary aspects of the rDNA, and those interested in conducting phylogenetic footprinting studies with the rDNA. PMID:27576718

  8. Dysfunction in Ribosomal Gene Expression in the Hypothalamus and Hippocampus following Chronic Social Defeat Stress in Male Mice as Revealed by RNA-Seq.

    Smagin, Dmitry A; Kovalenko, Irina L; Galyamina, Anna G; Bragin, Anatoly O; Orlov, Yuriy L; Kudryavtseva, Natalia N

    2016-01-01

    Chronic social defeat stress leads to the development of anxiety- and depression-like states in male mice and is accompanied by numerous molecular changes in brain. The influence of 21-day period of social stress on ribosomal gene expression in five brain regions was studied using the RNA-Seq database. Most Rps, Rpl, Mprs, and Mprl genes were upregulated in the hypothalamus and downregulated in the hippocampus, which may indicate ribosomal dysfunction following chronic social defeat stress. There were no differentially expressed ribosomal genes in the ventral tegmental area, midbrain raphe nuclei, or striatum. This approach may be used to identify a pharmacological treatment of ribosome biogenesis abnormalities in the brain of patients with "ribosomopathies." PMID:26839715

  9. Physical and biochemical nature of the bacterial cytoplasm: movement and localization of mRNA and the 30S subunits of ribosomes.

    Trevors, J T

    2012-05-01

    There is a paucity of knowledge on how mRNA transcripts in the spatially crowded, but molecularly organized bacterial cytoplasm contact the 30S ribosomal subunits. Does simple diffusion in the cytoplasm account for transcript-ribosome interactions given that a large number of ribosomes (e.g., about 72,000 in Escherichia coli during exponential growth) can be present in the cytoplasm? Or are undiscovered mechanisms present where specific transcripts are directed to specific ribosomes at specific cytoplasmic locations, while others are mobilized in a random manner? Moreover, is it possible that cytoplasmic mobilization occurs in bacteria, driven possibly by thermal infrared (IR) radiation and the generation of exclusion zone (EZ) water? These aspects will be discussed in this article and hypotheses presented. PMID:22710107

  10. Photochemical cross-linking of tRNA/sup Phe/ modified at A76 and A73 to the Escherichia coli ribosome

    [5'-32P]-8-azidoadenosine 3',5'-bisphosphate ([5'-32P]p(N3)Ap) has been prepared using a simple two-step procedure: alkaline hydrolysis of 8-azidoadenosine 3',5'-cyclic monophosphate followed by labeling of the resulting 3'-mononucleotide with 32P at the 5' position using [γ-32P]ATP and T4 polynucleotide kinase. [5'-32P]p(N3)Ap has proven to be an excellent substrate for T4 RNA ligase. To study the environment of the 3' end of tRNA on bacterial ribosomes, nucleosides A76 and A73 in yeast tRNA/sup Phe/ were replaced with their 8-azido derivatives. This was achieved by stepwise removal of 3'-terminal nucleosides from the tRNA using the Whitfield procedure, incorporation of [5'-32P]p(N3)Ap into appropriately degraded tRNA with T4 RNA ligase, and restoration of the CCA/sub OH/ terminus with yeast nucleotidyl transferase. The modified tRNAs were bound to the A or P site of Escherichia coli ribosomes programmed with poly(U). UV irradiation produced covalent, zero-length cross-links between the tRNA and neighboring ribosomal components. The tRNA derivative containing (N3)A73 became attached exclusively to proteins of the 50S subunit whose identity is currently under investigation

  11. Predicted class-I aminoacyl tRNA synthetase-like proteins in non-ribosomal peptide synthesis

    Iyer Lakshminarayan M

    2010-08-01

    Full Text Available Abstract Background Recent studies point to a great diversity of non-ribosomal peptide synthesis systems with major roles in amino acid and co-factor biosynthesis, secondary metabolism, and post-translational modifications of proteins by peptide tags. The least studied of these systems are those utilizing tRNAs or aminoacyl-tRNA synthetases (AAtRS in non-ribosomal peptide ligation. Results Here we describe novel examples of AAtRS related proteins that are likely to be involved in the synthesis of widely distributed peptide-derived metabolites. Using sensitive sequence profile methods we show that the cyclodipeptide synthases (CDPSs are members of the HUP class of Rossmannoid domains and are likely to be highly derived versions of the class-I AAtRS catalytic domains. We also identify the first eukaryotic CDPSs in fungi and in animals; they might be involved in immune response in the latter organisms. We also identify a paralogous version of the methionyl-tRNA synthetase, which is widespread in bacteria, and present evidence using contextual information that it might function independently of protein synthesis as a peptide ligase in the formation of a peptide- derived secondary metabolite. This metabolite is likely to be heavily modified through multiple reactions catalyzed by a metal-binding cupin domain and a lysine N6 monooxygenase that are strictly associated with this paralogous methionyl-tRNA synthetase (MtRS. We further identify an analogous system wherein the MtRS has been replaced by more typical peptide ligases with the ATP-grasp or modular condensation-domains. Conclusions The prevalence of these predicted biosynthetic pathways in phylogenetically distant, pathogenic or symbiotic bacteria suggests that metabolites synthesized by them might participate in interactions with the host. More generally, these findings point to a complete spectrum of recruitment of AAtRS to various non-ribosomal biosynthetic pathways, ranging from the

  12. Structural insights into ribosome translocation.

    Ling, Clarence; Ermolenko, Dmitri N

    2016-09-01

    During protein synthesis, tRNA and mRNA are translocated from the A to P to E sites of the ribosome thus enabling the ribosome to translate one codon of mRNA after the other. Ribosome translocation along mRNA is induced by the universally conserved ribosome GTPase, elongation factor G (EF-G) in bacteria and elongation factor 2 (EF-2) in eukaryotes. Recent structural and single-molecule studies revealed that tRNA and mRNA translocation within the ribosome is accompanied by cyclic forward and reverse rotations between the large and small ribosomal subunits parallel to the plane of the intersubunit interface. In addition, during ribosome translocation, the 'head' domain of small ribosomal subunit undergoes forward- and back-swiveling motions relative to the rest of the small ribosomal subunit around the axis that is orthogonal to the axis of intersubunit rotation. tRNA/mRNA translocation is also coupled to the docking of domain IV of EF-G into the A site of the small ribosomal subunit that converts the thermally driven motions of the ribosome and tRNA into the forward translocation of tRNA/mRNA inside the ribosome. Despite recent and enormous progress made in the understanding of the molecular mechanism of ribosome translocation, the sequence of structural rearrangements of the ribosome, EF-G and tRNA during translocation is still not fully established and awaits further investigation. WIREs RNA 2016, 7:620-636. doi: 10.1002/wrna.1354 For further resources related to this article, please visit the WIREs website. PMID:27117863

  13. The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

    Diels, Ludo; De Baere, Raymond; Vandenberghe, Antoon; De Wachter, Rupert

    1981-01-01

    The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU OH.

  14. A new fungal large subunit ribosomal RNA primer for high-throughput sequencing surveys.

    Mueller, Rebecca C; Gallegos-Graves, La Verne; Kuske, Cheryl R

    2016-02-01

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300-400 bp region of the D2 hypervariable region of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R-LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Together, these findings show that the LR22R-LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods. PMID:26656064

  15. Prokaryote phylogeny based on ribosomal proteins and aminoacyl tRNA synthetases by using the compositional distance approach

    WEI; Haibin; QI; Ji; HAO; Bailin

    2004-01-01

    In order to show that the newly developed K-string composition distance method,based on counting oligopeptide frequencies,for inferring phylogenetic relations of prokaryotes works equally well without requiring the whole proteome data,we used all ribosomal proteins and the set of aminoacyl tRNA synthetases for each species.The latter group has been known to yield inconsistent trees if used individually.Our trees are obtained without making any sequence alignment.Altogether 16 Archaea,105 Bacteria and 2 Eucarya are represented on the tree.Most of the lower branchings agree well with the latest,2003,Outline of the second edition of the Bergey's Manual of Systematic Bacteriology and the trees also suggest some relationships among higher taxa.

  16. Cloning and sequence analysis of the 18S rRNA gene of Trichinella from cat in Heilongjiang province%黑龙江省猫旋毛虫18S rRNA基因分子克隆及序列分析

    李冬梅; 王秀荣; 董小波; 路义鑫; 宋铭忻

    2007-01-01

    本文利用GenBank中发表的( Trichinella spiralis )18S rRNA序列为参考设计引物,对分离自黑龙江省猫体内的旋毛虫及本地毛形线虫( Trichinella nativa )的18S rRNA基因进行扩增,克隆后测序,序列分析结果表明:猫旋毛虫与旋毛形线虫基因同源性更高.

  17. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    Aagaard, C; Douthwaite, S

    1994-01-01

    A putative base-pairing interaction that determines the folding of the central region of 23S rRNA has been investigated by mutagenesis. Each of the possible base substitutions has been made at the phylogenetically covariant positions adenine-1262 (A1262) and U2017 in Escherichia coli 23S rRNA. Ev...

  18. An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

    Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

    1993-01-01

    The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

  19. Structural Studies of RNA Helicases Involved in Eukaryotic Pre-mRNA Splicing, Ribosome Biogenesis, and Translation Initiation

    He, Yangzi

    Ribonucleic acids (RNAs) take centre stage in gene expression. In eukaryotes, most RNAs are transcribed as precursors, and these precursors are co- or post-transcriptionally processed and assemble with particular proteins to form ribonucleoproteins (RNPs). Mature RNPs participate in various gene...... expression events, are then subject to recycling, disassembly or degradation. RNA helicases are highly conserved enzymes that use ATP to bind or remodel RNA or RNPs. They function in nearly every aspect of eukaryotic RNA metabolism. The spliceosome catalyzes pre-mRNAs splicing, which removes introns and...

  20. Macrolide-ketolide inhibition of MLS-resistant ribosomes is improved by alternative drug interaction with domain II of 23S rRNA

    Douthwaite, S; Hansen, L H; Mauvais, P

    2000-01-01

    The macrolide antibiotic erythromycin and its 6-O-methyl derivative (clarithromycin) bind to bacterial ribosomes primarily through interactions with nucleotides in domains II and V of 23S rRNA. The domain II interaction occurs between nucleotide A752 and the macrolide 3-cladinose moiety. Removal ...

  1. Mitochondrial 12S Ribosomal RNA A1555G Mutation Associated with Cardiomyopathy and Hearing Loss following High-Dose Chemotherapy and Repeated Aminoglycoside Exposure

    Skou, Anne-Sofie; Tranebjærg, Lisbeth; Jensen, Tim;

    2014-01-01

    A 19-month-old girl with the A1555G mitochondrial mutation in the 12S ribosomal RNA gene and acute myelogenous leukemia developed dilated cardiomyopathy and bilateral sensorineural hearing loss before undergoing allogeneic stem cell transplantation. She had received gentamicin during episodes of ...... febrile neutropenia. Testing for the A1555G mutation is recommended in patients frequently treated with aminoglycosides....

  2. Activation of the ribosomal RNA genes late in the third cell cycle of porcine embryos

    Viuff, Dorthe; Greve, Torben; Holm, Peter; Callesen, Henrik; Hyttel, Poul; Thomsen, Preben D

    2002-01-01

    In porcine embryos, nucleoli are first observed during the third postfertilization cell cycle, i.e., at the 4-cell stage. However, direct studies of the initiation of rRNA transcription have not been reported. This transcription was investigated in the present study by simultaneous visualization of...... electron microscopy. In general, the 2-cell and 4-cell embryos fixed at 10 and 20 h postcleavage (hpc) showed no signs of rRNA transcription. Four small clusters of fluorescein isothiocyanate (FITC) labeling were visible in interphase nuclei, consistent with hybridization to the rRNA gene clusters only...... phase during the third cell cycle....

  3. Sequence requirements for self-splicing of the Tetrahymena thermophila pre-ribosomal RNA.

    Price, J V; Kieft, G L; Kent, J R; Sievers, E L; Cech, T R

    1985-01-01

    The sequence requirements for splicing of the Tetrahymena pre-rRNA have been examined by altering the rRNA gene to produce versions that contain insertions and deletions within the intervening sequence (IVS). The altered genes were transcribed and the RNA tested for self-splicing in vitro. A number of insertions (8-54 nucleotides) at three locations had no effect on self-splicing activity. Two of these insertions, located at a site 5 nucleotides preceding the 3'-end of the IVS, did not alter ...

  4. RNA–DNA differences in human mitochondria restore ancestral form of 16S ribosomal RNA

    Bar-Yaacov, Dan; Avital, Gal; Levin, Liron; Richards, Allison L.; Hachen, Naomi; Rebolledo Jaramillo, Boris; Nekrutenko, Anton; Zarivach, Raz; Mishmar, Dan

    2013-01-01

    RNA transcripts are generally identical to the underlying DNA sequences. Nevertheless, RNA–DNA differences (RDDs) were found in the nuclear human genome and in plants and animals but not in human mitochondria. Here, by deep sequencing of human mitochondrial DNA (mtDNA) and RNA, we identified three RDD sites at mtDNA positions 295 (C-to-U), 13710 (A-to-U, A-to-G), and 2617 (A-to-U, A-to-G). Position 2617, within the 16S rRNA, harbored the most prevalent RDDs (>30% A-to-U and ∼15% A-to-G of the...

  5. A new set of primers directed to 18S rRNA gene for molecular identification of Cryptosporidium spp. and their performance in the detection and differentiation of oocysts shed by synanthropic rodents.

    Silva, Sheila O S; Richtzenhain, Leonardo J; Barros, Iracema N; Gomes, Alessandra M M C; Silva, Aristeu V; Kozerski, Noemila D; de Araújo Ceranto, Jaqueline B; Keid, Lara B; Soares, Rodrigo M

    2013-11-01

    Cryptosporidium spp. are cosmopolitan protozoa that infect fishes, reptiles, amphibians, birds and mammals. More than 20 species are recognized within this genus. Rodents are a group of abundant and ubiquitous organisms that have been considered reservoirs of Cryptosporidium for humans and livestock. The aim of this study was to design specific primers for the gene encoding 18S rRNA, potentially capable of amplifying any species or genotype of Cryptosporidium spp. and evaluate the diagnostic attributes of the nested-PCR based on such probes. The primers were designed to amplify the shortest segment as possible to maximize the sensitivity of the test, but preserving the discriminatory potential of the amplified sequences for phylogenetic inferences. The nested-PCR standardized in this study (nPCR-SH) was compared in terms of sensitivity with another similar assay (nPCR-XIAO) that has been largely used for the detection and identification of Cryptosporidium spp. worldwide. We also aimed to molecularly characterize samples of Cryptosporidum spp. isolated from synanthropic rodents using these probes. Forty-five rodents were captured in urban areas of the municipality of Umuarama, Paraná State, Brazil. Fecal samples were submitted to three molecular tests (nested-PCRs), two of them targeted to the 18S rDNA gene (nPCR-SH and nPCR-XIAO) and the third targeted to the gene encoding actin (nPCR-actin). The nPCR-SH was tested positive on samples of Cryptosporidum parvum, Cryptosporidum andersoni, Cryptosporidum meleagridis, Cryptosporidum hominis, Cryptosporidum canis, and Cryptosporidum serpentis. Sixteen samples of rodents were positive by nPCR-SH, six by nPCR-XIAO and five by nPCR-actin. Sequencing of amplified fragments allowed the identification of Cryptosporidum muris in three samples of Rattus rattus, and two genotypes of Cryptosporidium, the genotypes mouse II and III. Cryptosporidium genotype mouse II was found in one sample of Mus musculus and genotype mouse III

  6. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    Naveed, Muhammad; Mubeen, Samavia; Khan, Samiullah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

    2014-01-01

    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relat...

  7. FRET Characterization of Complex Conformational Changes in a Large 16S Ribosomal RNA Fragment Site-Specifically Labeled Using Unnatural Base Pairs.

    Lavergne, Thomas; Lamichhane, Rajan; Malyshev, Denis A; Li, Zhengtao; Li, Lingjun; Sperling, Edit; Williamson, James R; Millar, David P; Romesberg, Floyd E

    2016-05-20

    Ribosome assembly has been studied intensively using Förster resonance energy transfer (FRET) with fluorophore-labeled fragments of RNA produced by chemical synthesis. However, these studies are limited by the size of the accessible RNA fragments. We have developed a replicable unnatural base pair (UBP) formed between (d)5SICS and (d)MMO2 or (d)NaM, which efficiently directs the transcription of RNA containing unnatural nucleotides. We now report the synthesis and evaluation of several of the corresponding ribotriphosphates bearing linkers that enable the chemoselective attachment of different functionalities. We found that the RNA polymerase from T7 bacteriophage does not incorporate NaM derivatives but does efficiently incorporate 5SICS(CO), whose linker enables functional group conjugation via Click chemistry, and when combined with the previously identified MMO2(A), whose amine side chains permits conjugation via NHS coupling chemistry, enables site-specific double labeling of transcribed RNA. To study ribosome assembly, we transcribed RNA corresponding to a 243-nt fragment of the central domain of Thermus thermophilus 16S rRNA containing 5SICS(CO) and MMO2(A) at defined locations and then site-specifically attached the fluorophores Cy3 and Cy5. FRET was characterized using single-molecule total internal reflection fluorescence (smTIRF) microscopy in the presence of various combinations of added ribosomal proteins. We demonstrate that each of the fragment's two three-helix junctions exist in open and closed states, with the latter favored by sequential protein binding. These results elucidate early and previously uncharacterized folding events underlying ribosome assembly and demonstrate the applicability of UBPs for biochemical, structural, and functional studies of RNAs. PMID:26942998

  8. Non-FG mediated transport of the large pre-ribosomal subunit through the nuclear pore complex by the mRNA export factor Gle2

    Occhipinti, L.; Chang, Y.; Altvater, M.; Menet, A. M.; Kemmler, S.; Panse, V. G.

    2013-01-01

    Multiple export receptors passage bound pre-ribosomes through nuclear pore complexes (NPCs) by transiently interacting with the Phe-Gly (FG) meshwork of their transport channels. Here, we reveal how the non-FG interacting yeast mRNA export factor Gly-Leu-FG lethal 2 (Gle2) functions in the export of the large pre-ribosomal subunit (pre-60S). Structure-guided studies uncovered conserved platforms used by Gle2 to export pre-60S: an uncharacterized basic patch required to bind pre-60S, and a sec...

  9. Mitochondrial 16S ribosomal RNA gene for forensic identification of crocodile species.

    Naga Jogayya, K; Meganathan, P R; Dubey, Bhawna; Haque, I

    2013-05-01

    All crocodilians are under various threats due to over exploitation and these species have been listed in Appendix I or II of CITES. Lack of molecular techniques for the forensic identification of confiscated samples makes it difficult to enforce the law. Therefore, we herein present a molecular method developed on the basis on 16S rRNA gene of mitochondrial DNA for identification of crocodile species. We have developed a set of 16S rRNA primers for PCR based identification of crocodilian species. These novel primers amplify partial 16S rRNA sequences of six crocodile species which can be later combined to obtain a larger region (1290 bp) of 16S rRNA gene. This 16S rRNA gene could be used as an effective tool for forensic authentication of crocodiles. The described primers hold great promise in forensic identification of crocodile species, which can aid in the effective enforcement of law and conservation of these species. PMID:23622485

  10. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan.

    Martínez, Allyson K; Gordon, Emily; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M; Benedik, Michael J; Yanofsky, Charles; Mankin, Alexander S; Vazquez-Laslop, Nora; Sachs, Matthew S; Cruz-Vera, Luis R

    2014-01-01

    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome's ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the concentration dependence of L-Trp-mediated tna operon induction, whereas the TnaC I19L change suppresses this phenotype, restoring the sensitivity of the translating A2058U mutant ribosome to free L-Trp. These findings suggest that interactions between TnaC residue I19 and 23S rRNA nucleotide A2058 contribute to the creation of a regulatory L-Trp binding site within the translating ribosome. PMID:24137004

  11. Species-specific repeat units in the intergenic spacer of the ribosomal RNA cistron of Anopheles aquasalis Curry.

    Perera, O P; Cockburn, A F; Mitchell, S E; Conn, J; Seawright, J A

    1998-11-01

    A genomic DNA library of Anopheles aquasalis Curry was screened for clones that hybridized more intensely to DNA from A. aquasalis than to DNA from A. benarrochi Gabaldon, Cova Garcia, and Lopez, A. konderi Galvao and Damasceno, A. nuneztovari Gabaldon cytotypes A, B, and C, A. oswaldoi (Peryassu), A. rangeli Gabaldon, Cova Garcia, and Lopez, or A. trinkae Faran. Two specific clones (2.5 kilobasepairs [kbp] and 3.0 kbp) from A. aquasalis were isolated. Both A. aquasalis-specific clones were from the intergenic spacer region of the ribosomal RNA (rRNA) cistron. Upon digestion with Rsa I, a 900-bp fragment from the clone AA-1 hybridized specifically to A. aquasalis DNA. Analysis of the DNA sequence of this fragment revealed four tandemly repeated 36-bp units. Three of these repeat units were identical, and the fourth was 94% identical to the others. The DNA sequence of a highly conserved region of these repeats was used to synthesize an oligonucleotide probe specific to A. aquasalis. PMID:9840580

  12. Insulin receptor substrate-1 (IRS-1 associates with small nucleolar RNA which contributes to ribosome biogenesis

    Shin-IchiroTakahashi

    2014-03-01

    Full Text Available Insulin receptor substrates (IRSs are well known to play crucial roles in mediating intracellular signals of insulin-like growth factors (IGFs/insulin. Previously we showed that IRS-1 forms high molecular mass complexes containing RNAs. To identify RNAs in IRS-1 complexes, we performed UV cross-linking and immunoprecipitation (CLIP analysis using HEK293 cells expressing FLAG-IRS-1 and FLAG-IRS-2. We detected the radioactive signals in the immunoprecipitates of FLAG-IRS-1 proportional to the UV irradiation, but not in the immunoprecipitates of FLAG-IRS-2, suggesting the direct contact of RNAs with IRS-1. RNAs cross-linked to IRS-1 were then amplified by RT-PCR, followed by sequence analysis. We isolated sequence tags attributed to 25 messenger RNAs and 8 non-coding RNAs, including small nucleolar RNAs (snoRNAs. We focused on the interaction of IRS-1 with U96A snoRNA (U96A and its host Rack1 (receptor for activated C kinase 1 pre-mRNA. We confirmed the interaction of IRS-1 with U96A, and with RACK1 pre-mRNA by immunoprecipitation with IRS-1 followed by Northern blotting or RT-PCR analyses. Mature U96A in IRS-1-/- mouse embryonic fibroblasts was quantitatively less than WT. We also found that a part of nuclear IRS-1 is localized in the Cajal body, a nuclear subcompartment where snoRNA mature. The unanticipated function of IRS-1 in snoRNA biogenesis highlights the potential of RNA-associated IRS-1 complex to open a new line of investigation to dissect the novel mechanisms regulating IGFs/insulin-mediated biological events.

  13. Ribosomal RNA genes challenge the monophyly of the Hyalospheniidae (Amoebozoa: Arcellinida)

    Lara, Enrique; Heger, Thierry J; Ekelund, Flemming; Lamentowicz, Mariusz; Mitchell, Edward A D

    2008-01-01

    To date only five partial and two complete SSU rRNA gene sequences are available for the lobose testate amoebae (Arcellinida). Consequently, the phylogenetic relationships among taxa and the definition of species are still largely dependant on morphological characters of uncertain value, which...... causes confusion in the phylogeny, taxonomy and the debate on cosmopolitanism of free-living protists. Here we present a SSU rRNA-based phylogeny of the Hyalospheniidae including the most common species. Similar to the filose testate amoebae of the order Euglyphida the most basal clades have a terminal...

  14. Identification of Chlorophyceae based on 18S rDNA sequences from Persian Gulf.

    Raheem Haddad

    2014-12-01

    Full Text Available Chlorophyceae are important constituents of marine phytoplankton. The taxonomy of Chlorophyceae was traditionally based solely on morphological characteristics. In the present research project, genetic diversity was investigated to analyze five species of Chlorophyceae from waters of the Persian Gulf.A clone library of the ribosomal small subunit RNA gene (18S rDNA in the nuclear genome was constructed by PCR, and then, after examining the clones, selected clones were sequenced. The determined clone sequences were analyzed by a similarity search of the NCBI GenBank database using BLAST.Eleven sequences were identified correctly and used for phylogenetic analysis. We identified species of Chlorophyta (Chlorella sorokiniana, Chlamydomonas sp., Neochloris aquatic, Picochlorum sp. and Nannochloris atomus without the need to conduct extensive colony isolation techniques. Therefore, this improved molecular method can be used to generate a robust database describing the species diversity of environmental samples.

  15. Preparative-scale isolation and purification of procaryotic and eucaryotic ribosomal 5 S RNA: Bacillus subtilis, Neurospora crassa, and wheat germ.

    Li, S J; Chang, L H; Chen, S; Marshall, A G

    1984-05-01

    Ribosomal 5 S RNA from three different organisms has been isolated in high yield and purity. Without prior isolation of ribosomes, a presoak in buffer followed by phenol extraction, DE-32 ion-exchange chromatography, and Sephadex G-75 gel-permeation chromatography yields at least 5-10 mg of electrophoretically homogeneous 5 S RNA from 100 g of cells. Ribonuclease activity is eliminated by various combinations of low temperature, sodium dodecyl sulfate, phenol, and bentonite. High-molecular-weight contaminants are suppressed by either 65 degrees C heat treatment or lowered sodium dodecyl sulfate concentration. For the eucaryotes, 5.8 S RNA contamination is reduced either by low temperature in the initial solubilization or by postponing 65 degrees C heat treatment until after the phenol extraction step. PMID:6204554

  16. The aminoglycoside resistance methyltransferase Sgm impedes RsmF methylation at an adjacent rRNA nucleotide in the ribosomal A site

    Cubrilo, Sonja; Babić, Fedora; Douthwaite, Stephen;

    2009-01-01

    methylated nucleotides including m(4)Cm1402 and m(5)C1407. Modification at m(5)C1407 by the methyltransferase RsmF is impeded as Sgm gains access to its adjacent G1405 target on the 30S ribosomal subunit. An Sgm mutant (G135A), which is impaired in S-adenosylmethionine binding and confers lower resistance......Ribosome-targeting antibiotics block protein synthesis by binding at functionally important regions of the bacterial rRNA. Resistance is often conferred by addition of a methyl group at the antibiotic binding site within an rRNA region that is already highly modified with several nucleotide...... methylations. In bacterial rRNA, each methylation requires its own specific methyltransferase enzyme, and this raises the question as to how an extra methyltransferase conferring antibiotic resistance can be accommodated and how it can gain access to its nucleotide target within a short and functionally...

  17. Molecular evolution of rDNA in early diverging Metazoa: First comparative analysis and phylogenetic application of complete SSU rRNA secondary structures in Porifera

    Wörheide Gert; Erpenbeck Dirk; Voigt Oliver

    2008-01-01

    Abstract Background The cytoplasmic ribosomal small subunit (SSU, 18S) ribosomal RNA (rRNA) is the most frequently-used gene for molecular phylogenetic studies. However, information regarding its secondary structure is neglected in most phylogenetic analyses. Incorporation of this information is essential in order to apply specific rRNA evolutionary models to overcome the problem of co-evolution of paired sites, which violates the basic assumption of the independent evolution of sites made by...

  18. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is...

  19. An alternative strategy for bacterial ribosome synthesis: Bacillus subtilis rRNA transcription regulation

    Krásný, Libor; Gourse, Richard. L.

    2004-01-01

    Roč. 23, č. 22 (2004), s. 4473-4483. ISSN 0261-4189 Grant ostatní: National Institutes of Health(US) RO1 GM37048 Institutional research plan: CEZ:AV0Z5052915 Keywords : B. subtilis , GTP concentrations, rRNA transcription Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 10.492, year: 2004

  20. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    reveals increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits......The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea and...... chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...

  1. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  2. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  3. TAXONOMIC STATUS OF CAR BACILLUS BASED ON THE SMALL SUBUNIT RIBOSOMAL RNA SEQUENCES

    魏强; TsujiM; TakahashiT; IshiharaC; ItohT

    1995-01-01

    In an attempt to identify the taxonomic relationship between CAR bacillus and other bacteria, the SSU rRNA gene sequences of two CAR bacillus strains, CBM and CBR isolated from mice and rats respectively were used in the present studies. The SSU rRNA gene sequences, approximately 1.5 kb in size amplified from genomic DNAs from both strains, were determined and 96. 8% homologies were found to exist be-tween them. Those sequences were aligned to most euhacteria with a computer search showing high homol-ogy with those of Flavobacter/Flexibacter species especially closed to Fx. sanai and Ft. ferrugineum. Phylogenetic analysts indicated that CAR bacillus belongs to a species close to Fx. sancti and Ft. ferrug-imum subdivision.

  4. Sequence analysis of mitochondrial 16S ribosomal RNA gene fragment from seven mosquito species

    Yogesh S Shouche; Milind S Patole

    2000-12-01

    Mosquitoes are vectors for the transmission of many human pathogens that include viruses, nematodes and protozoa. For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. Recently, molecular taxonomic techniques have been utilized for this purpose. Sequence analysis of the mitochondrial 16S rRNA gene has been used for molecular taxonomy in many insects. In this paper, we have analysed a 450 bp hypervariable region of the mitochondrial 16S rRNA gene in three major genera of mosquitoes, Aedes, Anopheles and Culex. The sequence was found to be unusually A + T rich and in substitutions the rate of transversions was higher than the transition rate. A phylogenetic tree was constructed with these sequences. An interesting feature of the sequences was a stretch of Ts that distinguished between Aedes and Culex on the one hand, and Anopheles on the other. This is the first report of mitochondrial rRNA sequences from these medically important genera of mosquitoes.

  5. Effect of single base changes and the absence of modified bases in 16S RNA on the reconstitution and function of Escherichia coli 30S ribosomes

    The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C1400 was preserved. Changing C1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly

  6. Ribosome-inactivating proteins

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M.

    2013-01-01

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with oth...

  7. Phylogenetic position of the genus Perkinsus (Protista, Apicomplexa) based on small subunit ribosomal RNA.

    Goggin, C L; Barker, S C

    1993-07-01

    Parasites of the genus Perkinsus destroy marine molluscs worldwide. Their phylogenetic position within the kingdom Protista is controversial. Nucleotide sequence data (1792 bp) from the small subunit rRNA gene of Perkinsus sp. from Anadara trapezia (Mollusca: Bivalvia) from Moreton Bay, Queensland, was used to examine the phylogenetic affinities of this enigmatic genus. These data were aligned with nucleotide sequences from 6 apicomplexans, 3 ciliates, 3 flagellates, a dinoflagellate, 3 fungi, maize and human. Phylogenetic trees were constructed after analysis with maximum parsimony and distance matrix methods. Our analyses indicate that Perkinsus is phylogenetically closer to dinoflagellates and to coccidean and piroplasm apicomplexans than to fungi or flagellates. PMID:8366895

  8. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing.

    Naveed, Muhammad; Mubeen, Samavia; Khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

    2014-01-01

    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization. PMID:25477935

  9. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    Muhammad Naveed

    2014-09-01

    Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  10. A phylogeny of the Passerida(Aves: Passeriformes)based on mitochondrial 12S ribosomal RNA gene

    Lina; Wu; Yanfeng; Sun; Juyong; Li; Yaqing; Li; Yuefeng; Wu; Dongming; Li

    2015-01-01

    Background: Passerida is the largest avian radiation within the order Passeriformes. Current understanding of the high-level relationships within Passerida is based on DNA–DNA hybridizations; however, the phylogenetic relationships within this assemblage have been the subject of many debates.Methods: We analyzed the 12 S ribosomal RNA gene from 49 species of Passerida, representing 14 currently recognized families, to outline the phylogenetic relationships within this group.Results: Our results identified the monophyly of the three superfamilies in Passerida: Sylvioidea, Muscicapoidea and Passeroidea. However, current delimitation of some species is at variance with our phylogeny estimate. First, the Parus major, which had been placed as a distinct clade sister to Sylvioidea was identified as a member of the super family;second, the genus Regulus was united with the Sturnidae and nested in the Muscicapoidea clade instead of being a clade of Passerida.Conclusion: Our results were consistent with Johansson’s study of the three superfamilies except for the al ocation of two families, Paridae and Regulidae.

  11. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Taylor, R.C.

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese`s group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  12. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Taylor, R.C.

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese's group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  13. Quantification of uncultured Ruminococcus obeum-like bacteria in human fecal samples with fluorescent in situ hybridization and flow cytometry using 16S ribosomal RNA targeted probes

    Zoetendal, E.G.; Ben-Amor, K.; Harmsen, H. J. M.; Schut, F; Akkermans, A. D. L.; Vos, de, N.M.

    2002-01-01

    A 16S rRNA-targeted probe was designed and validated in order to quantify the number of uncultured Ruminococcus obeum-like bacteria by fluorescent in situ hybridization (FISH). These bacteria have frequently been found in 16S ribosomal DNA clone libraries prepared from bacterial communities in the human intestine. Thirty-two reference strains from the human intestine, including a phylogenetically related strain and strains of some other Ruminococcus species, were used as negative controls and...

  14. RNA:protein ratio of the unicellular organism as a characteristic of phosphorous and nitrogen stoichiometry and of the cellular requirement of ribosomes for protein synthesis

    Sams Carl E; Greenwood Duncan J; Karpinets Tatiana V; Ammons John T

    2006-01-01

    Abstract Background Mean phosphorous:nitrogen (P:N) ratios and relationships of P:N ratios with the growth rate of organisms indicate a surprising similarity among and within microbial species, plants, and insect herbivores. To reveal the cellular mechanisms underling this similarity, the macromolecular composition of seven microorganisms and the effect of specific growth rate (SGR) on RNA:protein ratio, the number of ribosomes, and peptide elongation rate (PER) were analyzed under different ...

  15. A novel protein-RNA binding assay: functional interactions of the foot-and-mouth disease virus internal ribosome entry site with cellular proteins.

    Stassinopoulos, I A; Belsham, G J

    2001-01-01

    Translation initiation on foot-and-mouth disease virus (FMDV) RNA occurs by a cap-independent mechanism directed by a highly structured element (approximately 435 nt) termed an internal ribosome entry site (IRES). A functional assay to identify proteins that bind to the FMDV IRES and are necessary for FMDV IRES-mediated translation initiation has been developed. In vitro-transcribed polyadenylated RNAs corresponding to the whole or part of the FMDV IRES were immobilized on oligo-dT Dynabeads ...

  16. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens

    Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D. T. J.

    2015-01-01

    Roč. 8, JUN 19 2015 (2015), s. 336. ISSN 1756-3305 R&D Projects: GA MŠk(CZ) EE2.3.30.0032; GA ČR(CZ) GA15-14198S Grant ostatní: GA MŠk(CZ) LM2010005 Institutional support: RVO:60077344 Keywords : Diplostomum (Platyhelminthes: Trematoda) * fish pathogens * mitochondrial genome * ribosomal RNA * illumina next-generation sequencing * phylogeny Subject RIV: EG - Zoology Impact factor: 3.430, year: 2014

  17. Mutation detection analysis of a region of 16S-like ribosomal RNA gene of Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii

    Khairnar Krishna; Parija Subhash

    2008-01-01

    Abstract Background The level of intra-species genetic variation in Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii populations in a localized geographic area, like Puducherry, India, remains unknown. Methods In the present study the existence of genetic variation in the nested multiplex polymerase chain reaction (NM-PCR) amplified region of the 16S-like ribosomal RNA genes of E. histolytica, E. dispar and E. moshkovskii was investigated by riboprinting and single strand con...

  18. Graphical representation of ribosomal RNA probe accessibility data using ARB software package

    Amann Rudolf

    2005-03-01

    Full Text Available Abstract Background Taxon specific hybridization probes in combination with a variety of commonly used hybridization formats nowadays are standard tools in microbial identification. A frequently applied technology, fluorescence in situ hybridization (FISH, besides single cell identification, allows the localization and functional studies of the microbial community composition. Careful in silico design and evaluation of potential oligonucleotide probe targets is therefore crucial for performing successful hybridization experiments. Results The PROBE Design tools of the ARB software package take into consideration several criteria such as number, position and quality of diagnostic sequence differences while designing oligonucleotide probes. Additionally, new visualization tools were developed to enable the user to easily examine further sequence associated criteria such as higher order structure, conservation, G+C content, transition-transversion profiles and in situ target accessibility patterns. The different types of sequence associated information (SAI can be visualized by user defined background colors within the ARB primary and secondary structure editors as well as in the PROBE Match tool. Conclusion Using this tool, in silico probe design and evaluation can be performed with respect to in situ probe accessibility data. The evaluation of proposed probe targets with respect to higher-order rRNA structure is of importance for successful design and performance of in situ hybridization experiments. The entire ARB software package along with the probe accessibility data is available from the ARB home page http://www.arb-home.de.

  19. Attachment sites of primary binding proteins L1, L2 and L23 on 23 S ribosomal RNA of Escherichia coli

    Egebjerg, Jan; Christiansen, Jan; Garrett, Roger Antony

    1991-01-01

    The attachment sites of the primary binding proteins L1, L2 and L23 on 23 S ribosomal RNA of Escherichia coli were examined by a chemical and ribonuclease footprinting method using several probes with different specificities. The results show that the sites are confined to localized RNA regions...... within the large ribonuclease-protected ribonucleoprotein fragments that were characterized earlier. They are as follows: 1. (1) L1 recognizes a tertiary structural motif in domain V centred on two interacting internal loops; the main protein interaction sites occur at the internal loop/helix junctions.2...

  20. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan

    Martínez, Allyson K.; GORDON, EMILY; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M.; Benedik, Michael J.; Yanofsky, Charles; Mankin, Alexander S.; Vazquez-Laslop, Nora; Sachs, Matthew S.; Cruz-Vera, Luis R.

    2013-01-01

    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome’s ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the con...

  1. Interconversion of active and inactive 30 S ribosomal subunits is accompanied by a conformational change in the decoding region of 16 S rRNA

    Moazed, D; Van Stolk, B J; Douthwaite, S;

    1986-01-01

    Zamir, Elson and their co-workers have shown that 30 S ribosomal subunits are reversibly inactivated by depletion of monovalent or divalent cations. We have re-investigated the conformation of 16 S rRNA in the active and inactive forms of the 30 S subunit, using a strategy that is designed......' regions of 16 S rRNA. The inactive form also shows significantly decreased reactivity at positions 1533 to 1538 (the Shine-Dalgarno region), in agreement with earlier findings. The principal changes in reactivity involve the universally conserved nucleotides G926, C1395, A1398 and G1401. The three purines...

  2. The structure of Aquifex aeolicus ribosomal protein S8 reveals a unique subdomain that contributes to an extremely tight association with 16S rRNA.

    Menichelli, Elena; Edgcomb, Stephen P; Recht, Michael I; Williamson, James R

    2012-01-20

    The assembly of ribonucleoprotein complexes occurs under a broad range of conditions, but the principles that promote assembly and allow function at high temperature are poorly understood. The ribosomal protein S8 from Aquifex aeolicus (AS8) is unique in that there is a 41-residue insertion in the consensus S8 sequence. In addition, AS8 exhibits an unusually high affinity for the 16S ribosomal RNA, characterized by a picomolar dissociation constant that is approximately 26,000-fold tighter than the equivalent interaction from Escherichia coli. Deletion analysis demonstrated that binding to the minimal site on helix 21 occurred at the same nanomolar affinity found for other bacterial species. The additional affinity required the presence of a three-helix junction between helices 20, 21, and 22. The crystal structure of AS8 was solved, revealing the helix-loop-helix geometry of the unique AS8 insertion region, while the core of the molecule is conserved with known S8 structures. The AS8 structure was modeled onto the structure of the 30S ribosomal subunit from E. coli, suggesting the possibility that the unique subdomain provides additional backbone and side-chain contacts between the protein and an unpaired base within the three-way junction of helices 20, 21, and 22. Point mutations in the protein insertion subdomain resulted in a significantly reduced RNA binding affinity with respect to wild-type AS8. These results indicate that the AS8-specific subdomain provides additional interactions with the three-way junction that contribute to the extremely tight binding to ribosomal RNA. PMID:22079365

  3. DsRNA-mediated targeting of ribosomal transcripts RPS6 and RPL26 induces long-lasting and significant reductions in fecundity of the vector Aedes aegypti.

    Estep, A S; Sanscrainte, N D; Becnel, J J

    2016-07-01

    Ribosomal transcripts produce critical proteins that are involved in most cellular production processes. Targeting ribosomal transcripts has produced mortality in mites and ticks but the effect of ribosomal transcript knockdown has not been thoroughly examined in mosquitoes. We examine the effects of triggers targeting four ribosomal proteins (RP) transcripts. Although no significant mortality was observed after dsRNA microinjection and subsequent blood feeding, significant contrasts were observed on fecundity. Triggers targeting RPS6 and RPL26 effectively reduced gene expression but more importantly, reduced reproductive output by more than 96% and 91% at the first oviposition while triggers targeting RPL1 and RPS2 did not cause a reduction although gene expression was reduced. Significantly reduced fecundity continued through a second oviposition cycle in dsRPS6 and dsRPL26 cohorts, although the effect was not as strong. Relative gene expression levels confirmed specific transcript knockdown up to 20days post-injection in mosquitoes that did not oviposit or produced reduced clutch sizes. Dissections at 36h post-blood meal indicated defects in oocyte provisioning. The strong phenotype produced by dsRPS6 allowed us to examine the effects in various tissues as well as the dose response, trigger format, delivery method and trigger specificity in Aedes aegypti. Strong knockdown was observed in the abdomen and the ovaries. Greater than 50ng of dsRPS6 significantly reduced fecundity but not when delivered in a sugar meal or as an siRNA. Similar bioassays with mutated dsRPS6 triggers indicates that up to three mismatches per possible siRNA are still effective in reducing fecundity. These studies indicate that while active and effective triggers can be developed for vector species, the lack of an efficient delivery method is the biggest barrier to use as a potential control method. PMID:27180677

  4. Expression of Ribosomal RNA and Protein Genes in Human Embryonic Stem Cells Is Associated With the Activating H3K4me3 Histone Mark.

    Zaidi, Sayyed K; Boyd, Joseph R; Grandy, Rodrigo A; Medina, Ricardo; Lian, Jane B; Stein, Gary S; Stein, Janet L

    2016-09-01

    Embryonic stem cells (ESCs) exhibit unrestricted and indefinite, but stringently controlled, proliferation, and can differentiate into any lineage in the body. In the current study, we test the hypothesis that expression of ribosomal RNA (rRNA) and ribosomal protein genes (RPGs) contribute to the ability of hESCs to proliferate indefinitely. Consistent with the accelerated growth rate of hESCs, we find that hESC lines H1 and H9 both exhibit significantly higher levels of rRNA when compared to a panel of normal and cancer human cell lines. Although many RPGs are expressed at levels that comparable to other human cell lines, a few RPGs also exhibit higher expression levels. In situ nuclear run-on assays reveal that both nucleoli in hESCs actively transcribe nascent rRNA. Employing genome-wide chromatin immunoprecipitation-deep sequencing and bioinformatics approaches, we discovered that, RPGs are dominantly marked by the activating H3K4me3 histone mark in the G1, M, and G2 phases of the cell cycle. Interestingly, the rDNA repeats are marked by the activating H3K4me3 only in the M phase, and repressive H3K27me3 histone mark in all three cell cycle phases. Bioinformatics analyses also reveal that Myc, a known regulator of cell growth and proliferation, occupies both the rRNA genes and RPGs. Functionally, down-regulation of Myc expression by siRNA results in a concomitant decrease in rRNA levels. Together, our results show that expression of rRNA, which is regulated by the Myc pluripotency transcription factor, and of RPGs in hESCs is associated with the activating H3K4me3 modification. J. Cell. Physiol. 231: 2007-2013, 2016. © 2016 Wiley Periodicals, Inc. PMID:26755341

  5. Ribosome recycling induces optimal translation rate at low ribosomal availability.

    Marshall, E; Stansfield, I; Romano, M C

    2014-09-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3' end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called 'closed-loop' model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  6. Purification and properties of a new ribosome-inactivating protein with RNA N-glycosidase activity suitable for immunotoxin preparation from the seeds of Momordica cochinchinensis.

    Bolognesi, A; Barbieri, L; Carnicelli, D; Abbondanza, A; Cenini, P; Falasca, A I; Dinota, A; Stirpe, F

    1989-12-01

    A ribosome-inactivating protein similar to those already known (Stirpe and Barbieri (1986) FEBS Lett. 195, 1-8) was purified from the seeds of Momordica cochinchinensis. This protein, for which the name of momorcochin-S is proposed, is a glycoprotein, has an Mr of approx. 30,000, and an alkaline isoelectric point and can be considered as an iso-form of the previously purified momorcochin from the roots of M. cochinchinensis. Momorcochin-S inhibits protein synthesis by a rabbit-reticulocyte lysate and phenylalanine polymerization by isolated ribosomes, and alters rRNA in a similar manner as the A-chain of ricin and related toxins (Endo et al. (1987) J. Biol. Chem. 262, 5908-5912). Momorcochin-S was linked to a monoclonal antibody (8A) against human plasma cells, and the resulting immunotoxin was selectively toxic to target cells. PMID:2597699

  7. Identification of the oligonucleotide and oligopeptide involved in an RNA-protein crosslink induced by ultraviolet irradiation of Escherichia coli 30 S ribosomal subunits

    When 30 S ribosomal subunits are irradiated with ultraviolet light, it has been found that an RNA-protein crosslinking reaction occurs whose primary target is protein S7. This paper describes the identification of the oligopeptide and oligonucleotide at the crosslinking point, by direct analysis (a) of the peptide remaining attached to an oligonucleotide (after total digestion of the RNA in the crosslinked complex with ribonucleases A and Tperpendicular, followed by digestion with trypsin), and (b) of the nucleotides remaining attached to the crosslinked protein (after digestion of the RNA in the complex with ribonuclease Tperpendicular alone). The crosslinking site was found to lie within a single short peptide, Ser-Met-Ala-Leu-Arg (positions 113 to 117 in the S7 sequence), with methionine as the probable amino acid concerned. The principal RNA site was found to lie within an oligonucleotide three to six bases long, the bracketed portion of the partially ordered sequence C-U-A-C-[A-A-U-G.G.C]-G in section P of the 16 S RNA. The methodology involved has been designed with a view to being generally applicable in future RNA-protein crosslinking studies, where several proteins are simultaneously attached to the RNA. (author)

  8. The trp RNA-binding attenuation protein of Bacillus subtilis regulates translation of the tryptophan transport gene trpP (yhaG) by blocking ribosome binding.

    Yakhnin, Helen; Zhang, Hong; Yakhnin, Alexander V; Babitzke, Paul

    2004-01-01

    Expression of the Bacillus subtilis tryptophan biosynthetic genes (trpEDCFBA and pabA [trpG]) is regulated in response to tryptophan by TRAP, the trp RNA-binding attenuation protein. TRAP-mediated regulation of the tryptophan biosynthetic genes includes a transcription attenuation and two distinct translation control mechanisms. TRAP also regulates translation of trpP (yhaG), a single-gene operon that encodes a putative tryptophan transporter. Its translation initiation region contains triplet repeats typical of TRAP-regulated mRNAs. We found that regulation of trpP and pabA is unaltered in a rho mutant strain. Results from filter binding and gel mobility shift assays demonstrated that TRAP binds specifically to a segment of the trpP transcript that includes the untranslated leader and translation initiation region. While the affinities of TRAP for the trpP and pabA transcripts are similar, TRAP-mediated translation control of trpP is much more extensive than for pabA. RNA footprinting revealed that the trpP TRAP binding site consists of nine triplet repeats (five GAG, three UAG, and one AAG) that surround and overlap the trpP Shine-Dalgarno (S-D) sequence and translation start codon. Results from toeprint and RNA-directed cell-free translation experiments indicated that tryptophan-activated TRAP inhibits TrpP synthesis by preventing binding of a 30S ribosomal subunit. Taken together, our results establish that TRAP regulates translation of trpP by blocking ribosome binding. Thus, TRAP coordinately regulates tryptophan synthesis and transport by three distinct mechanisms: attenuation transcription of the trpEDCFBA operon, promoting formation of the trpE S-D blocking hairpin, and blocking ribosome binding to the pabA and trpP transcripts. PMID:14702295

  9. A key role for the mRNA leader structure in translational control of ribosomal protein S1 synthesis in γ-proteobacteria

    Tchufistova, Ludmila S.; Komarova, Anastassia V.; Boni, Irina V.

    2003-01-01

    The translation initiation region (TIR) of the Escherichia coli rpsA mRNA coding for ribosomal protein S1 is characterized by a remarkable efficiency in driving protein synthesis despite the absence of the canonical Shine–Dalgarno element, and by a strong and specific autogenous repression in the presence of free S1 in trans. The efficient and autoregulated E.coli rpsA TIR comprises not less than 90 nt upstream of the translation start and can be unambiguously folded into three irregular hair...

  10. The 5' leader of the mRNA encoding the mouse neurotrophin receptor TrkB contains two internal ribosomal entry sites that are differentially regulated.

    Stephanie L Timmerman

    Full Text Available A single internal ribosomal entry site (IRES in conjunction with IRES transactivating factors (ITAFs is sufficient to recruit the translational machinery to a eukaryotic mRNA independent of the cap structure. However, we demonstrate that the mouse TrkB mRNA contains two independent IRESes. The mouse TrkB mRNA consists of one of two 5' leaders (1428 nt and 448 nt, both of which include the common 3' exon (Ex2, 344 nt. Dicistronic RNA transfections and in vitro translation of monocistronic RNA demonstrated that both full-length 5' leaders, as well as Ex2, exhibit IRES activity indicating the IRES is located within Ex2. Additional analysis of the upstream sequences demonstrated that the first 260 nt of exon 1 (Ex1a also contains an IRES. Dicistronic RNA transfections into SH-SY5Y cells showed the Ex1a IRES is constitutively active. However, the Ex2 IRES is only active in response to retinoic acid induced neural differentiation, a state which correlates with the synthesis of the ITAF polypyrimidine tract binding protein (PTB1. Correspondingly, addition or knock-down of PTB1 altered Ex2, but not Ex1a IRES activity in vitro and ex vivo, respectively. These results demonstrate that the two functionally independent IRESes within the mouse TrkB 5' leader are differentially regulated, in part by PTB1.

  11. The 5' leader of the mRNA encoding the mouse neurotrophin receptor TrkB contains two internal ribosomal entry sites that are differentially regulated.

    Timmerman, Stephanie L; Pfingsten, Jennifer S; Kieft, Jeffrey S; Krushel, Les A

    2008-01-01

    A single internal ribosomal entry site (IRES) in conjunction with IRES transactivating factors (ITAFs) is sufficient to recruit the translational machinery to a eukaryotic mRNA independent of the cap structure. However, we demonstrate that the mouse TrkB mRNA contains two independent IRESes. The mouse TrkB mRNA consists of one of two 5' leaders (1428 nt and 448 nt), both of which include the common 3' exon (Ex2, 344 nt). Dicistronic RNA transfections and in vitro translation of monocistronic RNA demonstrated that both full-length 5' leaders, as well as Ex2, exhibit IRES activity indicating the IRES is located within Ex2. Additional analysis of the upstream sequences demonstrated that the first 260 nt of exon 1 (Ex1a) also contains an IRES. Dicistronic RNA transfections into SH-SY5Y cells showed the Ex1a IRES is constitutively active. However, the Ex2 IRES is only active in response to retinoic acid induced neural differentiation, a state which correlates with the synthesis of the ITAF polypyrimidine tract binding protein (PTB1). Correspondingly, addition or knock-down of PTB1 altered Ex2, but not Ex1a IRES activity in vitro and ex vivo, respectively. These results demonstrate that the two functionally independent IRESes within the mouse TrkB 5' leader are differentially regulated, in part by PTB1. PMID:18779873

  12. Ribosomal P3 protein AtP3B of Arabidopsis acts as both protein and RNA chaperone to increase tolerance of heat and cold stresses.

    Kang, Chang Ho; Lee, Young Mee; Park, Joung Hun; Nawkar, Ganesh M; Oh, Hun Taek; Kim, Min Gab; Lee, Soo In; Kim, Woe Yeon; Yun, Dae-Jin; Lee, Sang Yeol

    2016-07-01

    The P3 proteins are plant-specific ribosomal P-proteins; however, their molecular functions have not been characterized. In a screen for components of heat-stable high-molecular weight (HMW) complexes, we isolated the P3 protein AtP3B from heat-treated Arabidopsis suspension cultures. By size-exclusion chromatography (SEC), SDS-PAGE and native PAGE followed by immunoblotting with anti-AtP3B antibody, we showed that AtP3B was stably retained in HMW complexes following heat shock. The level of AtP3B mRNA increased in response to both high- and low-temperature stresses. Bacterially expressed recombinant AtP3B protein exhibited both protein and RNA chaperone activities. Knockdown of AtP3B by RNAi made plants sensitive to both high- and low-temperature stresses, whereas overexpression of AtP3B increased tolerance of both conditions. Together, our results suggest that AtP3B protects cells against both high- and low-temperature stresses. These findings provide novel insight into the molecular functions and in vivo roles of acidic ribosomal P-proteins, thereby expanding our knowledge of the protein production machinery. PMID:27004478

  13. Non-FG mediated transport of the large pre-ribosomal subunit through the nuclear pore complex by the mRNA export factor Gle2.

    Occhipinti, Laura; Chang, Yiming; Altvater, Martin; Menet, Anna M; Kemmler, Stefan; Panse, Vikram G

    2013-09-01

    Multiple export receptors passage bound pre-ribosomes through nuclear pore complexes (NPCs) by transiently interacting with the Phe-Gly (FG) meshwork of their transport channels. Here, we reveal how the non-FG interacting yeast mRNA export factor Gly-Leu-FG lethal 2 (Gle2) functions in the export of the large pre-ribosomal subunit (pre-60S). Structure-guided studies uncovered conserved platforms used by Gle2 to export pre-60S: an uncharacterized basic patch required to bind pre-60S, and a second surface that makes non-FG contacts with the nucleoporin Nup116. A basic patch mutant of Gle2 is able to function in mRNA export, but not pre-60S export. Thus, Gle2 provides a distinct interaction platform to transport pre-60S to the cytoplasm. Notably, Gle2's interaction platforms become crucial for pre-60S export when FG-interacting receptors are either not recruited to pre-60S or are impaired. We propose that large complex cargos rely on non-FG as well as FG-interactions for their efficient translocation through the nuclear pore complex channel. PMID:23907389

  14. Hydrogen bonding and packing density are factors most strongly connected to limiting sites of high flexibility in the 16S rRNA in the 30S ribosome

    Ghosh Sujit K

    2009-07-01

    Full Text Available Abstract Background Conformational flexibility in structured RNA frequently is critical to function. The 30S ribosomal subunit exists in different conformations in different functional states due to changes in the central part of the 16S rRNA. We are interested in evaluating the factors that might be responsible for restricting flexibility to specific parts of the 16S rRNA using biochemical data obtained from the 30S subunit in solution. This problem was approached taking advantage of the observation that there must be a high degree of conformational flexibility at sites where UV photocrosslinking occurs and a lack of flexibility inhibits photoreactivity at many other sites that are otherwise suitable for reaction. Results We used 30S x-ray structures to quantify the properties of the nucleotide pairs at UV- and UVA-s4U-induced photocrosslinking sites in 16S rRNA and compared these to the properties of many hundreds of additional sites that have suitable geometry but do not undergo photocrosslinking. Five factors that might affect RNA flexibility were investigated – RNA interactions with ribosomal proteins, interactions with Mg2+ ions, the presence of long-range A minor motif interactions, hydrogen bonding and the count of neighboring heavy atoms around the center of each nucleobase to estimate the neighbor packing density. The two factors that are very different in the unreactive inflexible pairs compared to the reactive ones are the average number of hydrogen bonds and the average value for the number of neighboring atoms. In both cases, these factors are greater for the unreactive nucleotide pairs at a statistically very significant level. Conclusion The greater extent of hydrogen bonding and neighbor atom density in the unreactive nucleotide pairs is consistent with reduced flexibility at a majority of the unreactive sites. The reactive photocrosslinking sites are clustered in the 30S subunit and this indicates nonuniform patterns of

  15. Short hairpin RNA library-based functional screening identified ribosomal protein L31 that modulates prostate cancer cell growth via p53 pathway.

    Yojiro Maruyama

    Full Text Available Androgen receptor is a primary transcription factor involved in the proliferation of prostate cancer cells. Thus, hormone therapy using antiandrogens, such as bicalutamide, is a first-line treatment for the disease. Although hormone therapy initially reduces the tumor burden, many patients eventually relapse, developing tumors with acquired endocrine resistance. Elucidation of the molecular mechanisms underlying endocrine resistance is therefore a fundamental issue for the understanding and development of alternative therapeutics for advanced prostate cancer. In the present study, we performed short hairpin RNA (shRNA-mediated functional screening to identify genes involved in bicalutamide-mediated effects on LNCaP prostate cancer cells. Among such candidate genes selected by screening using volcano plot analysis, ribosomal protein L31 (RPL31 was found to be essential for cell proliferation and cell-cycle progression in bicalutamide-resistant LNCaP (BicR cells, based on small interfering RNA (siRNA-mediated knockdown experiments. Of note, RPL31 mRNA is more abundantly expressed in BicR cells than in parental LNCaP cells, and clinical data from ONCOMINE and The Cancer Genome Altas showed that RPL31 is overexpressed in prostate carcinomas compared with benign prostate tissues. Intriguingly, protein levels of the tumor suppressor p53 and its targets, p21 and MDM2, were increased in LNCaP and BicR cells treated with RPL31 siRNA. We observed decreased degradation of p53 protein after RPL31 knockdown. Moreover, the suppression of growth and cell cycle upon RPL31 knockdown was partially recovered with p53 siRNA treatment. These results suggest that RPL31 is involved in bicalutamide-resistant growth of prostate cancer cells. The shRNA-mediated functional screen in this study provides new insight into the molecular mechanisms and therapeutic targets of advanced prostate cancer.

  16. [Transport of newly synthesized rRNA from the nucleus to the cytoplasm in freely suspended cells of parsley (Petroselinum sativum)].

    Seitz, U; Seitz, U

    1972-06-01

    A rapidly labelled rRNA precursor can be detected in callus cells of Petroselinum sativum grown on a liquid synthetic medium. Its molecular weight has been calculated to be 2.3×10(6). This value agrees with that of the rRNA precursor from other plant material. In order to follow the synthesis and processing of rRNA in time and to correlate single steps in this process with cell organelles it was necessary to obtain pure fractions of nuclei and ribosomes. The isolation method for nuclei is given in detail. The nucleic acids are separated on polyacrylamide gels of low acrylamide concentration. Pulse-chase experiments show that the rRNA precursor is split into two fragments within the nucleus: an 18S and a 25S component. The 18S RNA leaves the nucleus rapidly. It is already found quantitatively in the ribosomal fraction after 30-60 min chase. At that time the 25S RNA is still within the nucleus; it appears much later in the ribosomes. Since the increase in ribosomal label occurs simultaneously with the decrease in nuclear label, it is concluded that there is no degradation of 18S RNA within the nucleus. Apparently there are two distinct transport mechanisms with different kinetics for the two RNA components. PMID:24477955

  17. VISUALIZATION OF THE HYBRID STATE OF tRNA BINDING PROMOTED BY SPONTANEOUS RATCHETING OF THE RIBOSOME

    Agirrezabala, Xabier; Lei, Jianlin; Brunelle, Julie L; Ortiz-Meoz, Rodrigo F.; Green, Rachel; Frank, Joachim

    2008-01-01

    A crucial step in protein translation is the translocation of tRNAs through the ribosome. In the transition from one canonical site to the other, the tRNAs acquire intermediate configurations, so-called hybrid states. At this stage, the small subunits is rotated with respect to the large subunit, and the anticodon stem loops reside in the A and P sites of the small subunit, while the acceptor ends interact with the P and E sites of the large subunit. In this work, by means of cryo-EM and part...

  18. mRNA decay factor AUF1 binds the internal ribosomal entry site of enterovirus 71 and inhibits virus replication.

    Jing-Yi Lin

    Full Text Available AU-rich element binding factor 1 (AUF1 has a role in the replication cycles of different viruses. Here we demonstrate that AUF1 binds the internal ribosome entry site (IRES of enterovirus 71 (EV71 and negatively regulates IRES-dependent translation. During EV71 infection, AUF1 accumulates in the cytoplasm where viral replication occurs, whereas AUF1 localizes predominantly in the nucleus in mock-infected cells. AUF1 knockdown in infected cells increases IRES activity and synthesis of viral proteins. Taken together, the results suggest that AUF1 interacts with the EV71 IRES to negatively regulate viral translation and replication.

  19. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G.

    2014-01-01

    eLife digest The production of a protein in a cell starts with a region of DNA being transcribed to produce a molecule of messenger RNA. A large molecular machine called ribosome then reads the information in the messenger RNA molecule to produce a protein. Ribosomes themselves are made of RNA and several different proteins called r-proteins. The construction of a ribosome starts with the assembly of a pre-ribosome inside the cell nucleus, and the ribosome is completed in the cytosol of the c...

  20. Characterization of Aquifex aeolicus ribonuclease III and the reactivity epitopes of its pre-ribosomal RNA substrates

    Shi, Zhongjie; Nicholson, Rhonda H.; Jaggi, Ritu; Nicholson, Allen W.

    2010-01-01

    Ribonuclease III cleaves double-stranded (ds) structures in bacterial RNAs and participates in diverse RNA maturation and decay pathways. Essential insight on the RNase III mechanism of dsRNA cleavage has been provided by crystallographic studies of the enzyme from the hyperthermophilic bacterium, Aquifex aeolicus. However, the biochemical properties of A. aeolicus (Aa)-RNase III and the reactivity epitopes of its substrates are not known. The catalytic activity of purified recombinant Aa-RNa...

  1. The Escherichia coli OxyS regulatory RNA represses fhlA translation by blocking ribosome binding.

    Altuvia, S; Zhang, A.; Argaman, L; Tiwari, A; Storz, G.

    1998-01-01

    OxyS is a small untranslated RNA which is induced in response to oxidative stress in Escherichia coli. This novel RNA acts as a global regulator to activate or repress the expression of as many as 40 genes, including the fhlA-encoded transcriptional activator and the rpoS-encoded sigma(s) subunit of RNA polymerase. Deletion analysis of OxyS showed that different domains of the small RNA are required for the regulation of fhlA and rpoS. We examined the mechanism of OxyS repression of fhlA and ...

  2. Repair of UV induced DNA lesions in ribosomal gene chromatin and the role of "Odd" RNA polymerases (I and III).

    Charton, Romain; Guintini, Laetitia; Peyresaubes, François; Conconi, Antonio

    2015-12-01

    In fast growing eukaryotic cells, a subset of rRNA genes are transcribed at very high rates by RNA polymerase I (RNAPI). Nuclease digestion-assays and psoralen crosslinking have shown that they are open; that is, largely devoid of nucleosomes. In the yeast Saccharomyces cerevisae, nucleotide excision repair (NER) and photolyase remove UV photoproducts faster from open rRNA genes than from closed and nucleosome-loaded inactive rRNA genes. After UV irradiation, rRNA transcription declines because RNAPI halt at UV photoproducts and are then displaced from the transcribed strand. When the DNA lesion is quickly recognized by NER, it is the sub-pathway transcription-coupled TC-NER that removes the UV photoproduct. If dislodged RNAPI are replaced by nucleosomes before NER recognizes the lesion, then it is the sub-pathway global genome GG-NER that removes the UV photoproducts from the transcribed strand. Also, GG-NER maneuvers in the non-transcribed strand of open genes and in both strands of closed rRNA genes. After repair, transcription resumes and elongating RNAPI reopen the rRNA gene. In higher eukaryotes, NER in rRNA genes is inefficient and there is no evidence for TC-NER. Moreover, TC-NER does not occur in RNA polymerase III transcribed genes of both, yeast and human fibroblast. PMID:26411875

  3. Visualization of the hybrid state of tRNA binding promoted by spontaneous ratcheting of the ribosome.

    Agirrezabala, Xabier; Lei, Jianlin; Brunelle, Julie L; Ortiz-Meoz, Rodrigo F; Green, Rachel; Frank, Joachim

    2008-10-24

    A crucial step in translation is the translocation of tRNAs through the ribosome. In the transition from one canonical site to the other, the tRNAs acquire intermediate configurations, so-called hybrid states. At this stage, the small subunit is rotated with respect to the large subunit, and the anticodon stem loops reside in the A and P sites of the small subunit, while the acceptor ends interact with the P and E sites of the large subunit. In this work, by means of cryo-EM and particle classification procedures, we visualize the hybrid state of both A/P and P/E tRNAs in an authentic factor-free ribosome complex during translocation. In addition, we show how the repositioning of the tRNAs goes hand in hand with the change in the interplay between S13, L1 stalk, L5, H68, H69, and H38 that is caused by the ratcheting of the small subunit. PMID:18951087

  4. Identification and characterization of anaerobic gut fungi using molecular methodologies based on ribosomal ITS1 and 185 rRNA.

    Brookman, J L; Mennim, G; Trinci, A P; Theodorou, M K; Tuckwell, D S

    2000-02-01

    The gut fungi are an unusual group of zoosporic fungi occupying a unique ecological niche, the anaerobic environment of the rumen. They exhibit two basic forms, with nuclear migration throughout the hyphal mass for polycentric species and with concentration of nuclear material in a zoosporangium for monocentric species. Differentiation between isolates of these fungi is difficult using conventional techniques. In this study, DNA-based methodologies were used to examine the relationships within and between two genera of monocentric gut fungi gathered from various geographical locations and host animals. The ribosomal ITS1 sequence from 16 mono- and 4 polycentric isolates was PCR-amplified and sequenced; the sequences obtained were aligned with published sequences and phylogenetic analyses were performed. These analyses clearly differentiate between the two genera and reflect the previously published physiological conclusions that Neocallimastix spp. constitute a more closely related genus than the relatively divergent genus Piromyces. The analyses place two type species N. frontalis and N. hurleyensis together but, contrary to a recent suggestion in the literature, place them apart from the other agreed species N. patriciarum. In situ hybridization and slot-blotting were investigated as potential methods for detection of and differentiation between monocentric gut fungi. DNA slot-blot analysis using ribosomal sequences is able to differentiate between gut fungal genera and thus has considerable potential for use in ecological studies of these organisms. PMID:10708378

  5. Identification of Biomphalaria havanensis and Biomphalaria obstructa populations from Cuba using polymerase chain reaction and restriction fragment length polymorphism of the ribosomal RNA intergenic spacer

    Teofânia HDA Vidigal

    2001-07-01

    Full Text Available In Cuba, several Biomphalaria species have been reported such as B. orbignyi, B. schrammi, B. helophila, B. havanensis and B. peregrina; only the latter three are considered as potential hosts of Schistosoma mansoni. The specific identification of Biomphalaria species is based on anatomical and morphological characters of genital organs and shells. The correct identification of these snails is complicated by the high variation in these characters, similarity among species and in some cases by the small size of the snails. In this paper, we reported the classical morphological identification, the use of PCR and RFLP analysis of the internal transcribed spacer region of the ribosomal RNA genes for molecular identification of seven snail populations from different localities in Cuba. Using morphological and molecular analysis, we showed that among the studied Cuban Biomphalaria populations only B. havanensis and B. obstructa species were found.

  6. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Caldeira Roberta L

    2000-01-01

    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  7. Mutation detection analysis of a region of 16S-like ribosomal RNA gene of Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii

    Khairnar Krishna

    2008-09-01

    Full Text Available Abstract Background The level of intra-species genetic variation in Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii populations in a localized geographic area, like Puducherry, India, remains unknown. Methods In the present study the existence of genetic variation in the nested multiplex polymerase chain reaction (NM-PCR amplified region of the 16S-like ribosomal RNA genes of E. histolytica, E. dispar and E. moshkovskii was investigated by riboprinting and single strand conformation polymorphism (SSCP analysis. Results We found that 70 stool specimens were positive for E. histolytica, 171 stool specimens were positive for E. dispar, and 37 stool specimens were positive for E. moshkovskii by NM-PCR. Ninety liver abscess pus specimens, 21 urine specimens, and 8 saliva specimens were positive for E. histolytica by NM-PCR. Riboprinting analysis detected a mutation in the PCR product of only one E. histolytica isolate from a stool specimen. However, SSCP analysis detected mutations in the PCR products of five E. histolytica isolates and three E. moshkovskii isolates from stool specimens, and one E. histolytica isolate from a saliva specimen. The mutations detected by riboprinting and SSCP analysis were confirmed by sequencing. All the nucleotide sequences showing mutations in this study have already been deposited into the NCBI GenBank database under accession numbers [GenBank: EF682200 to GenBank: EF682208]. Conclusion The present study has revealed the subsistence of mutations in the ribosomal RNA genes of E. histolytica and E. moshkovskii, which points towards the existence of intra-species genetic variation in E. histolytica and E. moshkovskii isolates infecting humans.

  8. DEAD-box helicase DDX27 regulates 3′ end formation of ribosomal 47S RNA and stably associates with the PeBoW-complex

    Kellner, Markus; Rohrmoser, Michaela [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Forné, Ignasi [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Voss, Kirsten; Burger, Kaspar; Mühl, Bastian; Gruber-Eber, Anita [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Kremmer, Elisabeth [Institute of Molecular Immunology, Helmholtz Center Munich, Marchioninistr. 25, Munich 81377 (Germany); Imhof, Axel [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Eick, Dirk, E-mail: eick@helmholtz-muenchen.de [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany)

    2015-05-15

    PeBoW, a trimeric complex consisting of pescadillo (Pes1), block of proliferation (Bop1), and the WD repeat protein 12 (WDR12), is essential for processing and maturation of mammalian 5.8S and 28S ribosomal RNAs. Applying a mass spectrometric analysis, we identified the DEAD-box helicase DDX27 as stably associated factor of the PeBoW-complex. DDX27 interacts with the PeBoW-complex via an evolutionary conserved F×F motif in the N-terminal domain and is recruited to the nucleolus via its basic C-terminal domain. This recruitment is RNA-dependent and occurs independently of the PeBoW-complex. Interestingly, knockdown of DDX27, but not of Pes1, induces the accumulation of an extended form of the primary 47S rRNA. We conclude that DDX27 can interact specifically with the Pes1 and Bop1 but fulfils critical function(s) for proper 3′ end formation of 47S rRNA independently of the PeBoW-complex. - Highlights: • DEAD-box helicase DDX27 is a new constituent of the PeBoW-complex. • The N-terminal F×F motif of DDX27 interacts with the PeBoW components Pes1 and Bop1. • Nucleolar anchoring of DDX27 via its basic C-terminal domain is RNA dependent. • Knockdown of DDX27 induces a specific defect in 3′ end formation of 47S rRNA.

  9. Requirement for SAPK-JNK signaling in the induction of apoptosis by ribosomal stress in REH lymphoid leukemia cells.

    Johnson, C R; Jiffar, T; Fischer, U M; Ruvolo, P P; Jarvis, W D

    2003-11-01

    The present studies examined performance of SAPK cascades and apoptotic commitment following ribosomal trauma in REH lymphoid leukemia cells. Ribostatic insults included disruption of ribosomal activity by mechanistically dissimilar agents such as blasticidin-S (BCS) (which binds 28S-rRNA to block peptidyl bond formation), kasugamycin (KSM) (which binds 18S-rRNA to prevent translational initiation), and cycloheximide (CHX) (which blocks A-site to P-site translocation of peptidyl-tRNA). Exposure of REH cells to BCS elicited DNA degradation and apoptotic cytolysis. BCS stimulated JNK1/JNK2 and p38, and their shared targets c-Jun and ATF2. Inhibition of JNK1/JNK2 (but not of p38) antagonized blasticidin-induced apoptosis, whereas targeting alternative ribosomal sites with KSM or CHX limited translation, but failed to activate the SAPK cascade or initiate apoptosis. Our findings indicate that interference with 28S-rRNA by BCS initiates apoptosis in REH cells through recruitment of SAPK-JNK signaling. Disparities between the lethal actions of BCS, KSM, and CHX appear to reflect established differences in the subribosomal targets of these agents. We propose that the SAPK cascade comprises an essential mechanism for the transduction of specific lethal stress signals emanating from active ribosomes, and that interference with the 28S-rRNA, rather than the peptidyl transfer center of the large subunit, is critical to apoptotic commitment. PMID:12970763

  10. Population-level study of ribosomal RNA genes expression in Tragopogon allotetraplopids of recent and recurrent origin

    Kovařík, Aleš; Matyášek, Roman; Tate, J. A.; Šrubařová, Hana; Yoong, K.Y.; Leitch, A.R.; Soltis, D.E.; Soltis, P.E.

    Prague, 2006. [Groupe Cytogenetique et polyploidie. 05.04.2006-07.04.2006, Bordeaux] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA * Tragopogon * allotetraploids Subject RIV: BO - Biophysics

  11. Molecular paleontology: a biochemical model of the ancestral ribosome

    Hsiao, Chiaolong; Lenz, Timothy K.; Peters, Jessica K; Fang, Po-Yu; Schneider, Dana M.; Anderson, Eric J.; Preeprem, Thanawadee; Bowman, Jessica C.; O'Neill, Eric B.; Lie, Lively; Athavale, Shreyas S.; Gossett, J. Jared; Trippe, Catherine; Murray, Jason; Anton S. Petrov

    2013-01-01

    Ancient components of the ribosome, inferred from a consensus of previous work, were constructed in silico, in vitro and in vivo. The resulting model of the ancestral ribosome presented here incorporates ∼20% of the extant 23S rRNA and fragments of five ribosomal proteins. We test hypotheses that ancestral rRNA can: (i) assume canonical 23S rRNA-like secondary structure, (ii) assume canonical tertiary structure and (iii) form native complexes with ribosomal protein fragments. Footprinting exp...

  12. Structural and Functional Characterization of Programmed Ribosomal Frameshift Signals in West Nile Virus Strains Reveals High Structural Plasticity Among cis-Acting RNA Elements.

    Moomau, Christine; Musalgaonkar, Sharmishtha; Khan, Yousuf A; Jones, John E; Dinman, Jonathan D

    2016-07-22

    West Nile virus (WNV) is a prototypical emerging virus for which no effective therapeutics currently exist. WNV uses programmed -1 ribosomal frameshifting (-1 PRF) to synthesize the NS1' protein, a C terminally extended version of its non-structural protein 1, the expression of which enhances neuro-invasiveness and viral RNA abundance. Here, the NS1' frameshift signals derived from four WNV strains were investigated to better understand -1 PRF in this quasispecies. Sequences previously predicted to promote -1 PRF strongly promote this activity, but frameshifting was significantly more efficient upon inclusion of additional 3' sequence information. The observation of different rates of -1 PRF, and by inference differences in the expression of NS1', may account for the greater degrees of pathogenesis associated with specific WNV strains. Chemical modification and mutational analyses of the longer and shorter forms of the -1 PRF signals suggests dynamic structural rearrangements between tandem stem-loop and mRNA pseudoknot structures in two of the strains. A model is suggested in which this is employed as a molecular switch to fine tune the relative expression of structural to non-structural proteins during different phases of the viral replication cycle. PMID:27226636

  13. Human Mitochondrial Ribosomal Protein MRPL12 Interacts Directly with Mitochondrial RNA Polymerase to Modulate Mitochondrial Gene Expression*

    Wang, Zhibo; Cotney, Justin; Shadel, Gerald S.

    2007-01-01

    The core human mitochondrial transcription machinery comprises a single subunit bacteriophage-related RNA polymerase, POLRMT, the high mobility group box DNA-binding protein h-mtTFA/TFAM, and two transcriptional co-activator proteins, h-mtTFB1 and h-mtTFB2 that also have rRNA methyltransferase activity. Recapitulation of specific initiation of transcription in vitro can be achieved by a complex of POLRMT, h-mtTFA, and either h-mtTFB1 or h-mtTFB2. However, the nature of mitochondrial transcrip...

  14. The majority of total nuclear-encoded non-ribosomal RNA in a human cell is 'dark matter' un-annotated RNA

    Milos Patrice; Reaman Gregory; Sorensen Poul HB; Reynolds C Patrick; Ozsolak Fatih; Raz Tal; St Laurent Georges; Kapranov Philipp; Arceci Robert J; Thompson John F; Triche Timothy J

    2010-01-01

    Abstract Background Discovery that the transcriptional output of the human genome is far more complex than predicted by the current set of protein-coding annotations and that most RNAs produced do not appear to encode proteins has transformed our understanding of genome complexity and suggests new paradigms of genome regulation. However, the fraction of all cellular RNA whose function we do not understand and the fraction of the genome that is utilized to produce that RNA remain controversial...

  15. A Step Subsequent to Preinitiation Complex Assembly at the Ribosomal RNA Gene Promoter Is Rate Limiting for Human RNA Polymerase I-Dependent Transcription

    Panov, Kostya I.; Friedrich, J. Karsten; Zomerdijk, Joost C. B. M.

    2001-01-01

    The assembly, disassembly, and functional properties of transcription preinitiation complexes (PICs) of human RNA polymerase I (Pol I) play a crucial role in the regulation of rRNA gene expression. To study the factors and processes involved, an immobilized-promoter template assay has been developed that allows the isolation from nuclear extracts of functional PICs, which support accurate initiation of transcription. Immunoblotting of template-bound factors showed that these complexes contain...

  16. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Deborah Chiabrando

    2010-01-01

    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  17. Interrelationships between yeast ribosomal protein assembly events and transient ribosome biogenesis factors interactions in early pre-ribosomes.

    Steffen Jakob

    Full Text Available Early steps of eukaryotic ribosome biogenesis require a large set of ribosome biogenesis factors which transiently interact with nascent rRNA precursors (pre-rRNA. Most likely, concomitant with that initial contacts between ribosomal proteins (r-proteins and ribosome precursors (pre-ribosomes are established which are converted into robust interactions between pre-rRNA and r-proteins during the course of ribosome maturation. Here we analysed the interrelationship between r-protein assembly events and the transient interactions of ribosome biogenesis factors with early pre-ribosomal intermediates termed 90S pre-ribosomes or small ribosomal subunit (SSU processome in yeast cells. We observed that components of the SSU processome UTP-A and UTP-B sub-modules were recruited to early pre-ribosomes independently of all tested r-proteins. On the other hand, groups of SSU processome components were identified whose association with early pre-ribosomes was affected by specific r-protein assembly events in the head-platform interface of the SSU. One of these components, Noc4p, appeared to be itself required for robust incorporation of r-proteins into the SSU head domain. Altogether, the data reveal an emerging network of specific interrelationships between local r-protein assembly events and the functional interactions of SSU processome components with early pre-ribosomes. They point towards some of these components being transient primary pre-rRNA in vivo binders and towards a role for others in coordinating the assembly of major SSU domains.

  18. The economics of ribosome biosynthesis in yeast.

    Warner, J R

    1999-11-01

    In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to ribosomal proteins (RPs). Coordinate regulation of the approximately 150 rRNA genes and 137 RP genes that make such prodigious use of resources is essential for the economy of the cell. This is entrusted to a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, leading to major implications for the expression of other genes as well. PMID:10542411

  19. 16S ribosomal RNA-based methods to monitor changes in the hindgut bacterial community of piglets after oral administration of Lactobacillus sobrius S1.

    Su, Yong; Yao, Wen; Perez-Gutierrez, Odette N; Smidt, Hauke; Zhu, Wei-Yun

    2008-04-01

    16S ribosomal RNA (rRNA) gene based PCR/denaturing gradient gel electrophoresis (DGGE) and real-time PCR were used to monitor the changes in the composition of microbiota in the hindgut of piglets after oral administration of Lactobacillus sobrius S1. Six litters of neonatal piglets were divided randomly into control group and treatment group. At 7, 9, and 11 days of age, piglets in the treatment group orally received a preparation of L. sobrius S1. At 7, 14, 21(weaning), 24, and 35 days of age, one piglet from each litter was sacrificed and digesta samples of hindgut were collected. DGGE analysis of 16S rRNA gene V6-V8 region for all bacteria showed that several populations present in the hindgut of piglets, represented by far-migrating bands, disappeared after weaning. Most of these bands corresponded to Lactobacillus spp. as revealed by sequence analysis. Quantitative real-time PCR specific for lactobacilli further demonstrated that the number of lactobacilli population tended to decrease after the piglets were weaned. Drastic changes of L. amylovorus and L. sobrius in total Lactobacillus populations were also observed in the colon of piglets around weaning, as monitored by 16S rRNA gene V2-V3 region based Lactobacillus-specific PCR-DGGE. Species-specific real-time PCR also revealed that the population of L. sobrius declined apparently in the colon of piglets after weaning. No remarkable changes in the overall microbial community in the hindgut were found between control and treatment groups. However, comparison of DGGE profiles between the two groups revealed a specific band related to Clostridium disporicum that was found in treatment group on day 14. On day 35, a specific band appeared only in the control group, representing a population most closely related to Streptococcus suis (99%). Real-time PCR showed that L. sobrius 16S rRNA gene copies in treatment group were relatively higher than in the control group (10(8.45) vs. 10(6.83)) on day 35, but no

  20. Ribosomal RNA-based panbacterial polymerase chain reaction for rapid diagnosis of septicaemia in Intensive Care Unit patients.

    Gupta, Mahua Das; Kaur, Harsimran; Ray, Pallab; Gautam, Vikas; Puri, G D

    2016-01-01

    Early diagnosis and treatment of sepsis by appropriate antibiotics is of utmost importance. Therefore, we evaluated 16S rRNA panbacterial polymerase chain reaction (PCR) for rapid diagnosis of sepsis in 49 adult patients in Intensive Care Units (ICUs) and compared it with an automated blood culture. 8 ml of 10 ml blood collected was inoculated into BACTEC® aerobic bottle and the remaining 2 ml was used for DNA extraction and PCR. 109 of 115 (93%) episodes of suspected sepsis showed concordant results between automated culture and PCR. Six episodes were positive by PCR only. Panbacterial PCR reduces turnaround time with rapid differentiation between systemic inflammatory response syndrome and sepsis. PMID:27080778

  1. Erythromycin binding is reduced in ribosomes with conformational alterations in the 23 S rRNA peptidyl transferase loop

    Douthwaite, S; Aagaard, C

    1993-01-01

    induced by mutations in the peptidyl transferase loop, and to determine how these changes affect drug interaction. Mutations at positions 2057 (G-->A) and 2058 (A-->G, or -->U), all of which confer drug resistance, induce a more open conformation in the peptidyl transferase loop. Erythromycin still...... protects against chemical modification in the mutant peptidyl transferase loops, but the affinity of the drug interaction is reduced 20-fold in the 2057A mutant, 10(3)-fold in the 2058U mutant and 10(4)-fold in the 2058G mutant. Single mutations at position 2032 in the adjacent hairpin loop, which have...... previously been shown to alter drug tolerances, gave no detectable effects on the structure of the peptidyl transferase loop or on erythromycin binding. Dual mutations at positions 2032 and 2058, however, induce a marked change in the rRNA conformation with opening of the phylogenetically conserved base...

  2. Phylogenetic position of the Phacotaceae within the Chlamydophyceaeas revealed by analysis of 18S rDNA and rbcL sequences.

    Hepperle, D; Nozaki, H; Hohenberger, S; Huss, V A; Morita, E; Krienitz, L

    1998-10-01

    Four genera of the Phacotaceae (Phacotus, Pteromonas, Wislouchiella, Dysmorphococcus), a family of loricated green algal flagellates within the Volvocales, were investigated by means of transmission electron microscopy and analysis of the nuclear encoded small-subunit ribosomal RNA (18S rRNA) genes and the plastid-encoded rbcL genes. Additionally, the 18S rDNA of Haematococcus pluvialis and the rbcL sequences of Chlorogonium elongatum, C. euchlorum, Dunaliella parva, Chloromonas serbinowii, Chlamydomonas radiata, and C. tetragama were determined. Analysis of ultrastructural data justified the separation of the Phacotaceae into two groups. Phacotus, Pteromonas, and Wislouchiella generally shared the following characters: egg-shaped protoplasts, a single pyrenoid with planar thylakoid double-lamellae, three-layered lorica, flagellar channels as part of the central lorica layer, mitochondria located in the central cytoplasm, lorica development that occurs in mucilaginous zoosporangia that are to be lysed, and no acid-resistant cell walls. Dysmorphococcus was clearly different in each of the characters mentioned. Direct comparison of sequences of Phacotus lenticularis, Pteromonas sp., Pteromonas protracta, and Wislouchiella planctonica revealed DNA sequence homologies of >/=98. 0% within the 18S gene and 93.9% within the rbcL gene. D. globosus was quite different from these species, with a maximum of 92.9% homology in the 18S rRNA and 18S rDNA of Dunaliella salina, with 95.3%, and to the rbcL sequence of Chlamydomonas tetragama, with 90.3% sequence homology. Additionally, the Phacotaceae sensu stricto exclusively shared 10 (rbcL: 4) characters which were present neither in other Chlamydomonadales nor in Dysmorphococcus globosus. Different phylogenetic analysis methods confirmed the hypothesis that the Phacotaceae are polyphyletic. The Phacotaceae sensu stricto form a stable cluster with affinities to the

  3. Molecular characterization of tlyA gene product, Rv1694 of Mycobacterium tuberculosis: A non-conventional hemolysin and a ribosomal RNA methyl transferase

    Ahmed Neesar

    2010-09-01

    was significantly slower than mock vector transformed E. coli. The S30 extract of E. coli expressing the Rv1694 had poor translational activity in presence of capreomycin, further confirming its methylation activity. Finally, incorporation of methyl group of [3H]-S-adenosylmethionine in isolated ribosomes also confirmed its methylation activity. Conclusions The Rv1694 has an unusual dual activity. It appears to contain two diverse functions such as haemolytic activity and ribosomal RNA methylation activity. It is possible that the haemolytic activity might be relevant to intra-cellular compartments such as phagosomes rather than cell lysis of erythrocytes and the self-assembly trait may have a potential role after successful entry into macrophages by Mycobacterium tuberculosis.

  4. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-07-01

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

  5. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-01-01

    Roč. 46, č. 2 (2014), s. 147-156. ISSN 0145-479X R&D Projects: GA ČR(CZ) GAP305/12/1247; GA ČR(CZ) GPP305/12/P388; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:67985823 Keywords : 5S-rRNA * mitochondrial DNA * nucleic acid import into mitochondria * fluorescent in vivo hybridization of mtDNA * mitochondrial nucleoids Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.212, year: 2014

  6. Ribosome engineering to promote new crystal forms

    Truncation of ribosomal protein L9 in T. thermophilus allows the generation of new crystal forms and the crystallization of ribosome–GTPase complexes. Crystallographic studies of the ribosome have provided molecular details of protein synthesis. However, the crystallization of functional complexes of ribosomes with GTPase translation factors proved to be elusive for a decade after the first ribosome structures were determined. Analysis of the packing in different 70S ribosome crystal forms revealed that regardless of the species or space group, a contact between ribosomal protein L9 from the large subunit and 16S rRNA in the shoulder of a neighbouring small subunit in the crystal lattice competes with the binding of GTPase elongation factors to this region of 16S rRNA. To prevent the formation of this preferred crystal contact, a mutant strain of Thermus thermophilus, HB8-MRCMSAW1, in which the ribosomal protein L9 gene has been truncated was constructed by homologous recombination. Mutant 70S ribosomes were used to crystallize and solve the structure of the ribosome with EF-G, GDP and fusidic acid in a previously unobserved crystal form. Subsequent work has shown the usefulness of this strain for crystallization of the ribosome with other GTPase factors

  7. Biological activities of some Acacia spp. (Fabaceae) against new clinical isolates identified by ribosomal RNA gene-based phylogenetic analysis.

    Mahmoud, Mahmoud Fawzy; Alrumman, Sulaiman Abdullah; Hesham, Abd El-Latif

    2016-01-01

    Nowadays,most of the pathogenic bacteria become resistant to antibiotics. Therefore,the pharmaceutical properties of the natural plant extracts have become of interest to researchers as alternative antimicrobial agents. In this study,antibacterial activities of extract gained from Acacia etbaica, Acacia laeta, Acacia origena and Acacia pycnantha have been evaluated against isolated pathogenic bacteria (Strains MFM-01, MFM-10 and AH-09) using agar well diffusion methods.The bacterial strains were isolated from infected individuals,and their exact identification was detected on the basis of 16S rRNA gene amplification and sequence determination. Alignment results and the comparison of 16 SrRN A gene sequences of the isolates to 16 SrRN A gene sequences available in Gen Bank data base as well as the phylogenetic analysis confirmed the accurate position of the isolates as Klebsiella oxytoca strain MFM-01, Staphylococcus aureus strain MFM-10 and Klebsiella pneumoniae strain AH-09. Except for cold water, all tested solvents (Chloroform, petroleum ether, methanol, diethyl ether, and acetone) showed variation in their activity against studied bacteria. GC-MS analysis of ethanol extracts showed that four investigated Acacia species have different phyto components. Eight important pharmaceutical components were found in the legume of Acacia etbaica, seven in the legume of Acacia laeta, fifteen in the legume of Acacia origena and nine in the leaves of Acacia pycnantha. A dendrogram was constructed based on chemical composition, revealed that Acacia laeta is more closely related to Acacia etbaica forming on eclade, whereas Acacia origena less similar to other species. Our results demonstrated that, investigated plants and chemical compounds present could be used as promising antibacterial agents. PMID:26826814

  8. The Functional Role of eL19 and eB12 Intersubunit Bridge in the Eukaryotic Ribosome.

    Kisly, Ivan; Gulay, Suna P; Mäeorg, Uno; Dinman, Jonathan D; Remme, Jaanus; Tamm, Tiina

    2016-05-22

    During translation, the two eukaryotic ribosomal subunits remain associated through 17 intersubunit bridges, five of which are eukaryote specific. These are mainly localized to the peripheral regions and are believed to stabilize the structure of the ribosome. The functional importance of these bridges remains largely unknown. Here, the essentiality of the eukaryote-specific bridge eB12 has been investigated. The main component of this bridge is ribosomal protein eL19 that is composed of an N-terminal globular domain, a middle region, and a long C-terminal α-helix. The analysis of deletion mutants demonstrated that the globular domain and middle region of eL19 are essential for cell viability, most likely functioning in ribosome assembly. The eB12 bridge, formed by contacts between the C-terminal α-helix of eL19 and 18S rRNA in concert with additional stabilizing interactions involving either eS7 or uS17, is dispensable for viability. Nevertheless, eL19 mutants impaired in eB12 bridge formation displayed slow growth phenotypes, altered sensitivity/resistance to translational inhibitors, and enhanced hyperosmotic stress tolerance. Biochemical analyses determined that the eB12 bridge contributes to the stability of ribosome subunit interactions in vitro. 60S subunits containing eL19 variants defective in eB12 bridge formation failed to form 80S ribosomes regardless of Mg(2+) concentration. The reassociation of 40S and mutant 60S subunits was markedly improved in the presence of deacetylated tRNA, emphasizing the importance of tRNAs during the subunit association. We propose that the eB12 bridge plays an important role in subunit joining and in optimizing ribosome functionality. PMID:27038511

  9. Extremophilic 50S Ribosomal RNA-Binding Protein L35Ae as a Basis for Engineering of an Alternative Protein Scaffold.

    Anna V Lomonosova

    Full Text Available Due to their remarkably high structural stability, proteins from extremophiles are particularly useful in numerous biological applications. Their utility as alternative protein scaffolds could be especially valuable in small antibody mimetic engineering. These artificial binding proteins occupy a specific niche between antibodies and low molecular weight substances, paving the way for development of innovative approaches in therapeutics, diagnostics, and reagent use. Here, the 50S ribosomal RNA-binding protein L35Ae from the extremophilic archaea Pyrococcus horikoshii has been probed for its potential to serve as a backbone in alternative scaffold engineering. The recombinant wild type L35Ae has a native-like secondary structure, extreme thermal stability (mid-transition temperature of 90°C and a moderate resistance to the denaturation by guanidine hydrochloride (half-transition at 2.6 M. Chemical crosslinking and dynamic light scattering data revealed that the wild type L35Ae protein has a propensity for multimerization and aggregation correlating with its non-specific binding to a model cell surface of HEK293 cells, as evidenced by flow cytometry. To suppress these negative features, a 10-amino acid mutant (called L35Ae 10X was designed, which lacks the interaction with HEK293 cells, is less susceptible to aggregation, and maintains native-like secondary structure and thermal stability. However, L35Ae 10X also shows lowered resistance to guanidine hydrochloride (half-transition at 2.0M and is more prone to oligomerization. This investigation of an extremophile protein's scaffolding potential demonstrates that lowered resistance to charged chemical denaturants and increased propensity to multimerization may limit the utility of extremophile proteins as alternative scaffolds.

  10. Ribosome dynamics and the evolutionary history of ribosomes

    Fox, George E.; Paci, Maxim; Tran, Quyen; Petrov, Anton S.; Williams, Loren D.

    2015-09-01

    The ribosome is a dynamic nanomachine responsible for coded protein synthesis. Its major subsystems were essentially in place at the time of the last universal common ancestor (LUCA). Ribosome evolutionary history thus potentially provides a window into the pre- LUCA world. This history begins with the origins of the peptidyl transferase center where the actual peptide is synthesized and then continues over an extended timeframe as additional functional centers including the GTPase center are added. The large ribosomal RNAs (rRNAs) have grown over time by an accretion process and a model exists that proposes a relative age of each accreted element. We have compared atomic resolution ribosome structures before and after EF-G bound GTP hydrolysis and thereby identified the location of 23 pivot points in the large rRNAs that facilitate ribosome dynamics. Pivots in small subunit helices h28 and h44 appear to be especially central to the process and according to the accretion model significantly older than the other helices containing pivots. Overall, the results suggest that ribosomal dynamics occurred in two phases. In the first phase, an inherently mobile h28/h44 combination provided the flexibility needed to create a dynamic ribosome that was essentially a Brownian machine. This addition likely made coded peptide synthesis possible by facilitating movement of a primitive mRNA. During the second phase, addition of pivoting elements and the creation of a factor binding site allowed the regulation of the inherent motion created by h28/h44. All of these events likely occurred before LUCA.

  11. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  12. Disassembly of yeast 80S ribosomes into subunits is a concerted action of ribosome-assisted folding of denatured protein.

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-22

    It has been shown by several groups that ribosome can assist folding of denatured protein in vitro and the process is conserved across the species. Domain V of large ribosomal rRNA which occupies the intersubunit side of the large subunit was identified as the key player responsible for chaperoning the folding process. Thus, it is conceivable that denatured protein needs to access the intersubunit space of the ribosome in order to get folded. In this study, we have investigated the mechanism of release of the protein from the eukaryotic ribosome following reactivation. We have observed significant splitting of yeast 80S ribosome when incubated with the denatured BCAII protein. Energy-free disassembly mechanism functions in low Mg(+2) ion concentration for prokaryotic ribosomes. Eukaryotic ribosomes do not show significant splitting even at low Mg(+2) ion concentration. In this respect, denatured protein-induced disassembly of eukaryotic ribosome without the involvement of any external energy source is intriguing. For prokaryotic ribosomes, it was reported that the denatured protein induces ribosome splitting into subunits in order to access domain V-rRNA. In contrast, our results suggest an alternative mechanism for eukaryotic ribosomal rRNA-mediated protein folding and subsequent separation of the subunits by which release of the activated-protein occurs. PMID:26723252

  13. Identification of a potential fungal species by 18S rDNA for ligninases production.

    Ferhan, M; Santos, S N; Melo, I S; Yan, N; Sain, M

    2013-12-01

    Fungal species for ligninases production was investigated by 18S ribosomal DNA sequence analysis. Two primer sets were chosen to amplify a major part of the 18S rDNA, which resulted in intense PCR product of approximately 550-820 bp in size per sample. The results suggest that the 18S rDNA-based approach is a useful tool for identification of unknown potential fungal species for ligninases production. The isolated fungal species produces mainly manganese peroxidase (MnP). The enzyme oxidized a variety of the usual MnP substrates, including lignin related polyphenols. Time course studies showed that maximum production of ligninolytic enzymes MnP (64 IU L⁻¹), lignin peroxidase (26.35 IU L⁻¹), and laccase (5.44 IU L⁻¹), respectively, were achieved after 10 days of cultivation under optimum conditions. Furthermore, the biological decolorization of Remazol Brilliant Blue R dye following 10 days of cultivation was 94 %. NCBI BLAST was used to search for closest matched sequences in the GenBank database and based on sequence homology the first BLAST hit was Dothioraceae sp. LM572 with accession number EF060858.1. PMID:23744034

  14. Identification of Sex and Female's Reproductive Stage in Commercial Fish Species through the Quantification of Ribosomal Transcripts in Gonads.

    Rojo-Bartolomé, Iratxe; Diaz de Cerio, Oihane; Diez, Guzman; Cancio, Ibon

    2016-01-01

    The estimation of maturity and sex of fish stocks in European waters is a requirement of the EU Data Collection Framework as part of the policy to improve fisheries management. On the other hand, research on fish biology is increasingly focused in molecular approaches, researchers needing correct identification of fish sex and reproductive stage without necessarily having in house the histological know-how necessary for the task. Taking advantage of the differential gene transcription occurring during fish sex differentiation and gametogenesis, the utility of 5S ribosomal RNA (5S rRNA) and General transcription factor IIIA (gtf3a) in the molecular identification of sex and gametogenic stage was tested in different economically-relevant fish species from the Bay of Biscay. Gonads of 9 fish species (, Atlantic, Atlantic-chub and horse mackerel, blue whiting, bogue, European anchovy, hake and pilchard and megrim), collected from local commercial fishing vessels were histologically sexed and 5S and 18S rRNA concentrations were quantified by capillary electrophoresis to calculate a 5S/18S rRNA index. Degenerate primers permitted cloning and sequencing of gtf3a fragments in 7 of the studied species. 5S rRNA and gtf3a transcript levels, together with 5S/18S rRNA index, distinguished clearly ovaries from testis in all of the studied species. The values were always higher in females than in males. 5S/18S rRNA index values in females were always highest when fish were captured in early phases of ovary development whilst, in later vitellogenic stages, the values decreased significantly. In megrim and European anchovy, where gonads in different oogenesis stages were obtained, the 5S/18S rRNA index identified clearly gametogenic stage. This approach, to the sexing and the quantitative non-subjective identification of the maturity stage of female fish, could have multiple applications in the study of fish stock dynamics, fish reproduction and fecundity and fish biology in

  15. Identification of Sex and Female's Reproductive Stage in Commercial Fish Species through the Quantification of Ribosomal Transcripts in Gonads.

    Iratxe Rojo-Bartolomé

    Full Text Available The estimation of maturity and sex of fish stocks in European waters is a requirement of the EU Data Collection Framework as part of the policy to improve fisheries management. On the other hand, research on fish biology is increasingly focused in molecular approaches, researchers needing correct identification of fish sex and reproductive stage without necessarily having in house the histological know-how necessary for the task. Taking advantage of the differential gene transcription occurring during fish sex differentiation and gametogenesis, the utility of 5S ribosomal RNA (5S rRNA and General transcription factor IIIA (gtf3a in the molecular identification of sex and gametogenic stage was tested in different economically-relevant fish species from the Bay of Biscay. Gonads of 9 fish species (, Atlantic, Atlantic-chub and horse mackerel, blue whiting, bogue, European anchovy, hake and pilchard and megrim, collected from local commercial fishing vessels were histologically sexed and 5S and 18S rRNA concentrations were quantified by capillary electrophoresis to calculate a 5S/18S rRNA index. Degenerate primers permitted cloning and sequencing of gtf3a fragments in 7 of the studied species. 5S rRNA and gtf3a transcript levels, together with 5S/18S rRNA index, distinguished clearly ovaries from testis in all of the studied species. The values were always higher in females than in males. 5S/18S rRNA index values in females were always highest when fish were captured in early phases of ovary development whilst, in later vitellogenic stages, the values decreased significantly. In megrim and European anchovy, where gonads in different oogenesis stages were obtained, the 5S/18S rRNA index identified clearly gametogenic stage. This approach, to the sexing and the quantitative non-subjective identification of the maturity stage of female fish, could have multiple applications in the study of fish stock dynamics, fish reproduction and fecundity and fish

  16. Structural and functional topography of the human ribosome

    Dmitri Graifer; Galina Karpova

    2012-01-01

    This review covers data on the structural organization of functional sites in the human ribosome,namely,the messenger RNA binding center,the binding site of the hepatitis C virus RNA internal ribosome entry site,and the peptidyl transferase center.The data summarized here have been obtained primarily by means of a site-directed crosslinking approach with application of the analogs of the respective ribosomal ligands bearing cross-linkers at the designed positions.These data are discussed taking into consideration available structural data on ribosomes from various kingdoms obtained with the use of cryo-electron microscopy,X-ray crystallography,and other approaches.

  17. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen (1H) for deuterium (2H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.)

  18. Morphology and 18S rDNA of Henneguya gurlei (Myxosporea) from Ameiurus nebulosus (Siluriformes) in North Carolina

    Iwanowicz, L.R.; Iwanowicz, D.D.; Pote, L.M.; Blazer, V.S.; Schill, W.B.

    2008-01-01

    Henneguya gurlei was isolated from Ameiurus nebulosus captured in North Carolina and redescribed using critical morphological features and 18S small-subunit ribosomal RNA (SSU rDNA) gene sequence. Plasmodia are white, spherical, or subspherical, occur in clusters, measure up to 1.8 mm in length, and are located on the dorsal, pectoral, and anal fins. Histologically, plasmodia are located in the dermis and subdermally, and the larger cysts disrupt the melanocyte pigment layer. The spore body is lanceolate, 18.2 ?? 0.3 ??m (range 15.7-20.3) in length, and 5.4 ?? 0.1 ??m (range 3.8-6.1) in width in valvular view. The caudal appendages are 41.1 ?? 1.1 ??m (range 34.0-49.7) in length. Polar capsules are pyriform and of unequal size. The longer polar capsule measures 6.2 ?? 0.1 ??m (range 5.48-7.06), while the shorter is 5.7 ?? 0.1 ??m (range 4.8-6.4) in length. Polar capsule width is 1.2 ?? 0.03 ??m (range 1.0-1.54). The total length of the spore is 60.9 ?? 1.2 ??m (range 48.7-68.5). Morphologically, this species is similar to other species of Henneguya that are known to infect ictalurids. Based on SSU rDNA sequences, this species is most closely related to H. exilis and H. ictaluri, which infect Ictalurus punctatus. ?? American Society of Parasitologists 2008.

  19. Genetic Characterization of Nematodirella cameli Based on 18S rDNA and Cytochrome c Oxidase Subunit 1 (CO1

    Hassan SHARIFIYAZDI

    2015-01-01

    Full Text Available To determine the phylogenic position and genetic diversity of Nematodirella cameli two portions of nuclear ribosomal DNA, 18S rDNA and mitochondrial DNA gene, the subunit 1 of cytochrome C oxidase gene (CO1 were sequenced and compared with those previously reported for other nematodes in Trichostrongylina. The phylogenetic trees constructed based upon the 18S rDNA sequences, yielded strong support for close relationship between the N. cameli and Nematodirus battus, with a high bootstrap value of 100%. In the present research, the level of sequence polymorphism among N. cameli isolates was higher for CO1 with 32 polymorphic sites compared to 18S rDNA sequence. Accordingly, molecular assays based on CO1 mitochondrial marker, demonstrated the existence of at least 11 distinct haplotypes (accession nos. JX305966 to JX305976 with an intraspecific diversity of 3-7% in Iran. Whereas, all of N. cameli samples examined herein (n=11, had a unique 18S sequence (accession no. JX305977. In addition, N. cameli CO1 sequences found in this study showed maximum identities to Haemonchus (88% and Ostertagia (87% in BLAST analysis for existing Trichostrongylina sequences. Further information is necessary to infer interspecific and intraspecific phylogenetic relationships between genera and species in Trichostrongylina. This study describes for the first time the nuclear 18S rDNA and mitochondrial CO1 sequence data from Nematodirella cameli species.

  20. Ribosome evolution: Emergence of peptide synthesis machinery

    Koji Tamura

    2011-12-01

    Proteins, the main players in current biological systems, are produced on ribosomes by sequential amide bond (peptide bond) formations between amino-acid-bearing tRNAs. The ribosome is an exquisite super-complex of RNA-proteins, containing more than 50 proteins and at least 3 kinds of RNAs. The combination of a variety of side chains of amino acids (typically 20 kinds with some exceptions) confers proteins with extraordinary structure and functions. The origin of peptide bond formation and the ribosome is crucial to the understanding of life itself. In this article, a possible evolutionary pathway to peptide bond formation machinery (proto-ribosome) will be discussed, with a special focus on the RNA minihelix (primordial form of modern tRNA) as a starting molecule. Combining the present data with recent experimental data, we can infer that the peptidyl transferase center (PTC) evolved from a primitive system in the RNA world comprising tRNA-like molecules formed by duplication of minihelix-like small RNA.

  1. Profiling of 2'-O-Me in human rRNA reveals a subset of fractionally modified positions and provides evidence for ribosome heterogeneity

    Krogh, Nicolai; Jansson, Martin D; Häfner, Sophia J; Tehler, Disa; Birkedal, Ulf; Christensen-Dalsgaard, Mikkel; Lund, Anders H; Nielsen, Henrik

    2016-01-01

    the level of RNA modifications. A comparison to HCT116 cells reveals similar 2'-O-Me profiles with distinct differences at several sites. This study constitutes the first comprehensive mapping of 2'-O-Me sites in human rRNA using a high throughput sequencing approach. It establishes the existence of a...

  2. Identification and assignment of base pairs in four helical segments of Bacillus megaterium ribosomal 5S RNA and its ribonuclease T1 cleavage fragments by means of 500-MHz proton homonuclear Overhauser enhancements

    Three different fragments of Bacillus megaterium ribosomal 5S RNA have been produced by enzymatic cleavage with ribonuclease T1. Fragment A consists of helices II and III, fragment B contains helix IV, and fragment C contains helix I of the universal 5S rRNA secondary structure. All (eight) imino proton resonances in the downfield region (9-15 ppm) of the 500-MHz proton FT NMR spectrum of fragment B have been identified and assigned as G80·C92·G81·C91-G82·C90-A83·U89-C84·G88 and three unpaired U's in helix IV by proton homonuclear Overhauser enhancement connectivities. The secondary structure in helix IV of the prokaryotic loop is completely demonstrated spectroscopically for the first time in any native or enzyme-cleaved 5S rRNA. In addition, G21·C58-A20·U59-G19·C60-A18·U61 in helix II, U32·A46-G31·C47-C30·G48-C29·G49 in helix III, and G4·C112-G5·C111-U6·G110 in the terminal stem (helix I) have been assigned by means of NOE experiments on intact 5S rRNA and its fragments A and C. Base pairs in helices I-IV of the universal secondary structure of B. megaterium 5S RNA are described

  3. Ribosome Mechanics Informs about Mechanism.

    Zimmermann, Michael T; Jia, Kejue; Jernigan, Robert L

    2016-02-27

    The essential aspects of the ribosome's mechanism can be extracted from coarse-grained simulations, including the ratchet motion, the movement together of critical bases at the decoding center, and movements of the peptide tunnel lining that assist in the expulsion of the synthesized peptide. Because of its large size, coarse graining helps to simplify and to aid in the understanding of its mechanism. Results presented here utilize coarse-grained elastic network modeling to extract the dynamics, and both RNAs and proteins are coarse grained. We review our previous results, showing the well-known ratchet motions and the motions in the peptide tunnel and in the mRNA tunnel. The motions of the lining of the peptide tunnel appear to assist in the expulsion of the growing peptide chain, and clamps at the ends of the mRNA tunnel with three proteins ensure that the mRNA is held tightly during decoding and essential for the helicase activity at the entrance. The entry clamp may also assist in base recognition to ensure proper selection of the incoming tRNA. The overall precision of the ribosome machine-like motions is remarkable. PMID:26687034

  4. Photoaffinity labelling of t-RNA binding sites

    For the photoaffinity labelling of E.coli ribosomes in the region of peptidyl transferase, an analogue to the substrate peptidyl-tRNA-ethyl-2-diazomalalonyl-Phe-tRNAsup(Phe) was synthesized. UV irradiation of the reversible complex with 70S ribosomes and poly(U) led to the formation of a covalent bond between N-acyl-Phe-tRNA and 23S-rRNA. The irreversibly bound N-acyl-phenylalanyl group may be transferred to puromycin in a reaction catalyzed by peptidyl transferase, in the presence of the Phe-tRNA, it forms products of a peptide synthesis covalently bound to 23S-RNA. The 23S-rRNA sequence thus labelled, which has not yet been identified, should therefore be in the active centre of the peptidyl transferase or in its near neighbourhood. An analysis of the reaction product showed that the N-acyl-Phe-tRNA is bound specifically to one or more sites of a 3'-terminal 18S fragment of the 23S-RNA. An attempt to prove the existence of further tRNA interaction with ribosonal substrate binding sites led to the discovery of a poly(U2,G)-stimulated, UV-inducible irreversible binding of valin-specific tRNA (E.coli) to 16S-rRNA in one or several tRNA decoding sites. A preliminary analysis of the T1 fragments of tRNAsup(Val) after binding to 16S-rRNA indicates that the DHU loop of tRNA takes part in this photoreaction. (orig.)

  5. The circadian clock coordinates ribosome biogenesis.

    Céline Jouffe

    Full Text Available Biological rhythms play a fundamental role in the physiology and behavior of most living organisms. Rhythmic circadian expression of clock-controlled genes is orchestrated by a molecular clock that relies on interconnected negative feedback loops of transcription regulators. Here we show that the circadian clock exerts its function also through the regulation of mRNA translation. Namely, the circadian clock influences the temporal translation of a subset of mRNAs involved in ribosome biogenesis by controlling the transcription of translation initiation factors as well as the clock-dependent rhythmic activation of signaling pathways involved in their regulation. Moreover, the circadian oscillator directly regulates the transcription of ribosomal protein mRNAs and ribosomal RNAs. Thus the circadian clock exerts a major role in coordinating transcription and translation steps underlying ribosome biogenesis.

  6. Characterization of Biomphalaria orbignyi, Biomphalaria peregrina and Biomphalaria oligoza by polymerase chain reaction and restriction enzyme digestion of the internal transcribed spacer region of the RNA ribosomal gene

    Spatz Linus

    2000-01-01

    Full Text Available The correct identification of Biomphalaria oligoza, B. orbignyi and B. peregrina species is difficult due to the morphological similarities among them. B. peregrina is widely distributed in South America and is considered a potential intermediate host of Schistosoma mansoni. We have reported the use of the polymerase chain reaction and restriction fragment length polymorphism analysis of the internal transcribed spacer region of the ribosomal DNA for the molecular identification of these snails. The snails were obtained from different localities of Argentina, Brazil and Uruguay. The restriction patterns obtained with MvaI enzyme presented the best profile to identify the three species. The profiles obtained with all enzymes were used to estimate genetic similarities among B. oligoza, B. peregrina and B. orbignyi. This is also the first report of B. orbignyi in Uruguay.

  7. Ribosome-dependent activation of stringent control.

    Brown, Alan; Fernández, Israel S; Gordiyenko, Yuliya; Ramakrishnan, V

    2016-06-01

    In order to survive, bacteria continually sense, and respond to, environmental fluctuations. Stringent control represents a key bacterial stress response to nutrient starvation that leads to rapid and comprehensive reprogramming of metabolic and transcriptional patterns. In general, transcription of genes for growth and proliferation is downregulated, while those important for survival and virulence are upregulated. Amino acid starvation is sensed by depletion of the aminoacylated tRNA pools, and this results in accumulation of ribosomes stalled with non-aminoacylated (uncharged) tRNA in the ribosomal A site. RelA is recruited to stalled ribosomes and activated to synthesize a hyperphosphorylated guanosine analogue, (p)ppGpp, which acts as a pleiotropic secondary messenger. However, structural information about how RelA recognizes stalled ribosomes and discriminates against aminoacylated tRNAs is missing. Here we present the cryo-electron microscopy structure of RelA bound to the bacterial ribosome stalled with uncharged tRNA. The structure reveals that RelA utilizes a distinct binding site compared to the translational factors, with a multi-domain architecture that wraps around a highly distorted A-site tRNA. The TGS (ThrRS, GTPase and SpoT) domain of RelA binds the CCA tail to orient the free 3' hydroxyl group of the terminal adenosine towards a β-strand, such that an aminoacylated tRNA at this position would be sterically precluded. The structure supports a model in which association of RelA with the ribosome suppresses auto-inhibition to activate synthesis of (p)ppGpp and initiate the stringent response. Since stringent control is responsible for the survival of pathogenic bacteria under stress conditions, and contributes to chronic infections and antibiotic tolerance, RelA represents a good target for the development of novel antibacterial therapeutics. PMID:27279228

  8. Optimization of RNA Extraction from Rat Pancreatic Tissue

    Sanaz Dastgheib

    2014-05-01

    Full Text Available Background: Optimized RNA extraction from tissues and cell lines consists of four main stages regardless of the method of extraction: 1 homogenizing, 2 effective denaturation of proteins from RNA, 3 inactivation of ribonuclease, and 4 removal of any DNA, protein, and carbohydrate contamination. Isolation of undamaged intact RNA is challenging when the related tissue contains high levels of RNase. Various technical difficulties occur during extraction of RNA from pancreatic tissue due to spontaneous autolysis. Since standard routine protocols yield unacceptable results in pancrease, we have designed a simple method for RNA extraction by comparing different protocols. Methods: We obtained 20-30 mg pancreatic tissues in less than 2 min from 30 rats. Several methods were performed to extract RNA from pancreatic tissue and evaluate its integrity. All methods were performed three times to obtain reproducible results. Results: Immersing pancreatic tissue in RNA-later for 24 h at -80ºC yielded high quality RNA by using the TriPure reagent which was comparable to the commercial RNeasy Micro Kit. The quality of RNA was evaluated by spectrophotometer, electrophoresis and RT-PCR. We separated intact 28S and 18S ribosomal RNA (rRNA when our procedure was compared with the RNeasy Micro Kit. Finally, full length of the actin gene was amplified by RT-PCR. Conclusion: We designed a simple, fast, cost-effective method for complete RNA extraction from the least amount of quantitatively intact pancreatic tissue

  9. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Background Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role...

  10. Evaluation of the semen swim-up method for bovine sperm RNA extraction.

    Han, C M; Chen, R; Li, T; Chen, X L; Zheng, Y F; Ma, M T; Gao, Q H

    2016-01-01

    Isolation of high-quality RNA is important for assessing sperm gene expression, and semen purification methods may affect the integrity of the isolated RNA. This study evaluated the effectiveness of the sperm swim-up method for seminal RNA isolation. Frozen semen samples in straws from three bulls of proven fertility were purified by the swim-up method. RNA extraction was carried out using the E.Z.N.A.(TM) Total RNA kit II, with non-swim-up sperm as a control. Total sperm RNA was analyzed by UV spectrophotometry, reverse transcription polymerase chain reaction (RT-PCR), and agarose gel electrophoresis, and expression of the sex-determining region on the Y chromosome (SRY), leptin (LEP), and ribosomal protein subunit 23 (RPS23) genes, were determined. 18S RNA was used as a positive control. Fewer somatic cells were found in sperm swim-up samples than in the non-swim-up counterparts (0 x 10(3) vs 17.33 ± 2.52 x 10(3) sperm, P agarose gel electrophoresis. Finally, no bands corresponding to 18S RNA were found in RNA samples from the sperm swim-up group. Our findings suggest that small amounts of sperm RNA can be efficiently extracted from frozen straw semen samples using the swim-up technique. PMID:27173315

  11. Identification of EhTIF-IA: The putative E. histolytica orthologue of the human ribosomal RNA transcription initiation factor-IA

    Ankita Srivastava; Alok Bhattacharya; Sudha Bhattacharya; Gagan Deep Jhingan

    2016-03-01

    Initiation of rDNA transcription requires the assembly of a specific multi-protein complex at the rDNA promoter containing the RNA Pol I with auxiliary factors. One of these factors is known as Rrn3P in yeast and Transcription Initiation Factor IA (TIF-IA) in mammals. Rrn3p/TIF-IA serves as a bridge between RNA Pol I and the pre-initiation complex at the promoter. It is phosphorylated at multiple sites and is involved in regulation of rDNA transcription in a growth-dependent manner. In the early branching parasitic protist Entamoeba histolytica, the rRNA genes are present exclusively on circular extra chromosomal plasmids. The protein factors involved in regulation of rDNA transcription in E. histolytica are not known. We have identified the E. histolytica equivalent of TIF-1A (EhTIF-IA) by homology search within the database and was further cloned and expressed. Immuno-localization studies showed that EhTIF-IA co-localized partially with fibrillarin in the peripherally localized nucleolus. EhTIF-IA was shown to interact with the RNA Pol I-specific subunit RPA12 both in vivo and in vitro. Mass spectroscopy data identified RNA Pol I-specific subunits and other nucleolar proteins to be the interacting partners of EhTIF-IA. Our study demonstrates for the first time a conserved putative RNA Pol I transcription factor TIF-IA in E. histolytica.

  12. Identification of EhTIF-IA: The putative E. histolytica orthologue of the human ribosomal RNA transcription initiation factor-IA.

    Srivastava, Ankita; Bhattacharya, Alok; Bhattacharya, Sudha; Jhingan, Gagan Deep

    2016-03-01

    Initiation of rDNA transcription requires the assembly of a specific multi-protein complex at the rDNA promoter containing the RNA Pol I with auxiliary factors. One of these factors is known as Rrn3P in yeast and Transcription Initiation Factor IA (TIF-IA) in mammals. Rrn3p/TIF-IA serves as a bridge between RNA Pol I and the pre-initiation complex at the promoter. It is phosphorylated at multiple sites and is involved in regulation of rDNA transcription in a growth-dependent manner. In the early branching parasitic protist Entamoeba histolytica, the rRNA genes are present exclusively on circular extra chromosomal plasmids. The protein factors involved in regulation of rDNA transcription in E. histolytica are not known. We have identified the E. histolytica equivalent of TIF-1A (EhTIF-IA) by homology search within the database and was further cloned and expressed. Immuno-localization studies showed that EhTIF-IA co-localized partially with fibrillarin in the peripherally localized nucleolus. EhTIF-IA was shown to interact with the RNA Pol I-specific subunit RPA12 both in vivo and in vitro. Mass spectroscopy data identified RNA Pol I-specific subunits and other nucleolar proteins to be the interacting partners of EhTIF-IA. Our study demonstrates for the first time a conserved putative RNA Pol I transcription factor TIF-IA in E. histolytica. PMID:26949087

  13. Phylogenetic relationships among six species of Epistylis inferred from 18S-ITS1 sequences

    缪炜; 余育和; 沈韫芬; 张锡元

    2002-01-01

    Phylogenetic relationships among six species of Epistylis (i. e. E. plicatilis, E. urceolata, E. chrysemydis, E. hentscheli, E. wenrichi, and E. galea) were investigated using sequences of the first internal transcribed spacer region (ITS-1) of ribosomal DNA (rDNA). Amplified rDNA fragment sequences consisted of 215 or 217 bases of the flanking 18S and 5.8S regions, and the entire ITS-1 region (from 145 to 155 bases). There were more than 33 variable bases between E. galea and the other five species in both the 18S region and the ITS-1 region. The affiliation of them was assessed using Neighbor-joining (NJ), maximum parsimony (MP) and maximum likelihood (ML) analyses. In all the NJ, MP and ML analyses E. galea, whose macronucleic position and shape are distinctly different from those of the other five species, was probably diverged from the ancestor of Epistylis earlier than the other five species. The topology in which E. plicatilis and E. hentscheli formed a strongly supported sister clade to E. urceolata, E. chrysemydis, and E. wenrichi was consistent with variations in the thickness of the peristomial lip. We concluded that the macronucleus and peristomial lip might be the important phylogenetic characteristics within the genus Epistylis.

  14. 18S-rDNA SEQUENCING, ENZYME PATTERNS AND MORPHOLOGICAL CHARACTERIZATION OF TRICHOPHYTON ISOLATES

    Nascimento Adriana Mendes do

    2001-01-01

    Full Text Available Dermatophytes, capable to use keratin of the host for nutrition, belong to one of the major groups of pathogenic fungi. Since dermatophytes are a closely related group they share various common features, and the morphology of isolates of a given species can be atypical, making species identification and differentiation even more difficult. Many methods have been explored in attempts to distinguish dermatophytes, but the combined use of different approaches for the investigation of the intraspecific and interspecific variability of Trichophyton continues to be scarce. Some studies have shown that amplified fragments of the small ribosomal DNA subunit 18S contains variable regions which can be used to discriminate between medically relevant yeast species, indicating that these regions could also be used for differentiation between dermatophytes. In our study, sequence analysis of the 18S-rDNA gene was combined with morphological and biochemical criteria in order to detect genetic differences between seven Trichophyton isolates and estimate their phylogenetic relationships. The results show that the isolates investigated belong to the Trichophyton group, which potentially contains the Trichophyton rubrum cluster.

  15. Molecular organization of the 25S-18S rDNA IGS of Fagus sylvatica and Quercus suber: a comparative analysis.

    Inácio, Vera; Rocheta, Margarida; Morais-Cecílio, Leonor

    2014-01-01

    The 35S ribosomal DNA (rDNA) units, repeated in tandem at one or more chromosomal loci, are separated by an intergenic spacer (IGS) containing functional elements involved in the regulation of transcription of downstream rRNA genes. In the present work, we have compared the IGS molecular organizations in two divergent species of Fagaceae, Fagus sylvatica and Quercus suber, aiming to comprehend the evolution of the IGS sequences within the family. Self- and cross-hybridization FISH was done on representative species of the Fagaceae. The IGS length variability and the methylation level of 18 and 25S rRNA genes were assessed in representatives of three genera of this family: Fagus, Quercus and Castanea. The intergenic spacers in Beech and Cork Oak showed similar overall organizations comprising putative functional elements needed for rRNA gene activity and containing a non-transcribed spacer (NTS), a promoter region, and a 5'-external transcribed spacer. In the NTS: the sub-repeats structure in Beech is more organized than in Cork Oak, sharing some short motifs which results in the lowest sequence similarity of the entire IGS; the AT-rich region differed in both spacers by a GC-rich block inserted in Cork Oak. The 5'-ETS is the region with the higher similarity, having nonetheless different lengths. FISH with the NTS-5'-ETS revealed fainter signals in cross-hybridization in agreement with the divergence between genera. The diversity of IGS lengths revealed variants from ∼ 2 kb in Fagus, and Quercus up to 5.3 kb in Castanea, and a lack of correlation between the number of variants and the number of rDNA loci in several species. Methylation of 25S Bam HI site was confirmed in all species and detected for the first time in the 18S of Q. suber and Q. faginea. These results provide important clues for the evolutionary trends of the rDNA 25S-18S IGS in the Fagaceae family. PMID:24893289

  16. Amplification of 16S ribosomal RNA genes of autotrophic ammonia-oxidizing bacteria demonstrates the ubiquity of nitrosospiras in the environment.

    Hiorns, W D; Hastings, R C; Head, I M; McCarthy, A J; Saunders, J R; Pickup, R W; Hall, G H

    1995-11-01

    Oligonucleotide sequences selected from the 16S rRNA genes of various species of ammonia-oxidizing bacteria were evaluated as specific PCR amplification primers and probes. The specificities of primer pairs for eubacterial, Nitrosospira and Nitrosomonas rRNA genes were established with sequence databases, and the primer pairs were used to amplify DNA from laboratory cultures and environmental samples. Eubacterial rRNA genes amplified from samples of soil and activated sludge hybridized with an oligonucleotide probe specific for Nitrosospira spp., but not with a Nitrosomonas-specific probe. Lakewater and sediment samples were analysed using a nested PCR technique in which eubacterial rRNA genes were subjected to a secondary amplification with Nitrosomonas or Nitrosospira specific primers. Again, the presence of Nitrosospira DNA, but not Nitrosomonas DNA, was detected and this was confirmed by hybridization of the amplified DNA with an internal oligonucleotide probe. Enrichments of lakewater and sediment samples, incubated for two weeks in the presence of ammonium, produced nitrite and were found to contain DNA from both Nitrosospira and Nitrosomonas as determined by nested PCR amplification and probing of 16S rRNA genes. This demonstrates that Nitrosospira spp. are widespread in the environment. The implications of the detection of Nitrosomonas DNA only after enrichment culture are discussed. PMID:8535507

  17. Amicoumacin A induces cancer cell death by targeting the eukaryotic ribosome

    Prokhorova, Irina V.; Akulich, Kseniya A.; Desislava S. Makeeva; Osterman, Ilya A.; Skvortsov, Dmitry A.; Sergiev, Petr V.; Dontsova, Olga A.; Gulnara Yusupova; Yusupov, Marat M; Dmitriev, Sergey E

    2016-01-01

    Amicoumacin A is an antibiotic that was recently shown to target bacterial ribosomes. It affects translocation and provides an additional contact interface between the ribosomal RNA and mRNA. The binding site of amicoumacin A is formed by universally conserved nucleotides of rRNA. In this work, we showed that amicoumacin A inhibits translation in yeast and mammalian systems by affecting translation elongation. We determined the structure of the amicoumacin A complex with yeast ribosomes at a ...

  18. Implications of macromolecular crowding and reducing conditions for in vitro ribosome construction

    Fritz, Brian R; Jamil, Osman K.; Jewett, Michael C

    2015-01-01

    In vitro construction of Escherichia coli ribosomes could elucidate a deeper understanding of these complex molecular machines and make possible the production of synthetic variants with new functions. Toward this goal, we recently developed an integrated synthesis, assembly and translation (iSAT) system that allows for co-activation of ribosomal RNA (rRNA) transcription and ribosome assembly, mRNA transcription and protein translation without intact cells. Here, we discovered that macromolec...

  19. Ribosomal crystallography: peptide bond formation and its inhibition.

    Bashan, Anat; Zarivach, Raz; Schluenzen, Frank; Agmon, Ilana; Harms, Joerg; Auerbach, Tamar; Baram, David; Berisio, Rita; Bartels, Heike; Hansen, Harly A S; Fucini, Paola; Wilson, Daniel; Peretz, Moshe; Kessler, Maggie; Yonath, Ada

    2003-09-01

    Ribosomes, the universal cellular organelles catalyzing the translation of genetic code into proteins, are protein/RNA assemblies, of a molecular weight 2.5 mega Daltons or higher. They are built of two subunits that associate for performing protein biosynthesis. The large subunit creates the peptide bond and provides the path for emerging proteins. The small has key roles in initiating the process and controlling its fidelity. Crystallographic studies on complexes of the small and the large eubacterial ribosomal subunits with substrate analogs, antibiotics, and inhibitors confirmed that the ribosomal RNA governs most of its activities, and indicated that the main catalytic contribution of the ribosome is the precise positioning and alignment of its substrates, the tRNA molecules. A symmetry-related region of a significant size, containing about two hundred nucleotides, was revealed in all known structures of the large ribosomal subunit, despite the asymmetric nature of the ribosome. The symmetry rotation axis, identified in the middle of the peptide-bond formation site, coincides with the bond connecting the tRNA double-helical features with its single-stranded 3' end, which is the moiety carrying the amino acids. This thus implies sovereign movements of tRNA features and suggests that tRNA translocation involves a rotatory motion within the ribosomal active site. This motion is guided and anchored by ribosomal nucleotides belonging to the active site walls, and results in geometry suitable for peptide-bond formation with no significant rearrangements. The sole geometrical requirement for this proposed mechanism is that the initial P-site tRNA adopts the flipped orientation. The rotatory motion is the major component of unified machinery for peptide-bond formation, translocation, and nascent protein progression, since its spiral nature ensures the entrance of the nascent peptide into the ribosomal exit tunnel. This tunnel, assumed to be a passive path for the

  20. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  1. Regulation of ribosome biogenesis in maize embryonic axes during germination.

    Villa-Hernández, J M; Dinkova, T D; Aguilar-Caballero, R; Rivera-Cabrera, F; Sánchez de Jiménez, E; Pérez-Flores, L J

    2013-10-01

    Ribosome biogenesis is a pre-requisite for cell growth and proliferation; it is however, a highly regulated process that consumes a great quantity of energy. It requires the coordinated production of rRNA, ribosomal proteins and non-ribosomal factors which participate in the processing and mobilization of the new ribosomes. Ribosome biogenesis has been studied in yeast and animals; however, there is little information about this process in plants. The objective of the present work was to study ribosome biogenesis in maize seeds during germination, a stage characterized for its fast growth, and the effect of insulin in this process. Insulin has been reported to accelerate germination and to induce seedling growth. It was observed that among the first events reactivated just after 3 h of imbibition are the rDNA transcription and the pre-rRNA processing and that insulin stimulates both of them (40-230%). The transcript of nucleolin, a protein which regulates rDNA transcription and pre-rRNA processing, is among the messages stored in quiescent dry seeds and it is mobilized into the polysomal fraction during the first hours of imbibition (6 h). In contrast, de novo ribosomal protein synthesis was low during the first hours of imbibition (3 and 6 h) increasing by 60 times in later stages (24 h). Insulin increased this synthesis (75%) at 24 h of imbibition; however, not all ribosomal proteins were similarly regulated. In this regard, an increase in RPS6 and RPL7 protein levels was observed, whereas RPL3 protein levels did not change even though its transcription was induced. Results show that ribosome biogenesis in the first stages of imbibition is carried out with newly synthesized rRNA and ribosomal proteins translated from stored mRNA. PMID:23806421

  2. 利用线粒体16S rRNA 基因全序列分析直翅目主要类群的系统发生关系%Phylogenetic relationships among Orthoptera insect groups based on complete sequences of 16S ribosomal RNA

    崔爱明; 黄原

    2012-01-01

    In order to reconstruct a robust phylogenetic relationship among major groups of Orthoptera and to explore the phylogenetic utility and performance of 16S Ribosomal RNA gene, complete sequences of 16S Ribosomal RNA were sequenced from 18 species in 9 families and 4 superfamilies of Orthoptera, and analyzed with other 40 species that have been completely sequenced. The result showed that the average length of 16S Ribosomal RNA was 1 310 bp. The positions of Tridactuloidea and Gryllotalpidae in Orthoptera were uncertain based on the 16S rRNA data, and the phylogenetic relationships of other major groups in Orthoptera were rather robust. Except for Oedipodidae and Gomphoceridae, Acrididae, Catantopidae, and Arcypteridae in Xia's taxonomic system were not monophyletic groups, and the genetic distances among the five groups were small. This indicates that the five families should be combined into one family. The genetic distances among Pamphagidae, Chrotogonidae, and Pyigomorphidae were also small. The loops of 16S rRNA gene could provide more information than stems when they were used for phylogenetic analysis. Complete sequence of 16S rRNA gene can be used to reconstruct robust phylogenetic relationship at the taxonomic category of species, genera, and suborder in Orthop-tera, but lack of resolution at family and superfamily levels.%为了构建稳健的直翅目主要类群间的系统发生关系并探讨16S rRNA 基因序列在构建直翅目昆虫不同分类阶元系统发生关系时的可行性、功效以及性能,文章测定了直翅目4 总科9 科18 种昆虫的16S rRNA 基因全序列,联合已知该基因全序列的其他40 种昆虫,构建了直翅目主要类群之间的系统发生关系,并分析了16S rRNA 基因全序列的系统发生性能和功效.结果表明,直翅目昆虫的16S rRNA 基因全长平均为1 310 bp; 除生活方式特化的蚤蝼总科和蝼蛄总科的地位无法确定外,直翅目其他主要类群

  3. Ribosomal RNA and nucleolar proteins from the oocyte are to some degree used for embryonic nucleolar formation in cattle and pig

    Maddox-Hyttel, Poul; Svarcova, Olga; Laurincik, Josef

    2007-01-01

    I and upstream binding factor) and early (fibrillarin) or late rRNA processing (nucleolin and nucleophosmin) localize to it. At the end of the oocyte growth phase, the nucleolus is inactivated again and transforms into a solid remnant. The nucleolar remnant is dissolved when meiosis is resumed. Upon...

  4. Phylogenetic Relationships of the Marine Haplosclerida (Phylum Porifera) Employing Ribosomal (28S rRNA) and Mitochondrial (cox1, nad1) Gene Sequence Data

    Redmond, Niamh E.; Jean Raleigh; Van Soest, Rob W.M.; Michelle Kelly; Travers, Simon A A; Brian Bradshaw; Salla Vartia; Kelly M Stephens; McCormack, Grace P.

    2011-01-01

    The systematics of the poriferan Order Haplosclerida (Class Demospongiae) has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, ...

  5. Mitochondrial-encoded membrane protein transcripts are pyrimidine-rich while soluble protein transcripts and ribosomal RNA are purine-rich

    Samuels David C

    2005-09-01

    Full Text Available Abstract Background Eukaryotic organisms contain mitochondria, organelles capable of producing large amounts of ATP by oxidative phosphorylation. Each cell contains many mitochondria with many copies of mitochondrial DNA in each organelle. The mitochondrial DNA encodes a small but functionally critical portion of the oxidative phosphorylation machinery, a few other species-specific proteins, and the rRNA and tRNA used for the translation of these transcripts. Because the microenvironment of the mitochondrion is unique, mitochondrial genes may be subject to different selectional pressures than those affecting nuclear genes. Results From an analysis of the mitochondrial genomes of a wide range of eukaryotic species we show that there are three simple rules for the pyrimidine and purine abundances in mitochondrial DNA transcripts. Mitochondrial membrane protein transcripts are pyrimidine rich, rRNA transcripts are purine-rich and the soluble protein transcripts are purine-rich. The transitions between pyrimidine and purine-rich regions of the genomes are rapid and are easily visible on a pyrimidine-purine walk graph. These rules are followed, with few exceptions, independent of which strand encodes the gene. Despite the robustness of these rules across a diverse set of species, the magnitude of the differences between the pyrimidine and purine content is fairly small. Typically, the mitochondrial membrane protein transcripts have a pyrimidine richness of 56%, the rRNA transcripts are 55% purine, and the soluble protein transcripts are only 53% purine. Conclusion The pyrimidine richness of mitochondrial-encoded membrane protein transcripts is partly driven by U nucleotides in the second codon position in all species, which yields hydrophobic amino acids. The purine-richness of soluble protein transcripts is mainly driven by A nucleotides in the first codon position. The purine-richness of rRNA is also due to an abundance of A nucleotides. Possible

  6. Ligation-free ribosome profiling of cell type-specific translation in the brain

    Hornstein, Nicholas; Torres, Daniela; Das Sharma, Sohani; Tang, Guomei; Canoll, Peter; Sims, Peter A

    2016-01-01

    Ribosome profiling has emerged as a powerful tool for genome-wide measurements of translation, but library construction requires multiple ligation steps and remains cumbersome relative to more conventional deep-sequencing experiments. We report a new, ligation-free approach to ribosome profiling that does not require ligation. Library construction for ligation-free ribosome profiling can be completed in one day with as little as 1 ng of purified RNA footprints. We apply ligation-free ribosome...

  7. Characterization of Dermanyssus gallinae (Acarina: Dermanissydae) by sequence analysis of the ribosomal internal transcribed spacer regions.

    Potenza, L; Cafiero, M A; Camarda, A; La Salandra, G; Cucchiarini, L; Dachà, M

    2009-10-01

    In the present work mites previously identified as Dermanyssus gallinae De Geer (Acari, Mesostigmata) using morphological keys were investigated by molecular tools. The complete internal transcribed spacer 1 (ITS1), 5.8S ribosomal DNA, and ITS2 region of the ribosomal DNA from mites were amplified and sequenced to examine the level of sequence variations and to explore the feasibility of using this region in the identification of this mite. Conserved primers located at the 3'end of 18S and at the 5'start of 28S rRNA genes were used first, and amplified fragments were sequenced. Sequence analyses showed no variation in 5.8S and ITS2 region while slight intraspecific variations involving substitutions as well as deletions concentrated in the ITS1 region. Based on the sequence analyses a nested PCR of the ITS2 region followed by RFLP analyses has been set up in the attempt to provide a rapid molecular diagnostic tool of D. gallinae. PMID:19214768

  8. Mechanism of fusidic acid inhibition of RRF- and EF-G-dependent splitting of the bacterial post-termination ribosome

    Borg, Anneli; Pavlov, Michael; Ehrenberg, Måns

    2016-01-01

    The antibiotic drug fusidic acid (FA) is commonly used in the clinic against gram-positive bacterial infections. FA targets ribosome-bound elongation factor G (EF-G), a translational GTPase that accelerates both messenger RNA (mRNA) translocation and ribosome recycling. How FA inhibits translocation was recently clarified, but FA inhibition of ribosome recycling by EF-G and ribosome recycling factor (RRF) has remained obscure. Here we use fast kinetics techniques to estimate mean times of rib...

  9. Immunomodulation by microbial ribosomes

    W. Domzig

    1987-01-01

    Full Text Available Over the past twenty years, many authors have reported evidence of the immunoprotective capacity of ribosomes isolated from bacteria, fungi and parasites. Since 1971 we have explored the protective capacity of ribosomes isolated from a large variety of microorganisms responsible for human and animal diseases. More recently, using monoclonal antibodies raised against ribosomes and then selected for their ability to confer passive immunity to mice, we have studied the mechanism of the protection induced by ribosomes. These studies, in parallel with the development of a technology for the large scale production of ribosomes, have allowed us to achieve a new regard for ribosomal vaccines for use in human. The general concept of ribosomal vaccines in presented and examples of two such vaccines are described with data on the specific protection that they induce in mice against experimental infections with Klebsiella peneumoniae, Streptococcus pneumoniae, S. pyogenes and Haemophilus influenzae for the first one, and against Candida albicans type A and type B for the second one. Because of their high immunogenicity and their innocuity these vaccines represent a decisive improvement over classical microbial vaccines.

  10. Phylogenetic relationships of the marine Haplosclerida (Phylum Porifera) employing ribosomal (28S rRNA) and mitochondrial (cox1, nad1) gene sequence data.

    Redmond, Niamh E; Raleigh, Jean; van Soest, Rob W M; Kelly, Michelle; Travers, Simon A A; Bradshaw, Brian; Vartia, Salla; Stephens, Kelly M; McCormack, Grace P

    2011-01-01

    The systematics of the poriferan Order Haplosclerida (Class Demospongiae) has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, are highly congruent and suggest the presence of four clades. Clade A is comprised primarily of species of Haliclona and Callyspongia, and clade B is comprised of H. simulans and H. vansoesti (Family Chalinidae), Amphimedon queenslandica (Family Niphatidae) and Tabulocalyx (Family Phloeodictyidae), Clade C is comprised primarily of members of the Families Petrosiidae and Niphatidae, while Clade D is comprised of Aka species. The polyphletic nature of the suborders, families and genera described in other studies is also found here. PMID:21931685

  11. Molecular characterisation of three regions of the nuclear ribosomal DNA unit and the mitochondrial cox1 gene of Sarcocystis fusiformis from water buffaloes (Bubalus bubalis) in Egypt.

    Gjerde, Bjørn; Hilali, Mosaad; Mawgood, Sahar Abdel

    2015-09-01

    A total of 33 macroscopically visible (3-11 × 1-5 mm) sarcocysts of Sarcocystis fusiformis were excised from the oesophagus of 12 freshly slaughtered water buffalos in Giza, Egypt. Genomic DNA was extracted from the sarcocysts, and all isolates were characterised at the mitochondrial cytochrome c oxidase subunit I (cox1) gene through PCR amplification and direct sequencing, whereas a few selected isolates were characterised at the 18S and 28S ribosomal (r) RNA genes and the internal transcribed spacer 1 (ITS1) region of the nuclear rDNA unit following cloning. Among the 33 cox1 sequences (1,038-bp long), there was a total of 13 haplotypes, differing from each other by one to seven substitutions and sharing an identity of 99.3-99.9 %. In comparison, the sequence identity was 98.8-99.0 % among eight complete 18S rRNA gene sequences (1,873-1,879-bp long), 98.1-100 % among 28 complete ITS1 sequences (853-864-bp long) and 97.4-99.6 % among five partial 28S rRNA gene sequences (1,607-1,622 bp). At the three nuclear loci, the intraspecific (and intra-isolate) sequence variation was due to both substitutions and indels, which necessitated cloning of the PCR products before sequencing. Some additional clones of the 18S and 28S rRNA genes were highly divergent from the more typical clones, but the true nature of these aberrant clones could not be determined. Sequence comparisons and phylogenetic analyses based on either 18S rRNA gene or cox1 nucleotide sequences, placed S. fusiformis closest to Sarcocystis cafferi from the African buffalo, but only the analyses based on cox1 data separated the two taxa clearly from each other and showed that they were separate species (monophyletic clusters and 93 % sequence identity at cox1 versus interleaved sequences and 98.7-99.1 % sequence identity at the 18S rRNA gene). Two cats experimentally infected with sarcocysts of S. fusiformis started shedding small numbers of sporocysts 8-10 days post-infection (dpi) and were euthanized 15

  12. Ribosome Inactivating Proteins from Plants Inhibiting Viruses

    Inderdeep Kaur; R C Gupta; Munish Puri

    2011-01-01

    Many plants contain ribosome inactivating proteins (RIPs) with N-glycosidase activity,which depurinate large ribosomal RNA and arrest protein synthesis.RIPs so far tested inhibit replication of mRNA as well as DNA viruses and these proteins,isolated from plants,are found to be effective against a broad range of viruses such as human immunodeficiency virus (HIV),hepatitis B virus (HBV) and herpes simplex virus (HSV).Most of the research work related to RIPs has been focused on antiviral activity against HIV; however,the exact mechanism of antiviral activity is still not clear.The mechanism of antiviral activity was thought to follow inactivation of the host cell ribosome,leading to inhibition of viral protein translation and host cell death.Enzymatic activity of RIPs is not hmited to depurination of the large rRNA,in addition they can depurinate viral DNA as well as RNA.Recently,Phase Ⅰ/Ⅱ clinical trials have demonstrated the potential use of RIPs for treating patients with HIV disease.The aim of this review is to focus on various RIPs from plants associated with anti-HIV activity.

  13. Silencing of ribosomal protein S9 elicits a multitude of cellular responses inhibiting the growth of cancer cells subsequent to p53 activation.

    Mikael S Lindström

    Full Text Available BACKGROUND: Disruption of the nucleolus often leads to activation of the p53 tumor suppressor pathway through inhibition of MDM2 that is mediated by a limited set of ribosomal proteins including RPL11 and RPL5. The effects of ribosomal protein loss in cultured mammalian cells have not been thoroughly investigated. Here we characterize the cellular stress response caused by depletion of ribosomal protein S9 (RPS9. METHODOLOGY/PRINCIPAL FINDINGS: Depletion of RPS9 impaired production of 18S ribosomal RNA and induced p53 activity. It promoted p53-dependent morphological differentiation of U343MGa Cl2:6 glioma cells as evidenced by intensified expression of glial fibrillary acidic protein and profound changes in cell shape. U2OS osteosarcoma cells displayed a limited senescence response with increased expression of DNA damage response markers, whereas HeLa cervical carcinoma cells underwent cell death by apoptosis. Knockdown of RPL11 impaired p53-dependent phenotypes in the different RPS9 depleted cell cultures. Importantly, knockdown of RPS9 or RPL11 also markedly inhibited cell proliferation through p53-independent mechanisms. RPL11 binding to MDM2 was retained despite decreased levels of RPL11 protein following nucleolar stress. In these settings, RPL11 was critical for maintaining p53 protein stability but was not strictly required for p53 protein synthesis. CONCLUSIONS: p53 plays an important role in the initial restriction of cell proliferation that occurs in response to decreased level of RPS9. Our results do not exclude the possibility that other nucleolar stress sensing molecules act upstream or in parallel to RPL11 to activate p53. Inhibiting the expression of certain ribosomal proteins, such as RPS9, could be one efficient way to reinitiate differentiation processes or to induce senescence or apoptosis in rapidly proliferating tumor cells.

  14. Epidemiology of sporadic (non-epidemic) cases of Trichophyton tonsurans infection in Japan based on PCR-RFLP analysis of non-transcribed spacer region of ribosomal RNA gene.

    Mochizuki, Takashi; Kawasaki, Masako; Anzawa, Kazushi; Fujita, Jun; Ushigami, Tsuyoshi; Takeda, Kiminobu; Sano, Ayako; Takahashi, Yoko; Kamei, Katsuhiko

    2008-05-01

    A number of cases of Trichophyton tonsurans infection have been reported among sportsmen and women participating in wrestling, judo, and sumo wrestling in Japan, but there have also been sporadic reports of cases with no history of contact with these sports. A molecular method using restriction enzyme analysis of PCR-amplified fragments targeting the non-transcribed spacer region (NTS) of ribosomal RNA gene in fungal nuclei was applied to T. tonsurans strains isolated from sporadic cases in Japan. Five of 6 molecular types recorded in Japan, i.e., NTS types I, II, IV, V, and VI, and two new types, designated NTS VII and NTS VIII, were observed among 10 strains isolated from sporadic cases. The NTS IV strains, considered not to be related to the present epidemic, were found to be the most prevalent molecular type accounting for 4 of the 10 strains isolated. NTS I was the most prevalent type in the current epidemic in Japan, but it was cultured from only one patient who was later noted to be the daughter of a retired judo practitioner. Four subjects had histories of living abroad and were considered to have been infected outside Japan. The strains in these cases were NTS II, V, VI, and VII. The results of this study suggested that the NTS IV strains were originally present in Japan at a low incidence, but that there has been a recent influx of NTS I, II, V, VI, and VII from abroad, which has been accompanied by the secondary spread of strains from wrestlers and practitioners of martial arts to the general community. PMID:18503175

  15. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes....

  16. Crystal Structures of EF-G-Ribosome Complexes Trapped in Intermediate States of Translocation

    Zhou, Jie; Lancaster, Laura; Donohue, John Paul; Noller, Harry F. [UCSC

    2013-11-12

    Translocation of messenger and transfer RNA (mRNA and tRNA) through the ribosome is a crucial step in protein synthesis, whose mechanism is not yet understood. The crystal structures of three Thermus ribosome-tRNA-mRNA–EF-G complexes trapped with β,γ-imidoguanosine 5'-triphosphate (GDPNP) or fusidic acid reveal conformational changes occurring during intermediate states of translocation, including large-scale rotation of the 30S subunit head and body. In all complexes, the tRNA acceptor ends occupy the 50S subunit E site, while their anticodon stem loops move with the head of the 30S subunit to positions between the P and E sites, forming chimeric intermediate states. Two universally conserved bases of 16S ribosomal RNA that intercalate between bases of the mRNA may act as “pawls” of a translocational ratchet. These findings provide new insights into the molecular mechanism of ribosomal translocation.

  17. GTPases and the origin of the ribosome

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  18. The Ribosome Comes Alive

    Frank, Joachim

    2010-01-01

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample (“story in a sample”), providing snapshots of an entire subprocess of translation, such as t...

  19. The Ribosome Comes Alive.

    Frank, Joachim

    2010-06-18

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample ("story in a sample"), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  20. Chaperoning ribosome assembly

    Karbstein, Katrin

    2010-01-01

    Chaperones help proteins fold in all cellular compartments, and many associate directly with ribosomes, capturing nascent chains to assist their folding and prevent aggregation. In this issue, new data from Koplin et al. (2010. J. Cell Biol. doi: 10.1083/jcb.200910074) and Albanèse et al. (2010. J. Cell Biol. doi: 10.1083/jcb.201001054) suggest that in addition to promoting protein folding, the chaperones ribosome-associated complex (RAC), nascent chain–associated complex (NAC), and Jjj1 also...

  1. Characterization of ribosomal DNA (rDNA in Drosophila arizonae

    Francisco Javier Tovar

    2000-06-01

    Full Text Available Ribosomal DNA (rDNA is a multigenic family composed of one or more clusters of repeating units (RU. Each unit consists of highly conserved sequences codifying 18S, 5.8S and 28S rRNA genes intercalated with poorly conserved regulatory sequences between species. In this work, we analyzed the rDNA of Drosophila arizonae, a member of the mulleri complex (Repleta group. Using genomic restriction patterns, cloning and mapping of some representative rDNA fragments, we were able to construct a representative restriction map. RU in this species are 13.5-14 kb long, restriction sites are completely conserved compared with other drosophilids and the rDNA has an R1 retrotransposable element in some RU. We were unable to detect R2 elements in this species.O DNA ribossômico (rDNA é uma família multigênica composta de um ou mais aglomerados de unidades de repetição (RU. Cada unidade consiste de seqüências altamente conservadas que codificam os rRNAs 18S, 5.8S e 28S, intercaladas com seqüências regulatórias pouco conservadas entre as espécies. Neste trabalho analisamos o rDNA de Drosophila arizonae, um membro do complexo mulleri (grupo Repleta. Usando padrões de restrição genômicos, clonagem e mapeamento de alguns fragmentos de rDNA representativos, estabelecemos um mapa de restrição do rDNA representativo desta espécie. Neste drosofilídeo, a RU tem um tamanho médio de 13.5-14 kb e os sítios de restrição estão completamente conservados com relação a outras drosófilas. Além disto, este rDNA possui um elemento transponível tipo R1 presente em algumas unidades. Neste trabalho não tivemos evidências da presença de elementos R2 no rDNA desta espécie.

  2. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors.

    Uli Ohmayer

    Full Text Available Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins and ribosomal RNAs (rRNAs. Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs.

  3. Differential effects of ribosomal proteins and Mg2+ ions on a conformational switch during 30S ribosome 5'-domain assembly.

    Abeysirigunawardena, Sanjaya C; Woodson, Sarah A

    2015-11-01

    Ribosomal protein S4 nucleates assembly of the 30S ribosome 5' and central domains, which is crucial for the survival of cells. Protein S4 changes the structure of its 16S rRNA binding site, passing through a non-native intermediate complex before forming native S4-rRNA contacts. Ensemble FRET was used to measure the thermodynamic stability of non-native and native S4 complexes in the presence of Mg(2+) ions and other 5'-domain proteins. Equilibrium titrations of Cy3-labeled 5'-domain RNA with Cy5-labeled protein S4 showed that Mg(2+) ions preferentially stabilize the native S4-rRNA complex. In contrast, ribosomal proteins S20 and S16 act by destabilizing the non-native S4-rRNA complex. The full cooperative switch to the native complex requires S4, S16, and S20 and is achieved to a lesser degree by S4 and S16. The resulting thermodynamic model for assembly of the 30S body illustrates how ribosomal proteins selectively bias the equilibrium between alternative rRNA conformations, increasing the cooperativity of rRNA folding beyond what can be achieved by Mg(2+) ions alone. PMID:26354770

  4. The ribosome as a missing link in prebiotic evolution II: Ribosomes encode ribosomal proteins that bind to common regions of their own mRNAs and rRNAs.

    Root-Bernstein, Robert; Root-Bernstein, Meredith

    2016-05-21

    We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their

  5. Stochastic kinetics of ribosomes: single motor properties and collective behavior

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

    2009-01-01

    Synthesis of protein molecules in a cell are carried out by ribosomes. A ribosome can be regarded as a molecular motor which utilizes the input chemical energy to move on a messenger RNA (mRNA) track that also serves as a template for the polymerization of the corresponding protein. The forward movement, however, is characterized by an alternating sequence of translocation and pause. Using a quantitative model, which captures the mechanochemical cycle of an individual ribosome, we derive an {\\it exact} analytical expression for the distribution of its dwell times at the successive positions on the mRNA track. Inverse of the average dwell time satisfies a ``Michaelis-Menten-like'' equation and is consistent with the general formula for the average velocity of a molecular motor with an unbranched mechano-chemical cycle. Extending this formula appropriately, we also derive the exact force-velocity relation for a ribosome. Often many ribosomes simultaneously move on the same mRNA track, while each synthesizes a c...

  6. Miniaturized fluorescent RNA dot blot method for rapid quantitation of gene expression

    Yadetie Fekadu

    2004-06-01

    Full Text Available Abstract Background RNA dot blot hybridization is a commonly used technique for gene expression assays. However, membrane based RNA dot/slot blot hybridization is time consuming, requires large amounts of RNA, and is less suited for parallel assays of more than one gene at a time. Here, we describe a glass-slide based miniaturized RNA dot blot (RNA array procedure for rapid and parallel gene expression analysis using fluorescently labeled probes. Results RNA arrays were prepared by simple manual spotting of RNA onto amino-silane coated microarray glass slides, and used for two-color fluorescent hybridization with specific probes labeled with Cy3 and 18S ribosomal RNA house-keeping gene probe labeled with Cy5 fluorescent dyes. After hybridization, arrays were scanned on a fluorescent microarray scanner and images analyzed using microarray image analysis software. We demonstrate that this method gives comparable results to Northern blot analysis, and enables high throughput quantification of transcripts from nanogram quantities of total RNA in hundreds of samples. Conclusion RNA array on glass slide and detection by fluorescently labeled probes can be used for rapid and parallel gene expression analysis. The method is particularly well suited for gene expression assays that involve quantitation of many transcripts in large numbers of samples.

  7. Ribosome Assembly as Antimicrobial Target.

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  8. Detecting Ricin: A Sensitive Luminescent Assay for Ricin A-chain Ribosome Depurination Kinetics+

    Sturm, Matthew B.; Schramm, Vern L.

    2009-01-01

    Ricin is a family member of the lethal ribosome-inactivating proteins (RIP) found in plants. Ricin toxin A-chain (RTA) from castor beans catalyzes the hydrolytic depurination of a single base from a GAGA tetraloop of eukaryotic ribosomal RNA to release a single adenine from the sarcin-ricin loop (SRL). Protein synthesis is inhibited by loss of elongation factor binding resulting in cell death. We report a sensitive coupled assay for the measurement of adenine released from ribosomes or small ...

  9. Turnover of messenger RNA: Polysome statistics beyond the steady state

    Valleriani, A.; Ignatova, Z.; Nagar, A.; Lipowsky, R.

    2010-03-01

    The interplay between turnover or degradation and ribosome loading of messenger RNA (mRNA) is studied theoretically using a stochastic model that is motivated by recent experimental results. Random mRNA degradation affects the statistics of polysomes, i.e., the statistics of the number of ribosomes per mRNA as extracted from cells. Since ribosome loading of newly created mRNA chains requires some time to reach steady state, a fraction of the extracted mRNA/ribosome complexes does not represent steady state conditions. As a consequence, the mean ribosome density obtained from the extracted complexes is found to be inversely proportional to the mRNA length. On the other hand, the ribosome density profile shows an exponential decrease along the mRNA for prokaryotes and becomes uniform in eukaryotic cells.

  10. Canonical Initiation Factor Requirements of the Myc Family of Internal Ribosome Entry Segments▿ †

    Spriggs, Keith A.; Cobbold, Laura C.; Jopling, Catherine L; Cooper, Rebecca E.; Wilson, Lindsay A; Stoneley, Mark; Coldwell, Mark J; Poncet, Didier; Shen, Ya-Ching; Morley, Simon; Bushell, Martin; Willis, Anne E.

    2009-01-01

    Initiation of protein synthesis in eukaryotes requires recruitment of the ribosome to the mRNA and its translocation to the start codon. There are at least two distinct mechanisms by which this process can be achieved; the ribosome can be recruited either to the cap structure at the 5' end of the message or to an internal ribosome entry segment (IRES), a complex RNA structural element located in the 5' untranslated region (5'-UTR) of the mRNA. However, it is not well understood how cellular I...

  11. Comparative Analysis of 18S and 28S rDNA Sequences of Schistosoma japonicum from Mainland China, the Philippines and Japan

    G.H. Zhao

    2011-01-01

    Full Text Available In the present study, a portion of the 18S and 28S ribosomal DNA (rDNA sequences of 35 Schistosoma japonicum isolates representing three geographical strains from mainland China, the Philippines and Japan were amplified and compared and phylogenetic relationships were also reconstructed by Unweighted Pair-Group Method with Arithmetic averages (UPGMA using combined 18S and 28S rDNA sequences as well as the corresponding sequences of other species belonging to the Schistosoma genus available in the public database. The results indicated that the partial 18S and 28S rDNA sequences of all S. japonicum isolates were 745 and 618 bp, respectively and displayed low genetic variation among S. japonicum strains and isolates. Phylogenetic analysis revealed that the combined 18S and 28S rDNA sequences were not able to distinguish S. japonicum isolates from three geographical origins but provided an effective molecular marker for the inter-species phylogenetic analysis and differential identification of different Schistosoma species.

  12. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-01-01

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S ...

  13. Initiation factor 2 stabilizes the ribosome in a semirotated conformation.

    Ling, Clarence; Ermolenko, Dmitri N

    2015-12-29

    Intersubunit rotation and movement of the L1 stalk, a mobile domain of the large ribosomal subunit, have been shown to accompany the elongation cycle of translation. The initiation phase of protein synthesis is crucial for translational control of gene expression; however, in contrast to elongation, little is known about the conformational rearrangements of the ribosome during initiation. Bacterial initiation factors (IFs) 1, 2, and 3 mediate the binding of initiator tRNA and mRNA to the small ribosomal subunit to form the initiation complex, which subsequently associates with the large subunit by a poorly understood mechanism. Here, we use single-molecule FRET to monitor intersubunit rotation and the inward/outward movement of the L1 stalk of the large ribosomal subunit during the subunit-joining step of translation initiation. We show that, on subunit association, the ribosome adopts a distinct conformation in which the ribosomal subunits are in a semirotated orientation and the L1 stalk is positioned in a half-closed state. The formation of the semirotated intermediate requires the presence of an aminoacylated initiator, fMet-tRNA(fMet), and IF2 in the GTP-bound state. GTP hydrolysis by IF2 induces opening of the L1 stalk and the transition to the nonrotated conformation of the ribosome. Our results suggest that positioning subunits in a semirotated orientation facilitates subunit association and support a model in which L1 stalk movement is coupled to intersubunit rotation and/or IF2 binding. PMID:26668356

  14. Protein-protein interactions within late pre-40S ribosomes.

    Melody G Campbell

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  15. Nucleolus: The ribosome factory

    Cmarko, Dušan; Šmigová, J.; Minichová, L.; Popov, Alexey

    2008-01-01

    Roč. 23, č. 10 (2008), s. 1291-1298. ISSN 0213-3911 R&D Projects: GA ČR(CZ) GA304/06/1691 Grant ostatní: Wellcome Trust(XE) 075834/04/Z; GA MŠk(CZ) LC535; GA ČR(CZ) GA304/06/1662 Institutional research plan: CEZ:AV0Z50110509 Keywords : nucleolus * nucleolar architecture * ribosome biogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.194, year: 2008

  16. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  17. Architecture of the E.coli 70S ribosome

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.; Meerwinck, W.; Stuhrmann, H.B.; Pedersen, J.S.; Koch, M.H.J.; Volkov, V.V.; Kozin, M.B.; Svergun, D.I.

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast-vari...

  18. Architecture of the E.coli 70S ribosome

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.;

    1997-01-01

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  19. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position. PMID:26926435

  20. Characterization of RNA in exosomes secreted by human breast cancer cell lines using next-generation sequencing

    Piroon Jenjaroenpun

    2013-11-01

    Full Text Available Exosomes are nanosized (30–100 nm membrane vesicles secreted by most cell types. Exosomes have been found to contain various RNA species including miRNA, mRNA and long non-protein coding RNAs. A number of cancer cells produce elevated levels of exosomes. Because exosomes have been isolated from most body fluids they may provide a source for non-invasive cancer diagnostics. Transcriptome profiling that uses deep-sequencing technologies (RNA-Seq offers enormous amount of data that can be used for biomarkers discovery, however, in case of exosomes this approach was applied only for the analysis of small RNAs. In this study, we utilized RNA-Seq technology to analyze RNAs present in microvesicles secreted by human breast cancer cell lines. Exosomes were isolated from the media conditioned by two human breast cancer cell lines, MDA-MB-231 and MDA-MB-436. Exosomal RNA was profiled using the Ion Torrent semiconductor chip-based technology. Exosomes were found to contain various classes of RNA with the major class represented by fragmented ribosomal RNA (rRNA, in particular 28S and 18S rRNA subunits. Analysis of exosomal RNA content revealed that it reflects RNA content of the donor cells. Although exosomes produced by the two cancer cell lines shared most of the RNA species, there was a number of non-coding transcripts unique to MDA-MB-231 and MDA-MB-436 cells. This suggests that RNA analysis might distinguish exosomes produced by low metastatic breast cancer cell line (MDA-MB-436 from that produced by highly metastatic breast cancer cell line (MDA-MB-231. The analysis of gene ontologies (GOs associated with the most abundant transcripts present in exosomes revealed significant enrichment in genes encoding proteins involved in translation and rRNA and ncRNA processing. These GO terms indicate most expressed genes for both, cellular and exosomal RNA. For the first time, using RNA-seq, we examined the transcriptomes of exosomes secreted by human breast

  1. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  2. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. PMID:27071492

  3. Control of ribosome traffic by position-dependent choice of synonymous codons

    Mitarai, Namiko; Pedersen, Steen

    2013-10-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species.

  4. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress

    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L. J.

    2016-01-01

    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucl...

  5. Traffic of interacting ribosomes: effects of single-machine mechano-chemistry on protein synthesis

    Basu, A; Basu, Aakash; Chowdhury, Debashish

    2006-01-01

    Many ribosomes simultaneously move on the same messenger RNA (mRNA), each synthesizing a protein. Earlier models of ribosome traffic represent each ribosome by a ``self-propelled particle'' and capture the dynamics by an extension of the totally asymmetric simple exclusion process. In contrast, here we develope a ``unified'' theoretical model that not only incorporates the mutual exclusions of the interacting ribosomes, but also describes explicitly the mechano-chemistry of each of these individual cyclic machines during protein synthesis. Using a combination of analytical and numerical techniques of non-equilibrium statistical mechanics, we analyze this model and illustrate its power by making experimentally testable predictions on the rate of protein synthesis and the density profile of the ribosomes on some mRNAs in E-Coli.

  6. Structure of the GTP Form of Elongation Factor 4 (EF4) Bound to the Ribosome.

    Kumar, Veerendra; Ero, Rya; Ahmed, Tofayel; Goh, Kwok Jian; Zhan, Yin; Bhushan, Shashi; Gao, Yong-Gui

    2016-06-17

    Elongation factor 4 (EF4) is a member of the family of ribosome-dependent translational GTPase factors, along with elongation factor G and BPI-inducible protein A. Although EF4 is highly conserved in bacterial, mitochondrial, and chloroplast genomes, its exact biological function remains controversial. Here we present the cryo-EM reconstitution of the GTP form of EF4 bound to the ribosome with P and E site tRNAs at 3.8-Å resolution. Interestingly, our structure reveals an unrotated ribosome rather than a clockwise-rotated ribosome, as observed in the presence of EF4-GDP and P site tRNA. In addition, we also observed a counterclockwise-rotated form of the above complex at 5.7-Å resolution. Taken together, our results shed light on the interactions formed between EF4, the ribosome, and the P site tRNA and illuminate the GTPase activation mechanism at previously unresolved detail. PMID:27137929

  7. Utilización del patrón de restricción del DNA codificante para el RNA Ribosomal de la subunidad pequeña para la caracterización de Apicomplexa

    López Adelaida

    1996-12-01

    Full Text Available Los Apicomplexos constituyen un phylum de protozoarios que se caracterizan por ser parásitos obligados de una gran variedad de huéspedes vertebrados e invertebrados. Hoy en día hay fuertes polémicas en tomo a su clasificación taxonómica, sus relaciones filogenéticas, y los patrones de coevolución con sus hospederos. El gen que codifica para el ARN ribosomal de la subunidad pequeña (ARN-SURp se utiliza como marcador molecular para resolver estas inquietudes. A partir del ADN de las especies de la familia Sarcocystidae (Sarcocystis cruzi, Sarcocystis sp. de Didelphis marsupialis y Sarcocystis sp. de Columbina talpacoti y Toxoplasma gondii, y de especies de la familia Plasmodiidae (Plasmodium de Anolis chloris, P. simium, y P. falciparumi, se amplificó por PCR el gen que codifica para el ARN de la subunidad ribosomal pequeña (ARN- SURp usando los iniciadores P5-P3, 0009-2134 Y566R-567R. Se compararon
    los patrones de restricción Hind III, Eco RI, Sau 3AI y Alw 261 del DNA ribosomal. La prueba de riboprini mostró que además de discriminar entre familias permite caracterizar diferencias a nivel de género y especie.Apicomplexa is a Protozoa phylum in which all members are obliged parasites of a wide range of vertebrate and invertebrate hosts. There is an ongoing controversy on
    systematics, phylogenetic relationships and parasite - host coevolution patterns. The SSU ribosomal gen has been used as a molecular marker in order to solve these issues.
    From DNA of the species of the Sarcocystidae family (Sarcocystis cruzi, Sarcocystis sp. from Didelphis marsupialis, Sarcocystis sp. from Columbina talpacoti and Toxoplasma
    gondii, and from the species of the Plasmodiidae family (Plasmodium from Anolis ehloris, P. simium, and P. falciparum, the SSU ribosomal DNA fragemnt was
    amplified by PCR, using the pair of primers P5-P3, 0009-2134 and 566R-567R. Hind III, Eco RI, Sau 3AI and Alw 261 restriction pattems were compared

  8. Identical ribosomal DNA sequence data from Pfiesteria piscicida (Dinophyceae) isolates with different toxicity phenotypes

    Complete small subunit ribosomal RNA, internal transcribed spacer 1 and 2, 5.8S, and partial large subunit ribosomal RNA gene sequences were generated from multiple isolates of Pfiesteria piscicida. Sequences were derived from isolates that have been shown to be ichthyotoxic as well as isolates that have no history of toxic behavior. All of the sequences generated were identical for the different cultures, and we therefore conclude that differences in toxicity seen between isolates of P. piscicida are linked to factors other than genetic strain variation detectable by ribosomal gene sequence analyses

  9. Ribosomes containing mutants of L4 ribosomal protein from Thermus thermophilus display multiple defects in ribosomal functions and sensitivity against erythromycin

    TSAGKALIA, AIKATERINI; LEONTIADOU, FOTINI; XAPLANTERI, MARIA A.; PAPADOPOULOS, GEORGIOS; KALPAXIS, DIMITRIOS L.; CHOLI-PAPADOPOULOU, THEODORA

    2005-01-01

    Protein L4 from Thermus thermophilus (TthL4) was heterologously overproduced in Escherichia coli cells. To study the implication of the extended loop of TthL4 in the exit-tunnel and peptidyltransferase functions, the highly conserved E56 was replaced by D or Q, while the semiconserved G55 was changed to E or S. Moreover, the sequence -G55E56- was inverted to -E55G56-. When we incorporated these mutants into E. coli ribosomes and investigated their impact on poly(Phe) synthesis, high variations in the synthetic activity and response to erythromycin of the resulting ribosomes were observed. In the absence of erythromycin, ribosomes harboring mutations G55E and E56D in TthL4 protein were characterized by low activity in synthesizing poly(Phe) and decreased capability in binding tRNA at the A site. On the other hand, ribosomes possessing mutations G55E, G55S, G55E-E56G, or E56Q in TthL4 protein were unexpectedly more sensitive to erythromycin. Evidence in support of these findings was drawn by in vivo experiments, assessing the erythromycin sensitivity of E. coli cells expressing wild-type or mutant TthL4 proteins. Our results emphasize the role of the extended loop of L4 ribosomal protein in the exit-tunnel and peptidyltransferase center functions. PMID:16244130

  10. Phylogenetic study of Class Armophorea (Alveolata, Ciliophora based on 18S-rDNA data

    Thiago da Silva Paiva

    2013-01-01

    Full Text Available The 18S rDNA phylogeny of Class Armophorea, a group of anaerobic ciliates, is proposed based on an analysis of 44 sequences (out of 195 retrieved from the NCBI/GenBank database. Emphasis was placed on the use of two nucleotide alignment criteria that involved variation in the gap-opening and gap-extension parameters and the use of rRNA secondary structure to orientate multiple-alignment. A sensitivity analysis of 76 data sets was run to assess the effect of variations in indel parameters on tree topologies. Bayesian inference, maximum likelihood and maximum parsimony phylogenetic analyses were used to explore how different analytic frameworks influenced the resulting hypotheses. A sensitivity analysis revealed that the relationships among higher taxa of the Intramacronucleata were dependent upon how indels were determined during multiple-alignment of nucleotides. The phylogenetic analyses rejected the monophyly of the Armophorea most of the time and consistently indicated that the Metopidae and Nyctotheridae were related to the Litostomatea. There was no consensus on the placement of the Caenomorphidae, which could be a sister group of the Metopidae + Nyctorheridae, or could have diverged at the base of the Spirotrichea branch or the Intramacronucleata tree.

  11. Single Molecule Fluorescence Measurements of Ribosomal Translocation Dynamics

    Chen, Chunlai; Stevens, Benjamin; Kaur, Jaskarin; Cabral, Diana; Liu, Hanqing; Wang, Yuhong; Zhang, Haibo; Rosenblum, Gabriel; Smilansky, Zeev; Goldman, Yale E.; Cooperman, Barry S.

    2011-01-01

    We employ single-molecule fluorescence resonance energy transfer (smFRET) to study structural dynamics over the first two elongation cycles of protein synthesis, using ribosomes containing either Cy3-labeled ribosomal protein L11 and A- or P-site Cy5-labeled tRNA or Cy3 and Cy5 labeled tRNAs. Pre-translocation (PRE) complexes demonstrate fluctuations between classical and hybrid forms, with concerted motions of tRNAs away from L11 and from each other when classical complex converts to hybrid ...

  12. The Human Nucleolar Protein FTSJ3 Associates with NIP7 and Functions in Pre-rRNA Processing

    Morello, Luis G.; Coltri, Patricia P.; Quaresma, Alexandre J. C.; Simabuco, Fernando M.; Silva, Tereza C. L.; Singh, Guramrit; Nickerson, Jeffrey A.; Oliveira, Carla C.; Moore, Melissa J.; Zanchin, Nilson I. T.

    2011-01-01

    NIP7 is one of the many trans-acting factors required for eukaryotic ribosome biogenesis, which interacts with nascent pre-ribosomal particles and dissociates as they complete maturation and are exported to the cytoplasm. By using conditional knockdown, we have shown previously that yeast Nip7p is required primarily for 60S subunit synthesis while human NIP7 is involved in the biogenesis of 40S subunit. This raised the possibility that human NIP7 interacts with a different set of proteins as compared to the yeast protein. By using the yeast two-hybrid system we identified FTSJ3, a putative ortholog of yeast Spb1p, as a human NIP7-interacting protein. A functional association between NIP7 and FTSJ3 is further supported by colocalization and coimmunoprecipitation analyses. Conditional knockdown revealed that depletion of FTSJ3 affects cell proliferation and causes pre-rRNA processing defects. The major pre-rRNA processing defect involves accumulation of the 34S pre-rRNA encompassing from site A′ to site 2b. Accumulation of this pre-rRNA indicates that processing of sites A0, 1 and 2 are slower in cells depleted of FTSJ3 and implicates FTSJ3 in the pathway leading to 18S rRNA maturation as observed previously for NIP7. The results presented in this work indicate a close functional interaction between NIP7 and FTSJ3 during pre-rRNA processing and show that FTSJ3 participates in ribosome synthesis in human cells. PMID:22195017

  13. Association of protein C23 with rapidly labeled nucleolar RNA

    Herrera, A.H.; Olson, M.O.

    1986-10-07

    The association of nucleolar phosphoprotein C23 with preribosomal ribonucleoprotein (RNP) particles was examined in Novikoff hepatoma nucleoli. RNA was labeled with (/sup 3/H)uridine for various times in cell suspensions, and RNP particles were extracted from isolated nucleoli and fractionated by sucrose gradient ultracentrifugation. The majority of protein C23 cosedimented with fractions containing rapidly labeled RNA (RL fraction). To determine whether there was a direct association of RNA with protein C23, the RL fraction was exposed to ultraviolet (UV) light (254 nm) for short periods of time. After 2 min of exposure there was a 50% decrease in C23 as measured by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analyses, with no significant further decrease at longer times. When UV-treated fractions were subjected to phenol/chloroform extractions, as much as 30% of the labeled RNA was found in the phenol (protein) layer, indicating that RNA became cross-linked to protein. Similarly, there was an increase in protein C23 extracted into the water layer after irradiation. By SDS-PAGE analyses the cross-linked species migrated more slowly than protein C23, appearing as a smear detected either by (/sup 3/H)uridine radioactivity or by anti-C23 antibody. With anti-C23 antibodies, up to 25% of the labeled RNA was precipitated from the RL fraction. Dot-blot hybridizations, using cloned rDNA fragments as probes, indicated that the RNA in the RL fraction and the immunoprecipitated RNA contained sequences from 18S and 28S ribosomal RNA.

  14. Association of protein C23 with rapidly labeled nucleolar RNA

    The association of nucleolar phosphoprotein C23 with preribosomal ribonucleoprotein (RNP) particles was examined in Novikoff hepatoma nucleoli. RNA was labeled with [3H]uridine for various times in cell suspensions, and RNP particles were extracted from isolated nucleoli and fractionated by sucrose gradient ultracentrifugation. The majority of protein C23 cosedimented with fractions containing rapidly labeled RNA (RL fraction). To determine whether there was a direct association of RNA with protein C23, the RL fraction was exposed to ultraviolet (UV) light (254 nm) for short periods of time. After 2 min of exposure there was a 50% decrease in C23 as measured by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analyses, with no significant further decrease at longer times. When UV-treated fractions were subjected to phenol/chloroform extractions, as much as 30% of the labeled RNA was found in the phenol (protein) layer, indicating that RNA became cross-linked to protein. Similarly, there was an increase in protein C23 extracted into the water layer after irradiation. By SDS-PAGE analyses the cross-linked species migrated more slowly than protein C23, appearing as a smear detected either by [3H]uridine radioactivity or by anti-C23 antibody. With anti-C23 antibodies, up to 25% of the labeled RNA was precipitated from the RL fraction. Dot-blot hybridizations, using cloned rDNA fragments as probes, indicated that the RNA in the RL fraction and the immunoprecipitated RNA contained sequences from 18S and 28S ribosomal RNA

  15. Further characterization of ribosome binding to thylakoid membranes

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [3H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

  16. Experimental Conditions: SE18_S1_M1_D1 [Metabolonote[Archive

    Full Text Available liver and brain by Orbitrap MS and automated search engine Lipid Search SE18_S1 Mouse liver SE18_S1_M1 34.1...phy. SE18_MS1 Preparation of lipid extract and ESI negative detection by LC-MS analysis SE18_DS1 Identification of phospholipids with Lipid Search default ...

  17. Experimental Conditions: SE18_S2_M1_D1 [Metabolonote[Archive

    Full Text Available liver and brain by Orbitrap MS and automated search engine Lipid Search SE18_S2 Mouse brain SE18_S2_M1 10.8...phy. SE18_MS1 Preparation of lipid extract and ESI negative detection by LC-MS analysis SE18_DS1 Identification of phospholipids with Lipid Search default ...

  18. Metabolism of ribosomal proteins microinjected into the oocytes of Xenopus laevis

    When the total proteins from Xenopus laevis 60 S ribosomal subunits (TP60) were 3H-labeled in vitro and injected back into X. laevis oocytes, most 3H-TP60 are integrated into the cytoplasmic 60 S subunits via the nucleus during 16 h of incubation. In the oocytes whose rRNA synthesis is inhibited, 3H-TP60 are rapidly degraded with a half-life of 2-3 h. This degradation ceased as soon as rRNA synthesis was resumed, suggesting that ribosomal proteins unassociated with nascent rRNA are unstable in the oocytes. The degradation of 3H-TP60 in the absence of RNA synthesis was inhibited by iodoacetamide, a cysteine protease inhibitor, resulting in the accumulation of 3H-TP60 in the nucleus reaching about a threefold concentration in the cytoplasm. Considering the results with enucleated oocytes, we suggest that the X. laevis nucleus has a limited capacity to accumulate ribosomal proteins in an active manner but that those ribosomal proteins accumulated in excess over rRNA synthesis are degraded by a cysteine protease in the nucleus. By contrast, ribosomal proteins from Escherichia coli only equilibrate between the nucleus and the cytoplasm and are degraded by serine protease(s) in the cytoplasm without being integrated in the form of ribosomes in the nucleus

  19. Ribosomal small subunit domains radiate from a central core

    Gulen, Burak; Petrov, Anton S.; Okafor, C. Denise; Vander Wood, Drew; O'Neill, Eric B.; Hud, Nicholas V.; Williams, Loren Dean

    2016-02-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2‧OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit.

  20. Abiotic Stress Resistance, a Novel Moonlighting Function of Ribosomal Protein RPL44 in the Halophilic Fungus Aspergillus glaucus

    LIU, XIAO-DAN; Xie, Lixia; Wei, Yi; Zhou, Xiaoyang; Jia, Baolei; Liu, Jinliang; Zhang, Shihong

    2014-01-01

    Ribosomal proteins are highly conserved components of basal cellular organelles, primarily involved in the translation of mRNA leading to protein synthesis. However, certain ribosomal proteins moonlight in the development and differentiation of organisms. In this study, the ribosomal protein L44 (RPL44), associated with salt resistance, was screened from the halophilic fungus Aspergillus glaucus (AgRPL44), and its activity was investigated in Saccharomyces cerevisiae and Nicotiana tabacum. Se...

  1. Structural, biophysical and functional characterization of Nop7-Erb1-Ytm1 complex and its implications in eukaryotic ribosome biogenesis

    Wegrecki, Marcin

    2015-01-01

    [EN] Ribosome biogenesis is one of the most important and energy-consuming processes in the cell. However, the vast majority of the events and factors that are involved in the synthesis of ribosomal subunits are not well understood. Ribosome maturation comprises multiple steps of rRNA processing that require sequential association and dissociation of numerous assembly factors. These proteins establish a complex network of interactions that are essential for the pathway to continue. Extensive ...

  2. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA in the fish Prochilodus lineatus (Characiformes, Prochilodontidae

    Marcelo Ricardo Vicari

    2006-01-01

    Full Text Available We used differential staining techniques (BSG, GTG, AgNO3, DAPI and CMA3 banding and fluorescent in situ hybridization (FISH with 5S and 18S probes to investigated the karyotypic and cytogenetic chracteristics of Prochilodus lineatus specimens from a population in Vila Velha state park (Parque Estadual de Vila Velha, Ponta Grossa, Paraná state, southern Brazil. The specimens studied showed the same karyotype as that found in other P. lineatus populations, i.e. 2n = 54 biarmed chromosomes (40m + 14 sm and c-positive heterochromatin preferentially located pericentromerically in all chromosomes. The presence of partial or totally heterochromatic supernumerary chromosomes with numeric intra-individual variation was confirmed in the analyzed population. The nucleolar organizing regions (NORs were interstitially situated on the long arm of chromosome pair 4 directly beneath the centromere. The differential banding techniques and FISH revealed NOR size polymorphism due to structural events such as breaks and duplication of the larger rDNA site cluster. We also observed syntenic localization of the 5S ribosomal genes in the distal segment of the 45S cluster.

  3. Chloroplast ribosomes and protein synthesis.

    Harris, E. H.; Boynton, J E; Gillham, N W

    1994-01-01

    Consistent with their postulated origin from endosymbiotic cyanobacteria, chloroplasts of plants and algae have ribosomes whose component RNAs and proteins are strikingly similar to those of eubacteria. Comparison of the secondary structures of 16S rRNAs of chloroplasts and bacteria has been particularly useful in identifying highly conserved regions likely to have essential functions. Comparative analysis of ribosomal protein sequences may likewise prove valuable in determining their roles i...

  4. The ribosome and the mechanism of protein synthesis

    In virtually all forms of life on earth, proteins in each cell are made according to a genetic blueprint, in the form of DNA. The translation of copies of this genetic blueprint (in the form of messenger RNA) into polypeptides is performed on the ribosome, a highly complex molecular machine composed of RNAs and proteins. To this end, special adaptor molecules called transfer RNAs are lined up by the ribosome in the sequence dictated by the genetic code, such that the amino acids carried by these molecules can be linked into a polypeptide. Several cofactors are involved in these processes, some of which require energy freed up by GTP hydrolysis. Although the ribosome was discovered more than 50 years ago, its structure has only been solved recently by X-ray crystallography. Another technique, cryo-electron microscopy, is starting to contribute toward our understanding of the ribosome's function, by portraying its conformational changes and binding interactions with the cofactors and tRNA

  5. Translation affects YoeB and MazF messenger RNA interferase activities by different mechanisms

    Christensen-Dalsgaard, Mikkel; Gerdes, Kenn

    2008-01-01

    Prokaryotic toxin-antitoxin loci encode mRNA cleaving enzymes that inhibit translation. Two types are known: those that cleave mRNA codons at the ribosomal A site and those that cleave any RNA site specifically. RelE of Escherichia coli cleaves mRNA at the ribosomal A site in vivo and in vitro but...

  6. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    William Orsi

    Full Text Available The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC, nitrate, sulfide, and dissolved inorganic carbon (DIC. These correlations are supported by terminal restriction length polymorphism (TRFLP analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  7. Close sequence identity between ribosomal DNA episomes of the non-pathogenic Entamoeba dispar and pathogenic Entamoeba histolytica

    Jaishree Paul; Alok Bhattacharya; Sudha Bhattacharya

    2002-11-01

    Entamoeba dispar and Entamoeba histolytica are now recognized as two distinct species – the former being nonpathogenic to humans. We had earlier studied the organization of ribosomal RNA genes in E. histolytica. Here we report the analysis of ribosomal RNA genes in E. dispar. The rRNA genes of E. dispar, like their counterpart in E. histolytica are located on a circular rDNA molecule. From restriction map analysis, the size of E. dispar rDNA circle was estimated to be 24.4 kb. The size was also confirmed by linearizing the circle with BsaHI, and by limited DNAseI digestion. The restriction map of the E. dispar rDNA circle showed close similarity to EhR1, the rDNA circle of E. histolytica strain HM-1:IMSS which has two rDNA units per circle. The various families of short tandem repeats found in the upstream and downstream intergenic spacers (IGS) of EhR1 were also present in E. dispar. Partial sequencing of the cloned fragments of E. dispar rDNA and comparison with EhR1 revealed only 2.6% to 3.8% sequence divergence in the IGS. The region Tr and the adjoining PvuI repeats in the IGS of EhR1, which are missing in those E. histolytica strains that have one rDNA unit per circle, were present in the E. dispar rDNA circle. Such close similarity in the overall organization and sequence of the IGS of rDNAs of two different species is uncommon. In fact the spacer sequences were only slightly more divergent than the 18S rRNA gene sequence which differs by 1.6% in the two species. The most divergent sequence between E. histolytica and E. dispar was the internal transcribed spacer, ITS2. Therefore, it was concluded that probes derived from the ITS1 and ITS2 sequences would be more reliable and reproducible than probes from the IGS regions used earlier for identifying these species.

  8. Structure determination of archaea-specific ribosomal protein L46a reveals a novel protein fold

    Feng, Yingang, E-mail: fengyg@qibebt.ac.cn [Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao, Shandong 266101 (China); Song, Xiaxia [Department of Biological Science and Engineering, School of Chemical and Biological Engineering, University of Science and Technology Beijing, Beijing 100083 (China); Lin, Jinzhong [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China); Xuan, Jinsong [Department of Biological Science and Engineering, School of Chemical and Biological Engineering, University of Science and Technology Beijing, Beijing 100083 (China); Cui, Qiu [Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao, Shandong 266101 (China); Wang, Jinfeng [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China)

    2014-07-18

    Highlights: • The archaea-specific ribosomal protein L46a has no homology to known proteins. • Three dimensional structure and backbone dynamics of L46a were determined by NMR. • The structure of L46a represents a novel protein fold. • A potential rRNA-binding surface on L46a was identified. • The potential position of L46a on the ribosome was proposed. - Abstract: Three archaea-specific ribosomal proteins recently identified show no sequence homology with other known proteins. Here we determined the structure of L46a, the most conserved one among the three proteins, from Sulfolobus solfataricus P2 using NMR spectroscopy. The structure presents a twisted β-sheet formed by the N-terminal part and two helices at the C-terminus. The L46a structure has a positively charged surface which is conserved in the L46a protein family and is the potential rRNA-binding site. Searching homologous structures in Protein Data Bank revealed that the structure of L46a represents a novel protein fold. The backbone dynamics identified by NMR relaxation experiments reveal significant flexibility at the rRNA binding surface. The potential position of L46a on the ribosome was proposed by fitting the structure into a previous electron microscopy map of the ribosomal 50S subunit, which indicated that L46a contacts to domain I of 23S rRNA near a multifunctional ribosomal protein L7ae.

  9. Structure determination of archaea-specific ribosomal protein L46a reveals a novel protein fold

    Highlights: • The archaea-specific ribosomal protein L46a has no homology to known proteins. • Three dimensional structure and backbone dynamics of L46a were determined by NMR. • The structure of L46a represents a novel protein fold. • A potential rRNA-binding surface on L46a was identified. • The potential position of L46a on the ribosome was proposed. - Abstract: Three archaea-specific ribosomal proteins recently identified show no sequence homology with other known proteins. Here we determined the structure of L46a, the most conserved one among the three proteins, from Sulfolobus solfataricus P2 using NMR spectroscopy. The structure presents a twisted β-sheet formed by the N-terminal part and two helices at the C-terminus. The L46a structure has a positively charged surface which is conserved in the L46a protein family and is the potential rRNA-binding site. Searching homologous structures in Protein Data Bank revealed that the structure of L46a represents a novel protein fold. The backbone dynamics identified by NMR relaxation experiments reveal significant flexibility at the rRNA binding surface. The potential position of L46a on the ribosome was proposed by fitting the structure into a previous electron microscopy map of the ribosomal 50S subunit, which indicated that L46a contacts to domain I of 23S rRNA near a multifunctional ribosomal protein L7ae

  10. The nucleolar size is associated to the methylation status of ribosomal DNA in breast carcinomas

    There is a body of evidence that shows a link between tumorigenesis and ribosome biogenesis. The precursor of mature 18S, 28S and 5.8S ribosomal RNAs is transcribed from the ribosomal DNA gene (rDNA), which exists as 300–400 copies in the human diploid genome. Approximately one half of these copies are epigenetically silenced, but the exact role of epigenetic regulation on ribosome biogenesis is not completely understood. In this study we analyzed the methylation profiles of the rDNA promoter and of the 5’ regions of 18S and 28S in breast cancer. We analyzed rDNA methylation in 68 breast cancer tissues of which the normal counterpart was partially available (45/68 samples) using the MassARRAY EpiTYPER assay, a sensitive and quantitative method with single base resolution. We found that rDNA locus tended to be hypermethylated in tumor compared to matched normal breast tissues and that the DNA methylation level of several CpG units within the rDNA locus was associated to nuclear grade and to nucleolar size of tumor tissues. In addition we identified a subgroup of samples in which large nucleoli were associated with very limited or absent rDNA hypermethylation in tumor respect to matched normal tissue. In conclusion, we suggest that rDNA is an important target of epigenetic regulation in breast tumors and that rDNA methylation level is associated to nucleolar size

  11. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome.

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through "molecular synapses", ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the "sensory-proteins" innervate the functional ribosomal sites, while the "inter-proteins" interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  12. Accommodation of tmRNA–SmpB into stalled ribosomes: A cryo-EM study

    Weis, Felix; Bron, Patrick; Rolland, Jean-Paul; Thomas, Daniel; Felden, Brice; Gillet, Reynald

    2010-01-01

    In eubacteria, translation of defective messenger RNAs (mRNAs) produces truncated polypeptides that stall on the ribosome. A quality control mechanism referred to as trans-translation is performed by transfer-messenger RNA (tmRNA), a specialized RNA acting as both a tRNA and an mRNA, associated with small protein B (SmpB). So far, a clear view of the structural movements of both the protein and RNA necessary to perform accommodation is still lacking. By using a construct containing the tRNA-l...

  13. Crystal structures of complexes containing domains from two viral internal ribosome entry site (IRES) RNAs bound to the 70S ribosome

    Zhu, Jianyu; Korostelev, Andrei; Costantino, David A.; Donohue, John P.; Noller, Harry F.; Kieft, Jeffrey S. (UCSC); (Colorado)

    2011-08-24

    Internal ribosome entry site (IRES) RNAs are elements of viral or cellular mRNAs that bypass steps of canonical eukaryotic cap-dependent translation initiation. Understanding of the structural basis of IRES mechanisms is limited, partially due to a lack of high-resolution structures of IRES RNAs bound to their cellular targets. Prompted by the universal phylogenetic conservation of the ribosomal P site, we solved the crystal structures of proposed P site binding domains from two intergenic region IRES RNAs bound to bacterial 70S ribosomes. The structures show that these IRES domains nearly perfectly mimic a tRNA-mRNA interaction. However, there are clear differences in the global shape and position of this IRES domain in the intersubunit space compared to those of tRNA, supporting a mechanism for IRES action that invokes hybrid state mimicry to drive a noncanonical mode of translocation. These structures suggest how relatively small structured RNAs can manipulate complex biological machines.

  14. β-Puromycin selection of modified ribosomes for in vitro incorporation of β-amino acids.

    Dedkova, Larisa M; Fahmi, Nour Eddine; Paul, Rakesh; del Rosario, Melissa; Zhang, Liqiang; Chen, Shengxi; Feder, Glen; Hecht, Sidney M

    2012-01-10

    Ribosomally mediated protein biosynthesis is limited to α-L-amino acids. A strong bias against β-L-amino acids precludes their incorporation into proteins in vivo and also in vitro in the presence of misacylated β-aminoacyl-tRNAs. Nonetheless, earlier studies provide some evidence that analogues of aminoacyl-tRNAs bearing β-amino acids can be accommodated in the ribosomal A-site. Both functional and X-ray crystallographic data make it clear that the exclusion of β-L-amino acids as participants in protein synthesis is a consequence of the architecture of the ribosomal peptidyltransferase center (PTC). To enable the reorganization of ribosomal PTC architecture through mutagenesis of 23S rRNA, a library of modified ribosomes having modifications in two regions of the 23S rRNA (2057-2063 and 2496-2507 or 2582-2588) was prepared. A dual selection procedure was used to obtain a set of modified ribosomes able to carry out protein synthesis in the presence β-L-amino acids and to provide evidence for the utilization of such amino acids, in addition to α-L-amino acids. β-Puromycin, a putative mimetic for β-aminoacyl-tRNAs, was used to select modified ribosome variants having altered PTC architectures, thus potentially enabling incorporation of β-L-amino acids. Eight types of modified ribosomes altered within the PTC have been selected by monitoring improved sensitivity to β-puromycin in vivo. Two of the modified ribosomes, having 2057AGCGUGA2063 and 2502UGGCAG2507 or 2502AGCCAG2507, were able to suppress UAG codons in E. coli dihydrofolate reductase (DHFR) and scorpion Opisthorcanthus madagascariensis peptide IsCT mRNAs in the presence of β-alanyl-tRNA(CUA). PMID:22145951

  15. A two-step binding model proposed for the electrostatic interactions of ricin A chain with ribosomes

    Li, Xiao-Ping; Chiou, Jia-Chi; Remacha, Miguel; Ballesta, Juan P.G.; Tumer, Nilgun E.

    2009-01-01

    Ricin is a ribosome inactivating protein that catalytically removes a universally conserved adenine from the α-sarcin/ricin loop (SRL) of the 28S rRNA. We recently showed that ricin A chain (RTA) interacts with the P1 and P2 proteins of the ribosomal stalk to depurinate the SRL in yeast. Here we examined the interaction of RTA with wild type and mutant yeast ribosomes deleted in the stalk proteins by surface plasmon resonance. The interaction between RTA and wild type ribosomes did not follow...

  16. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution...

  17. The antibiotic thiostrepton inhibits a functional transition within protein L11 at the ribosomal GTPase centre

    Porse, B T; Leviev, I; Mankin, A S;

    1998-01-01

    reduced for the mutant L11-rRNA complexes. These results indicate that although, as shown earlier, thiostrepton binds primarily to 23 S rRNA, the drug probably inhibits peptide elongation by impeding a conformational change within protein L11 that is important for the function of the ribosomal GTPase...

  18. Crucial elements that maintain the interactions between the regulatory TnaC peptide and the ribosome exit tunnel responsible for Trp inhibition of ribosome function.

    Martínez, Allyson K; Shirole, Nitin H; Murakami, Shino; Benedik, Michael J; Sachs, Matthew S; Cruz-Vera, Luis R

    2012-03-01

    Translation of the TnaC nascent peptide inhibits ribosomal activity in the presence of l-tryptophan, inducing expression of the tnaCAB operon in Escherichia coli. Using chemical methylation, this work reveals how interactions between TnaC and the ribosome are affected by mutations in both molecules. The presence of the TnaC-tRNA(Pro) peptidyl-tRNA within the ribosome protects the 23S rRNA nucleotide U2609 against chemical methylation. Such protection was not observed in mutant ribosomes containing changes in 23S rRNA nucleotides of the A748-A752 region. Nucleotides A752 and U2609 establish a base-pair interaction. Most replacements of either A752 or U2609 affected Trp induction of a TnaC-regulated LacZ reporter. However, the single change A752G, or the dual replacements A752G and U2609C, maintained Trp induction. Replacements at the conserved TnaC residues W12 and D16 also abolished the protection of U2609 by TnaC-tRNA(Pro) against chemical methylation. These data indicate that the TnaC nascent peptide in the ribosome exit tunnel interacts with the U2609 nucleotide when the ribosome is Trp responsive. This interaction is affected by mutational changes in exit tunnel nucleotides of 23S rRNA, as well as in conserved TnaC residues, suggesting that they affect the structure of the exit tunnel and/or the nascent peptide configuration in the tunnel. PMID:22110039

  19. Three distinct ribosome assemblies modulated by translation are the building blocks of polysomes.

    Viero, Gabriella; Lunelli, Lorenzo; Passerini, Andrea; Bianchini, Paolo; Gilbert, Robert J; Bernabò, Paola; Tebaldi, Toma; Diaspro, Alberto; Pederzolli, Cecilia; Quattrone, Alessandro

    2015-03-01

    Translation is increasingly recognized as a central control layer of gene expression in eukaryotic cells. The overall organization of mRNA and ribosomes within polysomes, as well as the possible role of this organization in translation are poorly understood. Here we show that polysomes are primarily formed by three distinct classes of ribosome assemblies. We observe that these assemblies can be connected by naked RNA regions of the transcript. We show that the relative proportions of the three classes of ribosome assemblies reflect, and probably dictate, the level of translational activity. These results reveal the existence of recurrent supra-ribosomal building blocks forming polysomes and suggest the presence of unexplored translational controls embedded in the polysome structure. PMID:25713412

  20. Ribosome biogenesis in replicating cells: Integration of experiment and theory.

    Earnest, Tyler M; Cole, John A; Peterson, Joseph R; Hallock, Michael J; Kuhlman, Thomas E; Luthey-Schulten, Zaida

    2016-10-01

    Ribosomes-the primary macromolecular machines responsible for translating the genetic code into proteins-are complexes of precisely folded RNA and proteins. The ways in which their production and assembly are managed by the living cell is of deep biological importance. Here we extend a recent spatially resolved whole-cell model of ribosome biogenesis in a fixed volume [Earnest et al., Biophys J 2015, 109, 1117-1135] to include the effects of growth, DNA replication, and cell division. All biological processes are described in terms of reaction-diffusion master equations and solved stochastically using the Lattice Microbes simulation software. In order to determine the replication parameters, we construct and analyze a series of Escherichia coli strains with fluorescently labeled genes distributed evenly throughout their chromosomes. By measuring these cells' lengths and number of gene copies at the single-cell level, we could fit a statistical model of the initiation and duration of chromosome replication. We found that for our slow-growing (120 min doubling time) E. coli cells, replication was initiated 42 min into the cell cycle and completed after an additional 42 min. While simulations of the biogenesis model produce the correct ribosome and mRNA counts over the cell cycle, the kinetic parameters for transcription and degradation are lower than anticipated from a recent analytical time dependent model of in vivo mRNA production. Describing expression in terms of a simple chemical master equation, we show that the discrepancies are due to the lack of nonribosomal genes in the extended biogenesis model which effects the competition of mRNA for ribosome binding, and suggest corrections to parameters to be used in the whole-cell model when modeling expression of the entire transcriptome. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 735-751, 2016. PMID:27294303

  1. Isolation, morphological and molecular characterization of phytate-hydrolysing fungi by 18S rDNA sequence analysis

    Iti Gontia-Mishra

    2013-01-01

    Full Text Available Phytate is the primary storage form of phosphate in plants. Monogastric animals like poultry, pigs and fishes have very low or no phytase activities in their digestive tracts therefore, are incapable to efficiently utilize phytate phosphorus from the feed. Phytase from microbial sources are supplemented to feedstuff of these to increase the uptake of phytate phosphorus. In the present work efforts were made to isolate and characterize proficient phytase producing fungi from soil. Phytase producing fungi were isolated using phytate specific medium. Fungal isolates were selected according to their higher phytase activities. These isolates were further characterized and identified by morphological and microscopic analysis and confirmed by amplification of 18S rRNA gene, using specific primers. This gene was subsequently sequenced and phylogenetic affiliations were assigned. Fungal isolates were identified as various species of Aspergillus. Phytases from these fungi could be utilized as a feed additive in poultry and swine industries.

  2. KIF4 Mediates Anterograde Translocation and Positioning of Ribosomal Constituents to Axons*S⃞

    Bisbal, Mariano; Wojnacki, José; Peretti, Diego; Ropolo, Andrea; Sesma, Juliana; Jausoro, Ignacio; Cáceres, Alfredo

    2009-01-01

    In this study, we have used a combination of biochemical and molecular biology techniques to demonstrate that the C-terminal tail domain of KIF4 directly interacts with P0, a major protein component of ribosomes. Besides, in dorsal root ganglion neurons, KIF4 and P0, as well as other ribosomal constituents, colocalize in clusters distributed along axons and neuritic tips. RNA interference suppression of KIF4 or expression of KIF4 variants lacking the tail domain or mut...

  3. Ribosome-associated pentatricopeptide repeat proteins function as translational activators in mitochondria of trypanosomes.

    Aphasizheva, Inna; Maslov, Dmitri A; Qian, Yu; Huang, Lan; Wang, Qi; Costello, Catherine E; Aphasizhev, Ruslan

    2016-03-01

    Mitochondrial ribosomes of Trypanosoma brucei are composed of 9S and 12S rRNAs, eubacterial-type ribosomal proteins, polypeptides lacking discernible motifs and approximately 20 pentatricopeptide repeat (PPR) RNA binding proteins. Several PPRs also populate the polyadenylation complex; among these, KPAF1 and KPAF2 function as general mRNA 3' adenylation/uridylation factors. The A/U-tail enables mRNA binding to the small ribosomal subunit and is essential for translation. The presence of A/U-tail also correlates with requirement for translation of certain mRNAs in mammalian and insect parasite stages. Here, we inquired whether additional PPRs activate translation of individual mRNAs. Proteomic analysis identified KRIPP1 and KRIPP8 as components of the small ribosomal subunit in mammalian and insect forms, but also revealed their association with the polyadenylation complex in the latter. RNAi knockdowns demonstrated essential functions of KRIPP1 and KRIPP8 in the actively respiring insect stage, but not in the mammalian stage. In the KRIPP1 knockdown, A/U-tailed mRNA encoding cytochrome c oxidase subunit 1 declined concomitantly with the de novo synthesis of this subunit whereas polyadenylation and translation of cyb mRNA were unaffected. In contrast, the KRIPP8 knockdown inhibited A/U-tailing and translation of both CO1 and cyb mRNAs. Our findings indicate that ribosome-associated PPRs may selectively activate mRNAs for translation. PMID:26713541

  4. Structural characterization of mRNA-tRNA translocation intermediates.

    Agirrezabala, Xabier; Liao, Hstau Y; Schreiner, Eduard; Fu, Jie; Ortiz-Meoz, Rodrigo F; Schulten, Klaus; Green, Rachel; Frank, Joachim

    2012-04-17

    Cryo-EM analysis of a wild-type Escherichia coli pretranslocational sample has revealed the presence of previously unseen intermediate substates of the bacterial ribosome during the first phase of translocation, characterized by intermediate intersubunit rotations, L1 stalk positions, and tRNA configurations. Furthermore, we describe the domain rearrangements in quantitative terms, which has allowed us to characterize the processivity and coordination of the conformational reorganization of the ribosome, along with the associated changes in tRNA ribosome-binding configuration. The results are consistent with the view of the ribosome as a molecular machine employing Brownian motion to reach a functionally productive state via a series of substates with incremental changes in conformation. PMID:22467828

  5. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  6. Partial deletion of the RPS0A-binding domain of TIF32/eIF3A affects 40S ribosome-association of the multifactor complex and severely impairs reinitiation on the GCN4 mRNA leader

    Szamecz, Bela; Rutkai, Edit; Nielsen, K. H.; Valášek, Leoš

    Nové Hrady : Verlag, 2006, s. 20-20. [Translational Control and Non-Coding RNA Meeting. Nové Hrady (CZ), 08.12.2006-12.12.2006] Grant ostatní: XE(XE) The Wellcome Trust grant to LV Institutional research plan: CEZ:AV0Z50200510 Keywords : translation * gcn4 Subject RIV: EE - Microbiology, Virology

  7. Characterization of the binding sites of protein L11 and the L10.(L12)4 pentameric complex in the GTPase domain of 23 S ribosomal RNA from Escherichia coli

    Egebjerg, J; Douthwaite, S R; Liljas, A; Garrett, R A

    1990-01-01

    data, were used in a computer graphics approach to build a partial RNA tertiary structural model. The model provides insight into the topography of the L11 binding site. It also provides a structural rationale for the mutually co-operative binding of protein L11 with the antibiotics thiostrepton and...

  8. RNA modifications by oxidation

    Poulsen, Henrik E; Specht, Elisabeth; Broedbaek, Kasper;

    2012-01-01

    to encompass various classes of novel regulatory RNAs, including, e.g., microRNAs. It is well known that DNA is constantly oxidized and repaired by complex genome maintenance mechanisms. Analogously, RNA also undergoes significant oxidation, and there are now convincing data suggesting that oxidation......, and the consequent loss of integrity of RNA, is a mechanism for disease development. Oxidized RNA is found in a large variety of diseases, and interest has been especially devoted to degenerative brain diseases such as Alzheimer disease, in which up to 50-70% of specific mRNA molecules are reported oxidized, whereas...... other RNA molecules show virtually no oxidation. The iron-storage disease hemochromatosis exhibits the most prominent general increase in RNA oxidation ever observed. Oxidation of RNA primarily leads to strand breaks and to oxidative base modifications. Oxidized mRNA is recognized by the ribosomes...

  9. Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3

    Anuradha Seshadri; Umesh Varshney

    2006-06-01

    Ribosome recycling is a process which dissociates the post-termination complexes (post-TC) consisting of mRNA-bound ribosomes harbouring deacylated tRNA(s). Ribosome recycling factor (RRF), and elongation factor G (EFG) participate in this crucial process to free the ribosomal subunits for a new round of translation. We discuss the overall pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor 3 (IF3) in this process. Depending on the step(s) at which IF3 function is implicated, three models have been proposed. In model 1, RRF and EFG dissociate the post-TCs into the 50S and 30S subunits, mRNA and tRNA(s). In this model, IF3, which binds to the 30S subunit, merely keeps the dissociated subunits apart by its anti-association activity. In model 2, RRF and EFG separate the 50S subunit from the post-TC. IF3 then dissociates the remaining complex of mRNA, tRNA and the 30S subunit, and keeps the ribosomal subunits apart from each other. However, in model 3, both the genetic and biochemical evidence support a more active role for IF3 even at the step of dissociation of the post-TC by RRF and EFG into the 50S and 30S subunits.

  10. Ribosomal crystallography: from crystal growth to initial phasing

    Thygesen, J.; Krumbholz, S.; Levin, I.; Zaytzev-Bashan, A.; Harms, J.; Bartels, H.; Schlünzen, F.; Hansen, H. A. S.; Bennett, W. S.; Volkmann, N.; Agmon, I.; Eisenstein, M.; Dribin, A.; Maltz, E.; Sagi, I.; Morlang, S.; Fua, M.; Franceschi, F.; Weinstein, S.; Böddeker, N.; Sharon, R.; Anagnostopoulos, K.; Peretz, M.; Geva, M.; Berkovitch-Yellin, Z.; Yonath, A.

    1996-10-01

    Preliminary phases were determined by the application of the isomorphous replacement method at low and intermediate resolution for structure factor amplitudes collected from crystals of large and small ribosomal subunits from halophilic and thermophilic bacteria. Derivatization was performed with dense heavy atom clusters, either by soaking or by specific covalent binding prior to the crystallization. The resulting initial electron density maps contain features comparable in size to those expected for the corresponding particles. The packing arrangements of these maps have been compared with motifs observed by electron microscopy in positively stained thin sections of embedded three-dimensional crystals, as well as with phase sets obtained by ab-initio computations. Aimed at higher resolution phasing, procedures are being developed for multi-site binding of relatively small dense metal clusters at selected locations. Potential sites are being inserted either by mutagenesis or by chemical modifications to facilitate cluster binding to the large halophilic and the small thermophilic ribosomal subunits which yield crystals diffracting to the highest resolution obtained so far for ribosomes, 2.9 and 7.3 Å, respectively. For this purpose the surfaces of these ribosomal particles have been characterized and conditions for quantitative reversible detachment of selected ribosomal proteins have been found. The corresponding genes are being cloned, sequenced, mutated to introduce the reactive side-groups (mainly cysteines) and overexpressed. To assist the interpretation of the anticipated electron density maps, sub-ribosomal stable complexes were isolated from H50S. One of these complexes is composed of two proteins and the other is made of a stretch of the rRNA and a protein. For exploiting the exposed parts of the surface of these complexes for heavy atom binding and for attempting the determination of their three-dimensional structure, their components are being produced

  11. Genetic divergences of South and Southeast Asian frogs: a case study of several taxa based on 16S ribosomal RNA gene data with notes on the generic name Fejervarya

    Hasan, Mahmudul; Islam, Mohammed Mafizul; KHAN, Md. Mukhlesur Rahman; Igawa, Takeshi; ALAM, Mohammad Shafiqul

    2014-01-01

    To elucidate the genetic divergences of several Asian frog taxa, the mitochondrial 16S rRNA gene (16S) sequences of 81 populations across 6 Asian countries were analyzed. In total, 109 haplotypes were found, and the concept of a 3% difference in 16S sequence corresponding to species threshold was applied to define candidate amphibian species, for which corroborating evidence, such as morphology, ecological characteristics, and/or nuclear gene data, is required. Polypedates leucomystax, Hylara...

  12. Assessment of helminth biodiversity in wild rats using 18S rDNA based metagenomics.

    Ryusei Tanaka

    Full Text Available Parasite diversity has important implications in several research fields including ecology, evolutionary biology and epidemiology. Wide-ranging analysis has been restricted because of the difficult, highly specialised and time-consuming processes involved in parasite identification. In this study, we assessed parasite diversity in wild rats using 18S rDNA-based metagenomics. 18S rDNA PCR products were sequenced using an Illumina MiSeq sequencer and the analysis of the sequences using the QIIME software successfully classified them into several parasite groups. The comparison of the results with those obtained using standard methods including microscopic observation of helminth parasites in the rat intestines and PCR amplification/sequencing of 18S rDNA from isolated single worms suggests that this new technique is reliable and useful to investigate parasite diversity.

  13. Amicoumacin A induces cancer cell death by targeting the eukaryotic ribosome

    Prokhorova, Irina V.; Akulich, Kseniya A.; Makeeva, Desislava S.; Osterman, Ilya A.; Skvortsov, Dmitry A.; Sergiev, Petr V.; Dontsova, Olga A.; Yusupova, Gulnara; Yusupov, Marat M.; Dmitriev, Sergey E.

    2016-01-01

    Amicoumacin A is an antibiotic that was recently shown to target bacterial ribosomes. It affects translocation and provides an additional contact interface between the ribosomal RNA and mRNA. The binding site of amicoumacin A is formed by universally conserved nucleotides of rRNA. In this work, we showed that amicoumacin A inhibits translation in yeast and mammalian systems by affecting translation elongation. We determined the structure of the amicoumacin A complex with yeast ribosomes at a resolution of 3.1  Å. Toxicity measurement demonstrated that human cancer cell lines are more susceptible to the inhibition by this compound as compared to non-cancerous ones. This might be used as a starting point to develop amicoumacin A derivatives with clinical value. PMID:27296282

  14. Heat shock stabilizes highly unstable transcripts of the Xenopus ribosomal gene spacer.

    Labhart, P; Reeder, R H

    1987-01-01

    We have shown recently that, in Xenopus laevis oocytes, the 3' end of the longest detectable ribosomal precursor RNA is not formed by transcription termination but by RNA processing and that RNA polymerase I continues to transcribe through the intergenic spacer region. In oocytes, these spacer transcripts are turned over rapidly, and the only apparent transcription termination site is located 215 base pairs upstream of the 5' end of the next transcription unit. In this paper we show that, at ...

  15. Ultrastructure of the extended ribonucleic acid molecules from purified ribosomes of Rous sarcoma virus-induced mouse ascites sarcoma cells

    Yamamoto,Goki

    1974-04-01

    Full Text Available To clarify the ultrastructure of the extended ribosomal RNA molecules, electron microscopic observations were carried out on the RNA molecules extracted from purified ribosomes of mouse ascites sarcoma cells. By the treatment with ethylenediamine-tetraacetate agglomerated rRNA molecules were elongated to thread-like structure by partial unfolding. The lengths of thread-like molecules were measured as less than Iii. The strand of RNA molecules stained with uranyl acetate was observed approximately l5A in width.

  16. New bioinformatic tools for analysis of nucleotide modifications in eukaryotic rRNA

    Piekna-Przybylska, Dorota; Decatur, Wayne A.; Fournier, Maurille J.

    2007-01-01

    This report presents a valuable new bioinformatics package for research on rRNA nucleotide modifications in the ribosome, especially those created by small nucleolar RNA:protein complexes (snoRNPs). The interactive service, which is not available elsewhere, enables a user to visualize the positions of pseudouridines, 2′-O-methylations, and base methylations in three-dimensional space in the ribosome and also in linear and secondary structure formats of ribosomal RNA. Our tools provide additio...

  17. Mechanism of fusidic acid inhibition of RRF- and EF-G-dependent splitting of the bacterial post-termination ribosome.

    Borg, Anneli; Pavlov, Michael; Ehrenberg, Måns

    2016-04-20

    The antibiotic drug fusidic acid (FA) is commonly used in the clinic against gram-positive bacterial infections. FA targets ribosome-bound elongation factor G (EF-G), a translational GTPase that accelerates both messenger RNA (mRNA) translocation and ribosome recycling. How FA inhibits translocation was recently clarified, but FA inhibition of ribosome recycling by EF-G and ribosome recycling factor (RRF) has remained obscure. Here we use fast kinetics techniques to estimate mean times of ribosome splitting and the stoichiometry of GTP hydrolysis by EF-G at varying concentrations of FA, EF-G and RRF. These mean times together with previous data on uninhibited ribosome recycling were used to clarify the mechanism of FA inhibition of ribosome splitting. The biochemical data on FA inhibition of translocation and recycling were used to model the growth inhibitory effect of FA on bacterial populations. We conclude that FA inhibition of translocation provides the dominant cause of bacterial growth reduction, but that FA inhibition of ribosome recycling may contribute significantly to FA-induced expression of short regulatory open reading frames, like those involved in FA resistance. PMID:27001509

  18. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka;

    2012-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several...

  19. Understanding Biases in Ribosome Profiling Experiments Reveals Signatures of Translation Dynamics in Yeast.

    Jeffrey A Hussmann

    2015-12-01

    Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.

  20. YsxC, an essential protein in Staphylococcus aureus crucial for ribosome assembly/stability

    García-Lara Jorge

    2009-12-01

    Full Text Available Abstract Background Bacterial growth and division requires a core set of essential proteins, several of which are still of unknown function. They are also attractive targets for the development of new antibiotics. YsxC is a member of a family of GTPases highly conserved across eubacteria with a possible ribosome associated function. Results Here, we demonstrate by the creation of a conditional lethal mutant that ysxC is apparently essential for growth in S. aureus. To begin to elucidate YsxC function, a translational fusion of YsxC to the CBP-ProteinA tag in the staphylococcal chromosome was made, enabling Tandem Affinity Purification (TAP of YsxC-interacting partners. These included the ribosomal proteins S2, S10 and L17, as well as the β' subunit of the RNA polymerase. YsxC was then shown to copurify with ribosomes as an accessory protein specifically localizing to the 50 S subunit. YsxC depletion led to a decrease in the presence of mature ribosomes, indicating a role in ribosome assembly and/or stability in S. aureus. Conclusions In this study we demonstrate that YsxC of S. aureus localizes to the ribosomes, is crucial for ribosomal stability and is apparently essential for the life of S. aureus.

  1. RNA nanoparticles come of age

    John J.Rossi

    2011-01-01

    @@ RNA has multiple functions in nature, including informa- tional transfer (mRNA) Ill, adaptor function (tRNAs) [2], guide functions (snRNAs, snoRNAs) [3,4]catalytic func- tion (ribozymes and the large ribosomal RNA) [5-7], and environmental sensing (riboswitehes) [8].In contrast, DNA only serves as an information storage molecule, and proteins serve as structural and enzymatic molecules.

  2. Affinity chromatography and capillary electrophoresis for analysis of the yeast ribosomal proteins

    Miriam S. Goyder

    2012-04-01

    Full Text Available We present a top down separation platform for yeast ribosomalproteins using affinity chromatography and capillary electrophoresiswhich is designed to allow deposition of proteins ontoa substrate. FLAG tagged ribosomes were affinity purified, andrRNA acid precipitation was performed on the ribosomes followedby capillary electrophoresis to separate the ribosomalproteins. Over 26 peaks were detected with excellent reproducibility(<0.5% RSD migration time. This is the first reportedseparation of eukaryotic ribosomal proteins using capillaryelectrophoresis. The two stages in this workflow, affinity chromatographyand capillary electrophoresis, share the advantagesthat they are fast, flexible and have small sample requirementsin comparison to more commonly used techniques. This methodis a remarkably quick route from cell to separation that hasthe potential to be coupled to high throughput readout platformsfor studies of the ribosomal proteome. [BMB reports2012; 45(4: 233-238

  3. Study of the Ribosomal Stress Pathway in Pluripotency, Cancer and Disease

    Morgado Palacín, Lucía

    2016-01-01

    Tesis Doctoral inédita leída en la Universidad Autónoma de Madrid, Facultad de Ciencias, Departamento de Biología Molecular La vía de estrés ribosomal se describió hace más de una década como una nueva vía activadora de p53. Dicha vía monitoriza la homeostasis de la biogénesis ribosomal. Perturbaciones en cualquiera de las etapas de la biosíntesis del ribosoma, transcripción del DNA ribosomal, procesamiento del RNA ribosomal, ensamblaje o transporte nuclear, conllevan un exceso de prote...

  4. A ribosome-inactivating protein in a Drosophila defensive symbiont.

    Hamilton, Phineas T; Peng, Fangni; Boulanger, Martin J; Perlman, Steve J

    2016-01-12

    Vertically transmitted symbionts that protect their hosts against parasites and pathogens are well known from insects, yet the underlying mechanisms of symbiont-mediated defense are largely unclear. A striking example of an ecologically important defensive symbiosis involves the woodland fly Drosophila neotestacea, which is protected by the bacterial endosymbiont Spiroplasma when parasitized by the nematode Howardula aoronymphium. The benefit of this defense strategy has led to the rapid spread of Spiroplasma throughout the range of D. neotestacea, although the molecular basis for this protection has been unresolved. Here, we show that Spiroplasma encodes a ribosome-inactivating protein (RIP) related to Shiga-like toxins from enterohemorrhagic Escherichia coli and that Howardula ribosomal RNA (rRNA) is depurinated during Spiroplasma-mediated protection of D. neotestacea. First, we show that recombinant Spiroplasma RIP catalyzes depurination of 28S rRNAs in a cell-free assay, as well as Howardula rRNA in vitro at the canonical RIP target site within the α-sarcin/ricin loop (SRL) of 28S rRNA. We then show that Howardula parasites in Spiroplasma-infected flies show a strong signal of rRNA depurination consistent with RIP-dependent modification and large decreases in the proportion of 28S rRNA intact at the α-sarcin/ricin loop. Notably, host 28S rRNA is largely unaffected, suggesting targeted specificity. Collectively, our study identifies a novel RIP in an insect defensive symbiont and suggests an underlying RIP-dependent mechanism in Spiroplasma-mediated defense. PMID:26712000

  5. The kissing-loop T-shaped structure translational enhancer of Pea enation mosaic virus can bind simultaneously to ribosomes and a 5' proximal hairpin.

    Gao, Feng; Gulay, Suna P; Kasprzak, Wojciech; Dinman, Jonathan D; Shapiro, Bruce A; Simon, Anne E

    2013-11-01

    The Pea enation mosaic virus (PEMV) 3' translational enhancer, known as the kissing-loop T-shaped structure (kl-TSS), binds to 40S subunits, 60S subunits, and 80S ribosomes, whereas the Turnip crinkle virus (TCV) TSS binds only to 60S subunits and 80S ribosomes. Using electrophoretic mobility gel shift assay (EMSA)-based competition assays, the kl-TSS was found to occupy a different site in the ribosome than the P-site-binding TCV TSS, suggesting that these two TSS employ different mechanisms for enhancing translation. The kl-TSS also engages in a stable, long-distance RNA-RNA kissing-loop interaction with a 12-bp 5'-coding-region hairpin that does not alter the structure of the kl-TSS as revealed by molecular dynamics simulations. Addition of the kl-TSS in trans to a luciferase reporter construct containing either wild-type or mutant 5' and 3' PEMV sequences suppressed translation, suggesting that the kl-TSS is required in cis to function, and both ribosome-binding and RNA interaction activities of the kl-TSS contributed to translational inhibition. Addition of the kl-TSS was more detrimental for translation than an adjacent eIF4E-binding 3' translational enhancer known as the PTE, suggesting that the PTE may support the ribosome-binding function of the kl-TSS. Results of in-line RNA structure probing, ribosome filter binding, and high-throughput selective 2'-hydroxyl acylation analyzed by primer extension (hSHAPE) of rRNAs within bound ribosomes suggest that kl-TSS binding to ribosomes and binding to the 5' hairpin are compatible activities. These results suggest a model whereby posttermination ribosomes/ribosomal subunits bind to the kl-TSS and are delivered to the 5' end of the genome via the associated RNA-RNA interaction, which enhances the rate of translation reinitiation. PMID:23986599

  6. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1997-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  7. Molecular characterization of 18S rDNA partial sequence in Microcosmus (Stolidobranchiata, Pyuridae

    D. FULGIONE

    2012-12-01

    Full Text Available We present a 18S rDNA based molecular phylogeny of two species of the genus Microcosmus (M. sulcatus and M. claudicans sampled in the Mediterranean, to investigate their phylogenetic position relative to species of the order Stolidobranchiata. The analysis is based on partial sequences (739 bp of the 18S rDNA. Among the 18 variable sites found between the two species, 4 correspond to transitions (ts, 14 to transversions (tv and 4 to deletions/insertions. In the considered Stolidobranchiata, we found 4.3% overall mean number of nucleotide differences and 0.06 (S.E. ±0.01 Kimura 2-parameter distance. The mean number of nucleotide differences between Microcosmus spp. and other Stolidobranchiata species was of 6% and 0.08 (S.E. ±0.01 Kimura 2-parameter distance. A molecular phylogeny obtained by Maximum Parsimony corroborates results of the traditional taxonomy.

  8. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

    Xie, Ping

    2014-12-01

    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  9. Aligned 18S for Zoraptera (Insecta) : Phylogenetic position and molecular evolution

    Yoshizawa, Kazunori; Johnson, Kevin P.

    2005-01-01

    The order Zoraptera (angel insects) is one of the least known insect groups, containing only 32 extant species. The phylogenetic position of Zoraptera is poorly understood, but it is generally thought to be closely related to either Paraneoptera (hemipteroid orders: booklice, lice, thrips, and bugs), Dictyoptera (blattoid orders: cockroaches, termites, and mantis), or Embioptera (web spinners). We inferred the phylogenetic position of Zoraptera by analyzing nuclear 18S rDNA sequences, which w...

  10. Diagnóstico de Mycoplasma genitalium por amplificación de los genes MgPa y ARN ribosomal 16S Diagnosis of Mycoplasma genitalium by MgPa and rRNA 16S gene amplification

    Carmen Fernández-Molina

    2008-10-01

    Full Text Available OBJETIVO: El microorganismo Mycoplasma genitalium se ha relacionado con la uretritis no gonocócica (UNG. La técnica de PCR se ha convertido en el principal método de detección de este patógeno. En consecuencia, debe aplicarse un método de diagnóstico mediante la amplificación de fragmentos de ADN por la técnica PCR. MATERIAL Y MÉTODOS: Se seleccionaron los cebadores MGF-MGR y MgPaF-MgPaR, complementarios de los genes de ARNr 16S y MgPa de M. genitalium, respectivamente. Se efectuaron ensayos de especificidad y sensibilidad y se estudiaron muestras clínicas. RESULTADOS: La PCR con cada grupo de cebadores utilizado fue específica sólo para M. genitalium y la sensibilidad fue mayor con el grupo de cebadores MGF-MGR. En el estudio de 34 muestras clínicas, 18.5% fue positivo a M. genitalium y se encontró un mayor número de muestras positivas al utilizar los cebadores MgPaF-MgPaR. CONCLUSIONES: Debe aplicarse en la práctica clínica el diagnóstico de M. genitalium mediante la amplificación del ADN por PCR en los pacientes con UNG.OBJECTIVE: Mycoplasma genitalium has been associated with nongonococcal urethritis (NGU. Diagnosis by PCR has become the primary detection method for this organism. Thus, diagnosis by DNA amplification using the PCR technique should be utilized. MATERIAL AND METHODS: GMF/GMR and MgpF/MgpR primer pairs, complementary to the M. genitalium 16S rRNA and MgPa genes, respectively, were selected. Specificity and sensibility assays were conducted and clinical samples were studied. RESULTS: The PCR with each primer pair was specific only for M. genitalium, and the sensibility was higher with the GMF/GMR primers. In the study of 34 clinical samples, 18,5% were positive for M. genitalium, with more positive samples when the MgpF/MgpR primers were used. CONCLUSIONS: DNA amplification by PCR should be applied in clinical practice to the diagnosis of M. genitalium in patients with NGU should using.

  11. TruSeq Stranded mRNA and Total RNA Sample Preparation Kits

    Total RNA-Seq enabled by ribosomal RNA (rRNA) reduction is compatible with formalin-fixed paraffin embedded (FFPE) samples, which contain potentially critical biological information. The family of TruSeq Stranded Total RNA sample preparation kits provides a unique combination of unmatched data quality for both mRNA and whole-transcriptome analyses, robust interrogation of both standard and low-quality samples and workflows compatible with a wide range of study designs.

  12. Nucleolar Clustering of Dispersed tRNA Genes

    Thompson, Martin; Haeusler, Rebecca A.; Good, Paul D.; Engelke, David R.

    2003-01-01

    Early transfer RNA (tRNA) processing events in Saccharomyces cerevisiae are coordinated in the nucleolus, the site normally associated with ribosome biosynthesis. To test whether spatial organization of the tRNA pathway begins with nucleolar clustering of the genes, we have probed the subnuclear location of five different tRNA gene families. The results show that tRNA genes, though dispersed in the linear genome, colocalize with 5S ribosomal DNA and U14 small nucleolar RNA at the nucleolus. N...

  13. Molecular mechanisms of ribosomal protein gene coregulation.

    Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B Franklin

    2015-09-15

    The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20-50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1-TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. PMID:26385964

  14. Organization of a large gene cluster encoding ribosomal proteins in the cyanobacterium Synechococcus sp. strain PCC 6301: comparison of gene clusters among cyanobacteria, eubacteria and chloroplast genomes.

    Sugita, M; Sugishita, H; Fujishiro, T; Tsuboi, M; Sugita, C; Endo, T; Sugiura, M

    1997-08-11

    The structure of a large gene cluster containing 22 ribosomal protein (r-protein) genes of the cyanobacterium Synechococcus sp. strain PCC6301 is presented. Based on DNA and protein sequence analyses, genes encoding r-proteins L3, L4, L23, L2, S19, L22, S3, L16, L29, S17, L14, L24, L5, S8, L6, L18, S5, L15, L36, S13, S11, L17, SecY, adenylate kinase (AK) and the alpha subunit of RNA polymerase were identified. The gene order is similar to that of the E. coli S10, spc and alpha operons. Unlike the corresponding E. coli operons, the genes for r-proteins S4, S10, S14 and L30 are not present in this cluster. The organization of Synechococcus r-protein genes also resembles that of chloroplast (cp) r-protein genes of red and brown algal species. This strongly supports the endosymbiotic theory that the cp genome evolved from an ancient photosynthetic bacterium. PMID:9300823

  15. Triploblastic relationships with emphasis on the acoelomates and the position of Gnathostomulida, Cycliophora, Plathelminthes, and Chaetognatha: a combined approach of 18S rDNA sequences and morphology.

    Giribet, G; Distel, D L; Polz, M; Sterrer, W; Wheeler, W C

    2000-09-01

    Triploblastic relationships were examined in the light of molecular and morphological evidence. Representatives for all triploblastic "phyla" (except Loricifera) were represented by both sources of phylogenetic data. The 18S ribosomal (rDNA) sequence data for 145 terminal taxa and 276 morphological characters coded for 36 supraspecific taxa were combined in a total evidence regime to determine the most consistent picture of triploblastic relationships for these data. Only triploblastic taxa are used to avoid rooting with distant outgroups, which seems to happen because of the extreme distance that separates diploblastic from triploblastic taxa according to the 18S rDNA data. Multiple phylogenetic analyses performed with variable analysis parameters yield largely inconsistent results for certain groups such as Chaetognatha, Acoela, and Nemertodermatida. A normalized incongruence length metric is used to assay the relative merit of the multiple analyses. The combined analysis having the least character incongruence yields the following scheme of relationships of four main clades: (1) Deuterostomia [((Echinodermata + Enteropneusta) (Cephalochordata (Urochordata + Vertebrata)))]; (2) Ecdysozoa [(((Priapulida + Kinorhyncha) (Nematoda + Nematomorpha)) ((Onychophora + Tardigrada) Arthropoda))]; (3) Trochozoa [((Phoronida + Brachiopoda) (Entoprocta (Nemertea (Sipuncula (Mollusca (Pogonophora (Echiura + Annelida)))))))]; and (4) Platyzoa [((Gnathostomulida (Cycliophora + Syndermata)) (Gastrotricha + Plathelminthes))]. Chaetognatha, Nemertodermatida, and Bryozoa cannot be assigned to any one of these four groups. For the first time, a data analysis recognizes a clade of acoelomates, the Platyzoa (sensu Cavalier-Smith, Biol. Rev. 73:203-266, 1998). Other relationships that corroborate some morphological analyses are the existence of a clade that groups Gnathostomulida + Syndermata (= Gnathifera), which is expanded to include the enigmatic phylum Cycliophora, as sister group

  16. The Listeria monocytogenes hibernation-promoting factor is required for the formation of 100S ribosomes, optimal fitness, and pathogenesis.

    Kline, Benjamin C; McKay, Susannah L; Tang, William W; Portnoy, Daniel A

    2015-02-01

    During exposure to certain stresses, bacteria dimerize pairs of 70S ribosomes into translationally silent 100S particles in a process called ribosome hibernation. Although the biological roles of ribosome hibernation are not completely understood, this process appears to represent a conserved and adaptive response that contributes to optimal survival during stress and post-exponential-phase growth. Hibernating ribosomes are formed by the activity of one or more highly conserved proteins; gammaproteobacteria produce two relevant proteins, ribosome modulation factor (RMF) and hibernation promoting factor (HPF), while most Gram-positive bacteria produce a single, longer HPF protein. Here, we report the formation of 100S ribosomes by an HPF homolog in Listeria monocytogenes. L. monocytogenes 100S ribosomes were observed by sucrose density gradient centrifugation of bacterial extracts during mid-logarithmic phase, peaked at the transition to stationary phase, and persisted at lower levels during post-exponential-phase growth. 100S ribosomes were undetectable in bacteria carrying an hpf::Himar1 transposon insertion, indicating that HPF is required for ribosome hibernation in L. monocytogenes. Additionally, epitope-tagged HPF cosedimented with 100S ribosomes, supporting its previously described direct role in 100S formation. We examined hpf mRNA by quantitative PCR (qPCR) and identified several conditions that upregulated its expression, including carbon starvation, heat shock, and exposure to high concentrations of salt or ethanol. Survival of HPF-deficient bacteria was impaired under certain conditions both in vitro and during animal infection, providing evidence for the biological relevance of 100S ribosome formation. PMID:25422304

  17. Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

    Douthwaite, S; Garrett, R A

    1981-01-01

    The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecule...

  18. Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites

    Quan, Selwyn; Skovgaard, Ole; McLaughlin, Robert E; Buurman, Ed T; Squires, Catherine L

    2015-01-01

    Single-copy rrn strains facilitate genetic ribosomal studies in Escherichia coli. Consecutive markerless deletion of rrn operons resulted in slower growth upon inactivation of the fourth copy, which was reversed by supplying transfer RNA genes encoded in rrn operons in trans. Removal of the sixth...... remaining scar sequences, facilitating homologous recombination events, presumably leads to elevated genomic instability...

  19. Protein Folding Activity of the Ribosome (PFAR –– A Target for Antiprion Compounds

    Debapriya Banerjee

    2014-10-01

    Full Text Available Prion diseases are fatal neurodegenerative diseases affecting mammals. Prions are misfolded amyloid aggregates of the prion protein (PrP, which form when the alpha helical, soluble form of PrP converts to an aggregation-prone, beta sheet form. Thus, prions originate as protein folding problems. The discovery of yeast prion(s and the development of a red-/white-colony based assay facilitated safe and high-throughput screening of antiprion compounds. With this assay three antiprion compounds; 6-aminophenanthridine (6AP, guanabenz acetate (GA, and imiquimod (IQ have been identified. Biochemical and genetic studies reveal that these compounds target ribosomal RNA (rRNA and inhibit specifically the protein folding activity of the ribosome (PFAR. The domain V of the 23S/25S/28S rRNA of the large ribosomal subunit constitutes the active site for PFAR. 6AP and GA inhibit PFAR by competition with the protein substrates for the common binding sites on the domain V rRNA. PFAR inhibition by these antiprion compounds opens up new possibilities for understanding prion formation, propagation and the role of the ribosome therein. In this review, we summarize and analyze the correlation between PFAR and prion processes using the antiprion compounds as tools.

  20. HCV IRES domain IIb affects the configuration of coding RNA in the 40S subunit's decoding groove

    Filbin, Megan E.; Kieft, Jeffrey S.

    2011-01-01

    Hepatitis C virus (HCV) uses a structured internal ribosome entry site (IRES) RNA to recruit the translation machinery to the viral RNA and begin protein synthesis without the ribosomal scanning process required for canonical translation initiation. Different IRES structural domains are used in this process, which begins with direct binding of the 40S ribosomal subunit to the IRES RNA and involves specific manipulation of the translational machinery. We have found that upon initial 40S subuni...

  1. Simulation and analysis of single-ribosome translation

    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

  2. Single Molecule Fluorescence Measurements of Ribosomal Translocation Dynamics

    Chen, Chunlai; Stevens, Benjamin; Kaur, Jaskarin; Cabral, Diana; Liu, Hanqing; Wang, Yuhong; Zhang, Haibo; Rosenblum, Gabriel; Smilansky, Zeev; Goldman, Yale E.; Cooperman, Barry S.

    2011-01-01

    We employ single-molecule fluorescence resonance energy transfer (smFRET) to study structural dynamics over the first two elongation cycles of protein synthesis, using ribosomes containing either Cy3-labeled ribosomal protein L11 and A- or P-site Cy5-labeled tRNA or Cy3 and Cy5 labeled tRNAs. Pre-translocation (PRE) complexes demonstrate fluctuations between classical and hybrid forms, with concerted motions of tRNAs away from L11 and from each other when classical complex converts to hybrid complex. EF-G·GTP binding to both hybrid and classical PRE complexes halts these fluctuations prior to catalyzing translocation to form the post-translocation (POST) complex. EF-G dependent translocation from the classical PRE complex proceeds via transient formation of a short-lived hybrid intermediate. A-site binding of either EF-G to the PRE complex or of aminoacyl-tRNA·EF-Tu ternary complex to the POST complex markedly suppresses ribosome conformational lability. PMID:21549313

  3. Single-molecule fluorescence measurements of ribosomal translocation dynamics.

    Chen, Chunlai; Stevens, Benjamin; Kaur, Jaskarin; Cabral, Diana; Liu, Hanqing; Wang, Yuhong; Zhang, Haibo; Rosenblum, Gabriel; Smilansky, Zeev; Goldman, Yale E; Cooperman, Barry S

    2011-05-01

    We employ single-molecule fluorescence resonance energy transfer (smFRET) to study structural dynamics over the first two elongation cycles of protein synthesis, using ribosomes containing either Cy3-labeled ribosomal protein L11 and A- or P-site Cy5-labeled tRNA or Cy3- and Cy5-labeled tRNAs. Pretranslocation (PRE) complexes demonstrate fluctuations between classical and hybrid forms, with concerted motions of tRNAs away from L11 and from each other when classical complex converts to hybrid complex. EF-G⋅GTP binding to both hybrid and classical PRE complexes halts these fluctuations prior to catalyzing translocation to form the posttranslocation (POST) complex. EF-G dependent translocation from the classical PRE complex proceeds via transient formation of a short-lived hybrid intermediate. A-site binding of either EF-G to the PRE complex or of aminoacyl-tRNA⋅EF-Tu ternary complex to the POST complex markedly suppresses ribosome conformational lability. PMID:21549313

  4. Detecting actively translated open reading frames in ribosome profiling data.

    Calviello, Lorenzo; Mukherjee, Neelanjan; Wyler, Emanuel; Zauber, Henrik; Hirsekorn, Antje; Selbach, Matthias; Landthaler, Markus; Obermayer, Benedikt; Ohler, Uwe

    2016-02-01

    RNA-sequencing protocols can quantify gene expression regulation from transcription to protein synthesis. Ribosome profiling (Ribo-seq) maps the positions of translating ribosomes over the entire transcriptome. We have developed RiboTaper (available at https://ohlerlab.mdc-berlin.de/software/), a rigorous statistical approach that identifies translated regions on the basis of the characteristic three-nucleotide periodicity of Ribo-seq data. We used RiboTaper with deep Ribo-seq data from HEK293 cells to derive an extensive map of translation that covered open reading frame (ORF) annotations for more than 11,000 protein-coding genes. We also found distinct ribosomal signatures for several hundred upstream ORFs and ORFs in annotated noncoding genes (ncORFs). Mass spectrometry data confirmed that RiboTaper achieved excellent coverage of the cellular proteome. Although dozens of novel peptide products were validated in this manner, few of the currently annotated long noncoding RNAs appeared to encode stable polypeptides. RiboTaper is a powerful method for comprehensive de novo identification of actively used ORFs from Ribo-seq data. PMID:26657557

  5. Visualization of the eEF2-80S ribosome transition-state complex by cryo-electron microscopy

    Nilsson, Jakob; Sengupta, Jayati; Gursky, Richard; Kjeldgaard, Morten; Nissen, Poul; Frank, Joachim

    2008-01-01

    small subunit binding display a large degree of flexibility. Furthermore, we find support for a transition-state model conformation of the switch I region in this complex where the reoriented switch I region interacts with a conserved rRNA region of the 40S subunit formed by loops of the 18S RNA helices...

  6. 云南保山和普洱地区带绦虫线粒体DNA基因编码核糖体RNA小亚基基因序列分析%Analysis of the mitochondrial DNA-gene encoding ribosomal RNA small subunit gene sequence of Taenia cestode from Baoshan and Puer areas in Yunnan Province

    刘爱波; 杨毅梅

    2011-01-01

    Objective To identify Taenia cestodes specimens collected from Baoshan and Puer regions of Yunnan Province by analyzing mitochondrial DNA gene encoding ribosomal RNA small subunit (mtDNA-12S rRNA) gene sequence. Methods The adult Taenia cestode samples were collected from Baoshan and Puer regions of Yunnan Province. The genomic DNA was extracted and mtDNA-12S rRAN gene was amplified by polymerase chain reaction (PCR), then sequenced.Combined with the known mtDNA-12S rRNA gene sequence of Taenia solium, Taenia saginata,Taenia asiatica in GenBank, homology tree and phylogenetic tree were constructed by DNA MAN software. Results Taenia cestode homology tree and phylogenetic tree showed that gene sequences of BS1, BS2, BS4 and BS5 were most close to YZ with identity of 99% and those of BS3, BS6, BST,PE1 and PE2 were most close to ND with identity of 99%. Conclusions Taenia saginata and Taenia asiatica can be found in Baoshan area, while Taenia saginata can be found in Puer area. The gene sequence of mtDNA-12S rRNA can be used for clarifying the three types of Taenia cestode.%目的 利用线粒体DNA基因编码核糖体RNA小亚基(mtDNA-12S rRNA)基因序列分析对采自云南保山、普洱地区的带绦虫标本进行鉴定.方法 选取保山(7条,BS1-BS7)、普洱(2条,PE1~PE2)带绦虫成虫节片,抽提基因组DNA,PCR扩增mtDNA-12S rRNA基因序列,并测序;结合GenBank中已知的猪带绦虫(ZD)、牛带绦虫(ND)、亚洲带绦虫(YZ)mtDNA-12S rRNA基因序列,经DNA MAN软件处理后构建同源树状图与系统发育树状图.结果 带绦虫同源树与系统发育树状图显示,BS1、BS2、BS4、BS5与YZ的同源性最近(99%).BS3、BS6、BS7、PE1、PE2与ND的同源性最近(99%).结论 云南保山存在牛带绦虫与亚洲带绦虫,普洱存在牛带绦虫,mtDNA-12S rRNA基因序列可用于三种带绦虫的分类研究.

  7. Estimation of divergence times in litostomatean ciliates (Ciliophora: Intramacronucleata), using Bayesian relaxed clock and 18S rRNA gene.

    Vďačný, Peter

    2015-08-01

    The class Litostomatea comprises a diverse assemblage of free-living and endosymbiotic ciliates. To understand diversification dynamic of litostomateans, divergence times of their main groups were estimated with the Bayesian molecular dating, a technique allowing relaxation of molecular clock and incorporation of flexible calibration points. The class Litostomatea very likely emerged during the Cryogenian around 680 Mya. The origin of the subclass Rhynchostomatia is dated to about 415 Mya, while that of the subclass Haptoria to about 654 Mya. The order Pleurostomatida, emerging about 556 Mya, was recognized as the oldest group within the subclass Haptoria. The order Spathidiida appeared in the Paleozoic about 442 Mya. The three remaining haptorian orders evolved in the Paleozoic/Mesozoic periods: Didiniida about 419 Mya, Lacrymariida about 269 Mya, and Haptorida about 194 Mya. The subclass Trichostomatia originated from a spathidiid ancestor in the Mesozoic about 260 Mya. A further goal of this study was to investigate the impact of various settings on posterior divergence time estimates. The root placement and tree topology as well as the priors of the rate-drift model, birth-death process and nucleotide substitution rate, had no significant effect on calculation of posterior divergence time estimates. However, removal of calibration points could significantly change time estimates at some nodes. PMID:26204556

  8. A new low resolution model for the 50S subunit of Escherichia coli ribosomes

    Neutron low angle scattering studies of the 50S subunit of Escherichia coli ribosomes using the contrast variation method reveals large fluctuations in the scattering density. A region of relatively low scattering density, rich in proteins, surrounds an RNA-rich core of higher scattering density. The centres of mass of the RNA and protein parts of the 50S subunit are separated by a distance that is considerably smaller than that reported in previous studies. (orig.)

  9. Cytoplasmic long noncoding RNAs are frequently bound to and degraded at ribosomes in human cells.

    Carlevaro-Fita, Joana; Rahim, Anisa; Guigó, Roderic; Vardy, Leah A; Johnson, Rory

    2016-06-01

    Recent footprinting studies have made the surprising observation that long noncoding RNAs (lncRNAs) physically interact with ribosomes. However, these findings remain controversial, and the overall proportion of cytoplasmic lncRNAs involved is unknown. Here we make a global, absolute estimate of the cytoplasmic and ribosome-associated population of stringently filtered lncRNAs in a human cell line using polysome profiling coupled to spike-in normalized microarray analysis. Fifty-four percent of expressed lncRNAs are detected in the cytoplasm. The majority of these (70%) have >50% of their cytoplasmic copies associated with polysomal fractions. These interactions are lost upon disruption of ribosomes by puromycin. Polysomal lncRNAs are distinguished by a number of 5' mRNA-like features, including capping and 5'UTR length. On the other hand, nonpolysomal "free cytoplasmic" lncRNAs have more conserved promoters and a wider range of expression across cell types. Exons of polysomal lncRNAs are depleted of endogenous retroviral insertions, suggesting a role for repetitive elements in lncRNA localization. Finally, we show that blocking of ribosomal elongation results in stabilization of many associated lncRNAs. Together these findings suggest that the ribosome is the default destination for the majority of cytoplasmic long noncoding RNAs and may play a role in their degradation. PMID:27090285

  10. Structural characterization of ribosome recruitment and translocation by type IV IRES.

    Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S

    2016-01-01

    Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts tvhe otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation. PMID:27159451

  11. Cytoplasmic long noncoding RNAs are frequently bound to and degraded at ribosomes in human cells

    Carlevaro-Fita, Joana; Rahim, Anisa; Guigó, Roderic; Vardy, Leah A.; Johnson, Rory

    2016-01-01

    Recent footprinting studies have made the surprising observation that long noncoding RNAs (lncRNAs) physically interact with ribosomes. However, these findings remain controversial, and the overall proportion of cytoplasmic lncRNAs involved is unknown. Here we make a global, absolute estimate of the cytoplasmic and ribosome-associated population of stringently filtered lncRNAs in a human cell line using polysome profiling coupled to spike-in normalized microarray analysis. Fifty-four percent of expressed lncRNAs are detected in the cytoplasm. The majority of these (70%) have >50% of their cytoplasmic copies associated with polysomal fractions. These interactions are lost upon disruption of ribosomes by puromycin. Polysomal lncRNAs are distinguished by a number of 5′ mRNA-like features, including capping and 5′UTR length. On the other hand, nonpolysomal “free cytoplasmic” lncRNAs have more conserved promoters and a wider range of expression across cell types. Exons of polysomal lncRNAs are depleted of endogenous retroviral insertions, suggesting a role for repetitive elements in lncRNA localization. Finally, we show that blocking of ribosomal elongation results in stabilization of many associated lncRNAs. Together these findings suggest that the ribosome is the default destination for the majority of cytoplasmic long noncoding RNAs and may play a role in their degradation. PMID:27090285

  12. Chaperone binding at the ribosomal exit tunnel

    Kristensen, Ole; Gajhede, Michael

    2003-01-01

    The exit tunnel region of the ribosome is well established as a focal point for interaction between the components that guide the fate of nascent polypeptides. One of these, the chaperone trigger factor (TF), associates with the 50S ribosomal subunit through its N-terminal domain. Targeting of TF...

  13. Biochemical characterization of three mycobacterial ribosomal fractions.

    Portelance, V; Beaudet, R

    1983-02-01

    The induction of antituberculous immunity by crude ribosomal fractions isolated from Mycobacterium tuberculosis strain H37Ra, M. bovis strain BCG, and M. smegmatis was studied in CF-1 mice. Levels of antituberculous immunity similar to that induced by live BCG were induced by the BCG and H37Ra ribosomal fractions whereas that isolated from M. smegmatis was found to be inactive. Electrophoresis of the three ribosomal fractions in sodium dodecyl sulfate - polyacylamide gels followed by differential staining showed the two active ribosomal fractions to be similar in their proteins, carbohydrate-containing substances, and lipid profiles. The inactive smegmatis ribosomal fraction differed mainly from the active ones on the basis of its carbohydrate-containing substances profile and by the absence of lipids. The polysaccharides and the ribosomes present in the H37Ra ribosomal fractions were purified by affinity chromatography on concanavalin A - Sepharose 4B. Each purified preparation showed no or only low antituberculous activity when injected separately, but when mixed together a high protection was observed. The formation of complexes between the ribosomes and the polysaccharide fraction was suggested and appears to be necessary for the induction of antituberculous immunity. PMID:6189570

  14. Surface topography of the Bacillus stearothermophilus ribosome

    The surface topography of the intact 70S ribosome and free 30S and 50S subunits from Bacillus stearothermophilus strain 2,184 was investigated by lactoperoxidase-catalyzed iodination. Two-dimensional polyacrylamide gel electrophoresis was employed to separate ribosomal proteins for analysis of their reactivity. Free 50S subunits incorporated about 18% more 125I than did 50S subunits derived from 70S ribosomes, whereas free 30S subunits and 30S subunits derived from 70S ribosomes incorporated similar amounts of 125I. Iodinated 70S ribosomes and subunits retained 62-78% of the protein synthesis activity of untreated particles and sedimentation profiles showed no gross conformational changes due to iodination. The proteins most reactive to enzymatic iodination were S4, S7, S10 and Sa of the small subunit and L2, L4, L5/9, L6 and L36 of the large subunit. Proteins S2, S3, S7, S13, Sa, L5/9, L10, L11 and L24/25 were labeled substantially more in the free subunits than in the 70S ribosome. Other proteins, including S5, S9, S12, S15/16, S18 and L36 were more extensively iodinated in the 70S ribosome than in the free subunits. The locations of tyrosine residues in some homologus ribosomal proteins from B. stearothermophilus and E. coli are compared. (orig.)

  15. Canonical Initiation Factor Requirements of the Myc Family of Internal Ribosome Entry Segments▿ †

    Spriggs, Keith A.; Cobbold, Laura C.; Jopling, Catherine L.; Cooper, Rebecca E.; Wilson, Lindsay A.; Stoneley, Mark; Coldwell, Mark J.; Poncet, Didier; Shen, Ya-Ching; Morley, Simon J.; Bushell, Martin; Willis, Anne E.

    2009-01-01

    Initiation of protein synthesis in eukaryotes requires recruitment of the ribosome to the mRNA and its translocation to the start codon. There are at least two distinct mechanisms by which this process can be achieved; the ribosome can be recruited either to the cap structure at the 5′ end of the message or to an internal ribosome entry segment (IRES), a complex RNA structural element located in the 5′ untranslated region (5′-UTR) of the mRNA. However, it is not well understood how cellular IRESs function to recruit the ribosome or how the 40S ribosomal subunits translocate from the initial recruitment site on the mRNA to the AUG initiation codon. We have investigated the canonical factors that are required by the IRESs found in the 5′-UTRs of c-, L-, and N-myc, using specific inhibitors and a tissue culture-based assay system, and have shown that they differ considerably in their requirements. The L-myc IRES requires the eIF4F complex and the association of PABP and eIF3 with eIF4G for activity. The minimum requirements of the N- and c-myc IRESs are the C-terminal domain of eIF4G to which eIF4A is bound and eIF3, although interestingly this protein does not appear to be recruited to the IRES RNA via eIF4G. Finally, our data show that all three IRESs require a ternary complex, although in contrast to c- and L-myc IRESs, the N-myc IRES has a lesser requirement for a ternary complex. PMID:19124605

  16. Magic wavelengths for the $5s-18s$ transition in rubidium

    Goldschmidt, E A; Koller, S B; Wyllie, R; Brown, R C; Porto, J V; Safronova, U I; Safronova, M S

    2015-01-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the $5s-18s$ transition of rubidium, and compare the calculation to experiment by measuring the light shift for atoms held in an optical dipole trap at a range of wavelengths near a calculated magic value.

  17. EmtA, a rRNA methyltransferase conferring high-level evernimicin resistance

    Mann, P. A.; Xiong, L.; Mankin, A. S.; Chau, A. S.; Najarian, D. J.; Mendrick, C. A.; Cramer, C. A.; Aarestrup, Frank Møller; Hare, R. S.; Black, T. A.; McNicholas, P. M.

    2001-01-01

    unique to the 23S rRNA extracted from resistant ribosomes. The pause corresponded to methylation of residue G2470 (Escherichia coli numbering). RNA footprinting revealed that G2470 is located within the evernimicin-binding site on the ribosome, thus providing an explanation for the reduced binding of the...

  18. Movement of the 3'-end of tRNA through the peptidyl transferase centre and its inhibition by antibiotics

    Kirillov, Stanislav; Porse, Bo Torben; Vester, Birthe;

    1997-01-01

    Determining how antibiotics inhibit ribosomal activity requires a detailed understanding of the interactions and relative movement of tRNA, mRNA and the ribosome. Recent models for the formation of hybrid tRNA binding sites during the elongation cycle have provided a basis for re-evaluating earlier...... experimental data and, especially, those relevant to substrate movements through the peptidyl transferase centre. With the exception of deacylated tRNA, which binds at the E-site, ribosomal interactions of the 3'-ends of the tRNA substrates generate only a small part of the total free energy of tRNA......-ribosome binding. Nevertheless, these relatively weak interactions determine the unidirectional movement of tRNAs through the ribosome and, moreover, they appear to be particularly susceptible to perturbation by antibiotics. Here we summarise current ideas relating particularly to the movement of the 3'-ends of tRNA...

  19. Changes produced by bound tryptophan in the ribosome peptidyl transferase center in response to TnaC, a nascent leader peptide.

    Cruz-Vera, Luis Rogelio; Gong, Ming; Yanofsky, Charles

    2006-03-01

    Studies in vitro have established that free tryptophan induces tna operon expression by binding to the ribosome that has just completed synthesis of TnaC-tRNA(Pro), the peptidyl-tRNA precursor of the leader peptide of this operon. Tryptophan acts by inhibiting Release Factor 2-mediated cleavage of this peptidyl-tRNA at the tnaC stop codon. Here we analyze the ribosomal location of free tryptophan, the changes it produces in the ribosome, and the role of the nascent TnaC-tRNA(Pro) peptide in facilitating tryptophan binding and induction. The positional changes of 23S rRNA nucleotides that occur during induction were detected by using methylation protection and binding/competition assays. The ribosome-TnaC-tRNA(Pro) complexes analyzed were formed in vitro; they contained either wild-type TnaC-tRNA(Pro) or its nonfunctional substitute, TnaC(W12R)-tRNA(Pro). Upon comparing these two peptidyl-tRNA-ribosome complexes, free tryptophan was found to block methylation of nucleotide A2572 of wild-type ribosome-TnaC-tRNA(Pro) complexes but not of ribosome-TnaC(W12R)-tRNA(Pro) complexes. Nucleotide A2572 is in the ribosomal peptidyl transferase center. Tryptophanol, a noninducing competitor of tryptophan, was ineffective in blocking A2572 methylation; however, it did reverse the protective effect of tryptophan. Free tryptophan inhibited puromycin cleavage of TnaC-tRNA(Pro); it also inhibited binding of the antibiotic sparsomycin. These effects were not observed with TnaC(W12R)-tRNA(Pro) mutant complexes. These findings establish that Trp-12 of TnaC-tRNA(Pro) is required for introducing specific changes in the peptidyl transferase center of the ribosome that activate free tryptophan binding, resulting in peptidyl transferase inhibition. Free tryptophan appears to act at or near the binding sites of several antibiotics in the peptidyl transferase center. PMID:16505360

  20. Nanometer scale pores similar in size to the entrance of the ribosomal exit cavity are a common feature of large RNAs

    Rivas, Mario; Tran, Quyen; Fox, George E.

    2013-01-01

    The highly conserved peptidyl transferase center (PTC) of the ribosome contains an RNA pore that serves as the entrance to the exit tunnel. Analysis of available ribosome crystal structures has revealed the presence of multiple additional well-defined pores of comparable size in the ribosomal (rRNA) RNAs. These typically have dimensions of 1–2 nm, with a total area of ∼100 Å2 or more, and most are associated with one or more ribosomal proteins. The PTC example and the other rRNA pores result from the packing of helices. However, in the non-PTC cases the nitrogenous bases do not protrude into the pore, thereby limiting the potential for hydrogen bonding within the pore. Instead, it is the RNA backbone that largely defines the pore likely resulting in a negatively charged environment. In many but not all cases, ribosomal proteins are associated with the pores to a greater or lesser extent. With the exception of the PTC case, the large subunit pores are not found in what are thought to be the evolutionarily oldest regions of the 23S rRNA. The unusual nature of the PTC pore may reflect a history of being created by hybridization between two or more RNAs early in evolution rather than simple folding of a single RNA. An initial survey of nonribosomal RNA crystal structures revealed additional pores, thereby showing that they are likely a general feature of RNA tertiary structure. PMID:23940386