WorldWideScience

Sample records for 16s-23s rrna intergenic

  1. Use of 16S-23S rRNA Intergenic Spacer Region PCR and Repetitive Extragenic Palindromic PCR Analyses of Escherichia coli Isolates To Identify Nonpoint Fecal Sources

    Seurinck, Sylvie; Verstraete, Willy; Siciliano, Steven D.

    2003-01-01

    Despite efforts to minimize fecal input into waterways, this kind of pollution continues to be a problem due to an inability to reliably identify nonpoint sources. Our objective was to find candidate source-specific Escherichia coli fingerprints as potential genotypic markers for raw sewage, horses, dogs, gulls, and cows. We evaluated 16S-23S rRNA intergenic spacer region (ISR)-PCR and repetitive extragenic palindromic (rep)-PCR analyses of E. coli isolates as tools to identify nonpoint fecal...

  2. Identification and phyletic evolution analysis of Proteus mirabilis strains by PCR and restriction fragment length polymorphism of 16S-23S rRNA gene intergenic spacer region%16S-23S rRNA基因间隔序列PCR及RFLP对奇异变形杆菌分离株的鉴别与系统发育分析

    崔国林; 朱瑞良; 左雪梅; 钟世勋; 杨世发; 梁漫飞; 孙婧; 刘静静

    2013-01-01

    根据临床常见致病菌16S-23S rRNA基因间隔序列(ISR)两端的16S及23S rRNA保守序列设计PCR扩增的通用引物,对9株奇异变形杆菌和6株相近菌株应用通用引物PCR扩增16S-23S rRNA ISR序列.通过PCR长度多态性比较、RFLP分析以及部分序列测序比较,分析鉴别奇异变形杆菌.结果显示,PCR长度多态性可以将奇异变形杆菌同其余菌种进行区分;RFLP分析可以将所有试验菌种进行区分;部分序列测序可以对奇异变形杆菌进行分型.由此表明,16S 23S rRNA ISR序列PCR及RFLP分析可以简单、快速、准确的鉴定奇异变形杆菌.%To establish a new method to identify Proteus mirabilis strains, according to the conserved sequences of 16S and 23S which located on both ends of the clinical common pathogenic bacteria 16S-23S rRNA gene intergenic spacer region (ISR),a pair of universal primers was designed. Nine Proteus mirabilis strains and six similar bacteria strains were amplified by PCR and identified by the PCR length polymorphism comparison,restriction fragment length polymorphism (RFLP) analysis and partial sequences sequencing. The result showed that Proteus mirabilis strains could be discriminated from other similar bacteria strains by PCR length polymorphism comparison,all of test organism could be discriminated by RFLP and Proteus mirabilis strains could be typed by partial sequences sequencing. The result indicated that the identification method based on the 16S-23S rRNA ISR, using PCR and PCR-RFLP,is very suitable for the rapid low-cost identification and discrimination of Proteus mirabilis strains from other phylogenetically related bacteria strains.

  3. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  4. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O139 outbreak based on the intergenomic heterogeneity of the 16S-23S rRNA intergenic spacer regions

    Atreyi Ghatak; Anasuya Majumdar; Ranajit K Ghosh

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O139 outbreak. ISR classes ‘a’ and ‘g’ were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O139 serogroup and post-O139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  5. Comparison of multiple genes and 16S-23S rRNA intergenic space region for their capacity in high resolution melt curve analysis to differentiate Mycoplasma gallisepticum vaccine strain ts-11 from field strains.

    Ghorashi, Seyed A; Bradbury, Janet M; Ferguson-Noel, Naola M; Noormohammadi, Amir H

    2013-12-27

    Mycoplasma gallisepticum (MG) is an important avian pathogen causing significant economic losses in the global poultry industry. In an attempt to compare and evaluate existing genotyping methods for differentiation of MG strains/isolates, high resolution melt (HRM) curve analysis was applied to 5 different PCR methods targeting vlhA, pvpA, gapA, mgc2 genes and 16S-23S rRNA intergenic space region (IGSR). To assess the discriminatory power of PCR-HRM of examined genes and IGSR, MG strains ts-11, F, 6/85 and S6, and, initially, 8 field isolates were tested. All MG strains/isolates were differentiated using PCR-HRM curve analysis and genotype confidence percentage (GCP) values of vlhA and pvpA genes, while only 0, 3 and 4 out of 12 MG strains/isolates were differentiated using gapA, mgc2 genes and IGSR, respectively. The HRM curve analysis of vlhA and pvpA genes was found to be highly correlated with the genetic diversity of the targeted genes confirmed by sequence analysis of amplicons generated from MG strains. The potential of the vlhA and pvpA genes was also demonstrated for genotyping of 12 additional MG strains from Europe and the USA. Results from this study provide a direct comparison between genes previously used in sequencing-based genotyping methods for MG strain identification and highlight the usefulness of vlhA and pvpA HRM curve analyses as rapid and reliable tools specially for diagnosis and differentiation of MG strains used here. PMID:24238667

  6. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. PMID:22510214

  7. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repeti...

  8. Rapid Identification and Differentiation of the Soft Rot Erwinias by 16S-23S Intergenic Transcribed Spacer-PCR and Restriction Fragment Length Polymorphism Analyses

    Toth, I. K.; Avrova, A. O.; Hyman, L. J.

    2001-01-01

    Current identification methods for the soft rot erwinias are both imprecise and time-consuming. We have used the 16S-23S rRNA intergenic transcribed spacer (ITS) to aid in their identification. Analysis by ITS-PCR and ITS-restriction fragment length polymorphism was found to be a simple, precise, and rapid method compared to current molecular and phenotypic techniques. The ITS was amplified from Erwinia and other genera using universal PCR primers. After PCR, the banding patterns generated al...

  9. Identification of Clinically Relevant Nonhemolytic Streptococci on the Basis of Sequence Analysis of 16S-23S Intergenic Spacer Region and Partial gdh Gene▿

    Nielsen, Xiaohui Chen; Justesen, Ulrik Stenz; Dargis, Rimtas; Kemp, Michael; Christensen, Jens Jørgen

    2009-01-01

    Nonhemolytic streptococci (NHS) cause serious infections, such as endocarditis and septicemia. Many conventional phenotypic methods are insufficient for the identification of bacteria in this group to the species level. Genetic analysis has revealed that single-gene analysis is insufficient for the identification of all species in this group of bacteria. The aim of the present study was to establish a method based on sequence analysis of the 16S-23S intergenic spacer (ITS) region and the part...

  10. Length polymorphisms for intergenic spacer regions of 16S-23S rDNA in members of the new hydrogen-producing bacteria

    2007-01-01

    A method based on PCR amplification of the 16S rRNA gene (rDNA) -23S rDNA intergenic spacer regions (ISR) was developed for the identification of species within the novel group hydrogen-producing anaerobes. The sizes of the PCR products varied from 1264 to 398 bp. Strain of isolate Rennanqilyf 3 was characterized as having products of 1262, 398, 638, 437 and 436 bp. The isolate Rennanqilyf 1 had product of 1264 bp. The isolate Rennanqilyf 13 had products of 1261, 579 and 485 bp. Of the 3 species of the novel group hydrogenproducing anaerobes examined, no one was indistinguishable. Two environmental isolates were identified as hydrogen-producing bacteria, which were new species in present taxon. Rennanqilyf 3 could not be associated With any Clostridium sp. Studied. Rennanqilyf 1 could be classified into Clostridium genus. The combination between 16S rDNA equencing and length polymorphisms of IRS in 16S-23S rDNA is a better method for determining species of the hydrogen-producing bacteria.

  11. Identification to the species level of Lactobacillus isolated in probiotic prospecting studies of human, animal or food origin by 16S-23S rRNA restriction profiling

    Neumann Elisabeth; Teixeira Santuza MR; Horta Maria F; Mota Rodrigo M; Moreira João; Nicoli Jacques R.; Nunes Álvaro C

    2005-01-01

    Abstract Background The accurate identification of Lactobacillus and other co-isolated bacteria during microbial ecological studies of ecosystems such as the human or animal intestinal tracts and food products is a hard task by phenotypic methods requiring additional tests such as protein and/or lipids profiling. Results Bacteria isolated in different probiotic prospecting studies, using de Man, Rogosa and Sharpe medium (MRS), were typed at species level by PCR amplification of 16S-23S rRNA i...

  12. Designing PCR Primers from 16S-23S rDNA Intergenic Spacer Region for the Identification of Pasteurella multocida%以 16S-23S rDNA 间区序列为目的基因设计 PCR 引物鉴定多杀巴斯德氏菌

    周浩; 刘寅; 陈一军; 郑泽军; 黄熙泰

    2008-01-01

    多杀巴斯德氏菌是养殖动物(鸡,猪,牛等)的重要致病菌.本研究以16S-23S rDNA间区序列为目的基因设计PCR引物鉴定多杀巴斯德氏菌.通过对多杀巴斯德氏菌ITS-IA(含有tDNA-Ile和tDNA-Ala的16S-23S rDNA间区序列)的测序和与GenBank中序列的BLAST,设计筛选了一对特异引物PS-F/PS-R.对引物的特异性和有效性,用PCR方法进行了验证.结果表明:所有的多杀巴斯德氏菌标准菌株和分离菌株都能被检出,而全部39株非多杀巴斯德氏菌都没有扩增出特异性条带.其检测灵敏度能达到102CFU/mL.研究结果表明,发展了的PCR鉴定方法是省时的和可靠的,整个过程只需要20 h,而传统的鉴定方法需要至少5 d的时间.%Pasteurella multocida is an important pathogen that infects many kinds of animals. In present study, a polymerase chain reaction (PCR) assay using primers derived from the 16S-23S rRNA intergenic spacer (ITS) of P. multocida was developed. One pairs of specific PCR primers were designed by sequencing the ITS-IA (ITS containing tDNA-Ile and tDNA-Ala) of P. multocida and BLAST of GenBank. The specificity and efficiency of the PCR methods were tested against a panel of numerous strains from 39 different bacterial strains. All of the P. multocida strains generated positive signal, and no cross-reaction was observed with non-P, multocida strains in the PCR detection. Sensitivity of the detection is 102 CFU/mL cultures. The newly developed PCR array procedures take only 20 hours for each time, whereas the conventional methods required at least five days. This study demonstrated that the PCR detection for P. multocida is time-saved and reliable.

  13. Identification to the species level of Lactobacillus isolated in probiotic prospecting studies of human, animal or food origin by 16S-23S rRNA restriction profiling

    Neumann Elisabeth

    2005-03-01

    Full Text Available Abstract Background The accurate identification of Lactobacillus and other co-isolated bacteria during microbial ecological studies of ecosystems such as the human or animal intestinal tracts and food products is a hard task by phenotypic methods requiring additional tests such as protein and/or lipids profiling. Results Bacteria isolated in different probiotic prospecting studies, using de Man, Rogosa and Sharpe medium (MRS, were typed at species level by PCR amplification of 16S-23S rRNA intergenic spacers using universal primers that anneal within 16S and 23S genes, followed by restriction digestion analyses of PCR products. The set of enzymes chosen differentiates most species of Lactobacillus genus and also co-isolated bacteria such as Enterococcus, Streptococcus, Weissella, Staphylococcus, and Escherichia species. The in silico predictions of restriction patterns generated by the Lactobacillus shorter spacers digested with 11 restriction enzymes with 6 bp specificities allowed us to distinguish almost all isolates at the species level but not at the subspecies one. Simultaneous theoretical digestions of the three spacers (long, medium and short with the same set of enzymes provided more complex patterns and allowed us to distinguish the species without purifying and cloning of PCR products. Conclusion Lactobacillus isolates and several other strains of bacteria co-isolated on MRS medium from gastrointestinal ecosystem and fermented food products could be identified using DNA fingerprints generated by restriction endonucleases. The methodology based on amplified ribosomal DNA restriction analysis (ARDRA is easier, faster and more accurate than the current methodologies based on fermentation profiles, used in most laboratories for the purpose of identification of these bacteria in different prospecting studies.

  14. A molecular biological study on identification of common septicemia bacteria using 16s-23s rRNA gene spacer regions

    傅君芬; 虞和永; 尚世强; 洪文澜; 陆淼泉; 李建平

    2002-01-01

    In the search for a rapid and reliable method for identification of bacteria in blood and cerebrospinal fluid , we developed a unified set of primers and used them under polymerase chain reaction(PCR) to amplify the spacer regions between the 16s and 23s genes in the prokaryotic rRNA genetic loci . Spacer regions within these loci showed a significant level of length and sequence polymorphism across most of the species lines. A generic pair of priming sequences was selected from highly conserved sequences in the 16s and 23s genes occurring adjacent to these polymorphic regions. This single set of primers and reaction conditions were used for the amplification of the 16s-23s spacer regions for 61 strains of standard bacteria and corresponding clinical isolates belonging to 20 genera and 27 species, including Listeria, Staphylococcus and Salmonella species, et al. When the spacer amplification products were resolved by electrophoresis, the resulting patterns could be used to distinguish most of the bacteria species within the test group, and the amplification products of the clinical isolates clustered at the standard species level. Some species presenting similar pattern were further analyzed by HinfI or AluI digestion or DNA clone and sequences analysis in order to establish the specific 16s-23s rRNA gene spacer regions map. Analysis of 42 blood specimens from septicemic neonates and 6 CSF specimens from suspected purulent meningitis patients by bacterial culture and PCR-RFLP(Restriction Fregament Length Polymorphism) showed that 15 specimens of blood culture were positive(35.7%) in the 42 septicemic neonates; 27 specimens were positive(64.2%) by PCR, and that the positive rate by PCR was significantly higher than that by blood culture(P<0.01). Among the 6 CSF specimens, one specimen found positive by blood culture was also positive by PCR, two found negative by blood culture showed positive by PCR; all three were S.epidermidis according to the DNA map. One C

  15. 山羊奇异变形杆菌分离鉴定及其16S-23S rRNA ISR序列RFLP分析%Isolation and Identification of Proteus mirabilis from Goat and the Analysis of Its 16S-23S rRNA ISR Sequence by RFLP

    崔国林; 钟世勋; 杨世发; 左雪梅; 朱瑞良

    2013-01-01

    2012年初,山东菏泽某羊场的羊群发病,从发病羊器官分离到2株病原细菌.对病原细菌进行鉴定,并对其与已知同种异源菌株相似性差异进行分析.从患病山羊内脏器官分离细菌,经形态特征、培养特性、生化试验、血清学试验及致病性试验进行鉴定;再通过设计通用引物扩增16S-23S rRNA ISR (intergenie spacer region)序列,将PCR产物经HinfⅠ单酶切获得3条可视条带,同时对扩增条带中的主带测序并进行系统发育分析.结果表明,分离菌株为奇异变形杆菌;分离菌株同本实验室保存的兔源与鸡源奇异变形杆菌PCR-RFLP结果一致;分离菌株PCR产物同GenBank收录的HI4320株奇异变形杆菌及本实验室保存的兔源与鸡源奇异变形杆菌进行序列比较,分离羊源菌株与兔源菌株相似性为94.8%、与鸡源菌株相似性为96.0%~98.2%,与人源HI4320株相似性为96.9%.研究证实发病羊致病病原为奇异变形杆菌,其与鸡源、兔源和人源奇异变形杆菌的亲缘关系较近.%At the beginning of 2012,a disease occurred in a goat farm in Heze City and two strains of pathogen were isolated from the infected goats.In order to identify the infected bacteria and analyze the homology between isolated strains and heterologous strains,bacteria were isolated from infected goats internal organs and were identified by morphologic characteristics,cultural characteristic,biochemistry test,serologic test and pathogenicity test; A pair of universal primers was designed to amplify 16S-23S rRNA ISR (intergenic spacer region) gene.and three visible straps were observed when PCR products were cut by Hinf Ⅰ,at the same time the main strap of PCR straps was sequenced and analyzed by phyletic evolution.The results showed that isolated strains were Proteus mirabilis ; the result of PCR-RFLP of isolated strains and Proteus mirabilis from rabbit and chicken was the same; The homology was 94.8% between

  16. Relationships between 16S-23S rRNA gene internal transcribed spacer DNA and genomic DNA similarities in the taxonomy of phototrophic bacteria

    Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.

  17. Cyanobacterial ecotypes in different optical microenvironments of a 68 C hot spring mat community revealed by 16S-23S rRNA internal transcribed spacer region variation

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea;

    2003-01-01

    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynth......We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic...... distinct populations over the vertical interval. We were unable to identify patterns in genetic variation in Synechococcus 16S rRNA sequences that correlate with different vertically distributed populations. However, patterns of variation at the internal transcribed spacer locus separating 16S and 23S r...

  18. Diversity of the marine picocyanobacteria Prochlorococcus and Synechococcus assessed by terminal restriction fragment length polymorphisms of 16S-23S rRNA internal transcribed spacer sequences Diversidad de las picocianobacterias marinas Prochlorococcus y Synechococcus por medio de polimorfismos de longitud de fragmentos de restricción terminal en secuencias del espaciador transcrito interno del ARNr 16S - 23S

    PARIS LAVIN

    2008-12-01

    Full Text Available In order to assess the appropriateness of the use of internal transcribed spacer (ITS sequences for the study of population genetics of marine cyanobacteria, we amplified and cloned the 16S rRNA gene plus the 16S-23S ITS regions of six strains of Prochlorococcus and Synechococcus. We analyzed them by denaturing gradient gel electrophoresis (DGGE and terminal restriction fragment length polymorphisms (T-RFLP. When using the standard application of these techniques, we obtained more than one band or terminal restriction fragment (T-RF per strain or cloned sequence. Reports in literature have suggested that these anomalies can result from the formation of secondary structures. Secondary structures of the ITS sequences of Prochlorococcus and Synechococcus strains were computationally modelled at the different temperatures that were used during the polymerase chain reaction (PCR. Modelling results predicted the existence of hairpin loops that would still be present at the extensión temperature; it is likely that these loops produced incomplete and single stranded PCR products. We modified the standard T-RFLP procedure by adding the labelled ITS primer in the last two cycles of the PCR reaction; this resulted, in most cases, in only one T-RF per ribotype. Application of this technique to a natural picoplankton community in marine waters off northern Chile, showed that it was possible to identify the presence, and determine the relative abundance, of several phylogenetic lineages within the genera Prochlorococcus and Synechococcus inhabiting the euphotic zone. Phylogenetic analysis of ITS sequences obtained by cloning and sequencing DNA from the same sample confirmed the presence of the different genotypes. With the proposed modification, T-RFLP profiles should therefore be suitable for studying the diversity of natural populations of cyanobacteria, and should become an important tool to study the factors influencing the genetic structure and

  19. Application of the Sequences Analysis of the 16S rRNA Gene and ITS of 16S-23S rRNA to the Systematic Study of the Genus Arthrospira and Spirulina%16S rRNA基因与16S-23S rRNA转录单元内间隔区序列分析及其在节旋藻和螺旋藻分类鉴定中的应用

    茅云翔; 杨官品; 张宝红; 张学成

    2001-01-01

    测定了节旋藻属3个品系和螺旋藻属1个品系的全长16S rRNA基因和16S-23S rRNA转录单元内间隔区序列(ITS),分析了已知的节旋藻、螺旋藻和相关品系的相应序列的同源性,构建了系统发生树,并评价了这两段DNA序列在节旋藻、螺旋藻种属分类和种质鉴定中的意义.结果表明:(1)16S rRNA基因序列和ITS序列均可用于节旋藻属和螺旋藻属的属间分类,以两序列为基础的系统学分析结果一致;(2)ITS序列变异程度高于16S rDNA序列,适用于节旋藻和螺旋藻属内品系或种质鉴定;(3)节旋藻属可明确界定,16S rRNA基因序列相似性大于98%,ITS序列相似性大于88%;(4)螺旋藻属某些品系间16S rDNA序列和ITS序列相似性较低,与不同属间的序列相似性程度为同一水平.

  20. The use of 16S and 16S-23S rDNA to easily detect and differentiate common Gram-negative orchard epiphytes.

    Jeng, R S; Svircev, A M; Myers, A L; Beliaeva, L; Hunter, D M; Hubbes, M

    2001-02-01

    The identification of Gram-negative pathogenic and non-pathogenic bacteria commonly isolated from an orchard phylloplane may result in a time consuming and tedious process for the plant pathologist. The paper provides a simple "one-step" protocol that uses the polymerase chain reaction (PCR) to amplify intergenic spacer regions between 16S and 23S genes and a portion of 16S gene in the prokaryotic rRNA genetic loci. Amplified 16S rDNA, and restriction fragment length polymorphisms (RFLP) following EcoRI digestion produced band patterns that readily distinguished between the plant pathogen Erwinia amylovora (causal agent of fire blight in pear and apple) and the orchard epiphyte Pantoea agglomerans (formerly E. herbicola). The amplified DNA patterns of 16S-23S spacer regions may be used to differentiate E. amylovora at the intraspecies level. Isolates of E. amylovora obtained from raspberries exhibited two major fragments while those obtained from apples showed three distinct amplified DNA bands. In addition, the size of the 16S-23S spacer region differs between Pseudomonas syringae and Pseudomonas fluorescens. The RFLP pattern generated by HaeIII digestion may be used to provide a rapid and accurate identification of these two common orchard epiphytes. PMID:11166101

  1. 116S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads

    Sima eTokajian

    2016-02-01

    Full Text Available Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 to 849 bp, while their G+C content was 42.2 mol% to 57.9 mol%. Five distinct ITS types were identified: ITSnone (without tRNA genes, ITSAla(TGC, ITSAla (TGC+Ile (GAT, ITSIle (GAT+Ala (TGC and ITS Ile (GAT+Pseudo. All of the identified tRNAAla (TGC molecules consisted of 73 bases, and all of the tRNAIle (GAT molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2.

  2. Identification of clinically relevant nonhemolytic Streptococci on the basis of sequence analysis of 16S-23S intergenic spacer region and partial gdh gene

    Nielsen, Xiaohui Chen; Justesen, Ulrik Stenz; Dargis, Rimtas;

    2009-01-01

    was performed with 57 NHS reference or clinical strains. Satisfactory identification to the species level was achieved for 14/19 NHS species included in this study on the basis of sequence analysis of the ITS region. Streptococcus salivarius and Streptococcus vestibularis obtained the expected taxon as the best...... taxon match, but there was a short maximum score distance to the next best match (distance, Streptococcus mitis, Streptococcus oralis, and Streptococcus pneumoniae could not be unambiguously discriminated by sequence analysis of the ITS region, as was also proven by phylogenetic analysis...

  3. Identification of Lactobacillus strains of goose origin using MALDI-TOF mass spectrometry and 16S-23S rDNA intergenic spacer PCR analysis.

    Dec, Marta; Urban-Chmiel, Renata; Gnat, Sebastian; Puchalski, Andrzej; Wernicki, Andrzej

    2014-04-01

    The objective of our study was to identify Lactobacillus sp. strains of goose origin using MALDI-TOF mass spectrometry, ITS-PCR and ITS-PCR/RFLP. All three techniques proved to be valuable tools for identification of avian lactobacilli and produced comparable classification results. Lactobacillus strains were isolated from 100% of geese aged 3 weeks to 4 years, but from only 25% of chicks aged 1-10 days. Among the 104 strains isolated, we distinguished 14 Lactobacillus species. The dominant species was Lactobacillus salivarius (35.6%), followed by Lactobacillus johnsonii (18.3%), Lactobacillus ingluviei (11.5%) and Lactobacillus agilis (7.7%). The intact-cell MALDI-TOF mass spectrometry enabled rapid species identification of the lactobacilli with minimal pretreatment. However, it produced more than one identification result for 11.5% examined strains (mainly of the species L. johnsonii). ITS-PCR distinguished 12 genotypes among the isolates, but was not able to differentiate closely related strains, i.e. between Lactobacillus amylovorus and Lactobacillus kitasatonis and between Lactobacillus paracasei, Lactobacillus rhamnosus and Lactobacillus zeae. These species were differentiated by ITS-PCR/RFLP using the restriction enzymes TaqI and MseI. The results obtained indicate that ITS-PCR and ITS-PCR/RFLP assays could be used not only for interspecific, but also for intraspecific, typing. PMID:24607713

  4. Applicability of the 16S-23S rDNA internal spacer for PCR detection of the phytostimulatory PGPR inoculant Azospirillum lipoferum CRT1 in field soil

    Baudoin, Ezékiel; Couillerot, O.; Spaepen, S.; Moenne-Loccoz, Y.; Nazaret, S.

    2010-01-01

    Aims: To assess the applicability of the 16S-23S rDNA internal spacer regions (ISR) as targets for PCR detection of Azospirillum ssp. and the phytostimulatory plant growth-promoting rhizobacteria seed inoculant Azospirillum lipoferum CRT1 in soil. Methods and Results: Primer sets were designed after sequence analysis of the ISR of A. lipoferum CRT1 and Azospirillum brasilense Sp245. The primers fAZO/rAZO targeting the Azospirillum genus successfully yielded PCR amplicons (400-550 bp) from Azo...

  5. 16s-23S rDNA: polymorphisms and their use for detection and identification of Xylella fastidiosa strains 16S-23S rDNA: polimorfismos e sua aplicação na detecção e identificação de linhagens de Xylella fastidiosa

    Juliana Camargo Martinati

    2007-03-01

    Full Text Available Strains of Xylella fastidiosa from several hosts (coffee, citrus, grape, almond, oleander, peach, plum, etc. were characterized by analyzing the content of the nucleotide sequences of 16S-23S rDNA (coding for a small subunit ribosomal RNA spacer region (ITS. Current methods for sequencing the ITS region yields partial sequences that do not contribute with significant information. According to this fact, new primers have been designed in order to obtain a complete sequence and facilitate the sequencing. The complete 16S-23S sequences from 08 strains were amplified through PCR using the primers designed in our lab. The 16S-23S sequences obtained were compared with 52 others sequences entries in GenBank database. The results revealed a higher level of variation than that found in 16S gene sequences, with similarity values ranging from 0.79-1.00. The dendogram based on similarity data revealed 5 main groups. This spacer sequence contains two genes for tRNA (tRNAala and tRNAile. The sequence analysis of the tRNA content showed a conserved region with a few differences in the nucleotide composition.Linhagens de Xylella fastidiosa de diferentes hospedeiros (café, uva, amêndoa, ameixa, etc. foram caracterizados analisando as sequências de nucleotídeos do espaço intergênico 16S-23S (ITS. Os métodos atuais para o sequenciamento da região ITS produzem fragmentos parciais das sequências que não contribuem com informações significantes. Em vista disso, novos primers foram desenhados a fim de obter uma sequência completa e facilitar o sequenciamento. A sequencia completa da região ITS de 08 linhagens de X. Fastidiosa foram amplificadas via PCR, sequenciadas e comparadas com outras 52 sequencias depositadas no GenBank. Os resultados revelaram um alto nível de variação sendo maior que os níveis encontrados quando se utiliza o gene 16S para este tipo de análise, com valores variando entre 0.79 a 1.00. O dendograma baseado em dados de

  6. Renibacterium salmoninarum isolates from different sources possess two highly conserved copies of the rRNA operon .

    Grayson, T H; Alexander, S M; Cooper, L F; Gilpin, M L

    2000-07-01

    The nucleotide sequences of the rRNA genes and the 5' flanking region were determined for R. salmoninarum ATCC 33209T from overlapping products generated by PCR amplification from the genomic DNA. Comparison of the sequences with rRNA genes from a variety of bacteria demonstrated the close relatedness between R. salmoninarum and the high G+C group of the actinobacteria, in particular, Arthrobacter species. A regulatory element within the 5' leader of the rRNA operon was identical to an element, CL2, described for mycobacteria. PCR, DNA sequence analysis, and DNA hybridisation were performed to examine variation between isolates from diverse sources which represented the four 16S-23S rRNA intergenic spacer sequevars previously described for R. salmoninarum. Two 23S-5S rRNA intergenic spacer sequevars of identical length were found. DNA hybridisation using probes complementary to 23S rDNA and 16S rDNA identified two rRNA operons which were identical or nearly identical amongst 40 isolates sourced from a variety of countries. PMID:11016696

  7. Methylation pattern of the intergenic spacer of rRNA genes in excised cotyledons of Cucurbita pepo L. (Zucchini) after hormone treatment

    High molecular mass genomic DNA was isolated from excised marrow cotyledons (Cucurbita pepo L. zucchini) treated with 6-benzyladenine (BA) of methyl ester of jasmonic acid (MeJA) for 24 h in darkness. DNA purified from contaminating polysaccharides with Celite column was completely digested with the restriction enzyme Eco RI and the changes in the methylation pattern of the intergenic spacer (IGS) of r RNA genes were studied after subsequent digestion with the couple of restriction enzymes-isoschizomers MSP I and Hpa II by the method of 'indirect end labelling'. As rDNA units probe a cloned 32P-labelled Eco RI 2.1 kb fragment spanning in the most part of 18S r RNA gene from flax rDNA was used. Results showed heavy methylation of the rRNA genes. As judged from the almost total lack of digestion with HPA II, there were no methylation free regions in repeated rDNA units or little if any were observed. A hypo methylated Hps II site was detected near the promoter region in some of the repeats. Digestion with Msp I affected nearly 50% of the repeating units. The Msp digestion fragments of the 6.2 kb Eco RI fragment of r DNA were few in number and large in size (0.5 - 2.5 kb). This suggested that in addition with -CpG- sequences, methylation in -CpNpG- might not be random. Methylation pattern in IGS was not changed upon treatment of the cotyledons in vivo with BA and MeJA. Thus, previously observed hormone-mediated effects on the eactivity of rRNA gene expression were not accompanied by any significant changes of the methylation pattern in IGS. (authors)

  8. Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿

    wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

    2008-01-01

    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative s...

  9. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    Deguo Wang

    2015-05-01

    Full Text Available Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  10. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    Deguo Wang; Yanhong Liu

    2015-01-01

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactia...

  11. Diversity and Antimicrobial Properties of Lactic Acid Bacteria Isolated from Rhizosphere of Olive Trees and Desert Truffles of Tunisia

    Imene Fhoula; Afef Najjari; Yousra Turki; Sana Jaballah; Abdelatif Boudabous; Hadda Ouzari

    2013-01-01

    A total of 119 lactic acid bacteria (LAB) were isolated, by culture-dependant method, from rhizosphere samples of olive trees and desert truffles and evaluated for different biotechnological properties. Using the variability of the intergenic spacer 16S-23S and 16S rRNA gene sequences, the isolates were identified as the genera Lactococcus, Pediococcus, Lactobacillus, Weissella, and Enterococcus. All the strains showed proteolytic activity with variable rates 42% were EPS producers, while onl...

  12. Rapid Differentiation and In Situ Detection of 16 Sourdough Lactobacillus Species by Multiplex PCR

    Settanni, Luca; van Sinderen, Douwe; Rossi, Jone; Corsetti, Aldo

    2005-01-01

    A two-step multiplex PCR-based method was designed for the rapid detection of 16 species of lactobacilli known to be commonly present in sourdough. The first step of multiplex PCR was developed with a mixture of group-specific primers, while the second step included three multiplex PCR assays with a mixture of species-specific primers. Primers were derived from sequences that specify the 16S rRNA, the 16S-23S rRNA intergenic spacer region, and part of the 23S rRNA gene. The primer pairs desig...

  13. Mycoplasmas hyorhinis in different regions of cuba: diagnosis

    Evelyn Lobo

    2011-06-01

    Full Text Available M. hyorhinis is considered one of the etiological agents of arthritis in sucking pigs, but recently as seen, some strains can produce pneumonia that could not be distinguished from the mycoplasmosis caused by M. hyopneumoniae. The study was conducted to research the presence of Mycoplasma hyorhinis (M. hyorhinis in different regions of the country from exudates of pig lungs with typical EP lesions. Exudates from 280 pig lungs with typical EP lesions were studied using molecular techniques such as PCR, real time PCR and amplification of the 16S-23S rRNA. It was detected that the 66% of the samples studied resulted positive to M. hyorhinis, and the presence of this species was detected in all the provinces. Amplification and studies on the intergenic region 16S-23S of M. hyorhinis rRNA demonstrated the existing variability among strains of a same species. This study is the first report on M. hyorhinis detection in Cuba.

  14. Extensive length variation in the ribosomal DNA intergenic spacer of yellow perch (Perca flavescens).

    Kakou, Bidénam; Angers, Bernard; Glémet, Hélène

    2016-03-01

    The intergenic spacer (IGS) is located between ribosomal RNA (rRNA) gene copies. Within the IGS, regulatory elements for rRNA gene transcription are found, as well as a varying number of other repetitive elements that are at the root of IGS length heterogeneity. This heterogeneity has been shown to have a functional significance through its effect on growth rate. Here, we present the structural organization of yellow perch (Perca flavescens) IGS based on its entire sequence, as well as the IGS length variation within a natural population. Yellow perch IGS structure has four discrete regions containing tandem repeat elements. For three of these regions, no specific length class was detected as allele size was seemingly normally distributed. However, for one repeat region, PCR amplification uncovered the presence of two distinctive IGS variants representing a length difference of 1116 bp. This repeat region was also devoid of any CpG sites despite a high GC content. Balanced selection may be holding the alleles in the population and would account for the high diversity of length variants observed for adjacent regions. Our study is an important precursor for further work aiming to assess the role of IGS length variation in influencing growth rate in fish. PMID:26841134

  15. Intergenic spacer length variants in Old Portuguese bread wheat cultivars

    Ana Carvalho; Henrique Guedes-Pinto; José Lima-Brito

    2011-08-01

    The intergenic spacer of the ribosomal DNA is highly variable, but is location specific in the nucleolar organizer region of the chromosomes. This study provides an event of high level of polymorphism / size variation and occurrence of 14 unique phenotypes in 48 landraces of Portuguese bread wheat cultivars for IGS-amplified products obtained by PCR-RFLP technique performed with TaqI. The attendant IGS polymorphism has been used to deduce affinities between landraces. Some of the high molecular weight IGS allelic variants were also probed for their chromosomal localization by sequential silver nitrate staining and fluorescence in situ hybridization. However, only the intergenic spacer allelic variant of 3.1 kb could be successfully hybridized, and was observed to be physically located on the chromosome pair 1B in the NOR loci of the cultivar ‘Magueija’.

  16. Adaptation of the short intergenic spacers between co-directional genes to the Shine-Dalgarno motif among prokaryote genomes

    Caro, Albert Pallejà; García-Vallvé, Santiago; Romeu, Antoni

    2009-01-01

    ABSTRACT: BACKGROUND: In prokaryote genomes most of the co-directional genes are in close proximity. Even the coding sequence or the stop codon of a gene can overlap with the Shine-Dalgarno (SD) sequence of the downstream co-directional gene. In this paper we analyze how the presence of SD may...... influence the stop codon usage or the spacing lengths between co-directional genes. RESULTS: The SD sequences for 530 prokaryote genomes have been predicted using computer calculations of the base-pairing free energy between translation initiation regions and the 16S rRNA 3' tail. Genomes with a large...... discussion of which factors affect the intergenic lengths, which cannot be totally explained by the pressure to compact the prokaryote genomes....

  17. Diversity of insect trypanosomatids assessed from the spliced leader RNA and 5S rRNA genes and intergenic regions

    Podlipaev, Sergei; Sturm, N. R.; Fiala, Ivan; Fernandes, O.; Westenberger, S. J.; Dollet, M.; Campbell, D. A.; Lukeš, Julius

    2004-01-01

    Roč. 51, č. 3 (2004), s. 283-290. ISSN 1066-5234 Grant ostatní: European Community(XE) QLK 2-CT-2001-01810 Institutional research plan: CEZ:AV0Z6022909 Keywords : Kinetoplastida * phylogeny * Trypanosomatidae Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.403, year: 2004

  18. Potential use of molecular-typing methods for the identification and characterization of salmonella enterica serotypes isolated in the poultry production chain

    CM Baratto

    2012-09-01

    Full Text Available Salmonella is widespread in nature and can be found in all links of the poultry production chain. Due to its high impact on meat processing, techniques for the rapid detection and reproducible characterization of Salmonella serotypes in foods are needed. The present study investigated the potential of molecular profiling to identify and differentiate 15 Salmonella serotypes isolated from the poultry production chain, based on 5 primers by random amplified polymorphic DNA (RAPD, enterobacterial repetitive intergenic consensus (ERIC-PCR, amplification of rDNA internal spacer analysis (RISA, and amplified ribosomal DNA restriction analysis (ARDRA of 16S-23S rRNA internal spacer region (ISR cleaved with Alu I and Hha I restriction enzymes. Three isolates of each serotype were analyzed for the identification of similar and different profiles. Dendrograms were constructed from molecular profiles using the UPGMA method (unweighted pair-group method for the arithmetic averages and the software program WinBoot. The present study indicates the usefulness of RISA and ARDRA of the 16S-23S rRNA intergenic spacer region (ISR for systematic, epidemiological, and diagnostic purposes. Since these techniques can be used for the differentiation of serotypes, they are highly promising for the characterization of Salmonella serotypes and intra-serotypes. Data indicate that these techniques may be used to produce more consistent, reliable, and reproducible results in the identification and epidemiological study (traceability of Salmonella in the poultry industry.

  19. Detection of Chlamydophila psittaci from pigeons by polymerase chain reaction in Ahvaz

    Masoud Ghorbanpoor

    2015-10-01

    Full Text Available Background and Objective: Chlamydophila psittaci is a lethal bacterium that causes endemic avian chlamydiosis, and respiratory psittacosis. Laboratory diagnosis of Chlamydophila psittaci is difficult by culture. This study was design to investigate the presence of Chlamydophila psittaci in collected pharyngeal swabs from asyptomatic pigeons by PCR.Materials and Methods: Pharyngeal samples from pigeons with no symptoms of disease (n=280 were collected during hot and cold seasons in different parts of Ahvaz. DNA was extracted from specimens and subjected to PCR targeting pmp genes and 16s-23s rRNA intergenic spacer of Cp. psittaci and chlamydiales specific primers.Results: Of 280 samples 2 (0.7% harbor were positive for chlamydiales (16s-23s intergenic spacer and Cp. psittaci specific genes (pmp gene.Conclusions: In this research the pigeons were asymptomatic carriers for Cp. psittaci in their respiratory discharges. These results suggest that Cp. psittaci infection of human can occur in very close and continuous contact with pigeons.

  20. Structure of rrn operons in pathogenic non-cultivable treponemes: sequence but not genomic position of intergenic spacers correlates with classification of Treponema pallidum and Treponema paraluiscuniculi strains

    Čejková, Darina; Zobaníková, Marie; Pospíšilová, Petra; Strouhal, Michal; Mikalová, Lenka; Weinstock, George M.

    2013-01-01

    This study examined the sequences of the two rRNA (rrn) operons of pathogenic non-cultivable treponemes, comprising 11 strains of T. pallidum ssp. pallidum (TPA), five strains of T. pallidum ssp. pertenue (TPE), two strains of T. pallidum ssp. endemicum (TEN), a simian Fribourg-Blanc strain and a rabbit T. paraluiscuniculi (TPc) strain. PCR was used to determine the type of 16S–23S ribosomal intergenic spacers in the rrn operons from 30 clinical samples belonging to five different genotypes. When compared with the TPA strains, TPc Cuniculi A strain had a 17 bp deletion, and the TPE, TEN and Fribourg-Blanc isolates had a deletion of 33 bp. Other than these deletions, only 17 heterogeneous sites were found within the entire region (excluding the 16S–23S intergenic spacer region encoding tRNA-Ile or tRNA-Ala). The pattern of nucleotide changes in the rrn operons corresponded to the classification of treponemal strains, whilst two different rrn spacer patterns (Ile/Ala and Ala/Ile) appeared to be distributed randomly across species/subspecies classification, time and geographical source of the treponemal strains. It is suggested that the random distribution of tRNA genes is caused by reciprocal translocation between repetitive sequences mediated by a recBCD-like system. PMID:23082031

  1. Species-specific repeat units in the intergenic spacer of the ribosomal RNA cistron of Anopheles aquasalis Curry.

    Perera, O P; Cockburn, A F; Mitchell, S E; Conn, J; Seawright, J A

    1998-11-01

    A genomic DNA library of Anopheles aquasalis Curry was screened for clones that hybridized more intensely to DNA from A. aquasalis than to DNA from A. benarrochi Gabaldon, Cova Garcia, and Lopez, A. konderi Galvao and Damasceno, A. nuneztovari Gabaldon cytotypes A, B, and C, A. oswaldoi (Peryassu), A. rangeli Gabaldon, Cova Garcia, and Lopez, or A. trinkae Faran. Two specific clones (2.5 kilobasepairs [kbp] and 3.0 kbp) from A. aquasalis were isolated. Both A. aquasalis-specific clones were from the intergenic spacer region of the ribosomal RNA (rRNA) cistron. Upon digestion with Rsa I, a 900-bp fragment from the clone AA-1 hybridized specifically to A. aquasalis DNA. Analysis of the DNA sequence of this fragment revealed four tandemly repeated 36-bp units. Three of these repeat units were identical, and the fourth was 94% identical to the others. The DNA sequence of a highly conserved region of these repeats was used to synthesize an oligonucleotide probe specific to A. aquasalis. PMID:9840580

  2. Phylogenetic relationships of Arthrospira strains inferred from 16S rRNA gene and cpcBA-IGS sequences

    Chi-Yong Ahn

    2012-06-01

    Full Text Available Arthrospira platensis and Arthrospira maxima are species of cyanobacteria used in health foods, animal feed, food additives, and fine chemicals. This study conducted a comparison of the 16S rRNA gene and cpcBA-intergenic spacer (cpcBA-IGS sequences in Arthrospira strains from culture collections around the world. A cluster analysis divided the 10 Arthrospira strains into two main genotypic clusters, designated I and II, where Group I contained A. platensis SAG 86.79, UTEX 2340, A. maxima KCTC AG30054, and SAG 49.88, while Group II contained A. platensis PCC 9108, NIES 39, NIES 46, and SAG 257.80. However, although A. platensis PCC 9223 belonged to Group II-2 based on its cpcBA-IGS sequence, this strain also belonged to Group I based on its 16S rRNA gene sequence. Phylogenetic analyses based on the 16S rRNA gene and cpcBA-IGS sequences showed no division between A. platensis and A. maxima, plus the 16S rRNA gene and cpcBAIGS sequence clusters did not indicate any well-defined geographical distribution, instead overlapping in a rather interesting way. Therefore, the current study supports some previous conclusions based on 16S rRNA gene and cpcBA-IGS sequences, which found that Arthrospira taxa are monophyletic. However, when compared with 16S rRNA sequences, cpcBA-IGS sequences may be better suited to resolve close relationships and intraspecies variability.

  3. Influence of commonly used primer systems on automated ribosomal intergenic spacer analysis of bacterial communities in environmental samples.

    Purahong, Witoon; Stempfhuber, Barbara; Lentendu, Guillaume; Francioli, Davide; Reitz, Thomas; Buscot, François; Schloter, Michael; Krüger, Dirk

    2015-01-01

    Due to the high diversity of bacteria in many ecosystems, their slow generation times, specific but mostly unknown nutrient requirements and syntrophic interactions, isolation based approaches in microbial ecology mostly fail to describe microbial community structure. Thus, cultivation independent techniques, which rely on directly extracted nucleic acids from the environment, are a well-used alternative. For example, bacterial automated ribosomal intergenic spacer analysis (B-ARISA) is one of the widely used methods for fingerprinting bacterial communities after PCR-based amplification of selected regions of the operon coding for rRNA genes using community DNA. However, B-ARISA alone does not provide any taxonomic information and the results may be severely biased in relation to the primer set selection. Furthermore, amplified DNA stemming from mitochondrial or chloroplast templates might strongly bias the obtained fingerprints. In this study, we determined the applicability of three different B-ARISA primer sets to the study of bacterial communities. The results from in silico analysis harnessing publicly available sequence databases showed that all three primer sets tested are specific to bacteria but only two primers sets assure high bacterial taxa coverage (1406f/23Sr and ITSF/ITSReub). Considering the study of bacteria in a plant interface, the primer set ITSF/ITSReub was found to amplify (in silico) sequences of some important crop species such as Sorghum bicolor and Zea mays. Bacterial genera and plant species potentially amplified by different primer sets are given. These data were confirmed when DNA extracted from soil and plant samples were analyzed. The presented information could be useful when interpreting existing B-ARISA results and planning B-ARISA experiments, especially when plant DNA can be expected. PMID:25749323

  4. Influence of commonly used primer systems on automated ribosomal intergenic spacer analysis of bacterial communities in environmental samples.

    Witoon Purahong

    Full Text Available Due to the high diversity of bacteria in many ecosystems, their slow generation times, specific but mostly unknown nutrient requirements and syntrophic interactions, isolation based approaches in microbial ecology mostly fail to describe microbial community structure. Thus, cultivation independent techniques, which rely on directly extracted nucleic acids from the environment, are a well-used alternative. For example, bacterial automated ribosomal intergenic spacer analysis (B-ARISA is one of the widely used methods for fingerprinting bacterial communities after PCR-based amplification of selected regions of the operon coding for rRNA genes using community DNA. However, B-ARISA alone does not provide any taxonomic information and the results may be severely biased in relation to the primer set selection. Furthermore, amplified DNA stemming from mitochondrial or chloroplast templates might strongly bias the obtained fingerprints. In this study, we determined the applicability of three different B-ARISA primer sets to the study of bacterial communities. The results from in silico analysis harnessing publicly available sequence databases showed that all three primer sets tested are specific to bacteria but only two primers sets assure high bacterial taxa coverage (1406f/23Sr and ITSF/ITSReub. Considering the study of bacteria in a plant interface, the primer set ITSF/ITSReub was found to amplify (in silico sequences of some important crop species such as Sorghum bicolor and Zea mays. Bacterial genera and plant species potentially amplified by different primer sets are given. These data were confirmed when DNA extracted from soil and plant samples were analyzed. The presented information could be useful when interpreting existing B-ARISA results and planning B-ARISA experiments, especially when plant DNA can be expected.

  5. New species in the genus Francisella (Gammaproteobacteria; Francisellaceae); Francisella piscicida sp. nov. isolated from cod (Gadus morhua)

    Ottem, Karl F; Nylund, Are; Karlsbakk, Egil; Friis-Møller, Alice; Krossøy, Bjørn; Knappskog, Dag

    2007-01-01

    A Francisella strain, GM2212, previously isolated from moribund farmed Atlantic cod (Gadus morhua) in Norway, is closely related to Francisella philomiragia among Francisella spp. according to its complete 16S rDNA, 16S-23S intergenic spacer, 23S rDNA, 23S-5S intergenic spacer, 5S rDNA, FopA, lip...

  6. Characterization of Francisella sp., GM2212, the first Francisella isolate from marine fish, Atlantic cod (Gadus morhua)

    Ottem, Karl F; Nylund, Are; Karlsbakk, Egil; Friis-Møller, Alice; Krossøy, Bjørn

    2007-01-01

    A Francisella sp., isolate GM2212(T), previously isolated from diseased farmed Atlantic cod Gadus morhua in Norway is characterized. The complete 16S rDNA, 16S-23S intergenic spacer, 23S rDNA, 23S-5S intergenic spacer, 5S rDNA, FopA, lipoprotein TUL4 (LpnA), malate dehydrogenase and a hypothetica...

  7. Molecular diversity of Renibacterium salmoninarum isolates determined by randomly amplified polymorphic DNA analysis.

    Grayson, T H; Atienzar, F A; Alexander, S M; Cooper, L F; Gilpin, M L

    2000-01-01

    The molecular diversity among 60 isolates of Renibacterium salmoninarum which differ in place and date of isolation was investigated by using randomly amplified polymorphic DNA (RAPD) analysis. Isolates were grouped into 21 banding patterns which did not reflect the biological source. Four 16S-23S rRNA intergenic spacer (ITS1) sequence variations and two alleles of an exact tandem repeat locus, ETR-A, were the bases for formation of distinct groups within the RAPD clusters. This study provides evidence that the most common ITS1 sequence variant, SV1, possesses two copies of a 51-bp repeat unit at ETR-A and has been widely dispersed among countries which are associated with mainstream intensive salmonid culture. PMID:10618262

  8. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  9. Trypanosoma brucei: Enrichment by UV of intergenic transcripts from the variable surface glycoprotein gene expression site

    The expression site for the variable surface glycoprotein (VSG) gene AnTat 1.3A of Trypanosoma brucei is 45 kilobases long and encompasses seven expression site-associated genes (ESAGs). After UV irradiation, several large transcripts from the putative promoter region were strongly enriched. We report that one such major transcript starts near the poly(A) addition site of the first gene (ESAG 7), spans the intergenic region, and extends to the poly(A) addition site of the second gene (ESAG 6), thus bypassing the normal 3' splice site of the ESAG 6 mRNA. Since this transcript is spliced, we conclude that UV irradiation does not inhibit splicing but stabilizes unstable processing products. This demonstrates that at least some intergenic regions of the VSG gene expression site are continuously transcribed in accordance with a polycistronic transcription model

  10. Combined eukaryotic and bacterial community fingerprinting of natural freshwater biofilms using automated ribosomal intergenic spacer analysis

    2010-01-01

    Biofilms are complex communities playing an important role in aquatic ecosystems. Automated ribosomal intergenic spacer analysis (ARISA) has been used successfully to explore biofilm bacterial diversity. However, a gap remains to be filled as regards its application to biofilm eukaryotic populations. The aim of this study is to use ARISA to detect eukaryotic population shifts in biofilm. We designed a new set of primers to focus specifically on the ITS1-5.8S-ITS2 region of diatoms and tested ...

  11. Detection of non-coding RNA genes by searching for transcription signals in intergenic regions. : Summary

    2004-01-01

    Detection of non-coding RNA genes by searching for transcription signals in intergenic regions. Background Non-coding RNA (ncRNA) genes produce transcripts that exert their function without ever being a recipe for proteins. ncRNA gene sequences, unlike protein coding genes, do not have strong transcription signals. This study was conducted to investigate a special version of a previously tested and suggested method of detecting RNAs. This study is a part of a larger project where m...

  12. Comparison of Internal Transcribed Spacers and Intergenic Spacer Regions of Five Common Iranian Sheep Bursate Nematodes

    Reza Nabavi; Brendan Conneely; Elaine McCarthy; Barbara Good; Parviz Shayan; Theo de Waal

    2014-01-01

    Background Accurate identification of sheep nematodes is a critical point in epidemiological studies and monitoring of drug resistance in flocks. However, due to a close morphological similarity between the eggs and larval stages of many of these nematodes, such identification is not a trivial task. There are a number of studies showing that molecular targets in ribosomal DNA (Internal transcribed spacer 1, 2 and Intergenic spacer) are suitable for accurate identification of sheep bursate nem...

  13. Intergenic and repeat transcription in human, chimpanzee and macaque brains measured by RNA-Seq.

    Augix Guohua Xu

    Full Text Available Transcription is the first step connecting genetic information with an organism's phenotype. While expression of annotated genes in the human brain has been characterized extensively, our knowledge about the scope and the conservation of transcripts located outside of the known genes' boundaries is limited. Here, we use high-throughput transcriptome sequencing (RNA-Seq to characterize the total non-ribosomal transcriptome of human, chimpanzee, and rhesus macaque brain. In all species, only 20-28% of non-ribosomal transcripts correspond to annotated exons and 20-23% to introns. By contrast, transcripts originating within intronic and intergenic repetitive sequences constitute 40-48% of the total brain transcriptome. Notably, some repeat families show elevated transcription. In non-repetitive intergenic regions, we identify and characterize 1,093 distinct regions highly expressed in the human brain. These regions are conserved at the RNA expression level across primates studied and at the DNA sequence level across mammals. A large proportion of these transcripts (20% represents 3'UTR extensions of known genes and may play roles in alternative microRNA-directed regulation. Finally, we show that while transcriptome divergence between species increases with evolutionary time, intergenic transcripts show more expression differences among species and exons show less. Our results show that many yet uncharacterized evolutionary conserved transcripts exist in the human brain. Some of these transcripts may play roles in transcriptional regulation and contribute to evolution of human-specific phenotypic traits.

  14. Bat white-nose syndrome: a real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructanstructans.

    Muller, Laura K.; Lorch, Jeffrey M.; Lindner, Daniel L.; O'Connor, Michael; Gargas, Andrea; Blehert, David S.

    2013-01-01

    The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The test is highly sensitive, consistently detecting as little as 3.3 fg of genomic DNA from G. destructans. The real-time PCR test specifically amplified genomic DNA from G. destructans but did not amplify target sequence from 54 closely related fungal isolates (including 43 Geomyces spp. isolates) associated with bats. The test was further qualified by analyzing DNA extracted from 91 bat wing skin samples, and PCR results matched histopathology findings. These data indicate the real-time TaqMan PCR method described herein is a sensitive, specific, and rapid test to detect DNA from G. destructans and provides a valuable tool for WNS diagnostics and research.

  15. A systematic search for new mammalian noncoding RNAs indicates little conserved intergenic transcription

    Blencowe Benjamin J

    2005-08-01

    Full Text Available Abstract Background Systematic identification and functional characterization of novel types of noncoding (ncRNA in genomes is more difficult than it is for protein coding mRNAs, since ncRNAs typically do not possess sequence features such as splicing or translation signals, or long open reading frames. Recent "tiling" microarray studies have reported that a surprisingly larger proportion of mammalian genomes is transcribed than was previously anticipated. However, these non-genic transcripts often appear to be low in abundance, and their functional significance is not known. Results To systematically search for functional ncRNAs, we designed microarrays to detect 3,478 intergenic and intronic sequences that are conserved between the human, mouse, and rat genomes, and that score highly by other criteria that characterize ncRNAs. We probed these arrays with total RNA isolated from 16 wild-type mouse tissues. Among 55 candidates for highly-expressed novel ncRNAs tested by northern blotting, eight were confirmed as small, highly-and ubiquitously-expressed RNAs in mouse. Of the eight, five were also detected in rat tissues, but none were detected at appreciable levels in human tissues or cultured cells. Conclusion Since the sequence and expression of most known coding transcripts and functional ncRNAs is conserved between human and mouse, the lack of northern-detectable expression in human cells and tissues of the novel mouse and rat ncRNAs that we identified suggests that they are not functional or possibly have rodent-specific functions. Our results confirm that relatively little of the intergenic sequence conserved between human, mouse and rat is transcribed at high levels in mammalian tissues, possibly suggesting a limited role for transcribed intergenic and intronic sequences as independent functional elements.

  16. Phylogenetic relationships of Salmonella based on rRNA sequences

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

  17. Transcription and decay of the lac messenger: role of an intergenic terminator.

    Murakawa, G J; Kwan, C; Yamashita, J; Nierlich, D P

    1991-01-01

    Prior work has indicated that the polycistronic lacZYA mRNA of Escherichia coli is cleaved during decay at approximately intergenic sites (L. W. Lim and D. Kennell, J. Mol. Biol. 135: 369-390, 1979). In this work, we characterized the products by using probes specific for the different cistrons. This analysis indicated that six lac mRNA species are present in the following order of decreasing abundance: lacZ, -A, -ZYA, -ZY, -YA, and -Y. Very little lacYA and lacY mRNAs were present, whereas i...

  18. Intergenic DNA sequences flanking the pseudo alpha globin genes of human and chimpanzee.

    Sawada, I; Beal, M P; Shen, C K; Chapman, B.; Wilson, A C; Schmid, C.

    1983-01-01

    We have determined the sequence of 2400 base pairs upstream from the human pseudo alpha globin (psi alpha) gene, and for comparison, 1100 base pairs of DNA within and upstream from the chimpanzee psi alpha gene. The region upstream from the promoter of the psi alpha gene shows no significant homology to the intergenic regions of the adult alpha 2 and alpha 1 globin genes. The chimpanzee gene has a coding defect in common with the human psi alpha gene, showing that the product of this gene, if...

  19. De Novo Identification of Regulatory Regions in Intergenic Spaces of Prokaryotic Genomes

    Chain, P; Garcia, E; Mcloughlin, K; Ovcharenko, I

    2007-02-20

    This project was begun to implement, test, and experimentally validate the results of a novel algorithm for genome-wide identification of candidate transcription-factor binding sites in prokaryotes. Most techniques used to identify regulatory regions rely on conservation between different genomes or have a predetermined sequence motif(s) to perform a genome-wide search. Therefore, such techniques cannot be used with new genome sequences, where information regarding such motifs has not yet been discovered. This project aimed to apply a de novo search algorithm to identify candidate binding-site motifs in intergenic regions of prokaryotic organisms, initially testing the available genomes of the Yersinia genus. We retrofitted existing nucleotide pattern-matching algorithms, analyzed the candidate sites identified by these algorithms as well as their target genes to screen for meaningful patterns. Using properly annotated prokaryotic genomes, this project aimed to develop a set of procedures to identify candidate intergenic sites important for gene regulation. We planned to demonstrate this in Yersinia pestis, a model biodefense, Category A Select Agent pathogen, and then follow up with experimental evidence that these regions are indeed involved in regulation. The ability to quickly characterize transcription-factor binding sites will help lead to a better understanding of how known virulence pathways are modulated in biodefense-related organisms, and will help our understanding and exploration of regulons--gene regulatory networks--and novel pathways for metabolic processes in environmental microbes.

  20. Distribution of 16S rRNA methylases among different species of Gram-negative bacilli with high-level resistance to aminoglycosides.

    Zhou, Y; Yu, H; Guo, Q; Xu, X; Ye, X; Wu, S; Guo, Y; Wang, M

    2010-11-01

    16S rRNA methylases confer high-level resistance to most aminoglycosides in Gram-negative bacteria. Seven 16S rRNA methylase genes, armA, rmtA, rmtB, rmtC, rmtD, rmtE and npmA, have been identified since 2003. We studied the distribution of methylase genes in more than 200 aminoglycoside-resistant Gram-negative clinical isolates collected in 2007 at our hospital in Shanghai, China. 16S rRNA methylase genes were amplified by polymerase chain reaction (PCR) among 217 consecutive clinical isolates of Gram-negative bacilli resistant to gentamicin and amikacin by a disk diffusion method. 16S rRNA methylase genes were present in 97.5% (193/198) of clinical isolates highly resistant to amikacin (≥512 μg/ml), with armA and rmtB detected in 67.2 and 30.3% of strains, respectively, while no 16S rRNA methylase genes were detected in 19 strains with amikacin minimum inhibitory concentration (MIC) ≤256 μg/ml. armA or rmtB genes were detected in 100% of 104 strains of Enterobacteriaceae, and these two genes were equally represented (49 vs. 55 strains). Genes for armA or rmtB were detected in 94.7% (89/94) of Acinetobacter baumannii and Pseudomonas aeruginosa strains, and armA was predominant (84 vs. 5 strains with rmtB). No rmtA, rmtC, rmtD or npmA genes were found. Enterobacterial repetitive intergenic consensus sequence (ERIC-PCR) indicated that armA and rmtB genes were spread by both horizontal transfer and clonal dissemination. PMID:20614151

  1. Limitations and benefits of ARISA intra-genomic diversity fingerprinting.

    Popa, Radu; Popa, Rodica; Mashall, Matthew J; Nguyen, Hien; Tebo, Bradley M; Brauer, Suzanna

    2009-08-01

    Monitoring diversity changes and contamination in mixed cultures and simple microcosms is challenged by fast community structure dynamics, and the need for means allowing fast, cost-efficient and accurate identification of microorganisms at high phylogenetic resolution. The method we explored is a variant of Automated rRNA Intergenic Spacer Analysis based on Intra-Genomic Diversity Fingerprinting (ARISA-IGDF), and identifies phylotypes with multiple 16S-23S rRNA gene Intergenic Transcribed Spacers. We verified the effect of PCR conditions (annealing temperature, duration of final extension, number of cycles, group-specific primers and formamide) on ARISA-IGD fingerprints of 44 strains of Shewanella. We present a digitization algorithm and data analysis procedures needed to determine confidence in strain identification. Though using stringent PCR conditions and group-specific primers allow reasonably accurate identification of strains with three ARISA-IGD amplicons within the 82-1000 bp size range, ARISA-IGDF is best for phylotypes with >or=4 unambiguously different amplicons. This method allows monitoring the occurrence of culturable microbes and can be implemented in applications requiring high phylogenetic resolution, reproducibility, low cost and high throughput such as identifying contamination and monitoring the evolution of diversity in mixed cultures and low diversity microcosms and periodic screening of small microbial culture libraries. PMID:19538993

  2. Optimisation of automated ribosomal intergenic spacer analysis for the estimation of microbial diversity in fynbos soil

    Karin Jacobs

    2010-07-01

    Full Text Available Automated ribosomal intergenic spacer analysis (ARISA has become a commonly used molecular technique for the study of microbial populations in environmental samples. The reproducibility and accuracy of ARISA, with and without the polymerase chain reaction (PCR are important aspects that influence the results and effectiveness of these techniques. We used the primer set ITS4/ITS5 for ARISA to assess the fungal community composition of two sites situated in the Sand Fynbos. The primer set proved to deliver reproducible ARISA profiles of the fungal community composition with little variation observed between ARISA-PCRs. Variation that occurred in a sample due to repeated DNA extraction is expected for ecological studies. This reproducibility made ARISA a useful tool for the assessment and comparison of diversity in ecological samples. In this paper, we also offered particular suggestions concerning the binning strategy for the analysis of ARISA profiles.

  3. Sequence analysis of the rDNA intergenic spacer of Metarhizium strains isolated in Brazil

    Fabiana Y. Yanaka-Schäfer

    2008-01-01

    Full Text Available To assess the extent of genetic variability of rDNA intergenic spacer (IGS in Metarhizium sp., 34 strains (27 isolated in Brazil were sequenced and analyzed together with an additional 20 Metarhizium anisopliae var. anisopliae sequences retrieved from GenBank. Overall, the global nucleotide diversity for the region under study was of 0.090, while for the Brazilian isolates it was only 0.016. Phylogenetic analyses showed four well-supported groups (A, B, C, and D, one of which (D has not been previously identified. All but one of the Brazilian strains cluster in this novel D phylogroup, suggesting that the genetic variation found in Brazil is a subset of the worldwide M. anisopiliae var. anisopliae variation.

  4. Downregulation of rRNA Transcription Triggers Cell Differentiation

    Yuki Hayashi; Takao Kuroda; Hiroyuki Kishimoto; Changshan Wang; Atsushi Iwama; Keiji Kimura

    2014-01-01

    Responding to various stimuli is indispensable for the maintenance of homeostasis. The downregulation of ribosomal RNA (rRNA) transcription is one of the mechanisms involved in the response to stimuli by various cellular processes, such as cell cycle arrest and apoptosis. Cell differentiation is caused by intra- and extracellular stimuli and is associated with the downregulation of rRNA transcription as well as reduced cell growth. The downregulation of rRNA transcription during differentiati...

  5. Molecular identfication and virulence of three Aeromonas hydrophila isolates cultured from infected channel catfish during a disease outbreak in West Alabama (USA) in 2009

    Three isolates (AL09-71, AL09-72, and AL09-73) of Aeromonas hydrophila were cultured from infected channel catfish during a disease outbreak in West Alabama in August 2009. Sequence analysis of 16S-23S rDNA intergenic spacer region (ISR), cpn60, gyrB, and rpoD genes of the three strains revealed tha...

  6. Molecular identification and virulence of three Aeromonas hydrophila isolates cultured from infected channel catfish during a disease outbreak in West Alabama in 2009

    Three isolates (AL09-71, AL09-72, and AL09-73) of Aeromonas hydrophila were cultured from infected channel catfish during a disease outbreak in West Alabama in August 2009. Sequence analysis of 16S-23S rDNA intergenic spacer region (ISR), cpn60, gyrB, and rpoD genes of the three strains revealed tha...

  7. Molecular Analysis of Promoter and Intergenic Region Attenuator of the Vibrio vulnificus prx1ahpF Operon.

    Lee, Hyun Sung; Lim, Jong Gyu; Han, Kook; Lee, Younghoon; Choi, Sang Ho

    2015-08-01

    Prx1, an AhpF-dependent 2-Cys peroxiredoxin (Prx), was previously identified in Vibrio vulnificus, a facultative aerobic pathogen. In the present study, transcription of the V. vulnificus prx1ahpF genes, which are adjacently located on the chromosome, was evaluated by analyzing the promoter and intergenic region of the two genes. Northern blot analyses revealed that transcription of prx1ahpF results in two transcripts, the prx1 and prx1ahpF transcripts. Primer extension analysis and a point mutational analysis of the promoter region showed that the two transcripts are generated from a single promoter. In addition, the 3' end of the prx1 transcript at the prx1ahpF intergenic region was determined by a 3'RACE assay. These results suggested that the prx1ahpF genes are transcribed as an operon, and the prx1 transcript was produced by transcriptional termination in the intergenic region. RNA secondary structure prediction of the prx1ahpF intergenic region singled out a stem-loop structure without poly(U) tract, and a deletion analysis of the intergenic region showed that the atypical stem-loop structure acts as the transcriptional attenuator to result in the prx1 and prx1ahpF transcripts. The combined results demonstrate that the differential expression of prx1 and ahpF is accomplished by the cis-acting transcriptional attenuator located between the two genes and thereby leads to the production of a high level of Prx1 and a low level of AhpF. PMID:25824432

  8. A small intergenic region drives exclusive tissue-specific expression of the adjacent genes in Arabidopsis thaliana

    Valle Estela M

    2009-10-01

    Full Text Available Abstract Background Transcription initiation by RNA polymerase II is unidirectional from most genes. In plants, divergent genes, defined as non-overlapping genes organized head-to-head, are highly represented in the Arabidopsis genome. Nevertheless, there is scarce evidence on functional analyses of these intergenic regions. The At5g06290 and At5g06280 loci are head-to-head oriented and encode a chloroplast-located 2-Cys peroxiredoxin B (2CPB and a protein of unknown function (PUF, respectively. The 2-Cys peroxiredoxins are proteins involved in redox processes, they are part of the plant antioxidant defence and also act as chaperons. In this study, the transcriptional activity of a small intergenic region (351 bp shared by At5g06290 and At5g06280 in Arabidopsis thaliana was characterized. Results Activity of the intergenic region in both orientations was analyzed by driving the β-glucuronidase (GUS reporter gene during the development and growth of Arabidopsis plants under physiological and stressful conditions. Results have shown that this region drives expression either of 2cpb or puf in photosynthetic or vascular tissues, respectively. GUS expression driven by the promoter in 2cpb orientation was enhanced by heat stress. On the other hand, the promoter in both orientations has shown similar down-regulation of GUS expression under low temperatures and other stress conditions such as mannitol, oxidative stress, or fungal elicitor. Conclusion The results from this study account for the first evidence of an intergenic region that, in opposite orientation, directs GUS expression in different spatially-localized Arabidopsis tissues in a mutually exclusive manner. Additionally, this is the first demonstration of a small intergenic region that drives expression of a gene whose product is involved in the chloroplast antioxidant defence such as 2cpb. Furthermore, these results contribute to show that 2cpb is related to the heat stress defensive system

  9. Rapid Acquisition of Linezolid Resistance in Methicillin-Resistant Staphylococcus aureus: Role of Hypermutation and Homologous Recombination

    Iguchi, Shigekazu; Mizutani, Tomonori; Hiramatsu, Keiichi; Kikuchi, Ken

    2016-01-01

    Background We previously reported the case of a 64-year-old man with mediastinitis caused by Staphylococcus aureus in which the infecting bacterium acquired linezolid resistance after only 14 days treatment with linezolid. We therefore investigated relevant clinical isolates for possible mechanisms of this rapid acquisition of linezolid resistance. Methods Using clinical S. aureus isolates, we assessed the in vitro mutation rate and performed stepwise selection for linezolid resistance. To investigate homologous recombination, sequences were determined for each of the 23S ribosomal RNA (23S rRNA) loci; analyzed sequences spanned the entirety of each 23S rRNA gene, including domain V, as well as the 16S-23S intergenic spacer regions. We additionally performed next-generation sequencing on clinical strains to identify single-nucleotide polymorphisms compared to the N315 genome. Results Strains isolated from the patient prior to linezolid exposure (M5-M7) showed higher-level linezolid resistance than N315, and the pre-exposure strain (M2) exhibited more rapid acquisition of linezolid resistance than did N315. However, the mutation rates of these and contemporaneous clinical isolates were similar to those of N315, and the isolates did not exhibit any mutations in hypermutation-related genes. Sequences of the 23S rRNA genes and 16S-23S intergenic spacer regions were identical among the pre- and post-exposure clinical strains. Notably, all of the pre-exposure isolates harbored a recQ missense mutation (Glu69Asp) with respect to N315; such a lesion may have affected short sequence recombination (facilitating, for example, recombination among rrn loci). We hypothesize that this mechanism contributed to rapid acquisition of linezolid resistance. Conclusions Hypermutation and homologous recombination of the ribosomal RNA genes, including 23S rRNA genes, appear not to have been sources of the accelerated acquisition of linezolid resistance observed in our clinical case

  10. Downregulation of rRNA transcription triggers cell differentiation.

    Yuki Hayashi

    Full Text Available Responding to various stimuli is indispensable for the maintenance of homeostasis. The downregulation of ribosomal RNA (rRNA transcription is one of the mechanisms involved in the response to stimuli by various cellular processes, such as cell cycle arrest and apoptosis. Cell differentiation is caused by intra- and extracellular stimuli and is associated with the downregulation of rRNA transcription as well as reduced cell growth. The downregulation of rRNA transcription during differentiation is considered to contribute to reduced cell growth. However, the downregulation of rRNA transcription can induce various cellular processes; therefore, it may positively regulate cell differentiation. To test this possibility, we specifically downregulated rRNA transcription using actinomycin D or a siRNA for Pol I-specific transcription factor IA (TIF-IA in HL-60 and THP-1 cells, both of which have differentiation potential. The inhibition of rRNA transcription induced cell differentiation in both cell lines, which was demonstrated by the expression of the common differentiation marker CD11b. Furthermore, TIF-IA knockdown in an ex vivo culture of mouse hematopoietic stem cells increased the percentage of myeloid cells and reduced the percentage of immature cells. We also evaluated whether differentiation was induced via the inhibition of cell cycle progression because rRNA transcription is tightly coupled to cell growth. We found that cell cycle arrest without affecting rRNA transcription did not induce differentiation. To the best of our knowledge, our results demonstrate the first time that the downregulation of rRNA levels could be a trigger for the induction of differentiation in mammalian cells. Furthermore, this phenomenon was not simply a reflection of cell cycle arrest. Our results provide a novel insight into the relationship between rRNA transcription and cell differentiation.

  11. PCR amplification and characterization of the intergenic spacer region of the ribosomal DNA in Pyrenophora graminea.

    Pecchia, S; Mercatelli, E; Vannacci, G

    1998-09-01

    Successful amplification of the whole intergenic spacer region of the nuclear ribosomal repeat (IGS) in Pyrenophora graminea was obtained with a PCR-based assay. Single amplification products showed length differences. Depending on the length of the IGS-PCR product, ca. 3.8 or 4.4 kb, two groups of isolates could be identified. The RFLP patterns of isolates obtained with the 6-base cutting enzymes Apal, BglII, DraI, EcoRV, HindIII and SacI were similar within each group and different between the two groups. Restriction patterns of IGS-PCR products digested with the 4-base cutting enzyme AluI were polymorphic among isolates in spite of their IGS-PCR product length. In order to characterize the long and short IGS-PCR products the restriction map is shown. The long product shows an additional HindIII site and a BglII site that is lacking in the short product. However, the latter shows a SacI site that is not present in the long IGS-PCR product. Therefore, the described PCR-RFLP analysis of the IGS appears to be a useful tool to resolve genetic variation between P. graminea isolates. PMID:9741081

  12. RNA structure-based ribosome recruitment: lessons from the Dicistroviridae intergenic region IRESes.

    Pfingsten, Jennifer S; Kieft, Jeffrey S

    2008-07-01

    In eukaryotes, the canonical process of initiating protein synthesis on an mRNA depends on many large protein factors and the modified nucleotide cap on the 5' end of the mRNA. However, certain RNA sequences can bypass the need for these proteins and cap, using an RNA structure-based mechanism called internal initiation of translation. These RNAs are called internal ribosome entry sites (IRESes), and the cap-independent initiation pathway they support is critical for successful infection by many viruses of medical and economic importance. In this review, we briefly describe and compare mechanistic and structural groups of viral IRES RNAs, focusing on those IRESes that are capable of direct ribosome recruitment using specific RNA structures. We then discuss in greater detail some recent advances in our understanding of the intergenic region IRESes of the Dicistroviridae, which use the most streamlined ribosome-recruitment mechanism yet discovered. By combining these findings with knowledge of canonical translation and the behavior of other IRESes, mechanistic models of this RNA structure-based process are emerging. PMID:18515544

  13. Conservation and diversity among the three-dimensional folds of the Dicistroviridae intergenic region IRESes.

    Pfingsten, Jennifer S; Costantino, David A; Kieft, Jeffrey S

    2007-07-27

    Internal ribosome entry site (IRES) RNAs are necessary for successful infection of many pathogenic viruses, but the details of the RNA structure-based mechanism used to bind and manipulate the ribosome remain poorly understood. The IRES RNAs from the Dicistroviridae intergenic region (IGR) are an excellent model system to understand the fundamental tenets of IRES function, requiring no protein factors to manipulate the ribosome and initiate translation. Here, we explore the architecture of four members of the IGR IRESes, representative of the two divergent classes of these IRES RNAs. Using biochemical and structural probing methods, we show that despite sequence variability they contain a common three-dimensional fold. The three-dimensional architecture of the ribosome binding domain from these IRESes is organized around a core helical scaffold, around which the rest of the RNA molecule folds. However, subtle variation in the folds of these IRESes and the presence of an additional secondary structure element suggest differences in the details of their manipulation of the large ribosomal subunit. Overall, the results demonstrate how a conserved three-dimensional RNA fold governs ribosome binding and manipulation. PMID:17544444

  14. Comparative Expression Dynamics of Intergenic Long Noncoding RNAs in the Genus Drosophila.

    Nyberg, Kevin G; Machado, Carlos A

    2016-01-01

    Thousands of long noncoding RNAs (lncRNAs) have been annotated in eukaryotic genomes, but comparative transcriptomic approaches are necessary to understand their biological impact and evolution. To facilitate such comparative studies in Drosophila, we identified and characterized lncRNAs in a second Drosophilid-the evolutionary model Drosophila pseudoobscura Using RNA-Seq and computational filtering of protein-coding potential, we identified 1,589 intergenic lncRNA loci in D. pseudoobscura We surveyed multiple sex-specific developmental stages and found, like in Drosophila melanogaster, increasingly prolific lncRNA expression through male development and an overrepresentation of lncRNAs in the testes. Other trends seen in D. melanogaster, like reduced pupal expression, were not observed. Nonrandom distributions of female-biased and non-testis-specific male-biased lncRNAs between the X chromosome and autosomes are consistent with selection-based models of gene trafficking to optimize genomic location of sex-biased genes. The numerous testis-specific lncRNAs, however, are randomly distributed between the X and autosomes, and we cannot reject the hypothesis that many of these are likely to be spurious transcripts. Finally, using annotated lncRNAs in both species, we identified 134 putative lncRNA homologs between D. pseudoobscura and D. melanogaster and find that many have conserved developmental expression dynamics, making them ideal candidates for future functional analyses. PMID:27189981

  15. Subfamilial relationships within solanaceae as inferred from atp beta-rbcl intergenic spacer

    A phylogenetic analysis of family Solanaceae was conducted using sequence data from the chloroplast intergenic atp beta-rbcL spacer. Sequence data was generated from 17 species representing 09 out of 14 genera of Solanaceae from Pakistan. Cladogram was constructed using maximum parsimony method and results indicate that Solanaceae is mainly divided into two subfamilies; Solanoideae and Cestroideae. Four major clades within Solanoideae represent tribes; Physaleae, Capsiceae, Datureae and Solaneae are supported by high bootstrap value and the relationships among them are not corroborating with the previous studies. The findings established that subfamily Cestroideae comprised of three genera; Cestrum, Lycium and Nicotiana with high bootstrap support. Position of Nicotiana inferred with atp beta-rbcL sequence is congruent with traditional classification, which placed the taxa in Cestroideae. In the current study Lycium unexpectedly nested with Nicotiana with 100% bootstrap support and identified as a member of tribe Nicotianeae. Expanded sampling of other genera from Pakistan could be valuable towards improving our understanding of intrafamilial relationships within Solanaceae. (author)

  16. Disruption of a Large Intergenic Noncoding RNA in Subjects with Neurodevelopmental Disabilities

    Talkowski, Michael E.; Maussion, Gilles; Crapper, Liam; Rosenfeld, Jill A.; Blumenthal, Ian; Hanscom, Carrie; Chiang, Colby; Lindgren, Amelia; Pereira, Shahrin; Ruderfer, Douglas; Diallo, Alpha B.; Lopez, Juan Pablo; Turecki, Gustavo; Chen, Elizabeth S.; Gigek, Carolina; Harris, David J.; Lip, Va; An, Yu; Biagioli, Marta; MacDonald, Marcy E.; Lin, Michael; Haggarty, Stephen J.; Sklar, Pamela; Purcell, Shaun; Kellis, Manolis; Schwartz, Stuart; Shaffer, Lisa G.; Natowicz, Marvin R.; Shen, Yiping; Morton, Cynthia C.; Gusella, James F.; Ernst, Carl

    2012-01-01

    Large intergenic noncoding (linc) RNAs represent a newly described class of ribonucleic acid whose importance in human disease remains undefined. We identified a severely developmentally delayed 16-year-old female with karyotype 46,XX,t(2;11)(p25.1;p15.1)dn in the absence of clinically significant copy number variants (CNVs). DNA capture followed by next-generation sequencing of the translocation breakpoints revealed disruption of a single noncoding gene on chromosome 2, LINC00299, whose RNA product is expressed in all tissues measured, but most abundantly in brain. Among a series of additional, unrelated subjects referred for clinical diagnostic testing who showed CNV affecting this locus, we identified four with exon-crossing deletions in association with neurodevelopmental abnormalities. No disruption of the LINC00299 coding sequence was seen in almost 14,000 control subjects. Together, these subjects with disruption of LINC00299 implicate this particular noncoding RNA in brain development and raise the possibility that, as a class, abnormalities of lincRNAs may play a significant role in human developmental disorders. PMID:23217328

  17. Adenovirus and mycoplasma infection in an ornate box turtle (Terrapene ornata ornata) in Hungary.

    Farkas, Szilvia L; Gál, János

    2009-07-01

    A female, adult ornate box turtle (Terrapene ornata ornata) with fatty liver was submitted for virologic examination in Hungary. Signs of an adenovirus infection including degeneration of the liver cells, enlarged nuclei and intranuclear inclusion bodies were detected by light microscopic examination. The presence of an adenovirus was later confirmed by obtaining partial sequence data from the adenoviral DNA-dependent DNA-polymerase. Phylogenetic analyses revealed that this novel chelonian adenovirus was distinct from previously described reptilian adenoviruses, not belonging to any of the recognized genera of the family Adenoviridae. As a part of the routine diagnostic procedure for chelonians the detection of herpes-, rana- and iridoviruses together with Mycoplasma spp. was attempted. Amplicons were generated by a general mycoplasma polymerase chain reaction (PCR) targeting the 16S/23S ribosomal RNA (rRNA) intergenic spacer region, as well as, a specific Mycoplasma agassizii PCR targeting the 16S rRNA gene. Based on the analyses of partial sequences of the 16S rRNA gene, the Mycoplasma sp. of the ornate box turtle seemed to be identical with the recently described eastern box turtle (Terrapene carolina carolina) Mycoplasma sp. This is the first report of a novel chelonian adenovirus and a mycoplasma infection in an ornate box turtle (T. ornata ornata) in Europe. PMID:19375875

  18. Molecular Epidemiology and Sequencing of the G-L Intergenic Region of Rabies Viruses Isolated in China

    Sheng-Li MENG; QI-You XIAO; Guan-Mu DONG; Ge-Lin XU; Jia-Xin YAN; Ping-Gang MING; Jie WU; Xiao-Ming YANG; He-Tian MING; Feng-Cai ZHU; Dun-Jin ZHOU

    2007-01-01

    A group of 25 rabies viruses (RABVs),recovered from 24 dogs and one human case,were collected from various areas in China between 2004 and 2006.Genetic and phylogenetic analyses of the G-L intergenic region were carried out in 25 street RABV isolates and CTN vaccine strains of 7 generations.The study was based on the comparison of a 519 bp nucleotide sequence,encompassing the G-L intergenic region.The nucleotide sequence homologies of Chinese street strains were from 95.5% to 100%.The phylogenetic analysis showed that all Chinese isolates clearly supported the placement of all Chinese viruses in Lyssavirus genotype 1 and they were distributed according to their geographical origins.All of the Chinese strains were closely related but they could still be divided into two groups:group of street strains and group of CTN strains.This study presents details about the molecular epidemiology of rabies viruses based on the sequences of the G-L Intergenic region.

  19. Phylogenetic relationships of Salmonella based on rRNA sequences

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    To establish the phylogenetic relationships between the subspecies of Salmonella enterica (official name Salmonella choleraesuis), Salmonella bongori and related members of Enterobacteriaceae, sequence comparison of rRNA was performed by maximum-likelihood analysis. The two Salmonella species were...

  20. Erwinia pyrifoliae sp. nov., a novel pathogen that affects Asian pear trees (Pyrus pyrifolia Nakai)

    Kim, W S; Gardan, L; Rhim, S L; Geider, K

    1999-04-01

    A novel pathogen from Asian pears (Pyrus pyrifolia Nakai) was analysed by sequencing the 16S rDNA and the adjacent intergenic region, and the data were compared to related Enterobacteriaceae. The 16S rDNA of the Asian pear pathogen was almost identical with the sequence of Erwinia amylovora, in contrast to the 16S-23S rRNA intergenic transcribed spacer region of both species. A dendrogram was deduced from determined sequences of the spacer regions including those of several related species such as Erwinia amylovora, Enterobacter pyrinus, Pantoea stewartii subsp. stewartii and Escherichia coli. Dendrograms derived from 121 biochemical characteristics including Biotype 100 data placed the Asian pear pathogen close to Erwinia amylovora and more distantly to other members of the species Erwinia and to the species Pantoea and Enterobacter. Another DNA relatedness study was performed by DNA hybridizations and estimation of delta Tm values. The Asian pear strains constituted a tight DNA hybridization group (89-100%) and were barely related to strains of Erwinia amylovora (40-50%) with a delta Tm in the range of 5.2-6.8. The G + C content of DNA from the novel pathogen is 52 mol%. Therefore, it is proposed that strains isolated from Asian pears constitute a new species and the name Erwinia pyrifoliae is suggested; the type strain is strain Ep 16/96T (= CFBP 4172T = DSM 12163T). PMID:10319516

  1. Genome-wide identification and characterization of long intergenic non-coding RNAs in Ganoderma lucidum.

    Jianqin Li

    Full Text Available Ganoderma lucidum is a white-rot fungus best-known for its medicinal activities. We have previously sequenced its genome and annotated the protein coding genes. However, long non-coding RNAs in G. lucidum genome have not been analyzed. In this study, we have identified and characterized long intergenic non-coding RNAs (lincRNA in G. lucidum systematically. We developed a computational pipeline, which was used to analyze RNA-Seq data derived from G. lucidum samples collected from three developmental stages. A total of 402 lincRNA candidates were identified, with an average length of 609 bp. Analysis of their adjacent protein-coding genes (apcGenes revealed that 46 apcGenes belong to the pathways of triterpenoid biosynthesis and lignin degradation, or families of cytochrome P450, mating type B genes, and carbohydrate-active enzymes. To determine if lincRNAs and these apcGenes have any interactions, the corresponding pairs of lincRNAs and apcGenes were analyzed in detail. We developed a modified 3' RACE method to analyze the transcriptional direction of a transcript. Among the 46 lincRNAs, 37 were found unidirectionally transcribed, and 9 were found bidirectionally transcribed. The expression profiles of 16 of these 37 lincRNAs were found to be highly correlated with those of the apcGenes across the three developmental stages. Among them, 11 are positively correlated (r>0.8 and 5 are negatively correlated (r<-0.8. The co-localization and co-expression of lincRNAs and those apcGenes playing important functions is consistent with the notion that lincRNAs might be important regulators for cellular processes. In summary, this represents the very first study to identify and characterize lincRNAs in the genomes of basidiomycetes. The results obtained here have laid the foundation for study of potential lincRNA-mediated expression regulation of genes in G. lucidum.

  2. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Smith, David R.; Lee, Robert W.; Cushman, John C.; Magnuson, Jon K.; Tran, Duc; Polle, Juergen E.

    2010-05-07

    Abstract Background: Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results: The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA) sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions: These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the development of a viable

  3. Molecular differentiation of Renibacterium salmoninarum isolates from worldwide locations.

    Grayson, T H; Cooper, L F; Atienzar, F A; Knowles, M R; Gilpin, M L

    1999-03-01

    Renibacterium salmoninarum is a genospecies that is an obligate pathogen of salmonid fish and is capable of intracellular survival. Conventional typing systems have failed to differentiate isolates of R. salmoninarum. We used two methods to assess the extent of molecular variation which was present in isolates from different geographic locations. In one analysis we investigated possible polymorphisms in a specific region of the genome, the intergenic spacer (ITS) region between the 16S and 23S rRNA genes. In the other analysis we analyzed differences throughout the genome by using randomly amplified polymorphic DNA (RAPD). We amplified the spacer region of 74 isolates by using PCR and performed a DNA sequence analysis with 14 geographically distinct samples. The results showed that the 16S-23S ribosomal DNA spacer region of R. salmoninarum is highly conserved and suggested that only a single copy of the rRNA operon is present in this slowly growing pathogen. DNA sequencing of the spacer region showed that it was the same length in all 14 isolates examined, and the same nucleotide sequence, sequevar 1, was obtained for 11 of these isolates. Two other sequevars were found. No tRNA genes were found. We found that RAPD analysis allows reproducible differentiation between isolates of R. salmoninarum obtained from different hosts and different geographic regions. By using RAPD analysis it was possible to differentiate between isolates with identical ITS sequences. PMID:10049848

  4. All-Trans Retinoic Acid Induces Expression of a Novel Intergenic Long Noncoding RNA in Adult rat Primary Hippocampal Neurons.

    Kour, Sukhleen; Rath, Pramod C

    2016-02-01

    Around 90% of the mammalian genome undergoes pervasive transcription into various types of small and long regulatory noncoding RNAs, whereas only ∼ 1.5% codes for proteins. Long noncoding RNAs (lncRNAs) constitute diverse classes of sense- and antisense transcripts that are abundantly expressed in the mammalian central nervous system (CNS) in cell type- and developmental stage-specific manners. They are implicated in brain development, differentiation, neuronal plasticity, and other cognitive functions. Mammalian brain requires the vitamin A metabolite all-trans retinoic acid (atRA) for its normal development, differentiation, and cell-fate determination. However, its role in adult brain function is less understood. Here, we report atRA-mediated transcriptional upregulation of endogenous expression of a novel long intergenic noncoding RNA-rat brain expressed (LINC-RBE) in cultured primary hippocampal neurons from adult rat. We have previously reported LINC-RBE as an intergenic, simple repeat sequence containing lncRNA highly expressed in the rat brain. This is a first-time report of involvement of atRA in transcriptional upregulation of lncRNA expression in rat hippocampal neurons. Therefore, it may be involved in regulation of brain function and disease. PMID:26572536

  5. rRNA fragmentation induced by a yeast killer toxin.

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  6. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  7. Genome-wide CpG island methylation and intergenic demethylation propensities vary among different tumor sites.

    Lee, Seung-Tae; Wiemels, Joseph L

    2016-02-18

    The epigenetic landscape of cancer includes both focal hypermethylation and broader hypomethylation in a genome-wide manner. By means of a comprehensive genomic analysis on 6637 tissues of 21 tumor types, we here show that the degrees of overall methylation in CpG island (CGI) and demethylation in intergenic regions, defined as 'backbone', largely vary among different tumors. Depending on tumor type, both CGI methylation and backbone demethylation are often associated with clinical, epidemiological and biological features such as age, sex, smoking history, anatomic location, histological type and grade, stage, molecular subtype and biological pathways. We found connections between CGI methylation and hypermutability, microsatellite instability, IDH1 mutation, 19p gain and polycomb features, and backbone demethylation with chromosomal instability, NSD1 and TP53 mutations, 5q and 19p loss and long repressive domains. These broad epigenetic patterns add a new dimension to our understanding of tumor biology and its clinical implications. PMID:26464434

  8. .i.Aulosira bohemensis./i. sp. nov.: further phylogenetic uncertainty at the base of the Nostocales (Cyanobacteria)

    Lukešová, Alena; Johansen, J. R.; Martin, M.P.; Casamatta, D.A.

    2009-01-01

    Roč. 48, č. 2 (2009), s. 118-129. ISSN 0031-8884 Institutional research plan: CEZ:AV0Z60660521 Keywords : Cyanobacteria * 16S rRNA gene * 16S-23S Internal transcribed spacer (ITS) Subject RIV: EH - Ecology, Behaviour Impact factor: 1.218, year: 2009

  9. Morphological and molecular characterization within 26 strains of the genus Cylindrospermum (Nostocaceae, Cyanobacteria), with description of three new species

    Johansen, J. R.; Bohunická, Markéta; Lukešová, Alena; Hrčková, Kristýna; Vaccarino, M. A.; Chesarino, N. M.

    2014-01-01

    Roč. 50, č. 1 (2014), s. 187-202. ISSN 0022-3646 Institutional support: RVO:67985939 ; RVO:60077344 Keywords : 16S rRNA gene * 16S-23S ITS * Nostocaceae * polyphasic approach Subject RIV: EF - Botanics; EE - Microbiology , Virology (BC-A) Impact factor: 2.844, year: 2014

  10. A cis-regulatory sequence from a short intergenic region gives rise to a strong microbe-associated molecular pattern-responsive synthetic promoter.

    Lehmeyer, Mona; Hanko, Erik K R; Roling, Lena; Gonzalez, Lilian; Wehrs, Maren; Hehl, Reinhard

    2016-06-01

    The high gene density in Arabidopsis thaliana leaves only relatively short intergenic regions for potential cis-regulatory sequences. To learn more about the regulation of genes harbouring only very short upstream intergenic regions, this study investigates a recently identified novel microbe-associated molecular pattern (MAMP)-responsive cis-sequence located within the 101 bp long intergenic region upstream of the At1g13990 gene. It is shown that the cis-regulatory sequence is sufficient for MAMP-responsive reporter gene activity in the context of its native promoter. The 3' UTR of the upstream gene has a quantitative effect on gene expression. In context of a synthetic promoter, the cis-sequence is shown to achieve a strong increase in reporter gene activity as a monomer, dimer and tetramer. Mutation analysis of the cis-sequence determined the specific nucleotides required for gene expression activation. In transgenic A. thaliana the synthetic promoter harbouring a tetramer of the cis-sequence not only drives strong pathogen-responsive reporter gene expression but also shows a high background activity. The results of this study contribute to our understanding how genes with very short upstream intergenic regions are regulated and how these regions can serve as a source for MAMP-responsive cis-sequences for synthetic promoter design. PMID:26833485

  11. Phylogenetic analysis of encapsulated and non-encapsulated Trichinella species by studying the 5S rDNA tandemly repeated intergenic region.

    van der Giessen, J W B; Fonville, M; Briels, I; Pozio, E

    2005-09-01

    The identification of sequence regions in the genomes of pathogens which can be useful to distinguish among species and genotypes, is of great importance for epidemiological, molecular, and phylogenetic studies. The 5S ribosomal DNA intergenic spacer region has been identified as a good target to distinguish among eight Trichinella species and genotypes. The recent discovery of two non-encapsulated species in this genus, Trichinella papuae and Trichinella zimbabwensis, which can infect both mammals and reptiles, has suggested analyzing their 5S rDNA. Amplification of the tandem repeats of the 5S rDNA intergenic region of encapsulated species of Trichinella shows a 751bp fragment, whereas the three non-encapsulated species show a fragment of 800bp with T. pseudospiralis showing an additional fragment of 522bp. Although the size of the 800bp PCR fragments of T. papuae and T. zimbabwensis are similar to that of T. pseudospiralis, there are differences in the 5S rDNA intergenic regions among the three non-encapsulated species. Phylogenetic analysis of the 5S rDNA intergenic regions shows a clustering together of the three non-encapsulated Trichinella species that is well separated from the encapsulated ones. In addition, a single PCR-based method allows distinguishing non-encapsulated and encapsulated species. PMID:16076532

  12. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    Triman, K; Becker, E; Dammel, C;

    1989-01-01

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alle...

  13. Optimization and head-to-head comparison of MISSR-PCR, ERIC-PCR, RAPD and 16S rRNA evolutionary clock for the genotyping of Vibrio cholerae isolated in China

    Q H Mo

    2015-01-01

    Full Text Available Purpose: To establish a new genotyping method for Vibrio cholerae and compare it with other methods. Materials and Methods: In the current study, a modified inter simple sequence repeat-polymerase chain reaction (MISSR-PCR system was developed via several rounds of optimisation. Comparison study was then conducted between MISSR-PCR and three other methods, including enterobacterial repetitive intergenic consensus sequences-based PCR (ERIC-PCR, randomly amplified polymorphic DNA (RAPD and 16S rRNA evolutionary clock, for the detection and genetic tracing of Vibrio cholerae isolated from seafood in China. Result: The results indicated that the MISSR-PCR system could generate the highest polymorphic fingerprinting map in a single round PCR and showed the best discriminatory ability for Vibrio cholerae genotyping by clearly separating toxigenic/nontoxigenic strains, local/foreign strains, and O1/O139/non-O1/non-O139 serogroup strains, comparing to ERIC-PCR, RAPD and 16S rRNA evolutionary clock. Moreover, the MISSR-PCR is superior to previously described traditional simple sequence repeat based PCR method on genotyping by more clearly separating different clusters. Conclusion: To the best of our knowledge, this is the first head-to-head comparison of four detection and genotyping methods for Vibrio cholerae The MISSR-PCR system established here could serve as a simple, quick, reliable and cost-effective tool for the genotyping and epidemiological study.

  14. 'View From A Bridge': A New Perspective on Eukaryotic rRNA Base Modification.

    Sharma, Sunny; Lafontaine, Denis L J

    2015-10-01

    Eukaryotic rRNA are modified frequently, although the diversity of modifications is low: in yeast rRNA, there are only 12 different types out of a possible natural repertoire exceeding 112. All nine rRNA base methyltransferases (MTases) and one acetyltransferase have recently been identified in budding yeast, and several instances of crosstalk between rRNA, tRNA, and mRNA modifications are emerging. Although the machinery has largely been identified, the functions of most rRNA modifications remain to be established. Remarkably, a eukaryote-specific bridge, comprising a single ribosomal protein (RP) from the large subunit (LSU), contacts four rRNA base modifications across the ribosomal subunit interface, potentially probing for their presence. We hypothesize in this article that long-range allosteric communication involving rRNA modifications is taking place between the two subunits during translation or, perhaps, the late stages of ribosome assembly. PMID:26410597

  15. Diversity and antimicrobial properties of lactic acid bacteria isolated from rhizosphere of olive trees and desert truffles of Tunisia.

    Fhoula, Imene; Najjari, Afef; Turki, Yousra; Jaballah, Sana; Boudabous, Abdelatif; Ouzari, Hadda

    2013-01-01

    A total of 119 lactic acid bacteria (LAB) were isolated, by culture-dependant method, from rhizosphere samples of olive trees and desert truffles and evaluated for different biotechnological properties. Using the variability of the intergenic spacer 16S-23S and 16S rRNA gene sequences, the isolates were identified as the genera Lactococcus, Pediococcus, Lactobacillus, Weissella, and Enterococcus. All the strains showed proteolytic activity with variable rates 42% were EPS producers, while only 10% showed the ability to grow in 9% NaCl. In addition, a low rate of antibiotic resistance was detected among rhizospheric enterococci. Furthermore, a strong antibacterial activity against plant and/or pathogenic bacteria of Stenotrophomonas maltophilia, Pantoea agglomerans, Pseudomonas savastanoi, the food-borne Staphylococcus aureus, and Listeria monocytogenes was recorded. Antifungal activity evaluation showed that Botrytis cinerea was the most inhibited fungus followed by Penicillium expansum, Verticillium dahliae, and Aspergillus niger. Most of the active strains belonged to the genera Enterococcus and Weissella. This study led to suggest that environmental-derived LAB strains could be selected for technological application to control pathogenic bacteria and to protect food safety from postharvest deleterious microbiota. PMID:24151598

  16. Development of a quantitative PCR assay for monitoring Streptococcus agalactiae colonization and tissue tropism in experimentally infected tilapia.

    Su, Y-L; Feng, J; Li, Y-W; Bai, J-S; Li, A-X

    2016-02-01

    Streptococcus agalactiae has become one of the most important emerging pathogens in the aquaculture industry and has resulted in large economic losses for tilapia farms in China. In this study, three pairs of specific primers were designed and tested for their specificities and sensitivities in quantitative real-time polymerase chain reactions (qPCRs) after optimization of the annealing temperature. The primer pair IGS-s/IGS-a, which targets the 16S-23S rRNA intergenic spacer region, was finally chosen, having a detection limit of 8.6 copies of S. agalactiae DNA in a 20 μL reaction mixture. Bacterial tissue tropism was demonstrated by qPCR in Oreochromis niloticus 5 days post-injection with a virulent S. agalactiae strain. Bacterial loads were detected at the highest level in brain, followed by moderately high levels in kidney, heart, spleen, intestines, and eye. Significantly lower bacterial loads were observed in muscle, gill and liver. In addition, significantly lower bacterial loads were observed in the brain of convalescent O. niloticus 14 days post-injection with several different S. agalactiae strains. The qPCR for the detection of S. agalactiae developed in this study provides a quantitative tool for investigating bacterial tissue tropism in infected fish, as well as for monitoring bacterial colonization in convalescent fish. PMID:25858765

  17. Diversity and Antimicrobial Properties of Lactic Acid Bacteria Isolated from Rhizosphere of Olive Trees and Desert Truffles of Tunisia

    Imene Fhoula

    2013-01-01

    Full Text Available A total of 119 lactic acid bacteria (LAB were isolated, by culture-dependant method, from rhizosphere samples of olive trees and desert truffles and evaluated for different biotechnological properties. Using the variability of the intergenic spacer 16S-23S and 16S rRNA gene sequences, the isolates were identified as the genera Lactococcus, Pediococcus, Lactobacillus, Weissella, and Enterococcus. All the strains showed proteolytic activity with variable rates 42% were EPS producers, while only 10% showed the ability to grow in 9% NaCl. In addition, a low rate of antibiotic resistance was detected among rhizospheric enterococci. Furthermore, a strong antibacterial activity against plant and/or pathogenic bacteria of Stenotrophomonas maltophilia, Pantoea agglomerans, Pseudomonas savastanoi, the food-borne Staphylococcus aureus, and Listeria monocytogenes was recorded. Antifungal activity evaluation showed that Botrytis cinerea was the most inhibited fungus followed by Penicillium expansum, Verticillium dahliae, and Aspergillus niger. Most of the active strains belonged to the genera Enterococcus and Weissella. This study led to suggest that environmental-derived LAB strains could be selected for technological application to control pathogenic bacteria and to protect food safety from postharvest deleterious microbiota.

  18. Molecular identification of Lactobacillus spp. associated with puba, a Brazilian fermented cassava food

    S.M. Crispim

    2013-01-01

    Full Text Available Puba or carimã is a Brazilian staple food obtained by spontaneous submerged fermentation of cassava roots. A total of 116 lactobacilli and three cocci isolates from 20 commercial puba samples were recovered on de Man, Rogosa and Sharpe agar (MRS; they were characterized for their antagonistic activity against foodborne pathogens and identified taxonomically by classical and molecular methods. In all samples, lactic acid bacteria were recovered as the dominant microbiota (7.86 ± 0.41 log10 CFU/g. 16S-23S rRNA ARDRA pattern assigned 116 isolates to the Lactobacillus genus, represented by the species Lactobacillus fermentum (59 isolates, Lactobacillus delbrueckii (18 isolates, Lactobacillus casei (9 isolates, Lactobacillus reuteri (6 isolates, Lactobacillus brevis (3 isolates, Lactobacillus gasseri (2 isolates, Lactobacillus nagelii (1 isolate, and Lactobacillus plantarum group (18 isolates. recA gene-multiplex PCR analysis revealed that L. plantarum group isolates belonged to Lactobacillus plantarum (15 isolates and Lactobacillus paraplantarum (3 isolates. Genomic diversity was investigated by molecular typing with rep (repetitive sequence-based PCR using the primer ERIC2 (enterobacterial repetitive intergenic consensus. The Lactobacillus isolates exhibited genetic heterogeneity and species-specific fingerprint patterns. All the isolates showed antagonistic activity against the foodborne pathogenic bacteria tested. This antibacterial effect was attributed to acid production, except in the cases of three isolates that apparently produced bacteriocin-like inhibitory substances. This study provides the first insight into the genetic diversity of Lactobacillus spp. of puba.

  19. Detection of Bartonella henselae and Bartonella clarridgeiae DNA in hepatic specimens from two dogs with hepatic disease.

    Gillespie, Tracey N; Washabau, Robert J; Goldschmidt, Michael H; Cullen, John M; Rogala, Allison R; Breitschwerdt, Edward B

    2003-01-01

    A 4-year-old Basset Hound and a 6-year-old Doberman Pinscher were referred for diagnostic evaluation following documentation of persistently increased hepatic enzyme activities and hepatic dysfunction. Histologic evaluation of hepatic biopsy specimens from the 2 dogs revealed granulomatous hepatitis in the Basset Hound and lymphocytic hepatitis with fibrosis and copper accumulation in the Doberman Pinscher. No etiologic agents were identified histologically. Bartonella henselae DNA was subsequently amplified from hepatic tissue from the Basset Hound and Bartonella clarridgeiae was amplified from hepatic tissue from the Doberman Pinscher. Amplification was performed with a polymerase chain reaction assay incorporating primers that target a portion of the 16S-23S rRNA intergenic spacer region. Both dogs were treated with azithromycin, in combination with a variety of other medications and herbal treatments, and improved clinically. Identification of Bartonella DNA in these dogs indicates the need for future prospective studies to determine the clinical relevance of Bartonella spp infection in dogs with hepatic disease. PMID:12523479

  20. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  1. Expressing activity of promoter elements of large intergenic region from cotton leaf curl virus in host plant*

    2001-01-01

    Cotton leaf curl virus (CLCuV) is a type of single-stranded DNAvirus, belonging to geminivirus of subgroup III. In order to determine the function of CLCuV large intergenic region (LIR), total DNA of CLCuV-infected cotton leaves was used as template, and fragment of LIR was obtained by PCR and inserted into clone vector. The fragment of LIR was fused with gus reporter gene and nos terminator in the orientation of transcription of virion sense and complementary sense respectively, and the plant expression vectors were constructed. GUS activity of Agrobacterium-mediated transgenic tobacco was measured. The result indicated that LIR showed strong promoter activity in complementary sense gene orientation. Average GUS activity of the complementary sense promoter was 5-6 times that of CaMV 35S promoter, and the highest GUS activity of individual plant was ten times of that of CaMV 35S promoter. Histochemical localization confirmed its activity in both mesophyll and vascular tissues. Activity of virion sense of LIR was rather low. Thus LIR isolated from CLCuV could be used as a novel strong promoter in plant genetic manipulation.

  2. A New Intergenic α-Globin Deletion (α-α(Δ125)) Found in a Kabyle Population.

    Rabbind Singh, Amrathlal; Lacan, Philippe; Cadet, Estelle; Bignet, Patricia; Dumesnil, Cécile; Vannier, Jean-Pierre; Joly, Philippe; Rochette, Jacques

    2016-03-01

    We have identified a deletion of 125 bp (α-α(Δ125)) (NG_000006.1: g.37040_37164del) in the α-globin gene cluster in a Kabyle population. A combination of singlex and multiplex polymerase chain reaction (PCR)-based assays have been used to identify the molecular defect. Sequencing of the abnormal PCR amplification product revealed a novel α1-globin promoter deletion. The endpoints of the deletion were characterized by sequencing the deletion junctions of the mutated allele. The observed deletion was located 378 bp upstream of the α1-globin gene transcription initiation site and leaves the α2 gene intact. In some patients, the α-α(Δ125) deletion was shown to segregate with Hb S (HBB: c.20A>T) and/or Hb C (HBB: c.19G>A) or a β-thalassemic allele. The α-α(Δ125) deletion has no discernible effect on red cell indices when inherited with no other abnormal globin genes. The family study demonstrated that the deletion is heritable. This is the only example of an intergenic α2-α1 non coding DNA deletion, leaving the α2-globin gene and the α1 coding part intact. PMID:26911300

  3. Genetic Diversity in Salmonella Isolates from Ducks and their Environments in Penang, Malaysia using Enterobacterial Repetitive Intergenic Consensus

    Frederick Adzitey 1, Gulam Rusul Rahmat Ali2*, Nurul Huda2 and Rosma Ahmad3

    2013-07-01

    Full Text Available A total of 107 Salmonella isolates (37 S. typhimurium, 26 S. hadar, 15 S. enteritidis, 15 S. braenderup, and 14 S. albany isolated from ducks and their environments in Penang, Malaysia were typed using enterobacterial repetitive intergenic consensus (ERIC to determine their genetic diversity. Analysis of the Salmonella strains by ERIC produced DNA fingerprints of different sizes for differentiation purposes. The DNA fingerprints or band sizes ranged from 14-8300bp for S. Typhimurium, 146-6593bp for S. hadar, 15-4929bp for S. enteritidis, 14-5142bp for S. braenderup and 7-5712bp for S. albany. Cluster analysis at a coefficient of 0.85 grouped the Salmonella strains into various clusters and singletons. S. typhimurium were grouped into 10 clusters and 6 singletons, S. Hadar were grouped into 3 clusters and 18 singletons, S. enteritidis were grouped into 3 clusters and 7 singletons, S. braenderup were grouped into 4 clusters and 7 singletons, and S. albany were grouped into 3 clusters and 7 singletons with discriminatory index (D ranging from 0.92-0.98. ERIC proved to be a useful typing tool for determining the genetic diversity of the duck Salmonella strains.

  4. Genome-wide identification and characterization of long intergenic noncoding RNAs and their potential association with larval development in the Pacific oyster

    Yu, Hong; Zhao, Xuelin; Li, Qi

    2016-01-01

    An increasing amount of evidence suggests that long intergenic noncoding RNAs (lincRNAs) may play diverse roles in many cellular processes. However, little is known about lincRNAs in marine invertebrates. Here, we presented the first identification and characterization of lincRNAs in the Pacific oyster (Crassostrea gigas). We developed a pipeline and identified 11,668 lincRNAs in C. gigas based on RNA-Seq resources available. These lincRNAs exhibited many common characteristics with vertebrat...

  5. Identification of SmtB/ArsR cis elements and proteins in archaea using the Prokaryotic InterGenic Exploration Database (PIGED)

    Bose, Michael; Slick, David; Sarto, Mickey J.; Roberts, David; Roberts, Jacqueline; Barber, Robert D.

    2006-01-01

    Microbial genome sequencing projects have revealed an apparently wide distribution of SmtB/ArsR metal-responsive transcriptional regulators among prokaryotes. Using a position-dependent weight matrix approach, prokaryotic genome sequences were screened for SmtB/ArsR DNA binding sites using data derived from intergenic sequences upstream of orthologous genes encoding these regulators. Sixty SmtB/ArsR operators linked...

  6. Identification of SmtB/ArsR cis elements and proteins in archaea using the Prokaryotic InterGenic Exploration Database (PIGED)

    Michael Bose; David Slick; Sarto, Mickey J.; Patrick Murphy; David Roberts; Jacqueline Roberts; Barber, Robert D.

    2006-01-01

    Microbial genome sequencing projects have revealed an apparently wide distribution of SmtB/ArsR metal-responsive transcriptional regulators among prokaryotes. Using a position-dependent weight matrix approach, prokaryotic genome sequences were screened for SmtB/ArsR DNA binding sites using data derived from intergenic sequences upstream of orthologous genes encoding these regulators. Sixty SmtB/ArsR operators linked to metal detoxification genes, including nine among various archaeal species,...

  7. High throughput 16S rRNA gene amplicon sequencing

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup;

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r...... belonging to the phylum Chloroflexi. Based on knowledge about their ecophysiology, other control measures were introduced and the bulking problem was reduced after 2 months. Besides changes in the filament abundance and composition also other changes in the microbial community were observed that likely...... correlated with the bacterial species composition in 25 Danish full-scale WWTPs with nutrient removal. Examples of properties were SVI, filament index, floc size, floc strength, content of cations and amount of extracellular polymeric substances. Multivariate statistics provided several important insights...

  8. Fragmentation of 23S rRNA in Strains of Proteus and Providencia Results from Intervening Sequences in the rrn (rRNA) Genes

    Miller, Wayne L.; Pabbaraju, Kanti; Sanderson, Kenneth E.

    2000-01-01

    Intervening sequences (IVSs) were originally identified in the rrl genes for 23S rRNA (rrl genes, for large ribosomal subunit, part of rrn operon encoding rRNA) of Salmonella enterica serovars Typhimurium LT2 and Arizonae. These sequences are transcribed but later removed during RNase III processing of the rRNA, resulting in fragmentation of the 23S species; IVSs are uncommon, but have been reported in at least 10 bacterial genera. Through PCR amplification of IVS-containing regions of the rr...

  9. Louse (Insecta : Phthiraptera) mitochondrial 12S rRNA secondary structure is highly variable

    Page, R.D.M.; Cruickshank, R.; Johnson, K P

    2002-01-01

    Lice are ectoparasitic insects hosted by birds and mammals. Mitochondrial 12S rRNA sequences obtained from lice show considerable length variation and are very difficult to align. We show that the louse 12S rRNA domain III secondary structure displays considerable variation compared to other insects, in both the shape and number of stems and loops. Phylogenetic trees constructed from tree edit distances between louse 12S rRNA structures do not closely resemble trees constructed from sequence ...

  10. Fragmentations of the large-subunit rRNA in the family Rhizobiaceae.

    Selenska-Pobell, S; Evguenieva-Hackenberg, E

    1995-01-01

    A 130-nucleotide-long rRNA species corresponding to the 5' end of the 23S rRNA gene was found in 96 strains belonging to different Rhizobium, Bradyrhizobium, and Agrobacterium species. Additional fragmentation in the central region of the large-subunit rRNA occurred in all agrobacteria, except Agrobacterium vitis, and in most Rhizobium leguminosarum and Rhizobium etli strains but did not occur in any of the other rhizobia and bradyrhizobia studied.

  11. Cyanobacterial Diversity and a New Acaryochloris-Like Symbiont from Bahamian Sea-Squirts

    Susanna López-Legentil; Bongkeun Song; Manel Bosch; Joseph R Pawlik; Xavier Turon

    2011-01-01

    Symbiotic interactions between ascidians (sea-squirts) and microbes are poorly understood. Here we characterized the cyanobacteria in the tissues of 8 distinct didemnid taxa from shallow-water marine habitats in the Bahamas Islands by sequencing a fragment of the cyanobacterial 16S rRNA gene and the entire 16S-23S rRNA internal transcribed spacer region (ITS) and by examining symbiont morphology with transmission electron (TEM) and confocal microscopy (CM). As described previously for other s...

  12. Rapid Identification of Pathogenic Bacteria by means of Two Conservative Gene Loci' Specific PCR-CE-RFLP

    高鹏; 张卓然; 徐维家; 安万新; 张晓慧; 戴兵; 范艳萍; 王运锋; 李萍; 温杰; 于卫健; 高向仪; 谢凡迪; 王永海

    2003-01-01

    To establish a rapid identification method for common pathogenic bacteria on the basis of molecular biology and to construct a preliminary Polymerase Chain Reaction-Capillary Electrophoresis-Restriction Fragment Length Polymorphism (PCR-CE-RFLP) database of bacteria isolated from clinical specimens frequently, 183 strains collected from clinical samples belonging to 12 genera and 19 species whose biochemical characterizations corresponded to the typical ones were examined.The genomic DNAs were amplified by two pairs of fluorescence labeled primers aiming at 16S rRNA gene and 16S-23S rRNA spacer region gene respectively at the same time. PCR products were then digested by restriction endonuclease Hae Ⅲ in-completely before taking capillary electrophoresis. The results with the PCR-CE-RFLP patterns of 16S rRNA genes were just alike within some genera, but when it comes to 16S-23S rRNA spacer region genes, each bacterium showed a unique pattern, which can be distinguished from each other easily. It seems that PCR-CE-RFLP patterns of 16S rRNA gene could only be used to classify the bacteria into family level, whereas the data of 16S-23S rRNA spacer region gene could be utilized to identify the whole microorganisms as precisely as the species level. In spite of the data of the spacer region gene alone can be sufficiently to verify the whole bacteria, we insist that the 16S rRNA gene could be of some assistant in case that there should be lots of families of bacteria, in which some similar ones, with the same RFLP data of 16S-23S rRNA spacer region gene, may coexist. This study proves that the utility of PCR-CE-RFLP is a convenient, rapid method to identify pathogenic bacteria, and is also a quick diagnosis measure for application to clinical use.

  13. Characterization of rhizobia from legumes of agronomic interest grown in semi-arid areas of Central Spain relates genetic differences to soil properties.

    Ruiz-Díez, Beatriz; Fajardo, Susana; Felipe, María del Rosario de; Fernández-Pascual, Mercedes

    2012-02-01

    A study of symbiotic bacteria from traditional agricultural legumes from Central Spain was performed to create a collection of rhizobia from soils differing in physicochemical, analytical and/or agroecological properties which could be well-adapted to the environmental conditions of this region, and be used for sustainable agricultural practices. Thirty-six isolates were obtained from root-nodules of fifteen legume species (including Cicer arietinum, Lathyrus sativus, Lens culinaris, Lupinus spp., Medicago sativa, Phaseolus vulgaris, Pisum sativum, and Vicia spp.) from three agriculture areas with soils of different pHs and from a forest area with undisturbed soils. Phenotypical characterization revealed uniformity across the thirty-six isolates, with important exceptions in terms of environmental tolerance (three isolates survived at high temperatures, three at high salinity and three at acid pH). The molecular analysis of 16S rRNA gene showed a close relationship of twenty-nine isolates to Rhizobium leguminosarum, one to Rhizobium gallicum, one to Mesorhizobium ciceri, two to Sinorhizobium (Ensifer) meliloti and three to Bradyrhizobium canariense. The sequence analysis of a symbiosis-specific gene, nod C, showed a correlation with the plant host and grouped twenty-six isolates with Rhizobium leguminosarum bv. viciae, establishing the diversity in relation to legume-host. The 16S-23S rRNA intergenic spacer (IGS) region allowed for intraspecific differentiation, so that strains with equal 16S rRNA were grouped by means of their soil origin. These results indicated that phenotypical and genetically related strains may be widely distributed in this region and that soil abiotic characteristics could have a substantial bearing on the selection of the strains living in each environment. PMID:21953333

  14. Microbial analysis of bite marks by sequence comparison of streptococcal DNA.

    Darnell M Kennedy

    Full Text Available Bite mark injuries often feature in violent crimes. Conventional morphometric methods for the forensic analysis of bite marks involve elements of subjective interpretation that threaten the credibility of this field. Human DNA recovered from bite marks has the highest evidentiary value, however recovery can be compromised by salivary components. This study assessed the feasibility of matching bacterial DNA sequences amplified from experimental bite marks to those obtained from the teeth responsible, with the aim of evaluating the capability of three genomic regions of streptococcal DNA to discriminate between participant samples. Bite mark and teeth swabs were collected from 16 participants. Bacterial DNA was extracted to provide the template for PCR primers specific for streptococcal 16S ribosomal RNA (16S rRNA gene, 16S-23S intergenic spacer (ITS and RNA polymerase beta subunit (rpoB. High throughput sequencing (GS FLX 454, followed by stringent quality filtering, generated reads from bite marks for comparison to those generated from teeth samples. For all three regions, the greatest overlaps of identical reads were between bite mark samples and the corresponding teeth samples. The average proportions of reads identical between bite mark and corresponding teeth samples were 0.31, 0.41 and 0.31, and for non-corresponding samples were 0.11, 0.20 and 0.016, for 16S rRNA, ITS and rpoB, respectively. The probabilities of correctly distinguishing matching and non-matching teeth samples were 0.92 for ITS, 0.99 for 16S rRNA and 1.0 for rpoB. These findings strongly support the tenet that bacterial DNA amplified from bite marks and teeth can provide corroborating information in the identification of assailants.

  15. Novel mutation in 16S rRNA associated with streptomycin dependence in Mycobacterium tuberculosis.

    Honoré, N; Marchal, G.; Cole, S T

    1995-01-01

    Molecular characterization of a streptomycin-dependent mutant of Mycobacterium tuberculosis revealed the presence of a novel mutation in the rrs gene encoding 16S rRNA. Insertion of an additional cytosine in the 530 loop of 16S rRNA, a region known to be involved in streptomycin susceptibility and resistance, was associated with streptomycin dependence.

  16. The effect of secondary compounds on the rumen microbial population structure measured by 16S rRNA and 18S rRNA

    Full text: Plant secondary compounds in the forages have an important role in determining forage quality. A method for evaluating their effects on microbial population structure was carried out using the in vitro gas syringe system followed by extraction of RNA and gel separation of 16S rRNA and 18S rRNA. Quantification of 16S rRNA and 18S rRNA bands indicated the prokaryote and eukaryote populations, respectively. Five types of plant materials, i.e. Nothopanax scutellarium (Mangkokan) leaves, Morinda citrifolia (Mengkudu) fruit, Sapindus rarak (lerak) fruit and two types of Sesbania sesban leaves (hgh saponin and low saponin) were tested and Pennisetum purpureum (rumput gajah, Indonesian name) was used as a control roughage. Presence of saponin in these plant materials was determined qualitatively by thin layer chromatography. Eukaryote population was found to be significantly affected by the above plant materials. Both types of S. sesban leaves caused total elimination of eukaryotes. S. rarak reduced both eukaryote and prokaryote populations. The observed inhibition of eukaryote population might be due to the presence of saponin in these plant materials. In another experiment, a methanol extract of S. rarak which contained saponin was included and its effect on in vitro fermentation of P. purpureum was evaluated. The results showed that at higher levels of inclusion of S. rarak methanol extract, eukaroytes were totally eliminated. Comparison was made between microbial mass calculated based on difference between apparent undigested residue and true undigested residue and microbial mass calculations based on 16S rRNA and 18S rRNA. Microbial mass calculated by difference method was much higher than the microbial mass calculated on the basis of 16S rRNA and 18S rRNA. The quantification of RNA can be a useful and rapid technique for an accurate assessment of the effect of new forage materials on the microbial population structure. Other parameters from in vitro

  17. An evaluation of logic regression-based biomarker discovery across multiple intergenic regions for predicting host specificity in Escherichia coli.

    Zhi, Shuai; Li, Qiaozhi; Yasui, Yutaka; Banting, Graham; Edge, Thomas A; Topp, Edward; McAllister, Tim A; Neumann, Norman F

    2016-10-01

    Several studies have demonstrated that E. coli appears to display some level of host adaptation and specificity. Recent studies in our laboratory support these findings as determined by logic regression modeling of single nucleotide polymorphisms (SNP) in intergenic regions (ITGRs). We sought to determine the degree of host-specific information encoded in various ITGRs across a library of animal E. coli isolates using both whole genome analysis and a targeted ITGR sequencing approach. Our findings demonstrated that ITGRs across the genome encode various degrees of host-specific information. Incorporating multiple ITGRs (i.e., concatenation) into logic regression model building resulted in greater host-specificity and sensitivity outcomes in biomarkers, but the overall level of polymorphism in an ITGR did not correlate with the degree of host-specificity encoded in the ITGR. This suggests that distinct SNPs in ITGRs may be more important in defining host-specificity than overall sequence variation, explaining why traditional unsupervised learning phylogenetic approaches may be less informative in terms of revealing host-specific information encoded in DNA sequence. In silico analysis of 80 candidate ITGRs from publically available E. coli genomes was performed as a tool for discovering highly host-specific ITGRs. In one ITGR (ydeR-yedS) we identified a SNP biomarker that was 98% specific for cattle and for which 92% of all E. coli isolates originating from cattle carried this unique biomarker. In the case of humans, a host-specific biomarker (98% specificity) was identified in the concatenated ITGR sequences of rcsD-ompC, ydeR-yedS, and rclR-ykgE, and for which 78% of E. coli originating from humans carried this biomarker. Interestingly, human-specific biomarkers were dominant in ITGRs regulating antibiotic resistance, whereas in cattle host-specific biomarkers were found in ITGRs involved in stress regulation. These data suggest that evolution towards host

  18. Genetic diversity, inter-gene pool introgression and nutritional quality of common beans (Phaseolus vulgaris L.) from Central Africa.

    Blair, Matthew W; González, Laura F; Kimani, Paul M; Butare, Louis

    2010-07-01

    The Great Lakes region of Central Africa is a major producer of common beans in Africa. The region is known for high population density and small average farm size. The common bean represents the most important legume crop of the region, grown on over a third of the cultivated land area, and the per capita consumption is among the highest in the world for the food crop. The objective of this study was to evaluate the genetic diversity in a collection of 365 genotypes from the Great Lakes region of Central Africa, including a large group of landraces from Rwanda as well as varieties from primary centers of diversity and from neighboring countries of Central Africa, such as the Democratic Republic of Congo and Uganda, using 30 fluorescently labeled microsatellite markers and automated allele detection. In addition, the landraces were evaluated for their seed iron and zinc concentration to determine if genetic diversity influenced nutritional quality. Principal coordinate and neighbor-joining analyses allowed the separation of the landraces into 132 Andean and 195 Mesoamerican (or Middle American) genotypes with 32 landraces and 6 varieties intermediate between the gene pools and representing inter-gene pool introgression in terms of seed characteristics and alleles. Genetic diversity and the number of alleles were high for the collection, reflecting the preference for a wide range of seed types in the region and no strong commercial class preference, although red, red mottled and brown seeded beans were common. Observed heterozygosity was also high and may be explained by the common practice of maintaining seed and plant mixtures, a coping strategy practiced by Central African farmers to reduce the effects of abiotic and biotic stresses. Finally, nutritional quality differed between the gene pools with respect to seed iron and zinc concentration, while genotypes from the intermediate group were notably high in both minerals. In conclusion, this study has shown that

  19. Subnuclear partitioning of rRNA genes between the nucleolus and nucleoplasm reflects alternative epiallelic states

    Pontvianne, Frederic; Blevins, Todd; Chandrasekhara, Chinmayi; Mozgová, Iva; Hassel, Christiane; Pontes, Olga M.F.; Tucker, Sarah; Mokroš, Petr; Muchová, Veronika; Fajkus, Jiří; Pikaard, Craig S.

    2013-01-01

    Eukaryotes can have thousands of 45S ribosomal RNA (rRNA) genes, many of which are silenced during development. Using fluorescence-activated sorting techniques, we show that active rRNA genes in Arabidopsis thaliana are present within sorted nucleoli, whereas silenced rRNA genes are excluded. DNA methyltransferase (met1), histone deacetylase (hda6), or chromatin assembly (caf1) mutants that disrupt silencing abrogate this nucleoplasmic–nucleolar partitioning. Bisulfite sequencing data indicate that active nucleolar rRNA genes are nearly completely demethylated at promoter CGs, whereas silenced genes are nearly fully methylated. Collectively, the data reveal that rRNA genes occupy distinct but changeable nuclear territories according to their epigenetic state. PMID:23873938

  20. Characterization of Francisella sp., GM2212, the first Francisella isolate from marine fish, Atlantic cod (Gadus morhua)

    Ottem, Karl F; Nylund, Are; Karlsbakk, Egil;

    2007-01-01

    A Francisella sp., isolate GM2212(T), previously isolated from diseased farmed Atlantic cod Gadus morhua in Norway is characterized. The complete 16S rDNA, 16S-23S intergenic spacer, 23S rDNA, 23S-5S intergenic spacer, 5S rDNA, FopA, lipoprotein TUL4 (LpnA), malate dehydrogenase and a hypothetica......; but is susceptible to ceftazidime, tetracycline, gentamicin, ciprofloxacin. Based on the molecular and phenotypical characteristics, we suggest that this GM2212 isolate, may represent a new species of Francisella. Isolate GM2212(T) (=CNCM I-3481(T) = CNCM I-3511(T) = DSM 18777(T))....

  1. Phylogeny of Panax using chloroplast trnC-trnD intergenic region and the utility of trnC-trnD in interspecific studies of plants.

    Lee, Chunghee; Wen, Jun

    2004-06-01

    Sequences of the chloroplast trnC-trnD region and the internal transcribed spacer (ITS) regions of nuclear ribosomal DNA were obtained for all species of Panax L. (the ginseng plant genus, Araliaceae) to reconstruct phylogenetic relationships. The trnC-trnD phylogeny is congruent with the ITS phylogeny for the diploid taxa of Panax. This study is the first use of the trnC-trnD sequence data for phylogenetic analysis at the interspecific level. We evaluated this DNA region for its phylogenetic utility at the lower taxonomic level for flowering plants. The trnC-trnD region includes the trnC-petN intergenic spacer, the petN gene, the petN-psbM intergenic spacer, the psbM gene, and the psbM-trnD intergenic spacer. The petN and psbM genes are small, 90 and 104-114 bp across angiosperms, respectively, and have conserved sequences. We have designed universal amplification and sequencing primers within these two genes. Using these primers, we have successfully amplified the entire trnC-trnD region for a diversity of flowering plant groups, including Aralia L. (Araliaceae), Calycanthus L. (Calycanthaceae), Corylus L. (Betulaceae), Hamamelis L. (Hamamelidaceae), Hydrocotyle L. (Apiaceae), Illigera Blume (Hernandiaceae), Nelumbo Adans. (Nelumbonaceae), Nolana L. ex L.f. (Solanaceae), Prunus L. (Rosaceae), and Staphylea L. (Staphyleaceae). In Panax, the trnC-trnD region provides a similar number of informative phylogenetic characters as the ITS regions and a slightly higher number of informative characters than the chloroplast ndhF gene. We thus demonstrate the utility of the trnC-trnD region for lower-level phylogenetic studies in flowering plants. PMID:15120387

  2. Assessing host-specificity of Escherichia coli using a supervised learning logic-regression-based analysis of single nucleotide polymorphisms in intergenic regions.

    Zhi, Shuai; Li, Qiaozhi; Yasui, Yutaka; Edge, Thomas; Topp, Edward; Neumann, Norman F

    2015-11-01

    Host specificity in E. coli is widely debated. Herein, we used supervised learning logic-regression-based analysis of intergenic DNA sequence variability in E. coli in an attempt to identify single nucleotide polymorphism (SNP) biomarkers of E. coli that are associated with natural selection and evolution toward host specificity. Seven-hundred and eighty strains of E. coli were isolated from 15 different animal hosts. We utilized logic regression for analyzing DNA sequence data of three intergenic regions (flanked by the genes uspC-flhDC, csgBAC-csgDEFG, and asnS-ompF) to identify genetic biomarkers that could potentially discriminate E. coli based on host sources. Across 15 different animal hosts, logic regression successfully discriminated E. coli based on animal host source with relatively high specificity (i.e., among the samples of the non-target animal host, the proportion that correctly did not have the host-specific marker pattern) and sensitivity (i.e., among the samples from a given animal host, the proportion that correctly had the host-specific marker pattern), even after fivefold cross validation. Permutation tests confirmed that for most animals, host specific intergenic biomarkers identified by logic regression in E. coli were significantly associated with animal host source. The highest level of biomarker sensitivity was observed in deer isolates, with 82% of all deer E. coli isolates displaying a unique SNP pattern that was 98% specific to deer. Fifty-three percent of human isolates displayed a unique biomarker pattern that was 98% specific to humans. Twenty-nine percent of cattle isolates displayed a unique biomarker that was 97% specific to cattle. Interestingly, even within a related host group (i.e., Family: Canidae [domestic dogs and coyotes]), highly specific SNP biomarkers (98% and 99% specificity for dog and coyotes, respectively) were observed, with 21% of dog E. coli isolates displaying a unique dog biomarker and 61% of coyote isolates

  3. Genome-wide characterization of long intergenic non-coding RNAs (lincRNAs) provides new insight into viral diseases in honey bees Apis cerana and Apis mellifera

    Jayakodi, Murukarthick; Jung, Je Won; Park, Doori; Ahn, Young-Joon; Lee, Sang-Choon; Shin, Sang-Yoon; Shin, Chanseok; Yang, Tae-Jin; Kwon, Hyung Wook

    2015-01-01

    Background Long non-coding RNAs (lncRNAs) are a class of RNAs that do not encode proteins. Recently, lncRNAs have gained special attention for their roles in various biological process and diseases. Results In an attempt to identify long intergenic non-coding RNAs (lincRNAs) and their possible involvement in honey bee development and diseases, we analyzed RNA-seq datasets generated from Asian honey bee (Apis cerana) and western honey bee (Apis mellifera). We identified 2470 lincRNAs with an a...

  4. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    Cangelosi, G A; Brabant, W H

    1997-07-01

    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA probes to measure steady-state cellular pre-16S rRNA pools during growth state transitions in Escherichia coli. Pre-16S rRNA became undetectable when cells entered the stationary phase on rich medium and was replenished upon restoration of favorable growth conditions. These fluctuations were of much greater magnitude than concurrent fluctuations in the mature 16S rRNA pool. The extent of pre-16S rRNA depletion depended upon the circumstances limiting growth. It was significantly more pronounced in carbon-energy-starved cells than in nitrogen-starved cells or in cells treated with energy uncouplers. In the presence of the transcriptional inhibitor rifampin, rates of pre-16S rRNA depletion in carbon-energy-starved cells and nitrogen-starved cells were similar, suggesting that the difference between these conditions resides primarily at the level of pre-rRNA synthesis. Chloramphenicol, which inhibits the final steps in rRNA maturation, halted pre-16S rRNA depletion under all conditions. The data show that E. coli cells continue to process pre-rRNA after growth and rrn operon transcription cease, leading to drainage of the pre-rRNA pool. This supports the feasibility of using pre-rRNA-targeted probes to monitor bacterial growth in natural systems, with the caveat that patterns of pre-rRNA depletion vary with the conditions limiting growth. PMID:9226253

  5. Epidemiology of vampire bat-transmitted rabies virus in Goiás, central Brazil: re-evaluation based on G-L intergenic region

    Ito Fumio H

    2010-11-01

    Full Text Available Abstract Background Vampire bat related rabies harms both livestock industry and public health sector in central Brazil. The geographical distributions of vampire bat-transmitted rabies virus variants are delimited by mountain chains. These findings were elucidated by analyzing a high conserved nucleoprotein gene. This study aims to elucidate the detailed epidemiological characters of vampire bat-transmitted rabies virus by phylogenetic methods based on 619-nt sequence including unconserved G-L intergenic region. Findings The vampire bat-transmitted rabies virus isolates divided into 8 phylogenetic lineages in the previous nucleoprotein gene analysis were divided into 10 phylogenetic lineages with significant bootstrap values. The distributions of most variants were reconfirmed to be delimited by mountain chains. Furthermore, variants in undulating areas have narrow distributions and are apparently separated by mountain ridges. Conclusions This study demonstrates that the 619-nt sequence including G-L intergenic region is more useful for a state-level phylogenetic analysis of rabies virus than the partial nucleoprotein gene, and simultaneously that the distribution of vampire bat-transmitted RABV variants tends to be separated not only by mountain chains but also by mountain ridges, thus suggesting that the diversity of vampire bat-transmitted RABV variants was delimited by geographical undulations.

  6. Identification of SmtB/ArsR cis elements and proteins in archaea using the Prokaryotic InterGenic Exploration Database (PIGED

    Michael Bose

    2006-01-01

    Full Text Available Microbial genome sequencing projects have revealed an apparently wide distribution of SmtB/ArsR metal-responsive transcriptional regulators among prokaryotes. Using a position-dependent weight matrix approach, prokaryotic genome sequences were screened for SmtB/ArsR DNA binding sites using data derived from intergenic sequences upstream of orthologous genes encoding these regulators. Sixty SmtB/ArsR operators linked to metal detoxification genes, including nine among various archaeal species, are predicted among 230 annotated and draft prokaryotic genome sequences. Independent multiple sequence alignments of putative operator sites and corresponding winged helix-turn-helix motifs define sequence signatures for the DNA binding activity of this SmtB/ArsR subfamily. Prediction of an archaeal SmtB/ArsR based upon these signature sequences is confirmed using purified Methanosarcina acetivorans C2A protein and electrophoretic mobility shift assays. Tools used in this study have been incorporated into a web application, the Prokaryotic InterGenic Exploration Database (PIGED; http://bioinformatics.uwp.edu/~PIGED/home.htm, facilitating comparable studies. Use of this tool and establishment of orthology based on DNA binding signatures holds promise for deciphering potential cellular roles of various archaeal winged helix-turn-helix transcriptional regulators.

  7. Identification of SmtB/ArsR cis elements and proteins in archaea using the Prokaryotic InterGenic Exploration Database (PIGED).

    Bose, Michael; Slick, David; Sarto, Mickey J; Murphy, Patrick; Roberts, David; Roberts, Jacqueline; Barber, Robert D

    2006-08-01

    Microbial genome sequencing projects have revealed an apparently wide distribution of SmtB/ArsR metal-responsive transcriptional regulators among prokaryotes. Using a position-dependent weight matrix approach, prokaryotic genome sequences were screened for SmtB/ArsR DNA binding sites using data derived from intergenic sequences upstream of orthologous genes encoding these regulators. Sixty SmtB/ArsR operators linked to metal detoxification genes, including nine among various archaeal species, are predicted among 230 annotated and draft prokaryotic genome sequences. Independent multiple sequence alignments of putative operator sites and corresponding winged helix-turn-helix motifs define sequence signatures for the DNA binding activity of this SmtB/ArsR subfamily. Prediction of an archaeal SmtB/ArsR based upon these signature sequences is confirmed using purified Methanosarcina acetivorans C2A protein and electrophoretic mobility shift assays. Tools used in this study have been incorporated into a web application, the Prokaryotic InterGenic Exploration Database (PIGED; http://bioinformatics.uwp.edu/~PIGED/home.htm), facilitating comparable studies. Use of this tool and establishment of orthology based on DNA binding signatures holds promise for deciphering potential cellular roles of various archaeal winged helix-turn-helix transcriptional regulators. PMID:16877320

  8. Sequencing of 16S rRNA Gene: A Rapid Tool for Identification of Bacillus anthracis

    Sacchi, Claudio T.; Whitney, Anne M.; Mayer, Leonard W.; Morey, Roger; Steigerwalt, Arnold; Boras, Ariana; Weyant, Robin S.; Popovic, Tanja

    2002-01-01

    In a bioterrorism event, a tool is needed to rapidly differentiate Bacillus anthracis from other closely related spore-forming Bacillus species. During the recent outbreak of bioterrorism-associated anthrax, we sequenced the 16S rRNA generom these species to evaluate the potential of 16S rRNA gene sequencing as a diagnostic tool. We found eight distinct 16S types among all 107 16S rRNA gene seqs fuences that differed from each other at 1 to 8 positions (0.06% to 0.5%). All 86 B. anthracis had...

  9. Pantanalinema gen. nov. and Alkalinema gen. nov.: novel pseudanabaenacean genera (Cyanobacteria) isolated from saline-alkaline lakes.

    Vieira Vaz, Marcelo Gomes Marçal; Genuário, Diego Bonaldo; Andreote, Ana Paula Dini; Malone, Camila Francieli Silva; Sant'Anna, Célia Leite; Barbiero, Laurent; Fiore, Marli Fátima

    2015-01-01

    The genus Leptolyngbya Anagnostidis & Komárek (1988) was described from a set of strains identified as 'LPP-group B'. The morphology within this group is not particularly informative and underestimates the group's genetic diversity. In the present study, two new pseudanabaenacean genera related to Leptolyngbya morphotypes, Pantanalinema gen. nov. and Alkalinema gen. nov., are described under the provisions of the International Code of Nomenclature for Algae, Fungi and Plants, based on a polyphasic approach. Pantanalinema gen. nov. (type species Pantanalinema rosaneae sp. nov.) has sheaths and trichomes with slight gliding motility, which distinguish this genus from Alkalinema gen. nov. (type species Alkalinema pantanalense sp. nov.), which possesses trichomes arranged in an ornate (interwoven) pattern. 16S rRNA gene sequences of strains of Pantanalinema and Alkalinema exhibited low identity to each other (≤91.6 %) and to other sequences from known pseudanabaenacean genera (≤94.3 and 93.7 %, respectively). In a phylogenetic reconstruction, six sequences from strains of Pantanalinema and four from strains of Alkalinema formed two separate and robust clades (99 % bootstrap value), with the genera Oculatella and Phormidesmis, respectively, as the closest related groups. 16S-23S rRNA intergenic spacer sequences and secondary structures of strains of Pantanalinema and Alkalinema did not correspond to any previous descriptions. The strains of Pantanalinema and Alkalinema were able to survive and produce biomass at a range of pH (pH 4-11) and were also able to alter the culture medium to pH values ranging from pH 8.4 to 9.9. These data indicate that cyanobacterial communities in underexplored environments, such as the Pantanal wetlands, are promising sources of novel taxa. PMID:25351877

  10. Inter- and intraspecies identification of Bartonella (Rochalimaea) species.

    Roux, V; Raoult, D

    1995-06-01

    Species of the genus Rochalimaea, recently renamed Bartonella, are of a growing medical interest. Bartonella quintana was reported as the cause of trench fever, endocarditis, and bacillary angiomatosis. B. henselae has been implicated in symptoms and infections of human immunodeficiency virus-infected patients, such as fever, endocarditis, and bacillary angiomatosis, and is involved in the etiology of cat scratch disease. Such a wide spectrum of infections makes it necessary to obtain an intraspecies identification tool in order to perform epidemiological studies. B. vinsonii, B. elizabethae, seven isolates of B. quintana, and four isolates of B. henselae were studied by pulsed-field gel electrophoresis (PFGE) after restriction with the infrequently cutting endonucleases NotI, EagI, and SmaI. Specific profiles were obtained for each of the four Bartonella species. Comparison of genomic fingerprints of isolates of the same species showed polymorphism in DNA restriction patterns, and a specific profile was obtained for each isolate. A phylogenetic analysis of the B. quintana isolates was obtained by using the Dice coefficient, UPGMA (unweighted pair-group method of arithmetic averages), and Package Philip programming. Amplification by PCR and subsequent sequencing using an automated laser fluorescent DNA sequencer (Pharmacia) was performed on the intergenic spacer region (ITS) between the 16 and 23S rRNA genes. It was found that each B. henselae isolate had a specific sequence, while the B. quintana isolates fell into only two groups. When endonuclease restriction analysis of the ITS PCR product was done, three enzymes, TaqI, HindIII, and HaeIII, allowed species identification of Bartonella spp. Restriction fragment length polymorphism after PCR amplification of the 16S-23S rRNA gene ITS may be useful for rapid species identification, and PFGE could be an efficient method for isolate identification. PMID:7650189

  11. Recognition determinants for proteins and antibiotics within 23S rRNA

    Douthwalte, S; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup;

    1995-01-01

    Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of...... molecular genetic and biochemical probing techniques, we have concentrated on regions of the rRNA that are connected with specific functions. These are located in different domains within the 23S rRNA and include the ribosomal GTPase-associated center in domain II, which contains the binding sites for r......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...

  12. Investigation of molluscan phylogeny on the basis of 18S rRNA sequences.

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1996-12-01

    The 18S rRNA sequences of 12 molluscs, representing the extant classes Gastropoda, Bivalvia, Polyplacophora, Scaphopoda, and Caudofoveata, were determined and compared with selected known 18S rRNA sequences of Metazoa, including other Mollusca. These data do not provide support for a close relationship between Platyhelminthes (Turbellaria) and Mollusca, but rather suggest that the latter group belongs to a clade of eutrochozoan coelomates. The 18S rRNA data fail to recover molluscan, bivalve, or gastropod monophyly. However, the branching pattern of the eutrochozoan phyla and classes is unstable, probably due to the explosive Cambrian radiation during which these groups arose. Similarly, the 18S rRNA data do not provide a reliable signal for the molluscan interclass relationships. Nevertheless, we obtained strong preliminary support for phylogenetic inferences at more restricted taxonomic levels, such as the monophyly of Polyplacophora, Caenogastropoda, Euthyneura, Heterodonta, and Arcoida. PMID:8952075

  13. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria

    Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.

    2015-01-01

    Roč. 15, APR 2015 (2015). ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EE - Microbiology , Virology Impact factor: 2.729, year: 2014

  14. Inhibition of Escherichia coli precursor-16S rRNA processing by mouse intestinal contents

    Licht, Tine Rask; Tolker-Nielsen, Tim; Holmstrøm, Kim; Krogfelt, Karen A.; Molin, Søren

    1999-01-01

    . We have applied fluorescence in situ hybridization of pre-16S rRNA to Escherichia coli cells growing in vitro in extracts from two different compartments of the mouse intestine: the caecal mucus layer, where E. coli grew rapidly, and the contents of the caecum, which supported much slower bacterial......The correlation between ribosome content and growth rate found in many bacterial species has proved useful for estimating the growth activity of individual cells by quantitative in situ rRNA hybridization. However, in dynamic environments, the stability of mature ribosomal RNA causes problems in...... using cellular rRNA contents for direct monitoring of bacterial growth activity in situ. In a recent paper, Cangelosi and Brabant suggested monitoring the content of precursors in rRNA synthesis (pre-rRNAs) as an alternative approach. These are rapidly broken down after the cessation of bacterial growth...

  15. Mutations in the 16S rRNA Genes of Helicobacter pylori Mediate Resistance to Tetracycline

    Trieber, Catharine A.; Taylor, Diane E.

    2002-01-01

    Low-cost and rescue treatments for Helicobacter pylori infections involve combinations of several drugs including tetracycline. Resistance to tetracycline has recently emerged in H. pylori. The 16S rRNA gene sequences of two tetracycline-resistant clinical isolates (MIC = 64 μg/ml) were determined and compared to the consensus H. pylori 16S rRNA sequence. One isolate had four nucleotide substitutions, and the other had four substitutions and two deletions. Natural transformation with the 16S ...

  16. 16S rRNA Mutation Associated with Tetracycline Resistance in a Gram-Positive Bacterium

    Ross, Jeremy I.; Eady, E Anne; Cove, Jonathan H.; Cunliffe, William J.

    1998-01-01

    A genetic basis for tetracycline resistance in cutaneous propionibacteria was suggested by comparing the nucleotide sequences of the 16S rRNA genes from 16 susceptible and 21 resistant clinical isolates and 6 laboratory-selected tetracycline-resistant mutants of a susceptible strain. Fifteen clinical isolates resistant to tetracycline were found to have cytosine instead of guanine at a position cognate with Escherichia coli 16S rRNA base 1058 in a region important for peptide chain terminatio...

  17. Functional interactions within 23S rRNA involving the peptidyltransferase center.

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S rRNA peptidyltransferase loop. All three base substitutions at position 2032 produce an erythromycin-hypersensitive phenotype. The 2032 substitutions were compared with and combined with a 12-bp deletion muta...

  18. Phylogenetic relationships of Carpha and its relatives (Schoeneae, Cyperaceae) inferred from chloroplast trnL intron and trnL-trnF intergenic spacer sequences.

    Zhang, Xiufu; Marchant, Adam; Wilson, Karen L; Bruhl, Jeremy J

    2004-05-01

    Within the tribe Schoeneae (Cyperaceae), the relationships between Carpha and its relatives have not been certain, and the limits and definition of Carpha have been controversial. Further, the relationships of species within Carpha have been unclear. In this study, cladistic analyses based on chloroplast trnL intron and trnL-trnF intergenic spacer sequence data were undertaken to estimate phylogenetic relationships in and around Carpha. This study found that Trianoptiles is sister to Carpha; Ptilothrix is sister to Cyathochaeta rather than to Carpha as suggested by some former authors; and Gymnoschoenus is distant from Carpha and its close relatives. The merging of Schoenoides back into Oreobolus is supported. The findings also revealed the non-monophyletic status of Costularia and of Schoenus, and indicated the phylogenetic relationships of species within Carpha. PMID:15062800

  19. Linkage of 35S and 5S rRNA genes in Artemisia (family Asteraceae): first evidence from angiosperms

    Garcia, S.; Lim, K.Y.; Chester, M.; Garnatje, T.; Pellicer, J.; Valles, J.; Leitch, A.R.; Kovařík, Aleš

    online, - (2008), s. 1-13. ISSN 0009-5915 R&D Projects: GA ČR(CZ) GA521/07/0116 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : organization of rDNA unit * intergenic spacer * Artemisia Subject RIV: BO - Biophysics Impact factor: 5.111, year: 2008

  20. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  1. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  2. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    William Orsi

    Full Text Available The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC, nitrate, sulfide, and dissolved inorganic carbon (DIC. These correlations are supported by terminal restriction length polymorphism (TRFLP analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  3. Whole-Genome Sequence of Rummeliibacillus stabekisii Strain PP9 Isolated from Antarctic Soil

    da Mota, Fábio Faria; Vollú, Renata Estebanez; Jurelevicius, Diogo

    2016-01-01

    The whole genome of Rummeliibacillus stabekisii PP9, isolated from a soil sample from Antarctica, consists of a circular chromosome of 3,412,092 bp and a circular plasmid of 8,647 bp, with 3,244 protein-coding genes, 12 copies of the 16S-23S-5S rRNA operon, 101 tRNA genes, and 6 noncoding RNAs (ncRNAs). PMID:27231360

  4. Evolution of the primate beta-globin gene region: nucleotide sequence of the delta-beta-globin intergenic region of gorilla and phylogenetic relationships between African apes and man.

    Perrin-Pecontal, P; Gouy, M; Nigon, V M; Trabuchet, G

    1992-01-01

    A 6.0-kb DNA fragment from Gorilla gorilla including the 5' part of the beta-globin gene and about 4.5 kb of its upstream flanking region was cloned and sequenced. The sequence was compared to the human, chimpanzee, and macaque delta-beta intergenic region. This analysis reveals four tandemly repeated sequences (RS), at the same location in the four species, showing a variable number of repeats generating both intraspecific (polymorphism) and interspecific variability. These tandem arrays delimit five regions of unique sequence called IG for intergenic. The divergence for these IG sequences is 1.85 +/- 0.22% between human and gorilla, which is not significantly different from the value estimated in the same region between chimpanzee and human (1.62 +/- 0.21%). The CpG and TpA dinucleotides are avoided. CpGs evolve faster than other sequence sites but do not confuse phylogenetic inferences by producing parallel mutations in different lineages. About 75% of CpG doublets have become TpG or CpA since the common ancestor, in agreement with the methylation/deamination pattern. Comparison of this intergenic region gives information on branching order within Hominoidea. Parsimony and distance-based methods when applied to the delta-beta intergenic region provide evidence (although not statistically significant) that human and chimpanzee are more closely related to each other than to gorilla. CpG sites are indeed rich in information by carrying substitutions along the short internal branch. Combining these results with those on the psi eta-delta intergenic region, shows in a statistically significant way that chimpanzee is the closest relative of human. PMID:1556740

  5. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    Ostergaard, P; Phan, H; Johansen, L B;

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

  6. Molecular phylogeny of Pneumocystis based on 5.8S rRNA gene and the internal transcribed spacers of rRNA gene sequences

    2008-01-01

    To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis.

  7. Primary and secondary structures of Tetrahymena and aphid 5.8S rRNAs: structural features of 5.8S rRNA which interacts with the 28S rRNA containing the hidden break.

    Fujiwara, H.; H. Ishikawa

    1982-01-01

    The Tetrahymena 5.8S rRNA is 154 nucleotides long, the shortest so far reported except for the split 5.8S rRNAs of Diptera (m5.8S plus 2S rRNA). In this molecule several nucleotides are deleted in the helix e (GC-rich stem) region. Upon constructing the secondary structure in accordance with "burp-gun" model, the Tetrahymena 5.8S rRNA forms a wide-open "muzzle" of the terminal regions due to both extra nucleotides and several unpaired bases. The aphid 5.8S rRNA consists of 161 nucleotides and...

  8. Exploring microbial diversity and taxonomy using SSU rRNA hypervariable tag sequencing.

    Susan M Huse

    2008-11-01

    Full Text Available Massively parallel pyrosequencing of hypervariable regions from small subunit ribosomal RNA (SSU rRNA genes can sample a microbial community two or three orders of magnitude more deeply per dollar and per hour than capillary sequencing of full-length SSU rRNA. As with full-length rRNA surveys, each sequence read is a tag surrogate for a single microbe. However, rather than assigning taxonomy by creating gene trees de novo that include all experimental sequences and certain reference taxa, we compare the hypervariable region tags to an extensive database of rRNA sequences and assign taxonomy based on the best match in a Global Alignment for Sequence Taxonomy (GAST process. The resulting taxonomic census provides information on both composition and diversity of the microbial community. To determine the effectiveness of using only hypervariable region tags for assessing microbial community membership, we compared the taxonomy assigned to the V3 and V6 hypervariable regions with the taxonomy assigned to full-length SSU rRNA sequences isolated from both the human gut and a deep-sea hydrothermal vent. The hypervariable region tags and full-length rRNA sequences provided equivalent taxonomy and measures of relative abundance of microbial communities, even for tags up to 15% divergent from their nearest reference match. The greater sampling depth per dollar afforded by massively parallel pyrosequencing reveals many more members of the "rare biosphere" than does capillary sequencing of the full-length gene. In addition, tag sequencing eliminates cloning bias and the sequences are short enough to be completely sequenced in a single read, maximizing the number of organisms sampled in a run while minimizing chimera formation. This technique allows the cost-effective exploration of changes in microbial community structure, including the rare biosphere, over space and time and can be applied immediately to initiatives, such as the Human Microbiome Project.

  9. Strength and Regulation of Seven rRNA Promoters in Escherichia coli.

    Michihisa Maeda

    Full Text Available The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed.

  10. A yeast transcription system for the 5S rRNA gene.

    Keulen, H.; Thomas, D. Y.

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA gen...

  11. Oligonucleotide Fingerprinting of rRNA Genes for Analysis of Fungal Community Composition

    Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

    2002-01-01

    Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones d...

  12. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    Cangelosi, G A; Brabant, W H

    1997-01-01

    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA prob...

  13. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  14. TaxMan: a server to trim rRNA reference databases and inspect taxonomic coverage

    Brandt, B. W.; Bonder, M. J.; Huse, S.M.; Zaura, E.

    2012-01-01

    Amplicon sequencing of the hypervariable regions of the small subunit ribosomal RNA gene is a widely accepted method for identifying the members of complex bacterial communities. Several rRNA gene sequence reference databases can be used to assign taxonomic names to the sequencing reads using BLAST, USEARCH, GAST or the RDP classifier. Next-generation sequencing methods produce ample reads, but they are short, currently ∼100-450 nt (depending on the technology), as compared to the full rRNA g...

  15. In Vivo Effect of NusB and NusG on rRNA Transcription Antitermination

    Torres, Martha; Balada, Joan-Miquel; Zellars, Malcolm; Squires, Craig; Squires, Catherine L.

    2004-01-01

    Similarities between lambda and rRNA transcription antitermination have led to suggestions that they involve the same Nus factors. However, direct in vivo confirmation that rRNA antitermination requires all of the lambda Nus factors is lacking. We have therefore analyzed the in vivo role of NusB and NusG in rRNA transcription antitermination and have established that both are essential for it. We used a plasmid test system in which reporter gene mRNA was measured to monitor rRNA antiterminato...

  16. Enhanced expression of lmb gene encoding laminin-binding protein in Streptococcus agalactiae strains harboring IS1548 in scpB-lmb intergenic region.

    Rim Al Safadi

    Full Text Available Group B streptococcus (GBS is the main cause of neonatal sepsis and meningitis. Bacterial surface proteins play a major role in GBS binding to and invasion of different host surfaces. The scpB and lmb genes, coding for fibronectin-binding and laminin-binding surface proteins, are present in almost all human GBS isolates. The scpB-lmb intergenic region is a hot spot for integration of two mobile genetic elements (MGEs: the insertion element IS1548 or the group II intron GBSi1. We studied the structure of scpB-lmb intergenic region in 111 GBS isolates belonging to the intraspecies major clonal complexes (CCs. IS1548 was mostly found (72.2% in CC19 serotype III strains recovered more specifically (92.3% from neonatal meningitis. GBSi1 was principally found (70.6% in CC17 strains, mostly (94.4% of serotype III, but also (15.7% in CC19 strains, mostly (87.5% of serotype II. No MGE was found in most strains of the other CCs (76.0%, notably CC23, CC10 and CC1. Twenty-six strains representing these three genetic configurations were selected to investigate the transcription and expression levels of scpB and lmb genes. Quantitative RT-PCR showed that lmb transcripts were 5.0- to 9.6-fold higher in the group of strains with IS1548 than in the other two groups of strains (P<0.001. Accordingly, the binding ability to laminin was 3.8- to 6.6-fold higher in these strains (P< or =0.001. Moreover, Lmb amount expressed on the cell surface was 2.4- to 2.7-fold greater in these strains (P<0.001. By contrast, scpB transcript levels and fibronectin binding ability were similar in the three groups of strains. Deletion of the IS1548 sequence between scpB and lmb genes in a CC19 serotype III GBS strain substantially reduced the transcription of lmb gene (13.5-fold, the binding ability to laminin (6.2-fold, and the expression of Lmb protein (5.0-fold. These data highlight the importance of MGEs in bacterial virulence and demonstrate the up-regulation of lmb gene by IS

  17. Identification of novel growth phase- and media-dependent small non-coding RNAs in Streptococcus pyogenes M49 using intergenic tiling arrays

    Patenge Nadja

    2012-10-01

    Full Text Available Abstract Background Small non-coding RNAs (sRNAs have attracted attention as a new class of gene regulators in both eukaryotes and bacteria. Genome-wide screening methods have been successfully applied in Gram-negative bacteria to identify sRNA regulators. Many sRNAs are well characterized, including their target mRNAs and mode of action. In comparison, little is known about sRNAs in Gram-positive pathogens. In this study, we identified novel sRNAs in the exclusively human pathogen Streptococcus pyogenes M49 (Group A Streptococcus, GAS M49, employing a whole genome intergenic tiling array approach. GAS is an important pathogen that causes diseases ranging from mild superficial infections of the skin and mucous membranes of the naso-pharynx, to severe toxic and invasive diseases. Results We identified 55 putative sRNAs in GAS M49 that were expressed during growth. Of these, 42 were novel. Some of the newly-identified sRNAs belonged to one of the common non-coding RNA families described in the Rfam database. Comparison of the results of our screen with the outcome of two recently published bioinformatics tools showed a low level of overlap between putative sRNA genes. Previously, 40 potential sRNAs have been reported to be expressed in a GAS M1T1 serotype, as detected by a whole genome intergenic tiling array approach. Our screen detected 12 putative sRNA genes that were expressed in both strains. Twenty sRNA candidates appeared to be regulated in a medium-dependent fashion, while eight sRNA genes were regulated throughout growth in chemically defined medium. Expression of candidate genes was verified by reverse transcriptase-qPCR. For a subset of sRNAs, the transcriptional start was determined by 5′ rapid amplification of cDNA ends-PCR (RACE-PCR analysis. Conclusions In accord with the results of previous studies, we found little overlap between different screening methods, which underlines the fact that a comprehensive analysis of s

  18. The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

    Hori, H; Sawada, M.; Osawa, S; Murao, K; Ishikura, H

    1981-01-01

    The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

  19. Methyltransferase Erm(37) Slips on rRNA to Confer Atypical Resistance in Mycobacterium tuberculosis

    Madsen, Ch. T.; Jakobsen, L.; Buriánková, Karolína; Doucet-Populaire, F.; Perdonet, J. L.; Douthwaite, S.

    2005-01-01

    Roč. 280, č. 47 (2005), s. 38942-38947. ISSN 0021-9258 R&D Projects: GA ČR GA310/03/0292 Institutional research plan: CEZ:AV0Z50200510 Keywords : methyltransferase erm * mycobacterium tuberculosis * rRNA Subject RIV: EE - Microbiology, Virology Impact factor: 5.854, year: 2005

  20. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten; Dalgaard, Jacob; Lykke-Andersen, Jens; Phan, Hoa T.N.; Trevisanato, Siro; Østergaard, Laust; Larsen, Niels; Leffers, Henrik

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows is a...

  1. An alternative strategy for bacterial ribosome synthesis: Bacillus subtilis rRNA transcription regulation

    Krásný, Libor; Gourse, Richard. L.

    2004-01-01

    Roč. 23, č. 22 (2004), s. 4473-4483. ISSN 0261-4189 Grant ostatní: National Institutes of Health(US) RO1 GM37048 Institutional research plan: CEZ:AV0Z5052915 Keywords : B. subtilis , GTP concentrations, rRNA transcription Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 10.492, year: 2004

  2. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    reveals increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits......The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea and...... chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...

  3. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    van Wezel, G P; Krab, I M; Douthwaite, S; Bibb, M J; Vijgenboom, E; Bosch, L

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, correspondi...

  4. Supramolecular hydrogel of kanamycin selectively sequesters 16S rRNA

    Yang, Zhimou; Kuang, Yi; Li, Xinming; Zhou, Ning; Zhang, Ye; Xu, Bing

    2012-01-01

    As the first example of hydrogelator derived from aminoglycoside antibiotics, the hydrogel of kanamycin indicates that the hydrogel of aminoglycosides preserve the specific interaction with their macromolecular targets (e.g., 16S rRNA), thus illustrating a simple approach to explore and identify possible biological targets of supramolecular nanofibers/hydrogels.

  5. EmtA, a rRNA methyltransferase conferring high-level evernimicin resistance

    Mann, P. A.; Xiong, L.; Mankin, A. S.; Chau, A. S.; Najarian, D. J.; Mendrick, C. A.; Cramer, C. A.; Aarestrup, Frank Møller; Hare, R. S.; Black, T. A.; McNicholas, P. M.

    2001-01-01

    unique to the 23S rRNA extracted from resistant ribosomes. The pause corresponded to methylation of residue G2470 (Escherichia coli numbering). RNA footprinting revealed that G2470 is located within the evernimicin-binding site on the ribosome, thus providing an explanation for the reduced binding of the...

  6. Survey of Bartonella spp. in U.S. bed bugs detects Burkholderia multivorans but not Bartonella.

    Virna L Saenz

    Full Text Available Bed bugs (Cimex lectularius L. have resurged in the United States and globally. Bed bugs are hematophagous ectoparasites of humans and other animals, including domestic pets, chickens, and bats, and their blood feeding habits contribute to their potential as disease vectors. Several species of Bartonella are re-emergent bacterial pathogens that also affect humans, domestic pets, bats and a number of other wildlife species. Because reports of both bed bugs and Bartonella have been increasing in the U.S., and because their host ranges can overlap, we investigated whether the resurgences of these medically important pathogens and their potential vector might be linked, by screening for Bartonella spp. in bed bugs collected from geographic areas where these pathogens are prevalent and from bed bugs that have been in culture in the laboratory for several years. We screened a total of 331 bed bugs: 316 bed bugs from 36 unique collections in 29 geographic locations in 13 states, 10 bed bugs from two colonies maintained in the laboratory for 3 yr, and 5 bed bugs from a colony that has been in culture since before the recent resurgence of bed bugs. Bartonella spp. DNA was screened using a polymerase chain reaction assay targeting the 16S-23S rRNA intergenic transcribed spacer region. Bartonella DNA was not amplified from any bed bug, but five bed bugs from four different apartments of an elderly housing building in North Carolina contained DNA sequences that corresponded to Burkholderia multivorans, an important pathogen in nosocomial infections that was not previously linked to an arthropod vector.

  7. Genetic transformation of novel isolates of chicken Lactobacillus bearing probiotic features for expression of heterologous proteins: a tool to develop live oral vaccines

    Neumann Elisabeth

    2006-01-01

    Full Text Available Abstract Background The use of lactic acid bacteria as vehicles to delivery antigens to immunize animals is a promising issue. When genetically modified, these bacteria can induce a specific local and systemic immune response against selected pathogens. Gastric acid and bile salts tolerance, production of antagonistic substances against pathogenic microorganisms, and adhesive ability to gut epithelium are other important characteristics that make these bacteria useful for oral immunization. Results Bacteria isolated on de Man, Rogosa and Sharpe medium (MRS from different gastrointestinal portions of broiler chicks were evaluated for their resistance to artificial gastric acid and bile salts, production of hydrogen peroxide, and cell surface hydrophobicity. Thirty-eight isolates were first typed at species level by PCR amplification of 16S-23S rRNA intergenic spacers using universal primers that anneal within 16S and 23S genes, followed by restriction digestion analyses of PCR amplicons (PCR-ARDRA. An expression cassette was assembled onto the pCR2.1-Topo vector by cloning the promoter, leader peptide, cell wall anchor and terminator sequences derived from the laminin binding S-layer protein gene of L. crispatus strain F5.7 (lbs gene. A sequence encoding the green fluorescent protein (GFP was inserted as reporter gene, and an erythromycin resistance gene was added as selective marker. All constructs were able to express GFP in the cloning host E. coli XL1-Blue and different Lactobacillus strains as verified by FACS and laser scanning confocal microscopy. Conclusion Lactobacillus isolated from gastrointestinal tract of broiler chickens and selected for probiotic characteristics can be genetically modified by introducing an expression cassette into the lbs locus. The transformed bacteria expressed on its cell wall surface different fluorescent proteins used as reporters of promoter function. It is possible then that similar bacterial model

  8. Richness and diversity of bacterioplankton species along an estuarine gradient in Moreton Bay, Australia.

    Hewson, Ian; Fuhrman, Jed A

    2004-06-01

    Bacterioplankton community diversity was investigated in the subtropical Brisbane River-Moreton Bay estuary, Australia (27 degrees 25 minutes S, 153 degrees 5 minutes E). Bacterial communities were studied using automated rRNA intergenic spacer analysis (ARISA), which amplifies 16S-23S ribosomal DNA internally transcribed spacer regions from mixed-community DNA and detects the separated products on a fragment analyzer. Samples were collected from eight sites throughout the estuary and east to the East Australian Current (Coral Sea). Bacterioplankton communities had the highest operational taxonomic unit (OTU) richness, as measured by ARISA at eastern bay stations (S [total richness] = 84 to 85 OTU) and the lowest richness in the Coral Sea (S = 39 to 59 OTU). Richness correlated positively with bacterial abundance; however, there were no strong correlations between diversity and salinity, NO(3)(-) and PO(4)(3-) concentrations, or chlorophyll a concentration. Bacterioplankton communities at the riverine stations were different from communities in the bay or Coral Sea. The main differences in OTU richness between stations were in taxa that each represented 0.1% (the detection limit) to 0.5% of the total amplified DNA, i.e., the "tail" of the distribution. We found that some bacterioplankton taxa are specific to distinct environments while others have a ubiquitous distribution from river to sea. Bacterioplankton richness and diversity patterns in the estuary are potentially a consequence of greater niche availability, mixing of local and adjacent environment communities, or intermediate disturbance. Furthermore, these results contrast with previous reports of spatially homogeneous bacterioplankton communities in other coastal waters. PMID:15184140

  9. Detection of Bartonella spp. in neotropical felids and evaluation of risk factors and hematological abnormalities associated with infection.

    Guimaraes, A M S; Brandão, P E; Moraes, W; Kiihl, S; Santos, L C; Filoni, C; Cubas, Z S; Robes, R R; Marques, L M; Neto, R L; Yamaguti, M; Oliveira, R C; Catão-Dias, J L; Richtzenhain, L J; Messick, J B; Biondo, A W; Timenetsky, J

    2010-05-19

    Although antibodies to Bartonella henselae have been described in all neotropical felid species, DNA has been detected in only one species, Leopardus wiedii. The aim of this study was to determine whether DNA of Bartonella spp. could be detected in blood of other captive neotropical felids and evaluate risk factors and hematological findings associated with infection. Blood samples were collected from 57 small felids, including 1 Leopardus geoffroyi, 17 L. wiedii, 22 Leopardus tigrinus, 14 Leopardus pardalis, and 3 Puma yagouaroundi; 10 blood samples from Panthera onca were retrieved from blood banks. Complete blood counts were performed on blood samples from small felids, while all samples were evaluated by PCR. DNA extraction was confirmed by amplification of the cat GAPDH gene. Bartonella spp. were assessed by amplifying a fragment of their 16S-23S rRNA intergenic spacer region; PCR products were purified and sequenced. For the small neotropical felids, risk factors [origin (wild-caught or zoo-born), gender, felid species, and flea exposure] were evaluated using exact multiple logistic regression. Hematological findings (anemia, polycythemia/hyperproteinemia, leukocytosis and leukopenia) were tested for association with infection using Fisher's exact test. The 635bp product amplified from 10 samples (10/67=14.92%) was identified as B. henselae by sequencing. Small neotropical felid males were more likely to be positive than females (95% CI=0.00-0.451, p=0.0028), however other analyzed variables were not considered risk factors (p>0.05). Hematological abnormalities were not associated with infection (p>0.05). This is the first report documenting B. henselae detection by PCR in several species of neotropical felids. PMID:19913372

  10. Oral microbiome profiles: 16S rRNA pyrosequencing and microarray assay comparison.

    Jiyoung Ahn

    Full Text Available OBJECTIVES: The human oral microbiome is potentially related to diverse health conditions and high-throughput technology provides the possibility of surveying microbial community structure at high resolution. We compared two oral microbiome survey methods: broad-based microbiome identification by 16S rRNA gene sequencing and targeted characterization of microbes by custom DNA microarray. METHODS: Oral wash samples were collected from 20 individuals at Memorial Sloan-Kettering Cancer Center. 16S rRNA gene survey was performed by 454 pyrosequencing of the V3-V5 region (450 bp. Targeted identification by DNA microarray was carried out with the Human Oral Microbe Identification Microarray (HOMIM. Correlations and relative abundance were compared at phylum and genus level, between 16S rRNA sequence read ratio and HOMIM hybridization intensity. RESULTS: The major phyla, Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, and Fusobacteria were identified with high correlation by the two methods (r = 0.70∼0.86. 16S rRNA gene pyrosequencing identified 77 genera and HOMIM identified 49, with 37 genera detected by both methods; more than 98% of classified bacteria were assigned in these 37 genera. Concordance by the two assays (presence/absence and correlations were high for common genera (Streptococcus, Veillonella, Leptotrichia, Prevotella, and Haemophilus; Correlation = 0.70-0.84. CONCLUSION: Microbiome community profiles assessed by 16S rRNA pyrosequencing and HOMIM were highly correlated at the phylum level and, when comparing the more commonly detected taxa, also at the genus level. Both methods are currently suitable for high-throughput epidemiologic investigations relating identified and more common oral microbial taxa to disease risk; yet, pyrosequencing may provide a broader spectrum of taxa identification, a distinct sequence-read record, and greater detection sensitivity.

  11. Long intergenic non-coding RNA APOC1P1-3 inhibits apoptosis by decreasing α-tubulin acetylation in breast cancer

    Liao, X-H; Wang, J-G; Li, L-Y; Zhou, D-M; Ren, K-H; Jin, Y-T; Lv, L; Yu, J-G; Yang, J-Y; Lu, Q; Zou, Q; Yu, J; Liu, X-P; Zhou, P

    2016-01-01

    Increasing evidence indicates that long non-coding RNAs (lncRNAs) act as important regulatory factors in tumor progression. However, their roles in breast cancer remain largely unknown. In present studies, we identified aberrantly expressed long intergenic non-coding RNA APOC1P1-3 (lincRNA-APOC1P1-3) in breast cancer by microarray, verified it by quantitative real-time PCR, and assessed methylation status in the promoter region by pyrosequencing. We also investigated the biological functions with plasmid transfection and siRNA silencing experiments, and further explored their mechanisms by RNA pull-down and RNA immunoprecipitation to identify binding proteins. We found that 224 lncRNAs were upregulated in breast cancer, whereas 324 were downregulated. The lincRNA-APOC1P1-3 was overexpressed in breast cancer, which was related to tumor size and hypomethylation in its promoter region. We also found that APOC1P1-3 could directly bind to tubulin to decrease α-tubulin acetylation, to inactivate caspase-3, and to inhibit apoptosis. This study demonstrates that overexpression of APOC1P1-3 can inhibit breast cancer apoptosis. PMID:27228351

  12. Differentiation between Aspergillus flavus and Aspergillus parasiticus from Pure Culture and Aflatoxin-Contaminated Grapes Using PCR-RFLP Analysis of aflR-aflJ Intergenic Spacer

    Aflatoxins (AFs) represent the most important single mycotoxin-related food safety problem in developed and developing countries as they have adverse effects on human and animal health. They are produced mainly by Aspergillus flavus and A. parasiticus. Both species have different aflatoxinogenic profile. In order to distinguish between A. flavus and A. parasiticus, gene-specific primers were designed to target the intergenic spacer (IGS) for the AF biosynthesis genes, aflJ and aflR. Polymerase chain reaction (PCR) products were subjected to restriction endonuclease analysis using BglII to look for restriction fragment length polymorphisms (RFLPs). Our result showed that both species displayed different PCR-based RFLP (PCR-RFLP) profile. PCR products from A. flavus cleaved into 3 fragments of 362, 210, and 102 bp. However, there is only one restriction site for this enzyme in the sequence of A. parasiticus that produced only 2 fragments of 363 and 311 bp. The method was successfully applied to contaminated grapes samples. This approach of differentiating these 2 species would be simpler, less costly, and quicker than conventional sequencing of PCR products and/or morphological identification. (author)

  13. Genome-wide identification and characterization of long intergenic noncoding RNAs and their potential association with larval development in the Pacific oyster.

    Yu, Hong; Zhao, Xuelin; Li, Qi

    2016-01-01

    An increasing amount of evidence suggests that long intergenic noncoding RNAs (lincRNAs) may play diverse roles in many cellular processes. However, little is known about lincRNAs in marine invertebrates. Here, we presented the first identification and characterization of lincRNAs in the Pacific oyster (Crassostrea gigas). We developed a pipeline and identified 11,668 lincRNAs in C. gigas based on RNA-Seq resources available. These lincRNAs exhibited many common characteristics with vertebrate lincRNAs: relatively short length, low exon numbers, low expression, and low sequence conservation. 1,175 lincRNAs were expressed in a tissue-specific manner, with 35.2% preferentially expressed in male gonad. 776 lincRNAs were specifically expressed in juvenile during different developmental stages. In addition, 47 lincRNAs were found to be potentially related to oyster settlement and metamorphosis. Such diverse temporal and spatial patterns of expression suggest that these lincRNAs might function in cell differentiation during early development, as well as sex differentiation and reproduction. Based on a co-expression network analysis, five lincRNAs were detected that have an expression correlation with key hub genes in four modules significantly correlated with larval development. Our study provides the first large-scale identification of lincRNAs in molluscs and offers new insights into potential functions of lincRNAs in marine invertebrates. PMID:26861843

  14. Identification of Trichosporon spp. Strains by Sequencing D1/D2 Region and Sub-typing by Sequencing Ribosomal Intergenic Spacer Region of Ribosomal DNA

    Jingsi ZENG; Cristina Maria de Souza Motta; Kazutaka Fukushima; Kayoko Takizawa; Oliane Maria Correia Magalhes; Rejane Pereira Neves; Kazuko Nishimura

    2009-01-01

    To re-identify and further group 25 isolates of Trichosporon spp. identified morphologically previously, sequences of D1/D2 region of large subunit (LSU) of ribosomal DNA (rDNA) of 25 tested strains for identification and those of ribosomal intergenic space 1 (IGS1) region of 11 strains for sub-grouping were detected. The identifications of tested strains were changed except 6 strains. According to the alignment of the IGS1 region, 6 T. asahii isolates tested fell into 4 groups and 5 T. faecale isolates into 3 groups. Polymorphism of 2 T.japonicum isolates was found in 10 positions. With the alignments obtained in this research compared with the relative GenBank entries, it was found that T. asahii, T.faecale and T.japonicum species were divided into 7, 3 and 2 subtypes respectively. Morphological and biophysical methods are not sufficient for Trichosporon spp. identification. Sequencing becomes neces-sary for Trichosporon diagnosis. There is obvious diversity within a species.

  15. Nucleolin is required for DNA methylation state and the expression of rRNA gene variants in Arabidopsis thaliana.

    Frédéric Pontvianne

    2010-11-01

    Full Text Available In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1. Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre-rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis.

  16. Biodegradation of Nitro-Substituted Explosives 2,4,6-Trinitrotoluene, Hexahydro-1,3,5-Trinitro-1,3,5-Triazine, and Octahydro-1,3,5,7-Tetranitro-1,3,5-Tetrazocine by a Phytosymbiotic Methylobacterium sp. Associated with Poplar Tissues (Populus deltoides × nigra DN34)

    Van Aken, Benoit; Yoon, Jong Moon; Schnoor, Jerald L.

    2004-01-01

    A pink-pigmented symbiotic bacterium was isolated from hybrid poplar tissues (Populus deltoides × nigra DN34). The bacterium was identified by 16S and 16S-23S intergenic spacer ribosomal DNA analysis as a Methylobacterium sp. (strain BJ001). The isolated bacterium was able to use methanol as the sole source of carbon and energy, which is a specific attribute of the genus Methylobacterium. The bacterium in pure culture was shown to degrade the toxic explosives 2,4,6-trinitrotoluene (TNT), hexa...

  17. First description of Trueperella (Arcanobacterium) bernardiae of animal origin.

    Hijazin, M; Metzner, M; Erhard, M; Nagib, S; Alber, J; Lämmler, C; Hassan, A A; Prenger-Berninghoff, E; Zschöck, M

    2012-10-12

    In the present study a Trueperella (Arcanobacterium) bernardiae strain isolated from an anal swab of a three-day-old piglet could be identified phenotypically, by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) and genotypically by sequencing the 16S rDNA, the 16S-23S rDNA intergenic spacer region (ISR) and by sequencing the superoxide dismutase A encoding gene sodA. The present study gives the first information about the presence of T. (A.) bernardiae in specimen of animals. PMID:22608102

  18. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment.

    Kwasniewska, Jolanta; Jaskowiak, Joanna

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  19. A renaissance for the pioneering 16S rRNA gene

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  20. Rapid identification of Renibacterium salmoninarum using an oligonucleotide probe complementary to 16S rRNA.

    Mattsson, J G; Gersdorf, H; Jansson, E; Hongslo, T; Göbel, U B; Johansson, K E

    1993-02-01

    Bacterial kidney disease in salmonid fish is caused by the slow-growing Gram-positive rod, Renibacterium salmoninarum. The partial sequence of 16S rRNA from R. salmoninarum was determined and compared with published bacterial 16S rRNA sequences. From this sequence information, a 30-bases-long oligonucleotide was designed and used as a specific probe for identification of R. salmoninarum in filter hybridization experiments. Strong specific hybridization signals were observed for all strains of R. salmoninarum tested. Furthermore, no cross-hybridization could be seen against 22 other bacterial species, among them other salmonid fish pathogens. The detection limit for the probe in direct filter hybridization by the dot-blot technique was 2.5 x 10(4) bacteria. It was also possible to detect R. salmoninarum in clinical samples by direct filter hybridization. PMID:8455640

  1. Phylogeny of the malarial genus Plasmodium, derived from rRNA gene sequences.

    Escalante, A A; Ayala, F. J.

    1994-01-01

    Malaria is among mankind's worst scourges, affecting many millions of people, particularly in the tropics. Human malaria is caused by several species of Plasmodium, a parasitic protozoan. We analyze the small subunit rRNA gene sequences of 11 Plasmodium species, including three parasitic to humans, to infer their evolutionary relationships. Plasmodium falciparum, the most virulent of the human species, is closely related to Plasmodium reichenowi, which is parasitic to chimpanzee. The estimate...

  2. Direct ribosome isolation from soil to extract bacterial rRNA for community analysis.

    Felske, A; B. Engelen; Nübel, U; Backhaus, H

    1996-01-01

    A simple method that combines an adapted ribosome isolation method and a common RNA extraction step has been developed for selective recovery of intact rRNA from natural microbial communities in soil. After mechanical cell lysis, ribosomes are separated by centrifugation steps, avoiding massive humic acid contamination and RNA degradation. The protocol accommodates the complex composition of soils by blocking adsorbing surfaces and humic acids with polyvinylpyrrolidone and bovine serum albumi...

  3. New bioinformatic tools for analysis of nucleotide modifications in eukaryotic rRNA

    Piekna-Przybylska, Dorota; Decatur, Wayne A.; Fournier, Maurille J.

    2007-01-01

    This report presents a valuable new bioinformatics package for research on rRNA nucleotide modifications in the ribosome, especially those created by small nucleolar RNA:protein complexes (snoRNPs). The interactive service, which is not available elsewhere, enables a user to visualize the positions of pseudouridines, 2′-O-methylations, and base methylations in three-dimensional space in the ribosome and also in linear and secondary structure formats of ribosomal RNA. Our tools provide additio...

  4. rRNA genes from the lower chordate Herdmania momus: structural similarity with higher eukaryotes.

    Degnan, B M; Yan, J.; Hawkins, C J; Lavin, M F

    1990-01-01

    Ascidians, primitive chordates that have retained features of the likely progenitors to all vertebrates, are a useful model to study the evolutionary relationship of chordates to other animals. We have selected the well characterized ribosomal RNA (rRNA) genes to investigate this relationship, and we describe here the cloning and characterization of an entire ribosomal DNA (rDNA) tandem repeat unit from a lower chordate, the ascidian Herdmania momus. rDNA copy number and considerable sequence...

  5. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    Haltiner, M M; Smale, S T; Tjian, R

    1986-01-01

    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this...

  6. 18S rRNA suggests that Entoprocta are protostomes, unrelated to Ectoprocta

    Mackey, L.Y.; Winnepenninckx, B.; Wachter, R.; Backeljau, T.; Emschermann, P.; Garey, J.R.

    1996-01-01

    The Ento- and Ectoprocta are sometimes placed together in the Bryozoa, which have variously been regarded as proto- or deuterostomes. However, Entoprocta have also been allied to the pseudocoelomates, while Ectoprocta are often united with the Brachiopoda and Phoronida in the (super)phylum Lophophorata. Hence, the phylogenetic relationships of these taxa are still much debated. We determined complete 18S rRNA sequences of two entoprocts, an ectoproct, an inarticulate brachiopod, a phoronid, t...

  7. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    Mohammad Bagher Javadi Nobandegani; Halimi Mohd Saud; Wong Mui Yun

    2015-01-01

    Phosphate solubilizing bacteria (PSB) can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang) oil palm field (University Putra Malaysia). Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta sub...

  8. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    Anna eKiryk

    2013-11-01

    Full Text Available Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer´s disease (AD and may play a role in dementia. Moreover aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3 and dentate gyrus. Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that thirty-six transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the dentate gyrus a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving

  9. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  10. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness.

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan

    2016-06-01

    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general. PMID:26119842

  11. Genotypic Characterization of Escherichia coli O157:H7 Isolates from Different Sources in the North-West Province, South Africa, Using Enterobacterial Repetitive Intergenic Consensus PCR Analysis

    Collins Njie Ateba

    2014-05-01

    Full Text Available In many developing countries, proper hygiene is not strictly implemented when animals are slaughtered and meat products become contaminated. Contaminated meat may contain Escherichia coli (E. coli O157:H7 that could cause diseases in humans if these food products are consumed undercooked. In the present study, a total of 94 confirmed E. coli O157:H7 isolates were subjected to the enterobacterial repetitive intergenic consensus (ERIC polymerase chain reaction (PCR typing to generate genetic fingerprints. The ERIC fragments were resolved by electrophoresis on 2% (w/v agarose gels. The presence, absence and intensity of band data were obtained, exported to Microsoft Excel (Microsoft Office 2003 and used to generate a data matrix. The unweighted pair group method with arithmetic mean (UPGMA and complete linkage algorithms were used to analyze the percentage of similarity and matrix data. Relationships between the various profiles and/or lanes were expressed as dendrograms. Data from groups of related lanes were compiled and reported on cluster tables. ERIC fragments ranged from one to 15 per isolate, and their sizes varied from 0.25 to 0.771 kb. A large proportion of the isolates produced an ERIC banding pattern with three duplets ranging in sizes from 0.408 to 0.628 kb. Eight major clusters (I–VIII were identified. Overall, the remarkable similarities (72% to 91% between the ERIC profiles for the isolate from animal species and their corresponding food products indicated some form of contamination, which may not exclude those at the level of the abattoirs. These results reveal that ERIC PCR analysis can be reliable in comparing the genetic profiles of E. coli O157:H7 from different sources in the North-West Province of South Africa.

  12. CHIR99021 promotes self-renewal of mouse embryonic stem cells by modulation of protein-encoding gene and long intergenic non-coding RNA expression

    Wu, Yongyan [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Ai, Zhiying [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Yao, Kezhen [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Cao, Lixia; Du, Juan; Shi, Xiaoyan [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Guo, Zekun, E-mail: gzk@nwsuaf.edu.cn [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Zhang, Yong, E-mail: zhylab@hotmail.com [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China)

    2013-10-15

    Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR.

  13. CHIR99021 promotes self-renewal of mouse embryonic stem cells by modulation of protein-encoding gene and long intergenic non-coding RNA expression

    Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR

  14. Analysis of stress-induced duplex destabilization (SIDD properties of replication origins, genes and intergenes in the fission yeast, Schizosaccharomyces pombe

    Yadav Mukesh P

    2012-11-01

    Full Text Available Abstract Background Replication and transcription, the two key functions of DNA, require unwinding of the DNA double helix. It has been shown that replication origins in the budding yeast, Saccharomyces cerevisiae contain an easily unwound stretch of DNA. We have used a recently developed method for determining the locations and degrees of stress-induced duplex destabilization (SIDD for all the reported replication origins in the genome of the fission yeast, Schizosaccharomyces pombe. Results We have found that the origins are more susceptible to SIDD as compared to the non-origin intergenic regions (NOIRs and genes. SIDD analysis of many known origins in other eukaryotes suggests that SIDD is a common property of replication origins. Interestingly, the previously shown deletion-dependent changes in the activities of the origins of the ura4 origin region on chromosome 3 are paralleled by changes in SIDD properties, suggesting SIDD’s role in origin activity. SIDD profiling following in silico deletions of some origins suggests that many of the closely spaced S. pombe origins could be clusters of two or three weak origins, similar to the ura4 origin region. Conclusion SIDD appears to be a highly conserved, functionally important property of replication origins in S. pombe and other organisms. The distinctly low SIDD scores of origins and the long range effects of genetic alterations on SIDD properties provide a unique predictive potential to the SIDD analysis. This could be used in exploring different aspects of structural and functional organization of origins including interactions between closely spaced origins.

  15. BAC-end microsatellites from intra and inter-genic regions of the common bean genome and their correlation with cytogenetic features.

    Matthew Wohlgemuth Blair

    Full Text Available Highly polymorphic markers such as simple sequence repeats (SSRs or microsatellites are very useful for genetic mapping. In this study novel SSRs were identified in BAC-end sequences (BES from non-contigged, non-overlapping bacterial artificial clones (BACs in common bean (Phaseolus vulgaris L.. These so called "singleton" BACs were from the G19833 Andean gene pool physical map and the new BES-SSR markers were used for the saturation of the inter-gene pool, DOR364×G19833 genetic map. A total of 899 SSR loci were found among the singleton BES, but only 346 loci corresponded to the single di- or tri-nucleotide motifs that were likely to be polymorphic (ATT or AG motifs, principally and useful for primer design and individual marker mapping. When these novel SSR markers were evaluated in the DOR364×G19833 population parents, 136 markers revealed polymorphism and 106 were mapped. Genetic mapping resulted in a map length of 2291 cM with an average distance between markers of 5.2 cM. The new genetic map was compared to the most recent cytogenetic analysis of common bean chromosomes. We found that the new singleton BES-SSR were helpful in filling peri-centromeric spaces on the cytogenetic map. Short genetic distances between some new singleton-derived BES-SSR markers was common showing suppressed recombination in these regions compared to other parts of the genome. The correlation of singleton-derived SSR marker distribution with other cytogenetic features of the bean genome is discussed.

  16. rRNA Binding Sites and the Molecular Mechanism of Action of the Tetracyclines.

    Chukwudi, Chinwe U

    2016-08-01

    The tetracycline antibiotics are known to be effective in the treatment of both infectious and noninfectious disease conditions. The 16S rRNA binding mechanism currently held for the antibacterial action of the tetracyclines does not explain their activity against viruses, protozoa that lack mitochondria, and noninfectious conditions. Also, the mechanism by which the tetracyclines selectively inhibit microbial protein synthesis against host eukaryotic protein synthesis despite conservation of ribosome structure and functions is still questionable. Many studies have investigated the binding of the tetracyclines to the 16S rRNA using the small ribosomal subunit of different bacterial species, but there seems to be no agreement between various reports on the exact binding site on the 16S rRNA. The wide range of activity of the tetracyclines against a broad spectrum of bacterial pathogens, viruses, protozoa, and helminths, as well as noninfectious conditions, indicates a more generalized effect on RNA. In the light of recent evidence that the tetracyclines bind to various synthetic double-stranded RNAs (dsRNAs) of random base sequences, suggesting that the double-stranded structures may play a more important role in the binding of the tetracyclines to RNA than the specific base pairs, as earlier speculated, it is imperative to consider possible alternative binding modes or sites that could help explain the mechanisms of action of the tetracyclines against various pathogens and disease conditions. PMID:27246781

  17. Characterization of Hydrocortisone Biometabolites and 18S rRNA Gene in Chlamydomonas reinhardtii Cultures

    Seyed Bagher Mosavi-Azam

    2008-10-01

    Full Text Available A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1. This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25ºC for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17b-Dihydroxyandrost-4-en-3-one (2, 11b-hydroxyandrost-4-en-3,17-dione (3, 11b,17a,20b,21-tetrahydroxypregn-4-en-3-one (4 and prednisolone (5 were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  18. Molecular systematics of Volvocales (Chlorophyceae, Chlorophyta) based on exhaustive 18S rRNA phylogenetic analyses.

    Nakada, Takashi; Misawa, Kazuharu; Nozaki, Hisayoshi

    2008-07-01

    The taxonomy of Volvocales (Chlorophyceae, Chlorophyta) was traditionally based solely on morphological characteristics. However, because recent molecular phylogeny largely contradicts the traditional subordinal and familial classifications, no classification system has yet been established that describes the subdivision of Volvocales in a manner consistent with the phylogenetic relationships. Towards development of a natural classification system at and above the generic level, identification and sorting of hundreds of sequences based on subjective phylogenetic definitions is a significant step. We constructed an 18S rRNA gene phylogeny based on 449 volvocalean sequences collected using exhaustive BLAST searches of the GenBank database. Many chimeric sequences, which can cause fallacious phylogenetic trees, were detected and excluded during data collection. The results revealed 21 strongly supported primary clades within phylogenetically redefined Volvocales. Phylogenetic classification following PhyloCode was proposed based on the presented 18S rRNA gene phylogeny along with the results of previous combined 18S and 26S rRNA and chloroplast multigene analyses. PMID:18430591

  19. Details of gastropod phylogeny inferred from 18S rRNA sequences.

    Winnepenninckx, B; Steiner, G; Backeljau, T; De Wachter, R

    1998-02-01

    Some generally accepted viewpoints on the phylogenetic relationships within the molluscan class Gastropoda are reassessed by comparing complete 18S rRNA sequences. Phylogenetic analyses were performed using the neighbor-joining and maximum parsimony methods. The previously suggested basal position of Archaeogastropoda, including Neritimorpha and Vetigastropoda, in the gastropod clade is confirmed. The present study also provides new molecular evidence for the monophyly of both Caenogastropoda and Euthyneura (Pulmonata and Opisthobranchia), making Prosobranchia paraphyletic. The relationships within Caenogastropoda and Euthyneura data turn out to be very unstable on the basis of the present 18S rRNA sequences. The present 18S rRNA data question, but are insufficient to decide on, muricacean (Neogastropoda), neotaenioglossan, pulmonate, or stylommatophoran monophyly. The analyses also focus on two systellommatophoran families, namely, Veronicellidae and Onchidiidae. It is suggested that Systellommatophora are not a monophyletic unit but, due to the lack of stability in the euthyneuran clade, their affinity to either Opisthobranchia or Pulmonata could not be determined. PMID:9479694

  20. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  1. Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome

    Carlos; W; Nossa; William; E; Oberdorf; Jφrn; A; Aas; Bruce; J; Paster; Todd; Z; DeSantis; Eoin; L; Brodie; Daniel; Malamud; Michael; A; Poles

    2010-01-01

    AIM:To design and validate broad-range 16S rRNA primers for use in high throughput sequencing to classify bacteria isolated from the human foregut microbiome.METHODS:A foregut microbiome dataset was constructed using 16S rRNA gene sequences obtained from oral,esophageal,and gastric microbiomes produced by Sanger sequencing in previous studies represented by 219 bacterial species.Candidate primers evaluated were from the European rRNA database.To assess the effect of sequence length on accuracy of classifica...

  2. Primary and secondary structure of 5.8S rRNA from the silkgland of Bombyx mori.

    Fujiwara, H.; Kawata, Y.; H. Ishikawa

    1982-01-01

    Nucleotide sequence of 5.8S rRNA of the silkworm, Bombyx mori has been determined by gel sequencing methods. The 5.8S rRNA was the longest so far reported, with the 5'-terminal sequence several nucleotides longer than those of the other organisms. Upon constructing the secondary structure in accordance with the "burp gun" model (12), the Bombyx 5.8S rRNA formed a wide-open "muzzle" due to several unpaired bases at the ends. The overall structure also appeared less stable with less G . C pairs...

  3. An efficient rRNA removal method for RNA sequencing in GC-rich bacteria

    Peano Clelia

    2013-01-01

    Full Text Available Abstract Background Next generation sequencing (NGS technologies have revolutionized gene expression studies and functional genomics analysis. However, further improvement of RNA sequencing protocols is still desirable, in order to reduce NGS costs and to increase its accuracy. In bacteria, a major problem in RNA sequencing is the abundance of ribosomal RNA (rRNA, which accounts for 95-98% of total RNA and can therefore hinder sufficient coverage of mRNA, the main focus of transcriptomic studies. Thus, efficient removal of rRNA is necessary to achieve optimal coverage, good detection sensitivity and reliable results. An additional challenge is presented by microorganisms with GC-rich genomes, in which rRNA removal is less efficient. Results In this work, we tested two commercial kits for rRNA removal, either alone or in combination, on Burkholderia thailandensis. This bacterium, chosen as representative of the important Burkholderia genus, which includes both pathogenic and environmental bacteria, has a rather large (6.72 Mb and GC-rich (67.7% genome. Each enriched mRNA sample was sequenced through paired-end Illumina GAIIx run in duplicate, yielding between 10 and 40 million reads. We show that combined treatment with both kits allows an mRNA enrichment of more than 238-fold, enabling the sequencing of almost all (more than 90% B. thailandensis transcripts from less than 10 million reads, without introducing any bias in mRNA relative abundance, thus preserving differential expression profile. Conclusions The mRNA enrichment protocol presented in this work leads to an increase in detection sensitivity up to 770% compared to total RNA; such increased sensitivity allows for a corresponding reduction in the number of sequencing reads necessary for the complete analysis of whole transcriptome expression profiling. Thus we can conclude that the MICROBExpress/Ovation combined rRNA removal method could be suitable for RNA sequencing of whole

  4. Species identification and profiling of complex microbial communities using shotgun Illumina sequencing of 16S rRNA amplicon sequences.

    Ong, SH; Kukkillaya, VU; Wilm, A; Lay, C; Ho, EX; Low, L; Hibberd, ML; Nagarajan, N.

    2013-01-01

    The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequenc...

  5. Intervening Sequences in rrl Genes and Fragmentation of 23S rRNA in Genera of the Family Enterobacteriaceae

    Pronk, Loes M; Sanderson, Kenneth E.

    2001-01-01

    Intervening sequences (IVSs) in the rrl genes for 23S rRNA are transcribed but later removed by RNase III without religation during RNA processing, leading to fragmented rRNA. We examined about 240 strains of the family Enterobacteriaceae for presence of IVSs using PCR. No IVSs were detected in strains belonging to Escherichia, Shigella, Enterobacter, Erwinia, Ewingella, Hafnia, Kluyvera, Morganella, Pantoea, or Serratia. Previously unreported IVSs were detected in Klebsiella oxytoca, Citroba...

  6. Transcriptional down-regulation and rRNA cleavage in Dictyostelium discoideum mitochondria during Legionella pneumophila infection.

    Chenyu Zhang

    Full Text Available Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial

  7. Comparative Bioinformatics and Experimental Analysis of the Intergenic Regulatory Regions of Bacillus cereus hbl and nhe Enterotoxin Operons and the Impact of CodY on Virulence Heterogeneity.

    Böhm, Maria-Elisabeth; Krey, Viktoria M; Jeßberger, Nadja; Frenzel, Elrike; Scherer, Siegfried

    2016-01-01

    Bacillus cereus is a food contaminant with greatly varying enteropathogenic potential. Almost all known strains harbor the genes for at least one of the three enterotoxins Nhe, Hbl, and CytK. While some strains show no cytotoxicity, others have caused outbreaks, in rare cases even with lethal outcome. The reason for these differences in cytotoxicity is unknown. To gain insight into the origin of enterotoxin expression heterogeneity in different strains, the architecture and role of 5' intergenic regions (5' IGRs) upstream of the nhe and hbl operons was investigated. In silico comparison of 142 strains of all seven phylogenetic groups of B. cereus sensu lato proved the presence of long 5' IGRs upstream of the nheABC and hblCDAB operons, which harbor recognition sites for several transcriptional regulators, including the virulence regulator PlcR, redox regulators ResD and Fnr, the nutrient-sensitive regulator CodY as well as the master regulator for biofilm formation SinR. By determining transcription start sites, unusually long 5' untranslated regions (5' UTRs) upstream of the nhe and hbl start codons were identified, which are not present upstream of cytK-1 and cytK-2. Promoter fusions lacking various parts of the nhe and hbl 5' UTR in B. cereus INRA C3 showed that the entire 331 bp 5' UTR of nhe is necessary for full promoter activity, while the presence of the complete 606 bp hbl 5' UTR lowers promoter activity. Repression was caused by a 268 bp sequence directly upstream of the hbl transcription start. Luciferase activity of reporter strains containing nhe and hbl 5' IGR lux fusions provided evidence that toxin gene transcription is upregulated by the depletion of free amino acids. Electrophoretic mobility shift assays showed that the branched-chain amino acid sensing regulator CodY binds to both nhe and hbl 5' UTR downstream of the promoter, potentially acting as a nutrient-responsive roadblock repressor of toxin gene transcription. PlcR binding sites are

  8. Inactivation of intergenic enhancers by EBNA3A initiates and maintains polycomb signatures across a chromatin domain encoding CXCL10 and CXCL9.

    Marie L Harth-Hertle

    2013-09-01

    Full Text Available Epstein-Barr virus (EBV causes a persistent infection in human B cells by establishing specific transcription programs to control B cell activation and differentiation. Transcriptional reprogramming of EBV infected B cells is predominantly driven by the action of EBV nuclear antigens, among them the transcriptional repressor EBNA3A. By comparing gene expression profiles of wt and EBNA3A negative EBV infected B cells, we have previously identified a broad array of cellular genes controlled by EBNA3A. We now find that genes repressed by EBNA3A in these cells are significantly enriched for the repressive histone mark H3K27me3, which is installed by Polycomb group (PcG proteins. This PcG-controlled subset of genes also carries H3K27me3 marks in a variety of other tissues, suggesting that the commitment to PcG silencing is an intrinsic feature of these gene loci that can be used by EBNA3A. In addition, EBNA3A targets frequently reside in co-regulated gene clusters. To study the mechanism of gene repression by EBNA3A and to evaluate the relative contribution of PcG proteins during this process, we have selected the genomic neighbors CXCL10 and CXCL9 as a model for co-repressed and PcG-controlled genes. We show that EBNA3A binds to CBF1 occupied intergenic enhancers located between CXCL10 and CXCL9 and displaces the transactivator EBNA2. This impairs enhancer activity, resulting in a rapid transcriptional shut-down of both genes in a CBF1-dependent manner and initiation of a delayed gain of H3K27me3 marks covering an extended chromatin domain. H3K27me3 marks increase gradually and are maintained by EBNA3A. Our study provides direct evidence that repression by EBNA3A requires CBF1 and that EBNA3A and EBNA2 compete for access to CBF1 at identical genomic sites. Most importantly, our results demonstrate that transcriptional silencing by EBNA3A precedes the appearance of repressive PcG marks and indicate that both events are triggered by loss of enhancer

  9. Inactivation of intergenic enhancers by EBNA3A initiates and maintains polycomb signatures across a chromatin domain encoding CXCL10 and CXCL9.

    Harth-Hertle, Marie L; Scholz, Barbara A; Erhard, Florian; Glaser, Laura V; Dölken, Lars; Zimmer, Ralf; Kempkes, Bettina

    2013-09-01

    Epstein-Barr virus (EBV) causes a persistent infection in human B cells by establishing specific transcription programs to control B cell activation and differentiation. Transcriptional reprogramming of EBV infected B cells is predominantly driven by the action of EBV nuclear antigens, among them the transcriptional repressor EBNA3A. By comparing gene expression profiles of wt and EBNA3A negative EBV infected B cells, we have previously identified a broad array of cellular genes controlled by EBNA3A. We now find that genes repressed by EBNA3A in these cells are significantly enriched for the repressive histone mark H3K27me3, which is installed by Polycomb group (PcG) proteins. This PcG-controlled subset of genes also carries H3K27me3 marks in a variety of other tissues, suggesting that the commitment to PcG silencing is an intrinsic feature of these gene loci that can be used by EBNA3A. In addition, EBNA3A targets frequently reside in co-regulated gene clusters. To study the mechanism of gene repression by EBNA3A and to evaluate the relative contribution of PcG proteins during this process, we have selected the genomic neighbors CXCL10 and CXCL9 as a model for co-repressed and PcG-controlled genes. We show that EBNA3A binds to CBF1 occupied intergenic enhancers located between CXCL10 and CXCL9 and displaces the transactivator EBNA2. This impairs enhancer activity, resulting in a rapid transcriptional shut-down of both genes in a CBF1-dependent manner and initiation of a delayed gain of H3K27me3 marks covering an extended chromatin domain. H3K27me3 marks increase gradually and are maintained by EBNA3A. Our study provides direct evidence that repression by EBNA3A requires CBF1 and that EBNA3A and EBNA2 compete for access to CBF1 at identical genomic sites. Most importantly, our results demonstrate that transcriptional silencing by EBNA3A precedes the appearance of repressive PcG marks and indicate that both events are triggered by loss of enhancer activity. PMID

  10. Upregulated long intergenic noncoding RNA KRT18P55 acts as a novel biomarker for the progression of intestinal-type gastric cancer

    Ma B

    2016-01-01

    Full Text Available Bin Ma,* Jiajun Wang,* Yongxi Song, Peng Gao, Jingxu Sun, Xiaowan Chen, Yuchong Yang, Zhenning Wang Department of Surgical Oncology and General Surgery, The First Hospital of China Medical University, Shenyang, People’s Republic of China *These authors contributed equally to this work Background: Long noncoding RNAs (lncRNAs with dysregulated expression levels have been investigated in numerous types of different cancer. Whether lncRNAs can predict the progression of gastric cancer (GC still remains largely unclear. The aim of our study was to investigate whether KRT18P55, a novel intergenic lncRNA, can be a predictive biomarker for GC. Methods: To determine the expression levels of KRT18P55 in GC, we evaluated it in five GC cell lines (SGC-7901, MGC-803, BGC-823, AGS, and HG27 and 97 GC tissue samples in comparison with a normal control by quantitative polymerase chain reaction. In addition, the association with patient clinicopathological characteristics was analyzed to identify the clinical significance of KRT18P55. We also used publicly accessible data from The Cancer Genome Atlas (TCGA to further verify the expression levels and clinical significance of KRT18P55. Furthermore, a receiver operating characteristic curve was also conducted to evaluate the diagnostic value of KRT18P55 for GC. Results: A significant upregulation was observed in GC cell lines (P<0.01 and tissue samples (P<0.01. This finding was consistent with the results of 29 pairs of GC tissue samples from TCGA (P<0.01. Additionally, we indicated that the increased expression of KRT18P55 was related to the progression of intestinal type (P=0.032, which was also supported by results of independent GC cohorts from TCGA (P<0.01. However, we did not find significant difference in prognosis between patients with high and low expression of KRT18P55 (P>0.05. Finally, KRT18P55 showed potential diagnostic value for GC with an area under the receiver operating characteristic curve of

  11. Comparative Bioinformatics and Experimental Analysis of the Intergenic Regulatory Regions of Bacillus cereus hbl and nhe Enterotoxin Operons and the Impact of CodY on Virulence Heterogeneity

    Böhm, Maria-Elisabeth; Krey, Viktoria M.; Jeßberger, Nadja; Frenzel, Elrike; Scherer, Siegfried

    2016-01-01

    Bacillus cereus is a food contaminant with greatly varying enteropathogenic potential. Almost all known strains harbor the genes for at least one of the three enterotoxins Nhe, Hbl, and CytK. While some strains show no cytotoxicity, others have caused outbreaks, in rare cases even with lethal outcome. The reason for these differences in cytotoxicity is unknown. To gain insight into the origin of enterotoxin expression heterogeneity in different strains, the architecture and role of 5′ intergenic regions (5′ IGRs) upstream of the nhe and hbl operons was investigated. In silico comparison of 142 strains of all seven phylogenetic groups of B. cereus sensu lato proved the presence of long 5′ IGRs upstream of the nheABC and hblCDAB operons, which harbor recognition sites for several transcriptional regulators, including the virulence regulator PlcR, redox regulators ResD and Fnr, the nutrient-sensitive regulator CodY as well as the master regulator for biofilm formation SinR. By determining transcription start sites, unusually long 5′ untranslated regions (5′ UTRs) upstream of the nhe and hbl start codons were identified, which are not present upstream of cytK-1 and cytK-2. Promoter fusions lacking various parts of the nhe and hbl 5′ UTR in B. cereus INRA C3 showed that the entire 331 bp 5′ UTR of nhe is necessary for full promoter activity, while the presence of the complete 606 bp hbl 5′ UTR lowers promoter activity. Repression was caused by a 268 bp sequence directly upstream of the hbl transcription start. Luciferase activity of reporter strains containing nhe and hbl 5′ IGR lux fusions provided evidence that toxin gene transcription is upregulated by the depletion of free amino acids. Electrophoretic mobility shift assays showed that the branched-chain amino acid sensing regulator CodY binds to both nhe and hbl 5′ UTR downstream of the promoter, potentially acting as a nutrient-responsive roadblock repressor of toxin gene transcription. Plc

  12. Molecular epidemiology of Plasmodium species prevalent in Yemen based on 18 s rRNA

    A Azazy Ahmed

    2010-11-01

    Full Text Available Abstract Background Malaria is an endemic disease in Yemen and is responsible for 4.9 deaths per 100,000 population per year and 43,000 disability adjusted life years lost. Although malaria in Yemen is caused mainly by Plasmodium falciparum and Plasmodium vivax, there are no sequence data available on the two species. This study was conducted to investigate the distribution of the Plasmodium species based on the molecular detection and to study the molecular phylogeny of these parasites. Methods Blood samples from 511 febrile patients were collected and a partial region of the 18 s ribosomal RNA (18 s rRNA gene was amplified using nested PCR. From the 86 positive blood samples, 13 Plasmodium falciparum and 4 Plasmodium vivax were selected and underwent cloning and, subsequently, sequencing and the sequences were subjected to phylogenetic analysis using the neighbor-joining and maximum parsimony methods. Results Malaria was detected by PCR in 86 samples (16.8%. The majority of the single infections were caused by P. falciparum (80.3%, followed by P. vivax (5.8%. Mixed infection rates of P. falciparum + P. vivax and P. falciparum + P. malariae were 11.6% and 2.3%, respectively. All P. falciparum isolates were grouped with the strain 3D7, while P. vivax isolates were grouped with the strain Salvador1. Phylogenetic trees based on 18 s rRNA placed the P. falciparum isolates into three sub-clusters and P. vivax into one cluster. Sequence alignment analysis showed 5-14.8% SNP in the partial sequences of the 18 s rRNA of P. falciparum. Conclusions Although P. falciparum is predominant, P. vivax, P. malariae and mixed infections are more prevalent than has been revealed by microscopy. This overlooked distribution should be considered by malaria control strategy makers. The genetic polymorphisms warrant further investigation.

  13. 巴戟天及其伪品的psbA-trnH序列鉴定%Molecular identification of psbA-trnH intergenic spacers' sequences of Morinda officinalis How and its counterfeit species

    姬生国; 王东; 张春荣; 张宏意

    2011-01-01

    Objective To perform the molecular identification for Morinda officinalis and its counterfeit species based on psbA-trnH intergenic spacers' sequences. Methods Total DNA was extracted and gene sequence was amplified by PCR. PCR product was directly sequenced after purification. Sequences were analyzed with Clustral X and MEGA 3.1 software. Results The length of psbA-trnH intergenic spacers'sequences was 306 bp. Distinctive variation sites among them can be observed. Conclusion The psbA-trnH intergenic spacers' sequences could be used to identificate Morinda officinalis and its counterfeit species.%目的 利用叶绿体基因psbA-trnH间区序列探讨巴戟天及其常见伪品大果巴戟、樟叶巴戟、羊角藤、虎刺的分子鉴定方法.方法 分别提取巴戟天及其伪品植物的总DNA,经PCR扩增纯化后,测序,利用Clustal X和MEGA 3.1软件对序列进行分析.结果 各样品psbA-trnH序列长度为306 bp,巴戟天及其伪品之间存在多个特异性信息位点.结论 psbA-trnH序列可作为巴戟天分子鉴定的依据.

  14. The role of human ribosomal proteins in the maturation of rRNA and ribosome production

    Robledo, Sara; Rachel A Idol; Crimmins, Dan L.; Ladenson, Jack H.; Mason, Philip J.; Bessler, Monica

    2008-01-01

    Production of ribosomes is a fundamental process that occurs in all dividing cells. It is a complex process consisting of the coordinated synthesis and assembly of four ribosomal RNAs (rRNA) with about 80 ribosomal proteins (r-proteins) involving more than 150 nonribosomal proteins and other factors. Diamond Blackfan anemia (DBA) is an inherited red cell aplasia caused by mutations in one of several r-proteins. How defects in r-proteins, essential for proliferation in all cells, lead to a hum...

  15. Structures of nucleolus and transcription sites of rRNA genes in rat liver cells

    2000-01-01

    We observed the ultrastructure of nucleolus in rat liver cells by conventional electronmicroscopy, and employed cytochemistry NAMA-Ur DNA specific stain method to analyze the distributionand position of nucleolar DNA in situ. The results showed that nucleolar DNA of rat livercells comes from nucleolus-associated chromatin, and continuously extends in the dense fibrillarcomponent (DFC) of nucleolus, localizes at the periphery of fibrillar center (FC) and in DFC. Furthermore,by employing anti-DNA/RNA hybrid antibodies, we directly and selectively labeled transcriptionsites of rRNA genes and testified that localization of transcription sites not only to DFC butalso to the periphery of FC.

  16. Altered features in the secondary structure of Vicia faba 5.8s rRNA.

    Nazar, R N; Wildeman, A G

    1981-01-01

    We have re-examined the nucleotide sequence of Vicia faba (broad bean) 5.8S rRNA using partial chemical degradation and a new approach to high temperature (65-80 degrees C) sequencing gels. The results indicate that the secondary structure was not completely disrupted in previous studies (Tanaka, Y., Dyer, T.A. and Brownlee, G.G. (1980) Nucleic Acid Res. 8, 1259-1272) and explain ambiguities between the nucleotide sequence and T1 ribonuclease digests. Despite this revision, estimates in the s...

  17. Functional interactions within 23S rRNA involving the peptidyltransferase center

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S r...... chloramphenicol. Introduction of the domain II deletion into these double-mutation constructs gives rise to erythromycin resistance. The results are interpreted as indicating that position 2032 interacts with the peptidyltransferase loop and that there is a functional connection between domains II and V....

  18. Evolution of green plants as deduced from 5S rRNA sequences

    Hori, Hiroshi; Lim, Byung-Lak; OSAWA, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land pl...

  19. Negative in vitro selection identifies the rRNA recognition motif for ErmE methyltransferase

    Nielsen, A K; Douthwaite, S; Vester, B

    1999-01-01

    the adjacent single-stranded region around A2058. An RNA transcript of 72 nt that displays this motif functions as an efficient substrate for the ErmE methyltransferase. Pools of degenerate RNAs were formed by doping 34-nt positions that extend over and beyond the putative Erm recognition motif within...... contained substitutions at single sites, and these are confined to 12 nucleotide positions. These nucleotides, corresponding to A2051-A2060, C2611, and A2614 in 23S rRNA, presumably comprise the RNA recognition motif for ErmE methyltransferase. The structure formed by these nucleotides is highly conserved...

  20. Enxertia intergenérica de cultivares de nespereira no porta-enxerto de marmeleiro 'japonês' Intergeneric grafting of loquat cultivars using 'Japonese' quince tree as rootstock

    Rafael Pio; Edvan Alves Chagas; Wilson Barbosa; Guilherme Signorini; Nelson Pires Feldberg

    2010-01-01

    No Brasil, foram desenvolvidos alguns trabalhos pioneiros com a utilização do marmeleiro (Cydonia oblonga Mill.) como porta-enxertos para as nespereiras (Eriobotrya japonica (Thunb.) Lindl.). O sucesso da utilização dessa enxertia intergenérica está relacionado, principalmente, à redução do porte da planta. Objetivou-se, neste trabalho estudar técnicas de enxertia de cultivares de nespereiras, utilizando-se o marmeleiro 'Japonês' (Chaenomeles sinensis (Thouin) Koehne) como nova opção de porta...

  1. GENE 16S RRNA SEQUENCE PHYLOGENETIC ANALYSIS OF LYSINE PRODUCERS STRAINS

    G. S. Andriiash

    2014-12-01

    Full Text Available The phylogenetic relationships of strainsproducers of essential amino acids of aspartate family Brevibacterium sp. UCM Ac-674 (Brevibacterium sp. 90, Brevibacterium sp. IMV Ac-5004 (Brevibacterium sp. 90H, Brevibacterium sp. UCM Ac-675 (Brevibacterium sp. E531, mutant strain Brevibacterium sp. IMV B-7447 from the «Collections strains and lines of plants for food and agricultural biotechnology SO “Institute for Food Biotechnology and Genomics” of National Academy of Sciences of Ukraine were investigated. The affiliation strain Brevibacterium sp. IMV B-7447 to the genus Brevibacterium within the sequences of the genes based on 16S rRNA was confirmed. The dendogram of phylogenetic relationships of studied strains and related strains Brevibacterium from database GenBank was constructed. It was shown that by the criterion of homology gene sequences based on 16S rRNA the investigated strains-producers belong to three phylogenetic groups. It was established that the mutant strain Brevibacterium sp. ІMV B-7447 has no analogues in the database GenBank.

  2. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  3. Analysis of the Precursor rRNA Fractions of Rapidly Growing Mycobacteria: Quantification by Methods That Include the Use of a Promoter (rrnA P1) as a Novel Standard†

    Menéndez, María del Carmen; Rebollo, María José; Núñez, María del Carmen; Cox, Robert A.; García, María Jesús

    2005-01-01

    Mycobacterial species are able to control rRNA production through variations in the number and strength of promoters controlling their rrn operons. Mycobacterium chelonae and M. fortuitum are members of the rapidly growing mycobacterial group. They carry a total of five promoters each, encoded, respectively, by one and two rrn operons per genome. Quantification of precursor rrn transcriptional products (pre-rrn) has allowed detection of different promoter usage during cell growth. Bacteria growing in several culture media with different nutrient contents were compared. Balanced to stationary phases were analyzed. Most promoters were found to be used at different levels depending on the stage of bacterial growth and the nutrient content of the culture medium. Some biological implications are discussed. Sequences of the several promoters showed motifs that could be correlated to their particular level of usage. A product corresponding to the first rrnA promoter in both species, namely, rrnA P1, was found to contribute at a low and near-constant level to pre-rRNA synthesis, regardless of the culture medium used and the stage of growth analyzed. This product was used as a standard to quantitate rRNA gene expression by real-time PCR when M. fortuitum infected macrophages. It was shown that this bacterium actively synthesizes rRNA during the course of infection and that one of its rrn operons is preferentially used under such conditions. PMID:15629925

  4. Changes in rRNA levels during stress invalidates results from mRNA blotting: Fluorescence in situ rRNA hybridization permits renormalization for estimation of cellular mRNA levels

    Hansen, M.C.; Nielsen, A.K.; Molin, Søren; Hammer, Karin; Kilstrup, Mogens

    2001-01-01

    experiments, in which mRNA levels routinely are normalized to a fixed amount of extracted total RNA. The cellular levels of specific mRNA species were estimated using a renormalization with the total RNA content per cell. By a combination of fluorescence in situ rRNA hybridization, which estimates the...... relative level of rRNA per cell, and slot blotting to rRNA probes, which estimates the level of rRNA per extracted total RNA, the amount of RNA per cell was calculated in a series of heat shock experiments with the gram-positive bacterium Lactococcus lactis. It was found that the level of rRNA per cell......Regulation of gene expression can be analyzed by a number of different techniques. Some techniques monitor the level of specific mRNA directly, and others monitor indirectly by determining the level of enzymes encoded by the mRNA. Each method has its own inherent way of normalization. When results...

  5. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics.

    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G

    2005-09-01

    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  6. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-01-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  7. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes.

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-06-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  8. On the brink of holoparasitism: plastome evolution in dwarf mistletoes (Arceuthobium, Viscaceae).

    Nickrent, Daniel L; García, Miguel A

    2009-06-01

    Chloroplast sequences spanning rps7 to 23S rDNA in Arceuthobium campylopodum and A. pendens were generated and compared to Arabidopsis and seven other parasitic plants. Pseudogenes for trnV, trnI (GAU), and trnA (UGC) were seen in both Arceuthobium species, paralleling the situation in the holoparasite Epifagus (Orobanchaceae). These tRNA genes were intact, however, in two other members of Santalales (Ximenia and Phoradendron). The 16S-23S rDNA intergenic spacer was sequenced for 13 additional species of Arceuthobium representing both Old and New World taxa. All species examined had pseudogenes for trnI and trnA, however, deletions in these tRNAs have occurred in different regions among various lineages of the genus. The aligned 16S-23S rDNA intergenic spacer was analyzed using maximum parsimony and compared with nuclear ITS rDNA using a similar suite of species. Overall species relationships were generally congruent, although two cases of potential lineage sorting or chloroplast capture were detected. Arceuthobium is a valuable genetic model to contrast with holoparasites because, despite significant alteration and truncation of its plastome, it still maintains photosynthetic function. PMID:19479176

  9. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    Recht, M I; Douthwaite, S; Dahlquist, K D;

    1999-01-01

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  10. Mapping important nucleotides in the peptidyl transferase centre of 23 S rRNA using a random mutagenesis approach

    Porse, B T; Garrett, R A

    1995-01-01

    Random mutations were generated in the lower half of the peptidyl transferase loop in domain V of 23 S rRNA from Escherichia coli using a polymerase chain reaction (PCR) approach, a rapid procedure for identifying mutants and a plasmid-based expression system. The effects of 21 single......-site mutations, at 18 different positions, on cell growth, mutant rRNA incorporation into ribosomes and peptidyl transferase activity of the mutant ribosomes were analysed. The general importance of the whole region for the peptidyl transferase centre was emphasized by the finding that 14 of the mutants were...... sick, or very sick, when ribosomes containing chromosomal-encoded 23 S rRNA were inhibited by erythromycin, and all except one of these exhibited low levels of peptidyl transferase activity in their mutated ribosomes. Two mutations, psi 2580-->C and U2584-->G that both yielded inactive ribosomes were...

  11. 16S rRNA gene sequencing as a tool to study microbial populations in foods and process environments

    Buschhardt, Tasja; Hansen, Tina Beck; Bahl, Martin Iain; Asser Hansen, Martin; Abu Al-Soud, Waleed; Aabo, Søren

    and their role in food safety. During method optimization, we have identified several factors which distort the characterization of microbial populations, including DNA extraction methods, DNA polymerases, and most importantly the analyzed fragment of the 16S rRNA gene. Methods: This study...... culture methods as cross reference. Results: Taxonomic assignments and abundances of sequences in the total community and in the Enterobacteriaceae subpopulation were affected by the 16S rRNA gene variable region, DNA extraction methods, and polymerases chosen. However, community compositions were very......Introduction: Methodological constraints during culturing and biochemical testing have left the true microbiological diversity of foods and process environments unexplored. Culture-independent molecular methods, such as 16S rRNA gene sequencing, may provide deeper insight into microbial communities...

  12. 16S rRNA amplicon sequencing dataset for conventionalized and conventionally raised zebrafish larvae.

    Davis, Daniel J; Bryda, Elizabeth C; Gillespie, Catherine H; Ericsson, Aaron C

    2016-09-01

    Data presented here contains metagenomic analysis regarding the sequential conventionalization of germ-free zebrafish embryos. Zebrafish embryos that underwent a germ-free sterilization process immediately after fertilization were promptly exposed to and raised to larval stage in conventional fish water. At 6 days postfertilization (dpf), these "conventionalized" larvae were compared to zebrafish larvae that were raised in conventional fish water never undergoing the initial sterilization process. Bacterial 16S rRNA amplicon sequencing was performed on DNA isolated from homogenates of the larvae revealing distinct microbiota variations between the two groups. The dataset described here is also related to the research article entitled "Microbial modulation of behavior and stress responses in zebrafish larvae" (Davis et al., 2016) [1]. PMID:27508247

  13. Multi-site-specific 16S rRNA methyltransferase RsmF from Thermus thermophilus

    Demirci, Hasan; Larsen, Line H G; Hansen, Trine;

    2010-01-01

    Cells devote a significant effort toward the production of multiple modified nucleotides in rRNAs, which fine tune the ribosome function. Here, we report that two methyltransferases, RsmB and RsmF, are responsible for all four 5-methylcytidine (m(5)C) modifications in 16S rRNA of Thermus...... thermophilus. Like Escherichia coli RsmB, T. thermophilus RsmB produces m(5)C967. In contrast to E. coli RsmF, which introduces a single m(5)C1407 modification, T. thermophilus RsmF modifies three positions, generating m(5)C1400 and m(5)C1404 in addition to m(5)C1407. These three residues are clustered near...

  14. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    Junko Obata

    Full Text Available While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating.

  15. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Nathan D. Olson

    2015-03-01

    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  16. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio

    2010-04-01

    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae. PMID:19656941

  17. Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus

    Verma Mansi; Lal Devi; Lal Rup

    2011-01-01

    Abstract Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplemen...

  18. Single Nucleotide Polymorphism of SSU rRNA Gene among ‎Plasmodium Knowlesi Isolates of Sabah

    Fread Anderios; Daw Khin Saw Naing; Zaw Lin

    2012-01-01

    ackground: ‎The advent of PCR (Polymerase Chain Reaction) assays helped in correctly identifying ‎Plasmodium knowlesi, which was previously misdiagnosed by microscopy as Plasmodium ‎malarie in Sabah, Malaysia. The PCR-based diagnosis of P. knowlesi in Sabah is currently using a ‎set of oligonucleotide primers namely Pmk8 and Pmk9 that target one of the parasite’s small ‎subunit rRNA (SSU rRNA) genes. PCR also helped in discovering a variant form of P. malariae ‎which has a deletion of 19 bp ...

  19. Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

    Dron, M; Rahire, M; Rochaix, J D

    1982-01-01

    The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stre...

  20. SSU rRNA reveals a sequential increase in shell complexity among the euglyphid testate amoebae (Rhizaria: Euglyphida)

    Lara, Enrique; Heger, Thierry J; Mitchell, Edward A D; Meisterfeld, Ralf; Ekelund, Flemming

    2007-01-01

    The existing data on the molecular phylogeny of filose testate amoebae from order Euglyphida has revealed contradictions between traditional morphological classification and SSU rRNA phylogeny and, moreover, the position of several important genera remained unknown. We therefore carried out a study...... aiming to fill several important gaps and better understand the relationships among the main euglyphid testate amoebae and the evolutionary steps that led to the present diversity at a higher level. We obtained new SSU rRNA sequences from five genera and seven species. This new phylogeny obtained shows...

  1. The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis

    Cole, J. R.; Chai, B.; Farris, R. J.; Wang, Q; Kulam, S. A.; McGarrell, D. M.; Garrity, G M; Tiedje, J M

    2004-01-01

    The Ribosomal Database Project (RDP-II) provides the research community with aligned and annotated rRNA gene sequences, along with analysis services and a phylogenetically consistent taxonomic framework for these data. Updated monthly, these services are made available through the RDP-II website (http://rdp.cme.msu.edu/). RDP-II release 9.21 (August 2004) contains 101 632 bacterial small subunit rRNA gene sequences in aligned and annotated format. High-throughput tools for initial taxonomic p...

  2. Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up- and downshift

    Jydegaard-Axelsen, A.M.; Aaes-Jorgensen, A.; Koch, A.G.; Stoumann Jensen, J.; Knochel, S.

    2005-01-01

    Cell morphology, rRNA content, and growth were examined for Listeria monocytogenes LO28 and EGD, respectively, grown in brain-heart infusion (BHI) and on slices of sausage at 10degreesC in 100% CO2, 100% N-2, and air. In CO2, filamentous cells were formed by both strains on sausage slices and by L...... unchanged. On sausage slices, the number of colony forming units also increased rapidly for both strains in response to CO2 downshift. Large variations in rRNA content of individual cells were observed in the tested scenarios. The results demonstrate the risk of underestimating the number of infectious...

  3. Assessing the Fecal Microbiota: An Optimized Ion Torrent 16S rRNA Gene-Based Analysis Protocol

    Foroni, Elena; Duranti, Sabrina; Turroni, Francesca; Lugli, Gabriele Andrea; Sanchez, Borja; Martín, Rebeca; Gueimonde, Miguel; van Sinderen, Douwe; Margolles, Abelardo; Ventura, Marco

    2013-01-01

    Assessing the distribution of 16S rRNA gene sequences within a biological sample represents the current state-of-the-art for determination of human gut microbiota composition. Advances in dissecting the microbial biodiversity of this ecosystem have very much been dependent on the development of novel high-throughput DNA sequencing technologies, like the Ion Torrent. However, the precise representation of this bacterial community may be affected by the protocols used for DNA extraction as well as by the PCR primers employed in the amplification reaction. Here, we describe an optimized protocol for 16S rRNA gene-based profiling of the fecal microbiota. PMID:23869230

  4. Molecular genetic monitoring of bacterial communities in manzala lake, egypt, based on 16S rRNA gene analysis

    El Saied, H.E.

    2007-01-01

    A first molecular genetic study on the diversity of bacterial communities at Manzala Lake, Egypt, was determined by culture-independent 16S rRNA gene analysis. Bulk DNAs were extracted from water and sediment at two different sampling sites namely; Bashtir and Genka, in the lake. The 16S rRNA gene was positively amplified by polymerase chain reaction (PCR) from bulk DNA of each sample, cloned and sequenced. The sequence analysis of one hundred clones from each clone library obtained number of...

  5. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

    Manal Helal

    Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

  6. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.

    2011-01-01

    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stab...

  7. Interaction of the tylosin-resistance methyltransferase RlmA II at its rRNA target differs from the orthologue RlmA I

    Douthwaite, Stephen; Jakobsen, Lene; Yoshizawa, Satoko;

    2008-01-01

    footprint contacts with nucleotides in stem-loops 33, 34 and 35, and does not interact elsewhere in the rRNA. Binding of RlmA(II) to the rRNA is dependent on the cofactor S-adenosylmethionine (or S-adenosylhomocysteine). RlmA(II) interacts with the same rRNA region as the orthologous enzyme RlmA(I) that...

  8. Automated identification of medically important bacteria by 16S rRNA gene sequencing using a novel comprehensive database, 16SpathDB

    Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

    2011-01-01

    Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiol...

  9. Domain V of 23S rRNA contains all the structural elements necessary for recognition by the ErmE methyltransferase

    Vester, B; Douthwaite, S

    1994-01-01

    enzyme efficiently modifies 23S rRNA in vitro. Removal of most of the 23S rRNA structure, so that only domain V (nucleotides 2000 to 2624) remains, does not affect the efficiency of modification by the methyltransferase. In addition, modification still occurs after the rRNA tertiary structure has been......The ErmE methyltransferase from the erythromycin-producing actinomycete Saccharopolyspora erythraea dimethylates the N-6 position of adenine 2058 in domain V of 23S rRNA. This modification confers resistance to erythromycin and to other macrolide, lincosamide, and streptogramin B antibiotics. We...

  10. Estimation of 16S rRNA gene copy number in several probiotic Lactobacillus strains isolated from the gastrointestinal tract of chicken

    Lee, Chin Mei; Sieo, Chin Chin; Abdullah, Norhani; Ho, Yin Wan

    2008-01-01

    The copy numbers of 16S rRNA genes in 12 probiotic Lactobacillus strains of poultry origin were analyzed. Genomic DNA of the strains was digested with restriction endonucleases that do not cut within the 16S rRNA gene of the strains. This was followed by Southern hybridization with a biotinylated probe complementary to the 16S rRNA gene. The copy number of the 16S rRNA gene within a Lactobacillus species was found to be conserved. From the hybridization results, Lactobacillus salivarius I 24 ...

  11. The secondary structure of large-subunit rRNA divergent domains, a marker for protist evolution

    Lenaers, G; Nielsen, Henrik; Engberg, J;

    1988-01-01

    ), Tetrahymena thermophila (ciliate), Physarum polycephalum and Dictyostelium discoideum (slime moulds), Crithidia fasciculata and Giardia lamblia (parasitic flagellates). The folding for the D3, D7a and D10 divergent domains has been refined and a consensus model for the protist 24-26S rRNA structure is...

  12. Variation in secondary structure of the 16S rRNA molecule in cyanobacteria with implications for phylogenetic analysis

    Řeháková, Klára; Johansen, J. R.; Bowen, M.B.; Martin, M.P.; Sheil, C.A.

    2014-01-01

    Roč. 14, č. 2 (2014), s. 161-178. ISSN 1802-5439 Institutional support: RVO:60077344 Keywords : 16S rRNA secondary structure * cyanobacteria * phylogeny Subject RIV: EE - Microbiology, Virology Impact factor: 1.930, year: 2014

  13. The Cfr rRNA methyltransferase confers resistance to Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A antibiotics

    Long, K. S.; Poehlsgaard, Jacob; Kehrenberg, C.; Schwarz, S.; Vester, B.

    2006-01-01

    A novel multidrug resistance phenotype mediated by the Cfr rRNA methyltransferase is observed in Staphylococcus aureus and Escherichia coli. The cfr gene has previously been identified as a phenicol and lincosamide resistance gene on plasmids isolated from Staphylococcus spp. of animal origin and...

  14. A pseudouridylation switch in rRNA is implicated in ribosome function during the life cycle of Trypanosoma brucei.

    Chikne, Vaibhav; Doniger, Tirza; Rajan, K Shanmugha; Bartok, Osnat; Eliaz, Dror; Cohen-Chalamish, Smadar; Tschudi, Christian; Unger, Ron; Hashem, Yaser; Kadener, Sebastian; Michaeli, Shulamit

    2016-01-01

    The protozoan parasite Trypanosoma brucei, which causes devastating diseases in humans and animals in sub-Saharan Africa, undergoes a complex life cycle between the mammalian host and the blood-feeding tsetse fly vector. However, little is known about how the parasite performs most molecular functions in such different environments. Here, we provide evidence for the intriguing possibility that pseudouridylation of rRNA plays an important role in the capacity of the parasite to transit between the insect midgut and the mammalian bloodstream. Briefly, we mapped pseudouridines (Ψ) on rRNA by Ψ-seq in procyclic form (PCF) and bloodstream form (BSF) trypanosomes. We detected 68 Ψs on rRNA, which are guided by H/ACA small nucleolar RNAs (snoRNA). The small RNome of both life cycle stages was determined by HiSeq and 83 H/ACAs were identified. We observed an elevation of 21 Ψs modifications in BSF as a result of increased levels of the guiding snoRNAs. Overexpression of snoRNAs guiding modification on H69 provided a slight growth advantage to PCF parasites at 30 °C. Interestingly, these modifications are predicted to significantly alter the secondary structure of the large subunit (LSU) rRNA suggesting that hypermodified positions may contribute to the adaption of ribosome function during cycling between the two hosts. PMID:27142987

  15. FiveS rRNA sequences and fatty acid profiles of colourless sulfur-oxidising bacteria

    LokaBharathi, P.A.; Ortiz-conde, B.A; Nair, S.; Chandramohan, D.; Colwell, R.R.

    these at the molecular level, 5S ribosomal ribonucleic acid (5S rRNA) sequences have been determined. Fatty acid profiles showed strain 29 to be related to Pseudomonas vesicularis with an E.D. of 5.965 and similarity index of 0.182. The nearest organism of strain 82...

  16. Comparison of gull-specific assays targeting 16S rRNA gene of Catellicoccus marimammalium and Streptococcus spp.

    Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...

  17. Species identification and profiling of complex microbial communities using shotgun Illumina sequencing of 16S rRNA amplicon sequences.

    Swee Hoe Ong

    Full Text Available The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequencing of the bacterial 16S rRNA gene, optimized to amplify more than 90% of sequences in the Greengenes database and with the ability to distinguish nearly twice as many species-level OTUs compared to existing protocols. Using several in silico and experimental datasets, we demonstrate that despite the presence of multiple variable and conserved regions, the resulting shotgun sequences can be used to accurately quantify the constituents of complex microbial communities. The reconstruction of a significant fraction of the 16S rRNA gene also enabled high precision (>90% in species-level identification thereby opening up potential application of this approach for clinical microbial characterization.

  18. 16S rRNA gene sequencing in routine identification of anaerobic bacteria isolated from blood cultures

    Justesen, Ulrik Stenz; Skov, Marianne Nielsine; Knudsen, Elisa;

    2010-01-01

    A comparison between conventional identification and 16S rRNA gene sequencing of anaerobic bacteria isolated from blood cultures in a routine setting was performed (n = 127). With sequencing, 89% were identified to the species level, versus 52% with conventional identification. The times for...... identification were 1.5 days and 2.8 days, respectively....

  19. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)

    Stenger, B.L.S.; Clark, M.E.; Kváč, Martin; Khan, E.; Giddings, C.W.; Dyer, N.W.; Schultz, J.L.; McEvoy, J.M.

    2015-01-01

    Roč. 32, JUN 2015 (2015), s. 113-123. ISSN 1567-1348 R&D Projects: GA MŠk(CZ) LH11061 Institutional support: RVO:60077344 Keywords : Cryptosporidium * Paralogy * 18S rRNA * 18S rDNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 3.015, year: 2014

  20. Taxonomy of the genus Rhexinema (Ulvophyceae) based on phylogeny of the 18S rRNA and morphology

    Caisová, Lenka

    2009-01-01

    Roč. 48, č. 4 (2009), s. 15-15. ISSN 0031-8884. [International Phycological Congress /9./. 02.08.2009-08.08.2009, Tokyo] Institutional research plan: CEZ:AV0Z60050516 Keywords : Rhexinema * 18S rRNA * morphology Subject RIV: EF - Botanics

  1. Characterization of the psbH precursor RNAs reveals a precise endoribonuclease cleavage site in the psbT/psbH intergenic region that is dependent on psbN gene expression.

    Chevalier, Fabien; Ghulam, Mustafa Malik; Rondet, Damien; Pfannschmidt, Thomas; Merendino, Livia; Lerbs-Mache, Silva

    2015-07-01

    The plastid psbB operon harbours 5 genes, psbB, psbT, psbH, petB and petD. A sixth gene, the psbN gene, is located on the opposite DNA strand in the psbT/psbH intergenic region. Its transcription produces antisense RNA to a large part of the psbB pentacistronic mRNA. We have investigated whether transcription of the psbN gene, i.e. production of antisense RNA, influences psbT/psbH intergenic processing. Results reveal the existence of four different psbH precursor RNAs. Three of them result from processing and one is produced by transcription initiation. One of the processed RNAs is probably created by site-specific RNA cleavage. This RNA is absent in plants where the psbN gene is not transcribed suggesting that cleavage at this site is dependent on the formation of sense/antisense double-stranded RNA. In order to characterize the nuclease that might be responsible for double-stranded RNA cleavage, we analysed csp41a and csp41b knock-out mutants and the corresponding double mutant. Both CSP41 proteins are known to interact physically and CSP41a had been shown to cleave within 3'-untranslated region stem-loop structures, which contain double-stranded RNA, in vitro. We demonstrate that the psbH RNA, that is absent in plants where the psbN gene is not transcribed, is also strongly diminished in all csp41 plants. Altogether, results reveal a site-specific endoribonuclease cleavage event that seems to depend on antisense RNA and might implicate endoribonuclease activity of CSP41a. PMID:26012647

  2. An intergenic region shared by At4g35985 and At4g35987 in Arabidopsis thaliana is a tissue specific and stress inducible bidirectional promoter analyzed in transgenic arabidopsis and tobacco plants.

    Joydeep Banerjee

    Full Text Available On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985 are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85 showed stronger expression (about 3.5 fold compared to the At4g35987 promoter (P87. The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications.

  3. H2A.Z demarcates intergenic regions of the plasmodium falciparum epigenome that are dynamically marked by H3K9ac and H3K4me3.

    Richárd Bártfai

    Full Text Available Epigenetic regulatory mechanisms and their enzymes are promising targets for malaria therapeutic intervention; however, the epigenetic component of gene expression in P. falciparum is poorly understood. Dynamic or stable association of epigenetic marks with genomic features provides important clues about their function and helps to understand how histone variants/modifications are used for indexing the Plasmodium epigenome. We describe a novel, linear amplification method for next-generation sequencing (NGS that allows unbiased analysis of the extremely AT-rich Plasmodium genome. We used this method for high resolution, genome-wide analysis of a histone H2A variant, H2A.Z and two histone H3 marks throughout parasite intraerythrocytic development. Unlike in other organisms, H2A.Z is a constant, ubiquitous feature of euchromatic intergenic regions throughout the intraerythrocytic cycle. The almost perfect colocalisation of H2A.Z with H3K9ac and H3K4me3 suggests that these marks are preferentially deposited on H2A.Z-containing nucleosomes. By performing RNA-seq on 8 time-points, we show that acetylation of H3K9 at promoter regions correlates very well with the transcriptional status whereas H3K4me3 appears to have stage-specific regulation, being low at early stages, peaking at trophozoite stage, but does not closely follow changes in gene expression. Our improved NGS library preparation procedure provides a foundation to exploit the malaria epigenome in detail. Furthermore, our findings place H2A.Z at the cradle of P. falciparum epigenetic regulation by stably defining intergenic regions and providing a platform for dynamic assembly of epigenetic and other transcription related complexes.

  4. De novo Synthesis and Assembly of rRNA into Ribosomal Subunits during Cold Acclimation in Escherichia coli.

    Piersimoni, Lolita; Giangrossi, Mara; Marchi, Paolo; Brandi, Anna; Gualerzi, Claudio O; Pon, Cynthia L

    2016-04-24

    During the cold adaptation that follows a cold stress, bacterial cells undergo many physiological changes and extensive reprogramming of their gene expression pattern. Bulk gene expression is drastically reduced, while a set of cold shock genes is selectively and transiently expressed. The initial stage of cold acclimation is characterized by the establishment of a stoichiometric imbalance of the translation initiation factors (IFs)/ribosomes ratio that contributes to the preferential translation of cold shock transcripts. Whereas de novo synthesis of the IFs following cold stress has been documented, nothing was known concerning the activity of the rrn operons during the cold acclimation period. In this work, we focus on the expression of the rrn operons and the fate of rRNA after temperature downshift. We demonstrate that in Escherichia coli, rRNA synthesis does not stop during the cold acclimation phase, but continues with greater contribution of the P2 compared to the P1 promoter and all seven rrn operons are active, although their expression levels change with respect to pre-stress conditions. Eight hours after the 37°→10°C temperature downshift, the newly transcribed rRNA represents up to 20% of total rRNA and is preferentially found in the polysomes. However, with respect to the de novo synthesis of the IFs, both rRNA transcription and maturation are slowed down drastically by cold stress, thereby accounting in part for the stoichiometric imbalance of the IFs/ribosomes. Overall, our data indicate that new ribosomes, which are possibly suitable to function at low temperature, are slowly assembled during cold acclimation. PMID:26953262

  5. Efficient subtraction of insect rRNA prior to transcriptome analysis of Wolbachia-Drosophila lateral gene transfer

    Kumar Nikhil

    2012-05-01

    Full Text Available Abstract Background Numerous methods exist for enriching bacterial or mammalian mRNA prior to transcriptome experiments. Yet there persists a need for methods to enrich for mRNA in non-mammalian animal systems. For example, insects contain many important and interesting obligate intracellular bacteria, including endosymbionts and vector-borne pathogens. Such obligate intracellular bacteria are difficult to study by traditional methods. Therefore, genomics has greatly increased our understanding of these bacteria. Efficient subtraction methods are needed for removing both bacteria and insect rRNA in these systems to enable transcriptome-based studies. Findings A method is described that efficiently removes >95% of insect rRNA from total RNA samples, as determined by microfluidics and transcriptome sequencing. This subtraction yielded a 6.2-fold increase in mRNA abundance. Such a host rRNA-depletion strategy, in combination with bacterial rRNA depletion, is necessary to analyze transcription of obligate intracellular bacteria. Here, transcripts were identified that arise from a lateral gene transfer of an entire Wolbachia bacterial genome into a Drosophila ananassae chromosome. In this case, an rRNA depletion strategy is preferred over polyA-based enrichment since transcripts arising from bacteria-to-animal lateral gene transfer may not be poly-adenylated. Conclusions This enrichment method yields a significant increase in mRNA abundance when poly-A selection is not suitable. It can be used in combination with bacterial rRNA subtraction to enable experiments to simultaneously measure bacteria and insect mRNA in vector and endosymbiont biology experiments.

  6. Sites of interaction of streptogramin A and B antibiotics in the peptidyl transferase loop of 23 S rRNA and the synergism of their inhibitory mechanisms

    Porse, B T; Garrett, R A

    1999-01-01

    nucleotides in the peptidyl transferase loop of 23 S rRNA, including the two mutated nucleotides. An rRNA footprinting study, performed both in vivo and in vitro, on the A and B components complexed to Bacillus megaterium ribosomes, indicated that similar drug-induced effects occur on free ribosomes and...

  7. Development of a Multiplex PCR Method for Detection of the Genes Encoding 16S rRNA, Coagulase, Methicillin Resistance and Enterotoxins in Staphylococcus aureus

    A multiplex PCR method was developed for simultaneous detection of the genes encoding methicillin resistance (mecA), staphylococcal enterotoxins A, B and C (sea, seb and sec), coagulase (coa) and 16S rRNA. The primers for amplification of the 16S rRNA gene were specific for Staphylococcus spp., and ...

  8. Comparison of COBAS AMPLICOR Neisseria gonorrhoeae PCR, including confirmation with N. gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    Luijt, D.S.; Bos, P.A.; van Zwet, A.A.; Voorst-Vader, P.C.; Schirm, J.

    2005-01-01

    : A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased

  9. Comparison of COBAS AMPLICOR Neissefia gonorrhoeae PCR, including confirmation with N-gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    Luijt, DS; Bos, PAJ; van Zwet, AA; Vader, PCV; Schirm, J

    2005-01-01

    A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased t

  10. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    Liu, M; Kirpekar, F; Van Wezel, G P;

    2000-01-01

    Streptomyces species indicates that in vivo TlrB modifies nucleotide G748 within helix 35 of 23S rRNA. Purified recombinant TlrB retains its activity and specificity in vitro and modifies G748 in 23S rRNA as well as in a 74 nucleotide RNA containing helix 35 and surrounding structures. Modification is...

  11. Absolute Quantification of Enterococcal 23S rRNA Gene Using Digital PCR.

    Wang, Dan; Yamahara, Kevan M; Cao, Yiping; Boehm, Alexandria B

    2016-04-01

    We evaluated the ability of chip-based digital PCR (dPCR) to quantify enterococci, the fecal indicator recommended by the United States Environmental Protection Agency (USEPA) for water-quality monitoring. dPCR uses Poisson statistics to estimate the number of DNA fragments in a sample with a specific sequence. Underestimation may occur when a gene is redundantly encoded in the genome and multiple copies of that gene are on one DNA fragment. When genomic DNA (gDNA) was extracted using two commercial DNA extraction kits, we confirmed that dPCR could discern individual copies of the redundant 23s rRNA gene in the enterococcal genome. dPCR quantification was accurate when compared to the nominal concentration inferred from fluorometer measurements (linear regression slope = 0.98, intercept = 0.03, R(2) = 0.99, and p value humic acid caused a similar level of inhibition in both dPCR and qPCR, but calcium inhibited dPCR to a lesser degree than qPCR. Inhibition of dPCR was partially relieved when the number of thermal cycles was increased. Based on these results, we conclude that dPCR is a viable option for enumerating enterococci in ambient water. PMID:26903207

  12. Molecular identification of adulteration in mutton based on mitochondrial 16S rRNA gene.

    Xu, Jia; Zhao, Wei; Zhu, Mengru; Wen, Yuanju; Xie, Tao; He, Xiaoqian; Zhang, Yongfeng; Cao, Suizhong; Niu, Lili; Zhang, Hongping; Zhong, Tao

    2016-01-01

    The aim of this study is to set up a protocol for identification of the adulteration in mutton based on mitochondrial 16S rRNA gene. The multiplex polymerase chain reaction (multi-PCR) assay was carried out to trace the impure DNA in mutton. A universal primer pair yielded an approximate 610 bp fragment in mutton, pork, duck, chicken, horse and cat meats. The amplicons of multi-PCR assay represented the species-specific products, which could be discriminated by the size ranging from 106 bp to 532 bp. Subsequently, the authentication of each fragment was also confirmed by sequencing. Random analyses of adulterants with various meats yielded the identical results to their components, showing the suitability of the multi-PCR assay for tracing of adulterant meats with high-accuracy and precision. This assay was sensitive to detect the species-specific DNA in different proportional mixtures of mutton and duck/pork (9.1%-90.9%). In conclusion, this multi-PCR assay successfully discriminated the double-, triple-, quadruple-, and quintuple-mixtures containing variant counterparts. This method will be particularly useful in the detection of mutton adulteration in processed foods further. PMID:24739005

  13. Oxazolidinone resistance mutations in 23S rRNA of Escherichia coli reveal the central region of domain V as the primary site of drug action

    Xiong, L; Kloss, P; Douthwaite, S; Andersen, N M; Swaney, S; Shinabarger, D L; Mankin, A S

    2000-01-01

    resistance mutations were clustered in the vicinity of the central loop of domain V of 23S rRNA, suggesting that this rRNA region plays a major role in the interaction of the drug with the ribosome. Although the central loop of domain V is an essential integral component of the ribosomal peptidyl transferase......, we selected Escherichia coli oxazolidinone-resistant mutants, which contained a randomly mutagenized plasmid-borne rRNA operon. The same mutation, G2032 to A, was identified in the 23S rRNA genes of several independent resistant isolates. Engineering of this mutation by site-directed mutagenesis in...... the wild-type rRNA operon produced an oxazolidinone resistance phenotype, establishing that the G2032A substitution was the determinant of resistance. Engineered U and C substitutions at G2032, as well as a G2447-to-U mutation, also conferred resistance to oxazolidinone. All the characterized...

  14. An updated 18S rRNA phylogeny of tunicates based on mixture and secondary structure models

    Shenkar Noa

    2009-08-01

    Full Text Available Abstract Background Tunicates have been recently revealed to be the closest living relatives of vertebrates. Yet, with more than 2500 described species, details of their evolutionary history are still obscure. From a molecular point of view, tunicate phylogenetic relationships have been mostly studied based on analyses of 18S rRNA sequences, which indicate several major clades at odds with the traditional class-level arrangements. Nonetheless, substantial uncertainty remains about the phylogenetic relationships and taxonomic status of key groups such as the Aplousobranchia, Appendicularia, and Thaliacea. Results Thirty new complete 18S rRNA sequences were acquired from previously unsampled tunicate species, with special focus on groups presenting high evolutionary rate. The updated 18S rRNA dataset has been aligned with respect to the constraint on homology imposed by the rRNA secondary structure. A probabilistic framework of phylogenetic reconstruction was adopted to accommodate the particular evolutionary dynamics of this ribosomal marker. Detailed Bayesian analyses were conducted under the non-parametric CAT mixture model accounting for site-specific heterogeneity of the evolutionary process, and under RNA-specific doublet models accommodating the occurrence of compensatory substitutions in stem regions. Our results support the division of tunicates into three major clades: 1 Phlebobranchia + Thaliacea + Aplousobranchia, 2 Appendicularia, and 3 Stolidobranchia, but the position of Appendicularia could not be firmly resolved. Our study additionally reveals that most Aplousobranchia evolve at extremely high rates involving changes in secondary structure of their 18S rRNA, with the exception of the family Clavelinidae, which appears to be slowly evolving. This extreme rate heterogeneity precluded resolving with certainty the exact phylogenetic placement of Aplousobranchia. Finally, the best fitting secondary-structure and CAT-mixture models

  15. 16S rRNA gene survey of microbial communities in Winogradsky columns.

    Ethan A Rundell

    Full Text Available A Winogradsky column is a clear glass or plastic column filled with enriched sediment. Over time, microbial communities in the sediment grow in a stratified ecosystem with an oxic top layer and anoxic sub-surface layers. Winogradsky columns have been used extensively to demonstrate microbial nutrient cycling and metabolic diversity in undergraduate microbiology labs. In this study, we used high-throughput 16s rRNA gene sequencing to investigate the microbial diversity of Winogradsky columns. Specifically, we tested the impact of sediment source, supplemental cellulose source, and depth within the column, on microbial community structure. We found that the Winogradsky columns were highly diverse communities but are dominated by three phyla: Proteobacteria, Bacteroidetes, and Firmicutes. The community is structured by a founding population dependent on the source of sediment used to prepare the columns and is differentiated by depth within the column. Numerous biomarkers were identified distinguishing sample depth, including Cyanobacteria, Alphaproteobacteria, and Betaproteobacteria as biomarkers of the soil-water interface, and Clostridia as a biomarker of the deepest depth. Supplemental cellulose source impacted community structure but less strongly than depth and sediment source. In columns dominated by Firmicutes, the family Peptococcaceae was the most abundant sulfate reducer, while in columns abundant in Proteobacteria, several Deltaproteobacteria families, including Desulfobacteraceae, were found, showing that different taxonomic groups carry out sulfur cycling in different columns. This study brings this historical method for enrichment culture of chemolithotrophs and other soil bacteria into the modern era of microbiology and demonstrates the potential of the Winogradsky column as a model system for investigating the effect of environmental variables on soil microbial communities.

  16. In situ hybridization of phytoplankton using fluorescently labeled rRNA probes.

    Groben, René; Medlin, Linda

    2005-01-01

    Phytoplankton are one of the major components of ecosystem processes and play an important role in many biogeochemical cycles in the marine and freshwater environment. Despite their importance, many microalgae are poorly described and little is known of broad spatial and temporal scale trends in their abundance and distribution. Reasons for this are that microalgae are often small, lack distinct morphological features, and are unculturable, which make analyses difficult. It is now possible by using molecular biological techniques to advance our knowledge of aquatic biodiversity and to understand how biodiversity supports ecosystem structure, dynamics, and resilience. We present in this chapter a brief review of the progress that has been made in analyzing microalgae from populations to the species level. The described methods range from DNA fingerprinting techniques, such as random amplified polymorphic DNA (RAPD), amplified fragment length polymorphisms (AFLPs), and simple sequence repeats (SSRs), to microsatellites, which are used in population studies, to sequence analysis, which help to reconstruct the evolutionary history of organisms and to examine relationships at various taxonomic levels. Special emphasis is given to the application of molecular probes for the identification and characterization of microalgal taxa. The fast and secure identification of phytoplankton, especially of toxic species, is important from an ecological and economical point of view and whole-cell hybridization with specific fluorochrome-labeled probes followed by fluorescence microscopy or flow cytometry offers a fast method for this purpose. In this context, we present a detailed protocol for fluorescence in situ hybridization (FISH) of ribosomal RNA (rRNA) probes that can be applied to many algal cell types and discuss practical considerations of its use. PMID:15865974

  17. Diversity of Aphanizomenon flos-aquae (Cyanobacterium) Populations along a Baltic Sea Salinity Gradient

    Laamanen, Maria J.; Forsström, Laura; Sivonen, Kaarina

    2002-01-01

    Colony-forming cyanobacteria of the genus Aphanizomenon form massive blooms in the brackish water of the Baltic Sea during the warmest summer months. There have been recent suggestions claiming that the Baltic Sea Aphanizomenon species may be different from Aphanizomenon flos-aquae found in lakes. In this study, we examined variability in the morphology and 16S-23S rRNA internal transcribed spacer (ITS) sequences of A. flos-aquae populations along a salinity gradient from a string of lakes to...

  18. Complete genome sequence of Microbacterium sp. CGR1, bacterium tolerant to wide abiotic conditions isolated from the Atacama Desert.

    Mandakovic, Dinka; Cabrera, Pablo; Pulgar, Rodrigo; Maldonado, Jonathan; Aravena, Pamela; Latorre, Mauricio; Cambiazo, Verónica; González, Mauricio

    2015-12-20

    Microbacterium sp. CGR1 (RGM2230) is an isolate from the Atacama Desert that displays a wide pH, salinity and temperature tolerance. This strain exhibits riboflavin overproducer features and traits for developing an environmental arsenic biosensor. Here, we report the complete genome sequence of this strain, which represents the first genome of the genus Microbacterium sequenced and assembled in a single contig. The genome contains 3,634,864bp, 3299 protein-coding genes, 45 tRNAs, six copies of 5S-16S-23S rRNA and a high genome average GC-content of 68.04%. PMID:26521698

  19. Taxonomic resolution, ecotypes and the biogeography of Prochlorococcus

    Martiny, AC; Tai, APK; D. Veneziano; F. Primeau; Chisholm, SW

    2008-01-01

    Summary In order to expand our understanding of the diversity and biogeography of Prochlorococcus ribotypes, we PCR-amplified, cloned and sequenced the 16S/23S rRNA ITS region from sites in the Atlantic and Pacific oceans. Ninety-three per cent of the ITS sequences could be assigned to existing Prochlorococcus clades, although many novel subclades were detected. We assigned the sequences to operational taxonomic units using a graduated scale of sequence identity from 80% to 99.5% and correlat...

  20. Phylogenetic relationships between Sarcocystis species from reindeer and other Sarcocystidae deduced from ssu rRNA gene sequences

    Dahlgren, S.S.; Oliveira, Rodrigo Gouveia; Gjerde, B.

    2008-01-01

    Six Sarcocystis species from reindeer (S. grueneri, S. rangi, S. tarandivulpes, S. hardangeri, S. rangiferi and S. tarandi) have previously been genetically characterised. The aim of this study was to identify possible definitive hosts for S. hardangeri, S. rangiferi and S. tarandi by including the...... six species in phylogenetic analyses of the Sarcocystidae, and also to investigate the phylogenetic relationships between the species from reindeer and those from other hosts. The study also aimed at revealing whether the inclusion of six Sarcocystis species from the same intermediate host would have...... any effect on previously inferred phylogenetic relationships within the Sarcocystidae. The complete small subunit (ssu) rRNA gene sequences of all six Sarcocystis species from reindeer were used in the phylogenetic analyses along with ssu rRNA gene sequences of 85 other members of the Coccidea. Trees...

  1. Distribution of DNA and localization of rRNA transcription in G2 phase nucleolus of Physarum polycephalum

    2001-01-01

    Using electron microscopy, NAMA-Ur DNA selective staining and BrUTP incorporation, the nucleo lus ultrastructure, the distribution of DNA and the rRNA transcription sites in nucleolus of G2 phase Physarum poly cephalum were studied. The nucleolus was found to be different in structure from that of other plant cells. Fibrillar cen tern (FCs) were present in a large amount all over the nucleolus. DNA was distributed both in dense fibrillar components (DFC) and in FC. The DNA in the nucleolus was less condensed than that of the chromosome territory. These changes suggested that the transcription was active within the nucleolus. BrUTP incorporation localized the rRNA transcription in DFC and at the interface of FC and DFC, suggesting that the DNA in FC is in a storage form and only the rDNA in DFC is transcribed.

  2. Phylogeny of the cuttlefishes (Mollusca:Cephalopoda) based on mitochondrial COI and 16S rRNA gene sequence data

    LIN Xiangzhi; ZHENG Xiaodong; XIAO Shu; WANG Rucai

    2004-01-01

    To clarify cuttlefish phylogeny, mitochondrial cytochrome c oxidase subunit I (COI) gene and partial 16S rRNA gene are sequenced for 13 cephalopod species. Phylogenetic trees are constructed, with the neighbor-joining method.Coleoids are divided into two main lineages, Decabrachia and Octobrachia. The monophyly of the order Sepioidea,which includes the families Sepiidae, Sepiolidae and Idiosepiidae, is not supported. From the two families of Sepioidea examined, the Sepiolidae are polyphyletic and are excluded from the order. On the basis of 16S rRNA and amino acid of COI gene sequences data, the two genera (Sepiella and Sepia) from the Sepiidae can be distinguished, but do not have a visible boundary using COI gene sequences. The reason is explained. This suggests that the 16S rDNA of cephalopods is a precious tool to analyze taxonomic relationships at the genus level, and COI gene is fitter at a higher taxonomic level (i.e., family).

  3. YccW is the m5C methyltransferase specific for 23S rRNA nucleotide 1962

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M;

    2008-01-01

    . However, YccW does not methylate assembled 50S subunits, and this is somewhat surprising as the published crystal structures show nucleotide C1962 to be fully accessible at the subunit interface. YccW-directed methylation at nucleotide C1962 is conserved in bacteria, and loss of this methylation in E....... coli marginally reduces its growth rate. YccW had previously eluded identification because it displays only limited sequence similarity to the m(5)C methyltransferases RsmB and RsmF and is in fact more similar to known m(5)U (5-methyluridine) RNA methyltransferases. In keeping with the previously...... proposed nomenclature system for bacterial rRNA methyltransferases, yccW is now designated as the rRNA large subunit methyltransferase gene rlmI....

  4. Validation of a PCR Assay for Chlamydophila abortus rRNA gene detection in a murine model

    Francielle Gibson da Silva-Zacarias

    2009-11-01

    Full Text Available Chlamydophila abortus (C. abortus is associated with reproductive problems in cattle, sheep, and goats. Diagnosis of C. abortus using embryonated chicken eggs or immortalized cell lines has a very low sensitivity. Polymerase chain reaction (PCR assays have been used to detect C. abortus infection in clinical specimens and organ fragments, such as placenta, fetal organs, vaginal secretions, and semen. The aim of this study was to develop a PCR assay for the amplification of an 856-bp fragment of the rRNA gene of the Chlamydiaceae family. The PCR assay was evaluated using organs from 15 mice experimentally infected with the S26/3 reference strain of C. abortus. The results of the rRNA PCR were compared to the results from another PCR system (Omp2 PCR that has been previously described for the Omp2 (outer major protein gene from the Chlamydiaceae family. From the 15 C. abortus-inoculated mice, 13 (K=0.84, standard error =0.20 tested positive using the rRNA PCR assay and 9 (K=0.55, standard error=0.18 tested positive using the Omp2 PCR assay. The detection limit, measured using inclusion-forming units (IFU, for C. abortus with the rRNA PCR (1.05 IFU was 100-fold lower than for the Omp2 PCR (105 IFU. The higher sensitivity of the rRNA PCR, as compared to the previously described PCR assay, and the specificity of the assay, demonstrated using different pathogenic microorganisms of the bovine reproductive system, suggest that the new PCR assay developed in this study can be used for the molecular diagnosis of C. abortus in abortion and other reproductive failures in bovines, caprines, and ovines.Chlamydophila abortus (C. abortus é frequentemente associada a distúrbios reprodutivos em bovinos, ovinos e caprinos. Para o diagnóstico, os métodos de cultivo em ovo embrionado de galinha e em células de linhagem contínua apresentam baixa sensibilidade. A reação em cadeia da polimerase (PCR tem sido utilizada em placenta, órgãos fetais, secre

  5. Identification of bacteria associated with underground parts of Crocus sativus by 16S rRNA gene targeted metagenomic approach.

    Ambardar, Sheetal; Sangwan, Naseer; Manjula, A; Rajendhran, J; Gunasekaran, P; Lal, Rup; Vakhlu, Jyoti

    2014-10-01

    Saffron (Crocus sativus L), an autumn-flowering perennial sterile plant, reproduces vegetatively by underground corms. Saffron has biannual corm-root cycle that makes it an interesting candidate to study microbial dynamics in its rhizosphere and cormosphere (area under influence of corm). Culture independent 16S rRNA gene metagenomic study of rhizosphere and cormosphere of Saffron during flowering stage revealed presence of 22 genera but none of the genus was common in all the three samples. Bulk soil bacterial community was represented by 13 genera with Acidobacteria being dominant. In rhizosphere, out of eight different genera identified, Pseudomonas was the most dominant genus. Cormosphere bacteria comprised of six different genera, dominated by the genus Pantoea. This study revealed that the bacterial composition of all the three samples is significantly different (P rhizosphere, cormosphere and bulk soil of Saffron, using cultivation independent 16S rRNA gene targeted metagenomic approach. PMID:24989343

  6. Community structure, cellular rRNA content, and activity of sulfate-reducing bacteria in marine Arctic sediments

    Ravenschlag, K.; Sahm, K.; Knoblauch, C.;

    2000-01-01

    The community structure of sulfate-reducing bacteria (SRB) of a marine Arctic sediment (Smeerenburg-fjorden, Svalbard) a-as characterized by both fluorescence in situ hybridization (FISH) and rRNA slot blot hybridization by using group- and genus-specific 16S rRNA-targeted oligonucleotide probes......, The SRB community was dominated by members of the Desulfosarcina-Desulfococcus group. This group accounted for up to 73% of the SRB detected and up to 70% of the SRB rRNA detected. The predominance was shown to be a common feature for different stations along the coast of Svalbard, In a top......-Desulfococcus group. A group of clone sequences (group SVAL1) most closely related to Desulfosarcina variabilis (91.2% sequence similarity) was dominant and was shown to be most abundant in situ, accounting for up to 54.8% of the total SRB detected. A comparison of the two methods used for quantification showed...

  7. rRNA Gene Expression of Abundant and Rare Activated-Sludge Microorganisms and Growth Rate Induced Micropollutant Removal.

    Vuono, David C; Regnery, Julia; Li, Dong; Jones, Zackary L; Holloway, Ryan W; Drewes, Jörg E

    2016-06-21

    The role of abundant and rare taxa in modulating the performance of wastewater-treatment systems is a critical component of making better predictions for enhanced functions such as micropollutant biotransformation. In this study, we compared 16S rRNA genes (rDNA) and rRNA gene expression of taxa in an activated-sludge-treatment plant (sequencing batch membrane bioreactor) at two solids retention times (SRTs): 20 and 5 days. These two SRTs were used to influence the rates of micropollutant biotransformation and nutrient removal. Our results show that rare taxa (micropollutant biotransformation. An analysis of micropollutant-associated degradation genes via metagenomics and direct measurements of a suite of micropollutants and nutrients further corroborates the loss of enhanced functions at 5-day SRT operation. This work advances our knowledge of the underlying ecosystem properties and dynamics of abundant and rare organisms associated with enhanced functions in engineered systems. PMID:27196630

  8. Determination of 16S rRNA Sequences of Enterococci and Application to Species Identification of Nonmotile Enterococcus gallinarum Isolates

    Patel, Robin; Piper, Kerryl E.; Rouse, Mark S; Steckelberg, James M.; Uhl, Jim R.; Kohner, Peggy; Hopkins, Marlene K.; Cockerill, Franklin R.; Kline, Bruce C.

    1998-01-01

    The 16S rRNA sequences of enterococcal species E. faecium, E. faecalis, E. gallinarum, E. casseliflavus/flavescens, E. dispar, E. pseudoavium, E. sulfureus, E. malodoratus, E. raffinosus, E. cecorum, E. hirae, E. saccharolyticus, E. seriolicida, E. mundtii, E. avium, E. durans, E. columbae, and E. solitarius are presented herein. These data were utilized to confirm the species identification of two nonmotile E. gallinarum isolates which had been previously phenotypically identified as E. faec...

  9. Unique 16S rRNA sequences of Eurythenes gryllus (Crustacea: Amphipoda: Lysianassidae) from the Gulf of Mexico abyssal plain

    Elva Escobar-Briones; Eduardo Nájera-Hillman; Fernando Álvarez

    2010-01-01

    Amphipods of the species Eurythenes gryllus were collected at 2 locations on the abyssal plain (~3 400 m) of the Gulf of Mexico in order to test whether or not these scavenger amphipods are isolated in this peripheral sea or show connectivity by their predominant swimming behavior, moving horizontally along the abyssal water masses in the region. Partial sequences of the mitochondrial 16S rRNA gene from 2 individuals of E. gryllus were determined and showed small differences when compared to ...

  10. Molecular characterization of Sarcocystis species from Polish roe deer based on ssu rRNA and cox1 sequence analysis.

    Kolenda, Rafał; Ugorski, Maciej; Bednarski, Michał

    2014-08-01

    Sarcocysts from four Polish roe deer were collected and examined by light microscopy, small subunit ribosomal RNA (ssu rRNA), and the subunit I of cytochrome oxidase (cox1) sequence analysis. This resulted in identification of Sarcocystis gracilis, Sarcocystis oviformis, and Sarcocystis silva. However, we were unable to detect Sarcocystis capreolicanis, the fourth Sarcocystis species found previously in Norwegian roe deer. Polish sarcocysts isolated from various tissues differed in terms of their shape and size and were larger than the respective Norwegian isolates. Analysis of ssu rRNA gene revealed the lack of differences between Sarcocystis isolates belonging to one species and a very low degree of genetic diversity between Polish and Norwegian sarcocysts, ranging from 0.1% for Sarcocystis gracilis and Sarcocystis oviformis to 0.44% for Sarcocystis silva. Contrary to the results of the ssu rRNA analysis, small intraspecies differences in cox1 sequences were found among Polish Sarcocystis gracilis and Sarcocystis silva isolates. The comparison of Polish and Norwegian cox1 sequences representing the same Sarcocystis species revealed similar degree of sequence identity, namely 99.72% for Sarcocystis gracilis, 98.76% for Sarcocystis silva, and 99.85% for Sarcocystis oviformis. Phylogenetic reconstruction and genetic population analyses showed an unexpected high degree of identity between Polish and Norwegian isolates. Moreover, cox1 gene sequences turned out to be more accurate than ssu rRNA when used to reveal phylogenetic relationships among closely related species. The results of our study revealed that the same Sarcocystis species isolated from the same hosts living in different geographic regions show a very high level of genetic similarity. PMID:24948101

  11. Influence of DNA extraction on oral microbial profiles obtained via 16S rRNA gene sequencing

    Diaz, Patricia I.; Abusleme, Loreto; Hong, Bo-Young; Amanda K. Dupuy; Linda D Strausbaugh

    2014-01-01

    Background and objective: The advent of next-generation sequencing has significantly facilitated characterization of the oral microbiome. Despite great efforts in streamlining the processes of sequencing and data curation, upstream steps required for amplicon library generation could still influence 16S rRNA gene-based microbial profiles. Among upstream processes, DNA extraction is a critical step that could represent a great source of bias. Accounting for bias introduced by extraction proced...

  12. Use of 16S rRNA Sequencing for Identification of Actinobacillus ureae Isolated from a Cerebrospinal Fluid Sample

    Whitelaw, A. C.; Shankland, I. M.; Elisha, B. G.

    2002-01-01

    Actinobacillus ureae, previously Pasteurella ureae, has on rare occasions been described as a cause of human infection. Owing to its rarity, it may not be easily identified in clinical microbiology laboratories by standard tests. This report describes a patient with acute bacterial meningitis due to A. ureae. The identity of the isolate was determined by means of DNA sequence analysis of a portion of the 16S rRNA gene.

  13. Analysis of Mixed Sequencing Chromatograms and Its Application in Direct 16S rRNA Gene Sequencing of Polymicrobial Samples▿

    Kommedal, Øyvind; Karlsen, Bjarte; Sæbø, Øystein

    2008-01-01

    Investigation of clinical samples by direct 16S rRNA gene sequencing provides the possibility to detect nonviable bacteria and bacteria with special growth requirements. This approach has been particularly valuable for the diagnosis of patients who have received antibiotics prior to sample collection. In specimens containing more than one bacterium, direct sequencing gives mixed chromatograms that complicate further interpretation. We designed an algorithm able to analyze these ambiguous chro...

  14. The Identification of Discriminating Patterns from 16S rRNA Gene to Generate Signature for Bacillus Genus.

    More, Ravi P; Purohit, Hemant J

    2016-08-01

    The 16S ribosomal RNA (16S rRNA) gene has been widely used for the taxonomic classification of bacteria. A molecular signature is a set of nucleotide patterns, which constitute a regular expression that is specific to each particular taxon. Our main goal was to identify discriminating nucleotide patterns in 16S rRNA gene and then to generate signatures for taxonomic classification. To demonstrate our approach, we used the phylum Firmicutes as a model using representative taxa Bacilli (class), Bacillales (order), Bacillaceae (family), and Bacillus (genus), according to their dominance at each hierarchical taxonomic level. We applied combined composite vector and multiple sequence alignment approaches to generate gene-specific signatures. Further, we mapped all the patterns into the different hypervariable regions of 16S rRNA gene and confirmed the most appropriate distinguishing region as V3-V4 for targeted taxa. We also examined the evolution in discriminating patterns of signatures across taxonomic levels. We assessed the comparative classification accuracy of signatures with other methods (i.e., RDP Classifier, KNN, and SINA). Results revealed that the signatures for taxa Bacilli, Bacillales, Bacillaceae, and Bacillus could correctly classify isolate sequences with sensitivity of 0.99, 0.97, 0.94, and 0.89, respectively, and specificity close to 0.99. We developed signature-based software DNA Barcode Identification (DNA BarID) for taxonomic classification that is available at website http://www.neeri.res.in/DNA_BarID.htm . This pattern-based study provides a deeper understanding of taxon-specific discriminating patterns in 16S rRNA gene with respect to taxonomic classification. PMID:27104769

  15. Cilantro microbiome before and after nonselective pre-enrichment for Salmonella using 16S rRNA and metagenomic sequencing

    Jarvis, Karen G.; White, James R.; Grim, Christopher J.; Ewing, Laura; Ottesen, Andrea R; Beaubrun, Junia Jean-Gilles; Pettengill, James B; Brown, Eric; Hanes, Darcy E.

    2015-01-01

    Background Salmonella enterica is a common cause of foodborne gastroenteritis in the United States and is associated with outbreaks in fresh produce such as cilantro. Salmonella culture-based detection methods are complex and time consuming, and improvments to increase detection sensitivity will benefit consumers. In this study, we used 16S rRNA sequencing to determine the microbiome of cilantro. We also investigated changes to the microbial community prior to and after a 24-hour nonselective...

  16. Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

    Xiao Li Shi

    Full Text Available The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX, which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

  17. An intramolecular recombination mechanism for the formation of the rRNA gene palindrome of Tetrahymena thermophila.

    Butler, D. K.; Yasuda, L E; Yao, M C

    1995-01-01

    Large palindromic DNAs are found in a wide variety of eukaryotic cells. In Tetrahymena thermophila, a large palindrome is formed from a single rRNA gene (rDNA) during nuclear differentiation. We present evidence that a key step in the formation of the rDNA palindrome of T. thermophila involves homologous intramolecular recombination. Heteroduplex micronuclear rDNA molecules were constructed in vitro and microinjected into developing macronuclei, where they formed palindromes. Analysis of the ...

  18. Analysis of 16S rRNA amplicon sequencing options on the Roche/454 next-generation titanium sequencing platform.

    Hideyuki Tamaki

    Full Text Available BACKGROUND: 16S rRNA gene pyrosequencing approach has revolutionized studies in microbial ecology. While primer selection and short read length can affect the resulting microbial community profile, little is known about the influence of pyrosequencing methods on the sequencing throughput and the outcome of microbial community analyses. The aim of this study is to compare differences in output, ease, and cost among three different amplicon pyrosequencing methods for the Roche/454 Titanium platform METHODOLOGY/PRINCIPAL FINDINGS: The following three pyrosequencing methods for 16S rRNA genes were selected in this study: Method-1 (standard method is the recommended method for bi-directional sequencing using the LIB-A kit; Method-2 is a new option designed in this study for unidirectional sequencing with the LIB-A kit; and Method-3 uses the LIB-L kit for unidirectional sequencing. In our comparison among these three methods using 10 different environmental samples, Method-2 and Method-3 produced 1.5-1.6 times more useable reads than the standard method (Method-1, after quality-based trimming, and did not compromise the outcome of microbial community analyses. Specifically, Method-3 is the most cost-effective unidirectional amplicon sequencing method as it provided the most reads and required the least effort in consumables management. CONCLUSIONS: Our findings clearly demonstrated that alternative pyrosequencing methods for 16S rRNA genes could drastically affect sequencing output (e.g. number of reads before and after trimming but have little effect on the outcomes of microbial community analysis. This finding is important for both researchers and sequencing facilities utilizing 16S rRNA gene pyrosequencing for microbial ecological studies.

  19. Sequence analysis of 16S rRNA from mycoplasmas by direct solid-phase DNA sequencing.

    Pettersson, B; Johansson, K. E.; Uhlén, M

    1994-01-01

    Automated solid-phase DNA sequencing was used for determination of partial 16S ribosomal DNA sequences of mycoplasmas. The sequence information was used to establish phylogenetic relationships of 11 different mycoplasmas whose 16S rRNA sequences had not been determined earlier. A biotinylated fragment corresponding to positions 344 to 939 in the Escherichia coli sequence was generated by PCR. The PCR product was immobilized onto streptavidin-coated paramagnetic beads, and direct sequencing wa...

  20. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes

    Mu Peng; Xiaoxue Zi; Qiuyu Wang

    2015-01-01

    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacte...

  1. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    Martins Cesar

    2010-01-01

    Full Text Available Abstract Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s occurring in 39.6% of the analyzed individuals (both male and female were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement.

  2. The phylogenetic relationship of the family Lutjanidae based on analyses of AFLP and mitochondrial 12S rRNA sequences

    ZHANG Junbin; LIU Xin

    2006-01-01

    Fishes of the family Lutjanidae are commercially important in South China Sea. However,the phylogeny of Lutjanids is still unclear and there are many controversies over it. Herein, studies about the phylogeny of Lutjanids were performed based on Amplified Fragment Length Polymorphism (AFLP) analysis of genome DNA and sequence analysis of mitochondrial 12S rRNA gene, and 10 Lutjanidae species and 1 Lethrinidae species were employed.The topologies of minimum evolution (ME) trees based on the two analyses respectively were congruent except for positions of genera Pristipomoides and Caesio. The optimal substitution model TrN + G for DNA sequences of 12S rRNA genes in Lutjanids was obtained using MODELTEST 3.6 software and maximum likelihood (ML) analysis supports the topology displayed by the ME tree. The test of log-likelihood suggests that the use of molecular clock calibrations to estimate species divergence time appeared valid. Phylogenetic analyses using AFLP data and DNA sequences of mitochondrial 12S rRNA genes indicated the monophyly of Lutjanus genra. However, further studies are required to reveal the phylogenetic relationship among other genera. In addition, the results demonstrated that AFLP genetic marker was suitable for the phylogenetic analysis of Lutjanids.

  3. Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing.

    Shin, Jongoh; Lee, Sooin; Go, Min-Jeong; Lee, Sang Yup; Kim, Sun Chang; Lee, Chul-Ho; Cho, Byung-Kwan

    2016-01-01

    Demands for faster and more accurate methods to analyze microbial communities from natural and clinical samples have been increasing in the medical and healthcare industry. Recent advances in next-generation sequencing technologies have facilitated the elucidation of the microbial community composition with higher accuracy and greater throughput than was previously achievable; however, the short sequencing reads often limit the microbial composition analysis at the species level due to the high similarity of 16S rRNA amplicon sequences. To overcome this limitation, we used the nanopore sequencing platform to sequence full-length 16S rRNA amplicon libraries prepared from the mouse gut microbiota. A comparison of the nanopore and short-read sequencing data showed that there were no significant differences in major taxonomic units (89%) except one phylotype and three taxonomic units. Moreover, both sequencing data were highly similar at all taxonomic resolutions except the species level. At the species level, nanopore sequencing allowed identification of more species than short-read sequencing, facilitating the accurate classification of the bacterial community composition. Therefore, this method of full-length 16S rRNA amplicon sequencing will be useful for rapid, accurate and efficient detection of microbial diversity in various biological and clinical samples. PMID:27411898

  4. TaxCollector: Modifying Current 16S rRNA Databases for the Rapid Classification at Six Taxonomic Levels

    Eric W. Triplett

    2010-07-01

    Full Text Available The high level of conservation of 16S ribosomal RNA gene (16S rRNA in all Prokaryotes makes this gene an ideal tool for the rapid identification and classification of these microorganisms. Databases such as the Ribosomal Database Project II (RDP-II and the Greengenes Project offer access to sets of ribosomal RNA sequence databases useful in identification of microbes in a culture-independent analysis of microbial communities. However, these databases do not contain all of the taxonomic levels attached to the published names of the bacterial and archaeal sequences. TaxCollector is a set of scripts developed in Python language that attaches taxonomic information to all 16S rRNA sequences in the RDP-II and Greengenes databases. These modified databases are referred to as TaxCollector databases, which when used in conjunction with BLAST allow for rapid classification of sequences from any environmental or clinical source at six different taxonomic levels, from domain to species. The TaxCollector database prepared from the RDP-II database is an important component of a new 16S rRNA pipeline called PANGEA. The usefulness of TaxCollector databases is demonstrated with two very different datasets obtained using samples from a clinical setting and an agricultural soil. The six TaxCollector scripts are freely available on http://taxcollector.sourceforge.net and on http://www.microgator.org.

  5. A nested array of rRNA targeted probes for the detection and identification of enterococci by reverse hybridization.

    Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W

    2000-12-01

    Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants. PMID:11249027

  6. The conformation of 23S rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase

    Vester, B; Hansen, L H; Douthwaite, S

    1995-01-01

    it was shown that the A2057 and U2611 mutations alone and in combination alter the reactivity of A2058 and adjacent bases. However, mutagenizing position G-->A2032 in an adjacent loop, which has been implicated to interact with A2058, alters neither the ErmE methylation at A2058 nor the accessibility...... effects of mutations around position A2058 on methylation. Mutagenizing A2058 (to G or U) completely abolishes methylation of 23S rRNA by ErmE. No methylation occurred at other sites in the rRNA, demonstrating the fidelity of ErmE for A2058. Breaking the neighboring G2057-C2611 Watson-Crick base pair by...... introducing either an A2057 or a U2611 mutation, greatly reduces the rate of methylation at A2058. Methylation remains impaired after these mutations have been combined to create a new A2057-U2611 Watson-Crick base interaction. The conformation of this region in 23S rRNA was probed with chemical reagents and...

  7. Evolutionary History of the Chaetognaths Inferred from Actin and 18S-28S rRNA Paralogous Genes

    J.P. Casanova

    2006-01-01

    Full Text Available The chaetognaths constitute a small and enigmatic phylum of marine invertebrates whose phylogenetic affinities remain uncertain. Our phylogenetical investigations inferred from partial paralogous 18S-28S rRNA genes suggest that the event resulting in the presence of two classes of rRNA genes would have occurred at approximately 300-400 million years and prior to the radiation of extant chaetognath, whereas the taxon, according to both molecular and paleontological data, would be dated from at least the Early Cambrian. These divergent rRNA genes could be the result of a whole ribosomal cluster duplication or of an allopolyploid event during a crisis period, since, the fossil are lacking posterioly to the post-Carboniferous period (c.a., 300 million years. In addition, actin phylogeny evidenced that the cytoplasmic chaetognath actin clustered with the cytoplasmic insect actins, while the muscular chaetognath actins are placed basal to all muscular vertebrate actins. The present study suggests that the gene conversion mechanisms could be inefficient in this taxon; this could explain the conservation of extremely divergent paralogous sequences in the chaetognath genomes which could be correlated to the difficulties to identify a sister group between chaetognaths and other taxa among metazoans.

  8. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.

    2011-01-01

    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show this structural change depends only on 16S residues within the S4 binding site. SHAPE chemical-probing experiments showed that S4 strongly stabilizes the five-helix junction and helix 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in helix 16 that makes specific contacts with the S4 N-terminal extension, and a right angle motif between helices 3, 4 and 18, require a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of helix 3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  9. Limitations of metazoan 18S rRNA sequence data : implications for reconstructing a phylogeny of the animal kingdom and inferring the reality of the cambrian explosion

    Abouheif, Ehab; Zardoya, Rafael; Meyer, Axel

    1998-01-01

    We document the phylogenetic behavior of the 18S rRNA molecule in 67 taxa from 28 metazoan phyla and assess the effects of among-site rate variation on reconstructing phylogenies of the animal kingdom. This empirical assessment was undertaken to clarify further the limits of resolution of the 18S rRNA gene as a phylogenetic marker and to address the question of whether 18S rRNA phylogenies can be used as a source of evidence to infer the reality of a Cambrian explosion. A notable degree of am...

  10. Quantification of Hyphomicrobium Populations in Activated Sludge from an Industrial Wastewater Treatment System as Determined by 16S rRNA Analysis

    Layton, A C; Karanth, P. N.; Lajoie, C. A.; Meyers, A J; Gregory, I. R.; Stapleton, R. D.; Taylor, D E; Sayler, G. S.

    2000-01-01

    The bacterial community structure of the activated sludge from a 25 million-gal-per-day industrial wastewater treatment plant was investigated using rRNA analysis. 16S ribosomal DNA (rDNA) libraries were created from three sludge samples taken on different dates. Partial rRNA gene sequences were obtained for 46 rDNA clones, and nearly complete 16S rRNA sequences were obtained for 18 clones. Seventeen of these clones were members of the beta subdivision, and their sequences showed high homolog...

  11. Sulphate reduction and vertical distribution of sulphate-reducing bacteria quantified by rRNA slot-blot hybridization in a coastal marine sediment

    Sahm, K.; MacGregor, BJ; Jørgensen, BB; Stahl, DA

    1999-01-01

    In the past, enumeration of sulphate-reducing bacteria (SRB) by cultivation-based methods generally contradicted measurements of sulphate reduction, suggesting unrealistically high respiration rates per cell. Here, we report evidence that quantification of SRB rRNA by slot-blot hybridization is a...... between 18% and 25% to the prokaryotic rRNA pool. The dominant SRB were related to complete oxidizing genera (Desulphococcus, Desulphosarcina and Desulphobacterium), while Desulpho-bacter could not be detected. The vertical profile and quantity of rRNA from SRB was compared with sulphate reduction rates...... (SRR) measured with (SO42-)-S-35 tracer in whole-core incubations. While SRB abundance was highest near the surface, peaking at around 1.5cm, measured sulphate reduction rates were lowest in this region. A second peak of SRB rRNA was observed at the transition zone from oxidized to reduced sediment...

  12. Transport of rRNA into cytoplasm required for initiation of S phase in root meristem cells in Helianthus annuus L

    Cold treatment (10degC) of root meristems during a period longer than duration of the cell cycle in 20degC causes a blocking of most cells in G1. One of the causes of cell cycle blockade is the decrease of rRNA synthesis and inhibition of rRNA transport into cytoplasm. Transfer of seedlings to 20degC results in increase of rRNA synthesis and its transport to cytoplasm as well as transition of almost all cells from G1 to S during 3 hours. Synchronization of DNA replication, comprising cells within rows of cells, is preceded by similar transport patter of rRNA to cytoplasm. (Author)

  13. The identification of two Trypanosoma cruzi I genotypes from domestic and sylvatic transmission cycles in Colombia based on a single polymerase chain reaction amplification of the spliced-leader intergenic region

    Lina Marcela Villa

    2013-11-01

    Full Text Available A single polymerase chain reaction (PCR reaction targeting the spliced-leader intergenic region of Trypanosoma cruzi I was standardised by amplifying a 231 bp fragment in domestic (TcIDOM strains or clones and 450 and 550 bp fragments in sylvatic strains or clones. This reaction was validated using 44 blind coded samples and 184 non-coded T. cruzi I clones isolated from sylvatic triatomines and the correspondence between the amplified fragments and their domestic or sylvatic origin was determined. Six of the nine strains isolated from acute cases suspected of oral infection had the sylvatic T. cruzi I profile. These results confirmed that the sylvatic T. cruzi I genotype is linked to cases of oral Chagas disease in Colombia. We therefore propose the use of this novel PCR reaction in strains or clones previously characterised as T. cruzi I to distinguish TcIDOMfrom sylvatic genotypes in studies of transmission dynamics, including the verification of population selection within hosts or detection of the frequency of mixed infections by both T. cruzi I genotypes in Colombia.

  14. A rapid method for sequencing of rRNA gene(s) amplified by polymerase chain reaction using an automated DNA sequencer

    Dwivedi, P.P.; Patel, B.K.C.; Rees, G.N.; Ollivier, Bernard

    1996-01-01

    A method for DNA sequencing of ribosomal RNA (rRNA) genes, amplified by polymerase chain reaction (PCR), using internal primers, designed on the basis of conserved regions of rRNA genes for determining a near complete sequence (99%) of the gene using an automated DNA sequencer (Applied Biosystem Incorporation, USA) is described. The procedure is extremely rapid as cloning of the gene is not required for sequence determination. In addition time consuming steps such as ethanol precipitation and...

  15. Molecular evolution of rDNA in early diverging Metazoa: First comparative analysis and phylogenetic application of complete SSU rRNA secondary structures in Porifera

    Wörheide Gert; Erpenbeck Dirk; Voigt Oliver

    2008-01-01

    Abstract Background The cytoplasmic ribosomal small subunit (SSU, 18S) ribosomal RNA (rRNA) is the most frequently-used gene for molecular phylogenetic studies. However, information regarding its secondary structure is neglected in most phylogenetic analyses. Incorporation of this information is essential in order to apply specific rRNA evolutionary models to overcome the problem of co-evolution of paired sites, which violates the basic assumption of the independent evolution of sites made by...

  16. Update and evaluation of 16SpathDB, an automated comprehensive database for identification of medically important bacteria by 16S rRNA gene sequencing

    Yeung, Shiu-yan; 楊兆恩

    2013-01-01

    Identification of pathogens is one of the important duties of clinical microbiology laboratory. Traditionally, phenotypic tests are used to identify the bacteria. However, due to some limitations of the phenotypic tests, the bacteria may not be identified sometimes and cannot be identified promptly. 16S rRNA gene sequencing is a rapid and accurate method to achieve this target. It is especially useful for identify rare or slow growing bacteria. However, the interpretation of the 16S rRNA gene...

  17. Soil Acidobacterial 16S rRNA Gene Sequences Reveal Subgroup Level Differences between Savanna-Like Cerrado and Atlantic Forest Brazilian Biomes

    Catão, Elisa C. P.; Lopes, Fabyano A. C.; Janaína F. Araújo; Alinne P. de Castro; Barreto, Cristine C.; Mercedes M.C. Bustamante; Betania F. Quirino; Krüger, Ricardo H.

    2014-01-01

    16S rRNA sequences from the phylum Acidobacteria have been commonly reported from soil microbial communities, including those from the Brazilian Savanna (Cerrado) and the Atlantic Forest biomes, two biomes that present contrasting characteristics of soil and vegetation. Using 16S rRNA sequences, the present work aimed to study acidobacterial diversity and distribution in soils of Cerrado savanna and two Atlantic forest sites. PCA and phylogenetic reconstruction showed that the acidobacterial ...

  18. Associations of passerine birds, rabbits, and ticks with Borrelia miyamotoi and Borrelia andersonii in Michigan, U.S.A.

    Hamer Sarah A

    2012-10-01

    Full Text Available Abstract Background Wild birds contribute to maintenance and dissemination of vectors and microbes, including those that impact human, domestic animal, and wildlife health. Here we elucidate roles of wild passerine birds, eastern cottontail rabbits (Sylvilagus floridanus, and Ixodes dentatus ticks in enzootic cycles of two spirochetes, Borrelia miyamotoi and B. andersonii in a region of Michigan where the zoonotic pathogen B. burgdorferi co-circulates. Methods Over a four-year period, wild birds (n = 19,631 and rabbits (n = 20 were inspected for tick presence and ear tissue was obtained from rabbits. Samples were tested for Borrelia spirochetes using nested PCR of the 16S-23S rRNA intergenic spacer region (IGS and bidirectional DNA sequencing. Natural xenodiagnosis was used to implicate wildlife reservoirs. Results Ixodes dentatus, a tick that specializes on birds and rabbits and rarely bites humans, was the most common tick found, comprising 86.5% of the 12,432 ticks collected in the study. The relapsing fever group spirochete B. miyamotoi was documented for the first time in ticks removed from wild birds (0.7% minimum infection prevalence; MIP, in I. dentatus, and included two IGS strains. The majority of B. miyamotoi-positive ticks were removed from Northern Cardinals (Cardinalis cardinalis. Borrelia andersonii infected ticks removed from birds (1.6% MIP, ticks removed from rabbits (5.3% MIP, and rabbit ear biopsies (5% comprised twelve novel IGS strains. Six species of wild birds were implicated as reservoirs for B. andersonii. Frequency of I. dentatus larval and nymphal co-feeding on birds was ten times greater than expected by chance. The relatively well-studied ecology of I. scapularis and the Lyme disease pathogen provides a context for understanding how the phenology of bird ticks may impact B. miyamotoi and B. andersonii prevalence and host associations. Conclusions Given the current invasion of I. scapularis, a human biting species

  19. Enterotoxin-producing Staphylococcus aureus genotype B as a major contaminant in Swiss raw milk cheese.

    Hummerjohann, J; Naskova, J; Baumgartner, A; Graber, H U

    2014-03-01

    The objective of this study was to characterize Staphylococcus aureus isolates from Swiss raw milk cheeses that had been found to be contaminated with coagulase-positive staphylococci and to estimate the frequency of the various genotypes, in particular the mastitis-associated Staph. aureus genotype B (GTB). The isolates were also tested for staphylococcal enterotoxin (SE) genes and other virulence factors. From 623 coagulase-positive staphylococci isolated from 78 contaminated raw milk cheeses, 609 were found to be Staphylococcus aureus. Genotyping of all Staph. aureus isolates was performed by PCR amplification of the 16S-23S rRNA intergenic spacer region, as this method was used previously to differentiate between mastitis subtypes associated with their clinical outcome. In total, 20 different genotypes were obtained and the 5 most frequently occurring genotypes were distributed in 6.4% or more of the samples. The enterotoxin-producing Staph. aureus GTB, known for its high contagiousness and increased pathogenicity in Swiss mastitis herds, was found to be the most abundant subtype at the sample level (71.8%) as well as among the isolates (62.0%). A subset of 107 isolates of the different genotypes were analyzed for the presence of SE genes and revealed 9 different SE gene patterns, with sed being most frequently detected and 26% being PCR-negative for SE genes. Almost all isolates of the major contaminant GTB contained the SE gene pattern sed, sej, ser, with half of them additionally carrying sea. Production of SE in vitro was consistent with the SE genes detected in most of the cases; however, some isolated GTB did not produce SEA. Staphylococcus aureus Protein A (spa) typing revealed 30 different subtypes and most GTB isolates belonged to the bovine spa type t2953; GTB/t2953 was linked among other subtypes to SE production in cheese and staphylococcal intoxication cases. Furthermore, 1 of the 623 isolates was a methicillin-resistant Staph. aureus, which was an

  20. Identificación de Yarrowia lipolytica (Ascomycota: Hemiascomycetes como contaminante en la obtención de amplificados del gen 28S rRNA de moluscos

    Jenny Chirinos

    2011-05-01

    Full Text Available En el presente trabajo se identifica una secuencia de DNA no esperada proveniente de los amplificados del gen 28S rRNA de moluscos terrestres. Las extracciones de DNA se realizaron del tejido del pie de caracoles terrestres por el método del CTAB modificado. Las PCRs fueron llevadas a cabo con primers universales para el gen COI e iniciadores diseñados para moluscos, para el marcador 16S rRNA, 28S rRNA y la región ITS-2. Los tamaños aproximados de las bandas de los amplificados de moluscos fueron de 706 pb para el COI, 330 pb para el 16S rRNA, 900 pb para el ITS-2 y 583 pb para el 28S rRNA; un amplificado del último marcador fue de una longitud inesperada, ~340 pb. Las secuencias de DNA fueron comparadas con la base de datos del GenBank mediante el programa BLASTn y la muestra con la banda de tamaño inesperado resultó en un 100% de identidad y cobertura del 99% con el gen 26S rRNA de la levadura Yarrowia lipolytica. El análisis filogenético con Neighbour-Joining y los valores de divergencia confirmaron la identificación, proporcionando resultados que apoyan la ubicación taxonómica de la especie dentro del clado de los Hemiascomycetes.

  1. Microbial Dark Matter: Unusual intervening sequences in 16S rRNA genes of candidate phyla from the deep subsurface

    Jarett, Jessica; Stepanauskas, Ramunas; Kieft, Thomas; Onstott, Tullis; Woyke, Tanja

    2014-03-17

    The Microbial Dark Matter project has sequenced genomes from over 200 single cells from candidate phyla, greatly expanding our knowledge of the ecology, inferred metabolism, and evolution of these widely distributed, yet poorly understood lineages. The second phase of this project aims to sequence an additional 800 single cells from known as well as potentially novel candidate phyla derived from a variety of environments. In order to identify whole genome amplified single cells, screening based on phylogenetic placement of 16S rRNA gene sequences is being conducted. Briefly, derived 16S rRNA gene sequences are aligned to a custom version of the Greengenes reference database and added to a reference tree in ARB using parsimony. In multiple samples from deep subsurface habitats but not from other habitats, a large number of sequences proved difficult to align and therefore to place in the tree. Based on comparisons to reference sequences and structural alignments using SSU-ALIGN, many of these ?difficult? sequences appear to originate from candidate phyla, and contain intervening sequences (IVSs) within the 16S rRNA genes. These IVSs are short (39 - 79 nt) and do not appear to be self-splicing or to contain open reading frames. IVSs were found in the loop regions of stem-loop structures in several different taxonomic groups. Phylogenetic placement of sequences is strongly affected by IVSs; two out of three groups investigated were classified as different phyla after their removal. Based on data from samples screened in this project, IVSs appear to be more common in microbes occurring in deep subsurface habitats, although the reasons for this remain elusive.

  2. Analysis of the function of E. coli 23S rRNA helix-loop 69 by mutagenesis

    Maiväli Ülo

    2005-07-01

    Full Text Available Abstract Background The ribosome is a two-subunit enzyme known to exhibit structural dynamism during protein synthesis. The intersubunit bridges have been proposed to play important roles in decoding, translocation, and the peptidyl transferase reaction; yet the physical nature of their contributions is ill understood. An intriguing intersubunit bridge, B2a, which contains 23S rRNA helix 69 as a major component, has been implicated by proximity in a number of catalytically important regions. In addition to contacting the small ribosomal subunit, helix 69 contacts both the A and P site tRNAs and several translation factors. Results We scanned the loop of helix 69 by mutagenesis and analyzed the mutant ribosomes using a plasmid-borne IPTG-inducible expression system. We assayed the effects of 23S rRNA mutations on cell growth, contribution of mutant ribosomes to cellular polysome pools and the ability of mutant ribosomes to function in cell-free translation. Mutations A1912G, and A1919G have very strong growth phenotypes, are inactive during in vitro protein synthesis, and under-represented in the polysomes. Mutation Ψ1917C has a very strong growth phenotype and leads to a general depletion of the cellular polysome pool. Mutation A1916G, having a modest growth phenotype, is apparently defective in the assembly of the 70S ribosome. Conclusion Mutations A1912G, A1919G, and Ψ1917C of 23S rRNA strongly inhibit translation. Mutation A1916G causes a defect in the 50S subunit or 70S formation. Mutations Ψ1911C, A1913G, C1914A, Ψ1915C, and A1918G lack clear phenotypes.

  3. Application of rRNA probes and fluorescence in situ hybridization for rapid detection of the toxic dinoflagellate Alexandrium minutum

    TANG Xianghai; YU Rencheng; ZHOU Mingjiang; YU Zhigang

    2012-01-01

    The dinoflagellate Alexandrium minutum is often associated with harmful algal blooms (HABs).This species consists of many strains that differ in their ability to produce toxins but have similar morphology,making identification difficult.In this study,species-specific rRNA probes were designed for whole-cell fluorescence in situ hybridization (FISH) to distinguish A.minutum from two phylogenetic clades.We acquired the complete SSU to LSU rDNA sequences (GenBank accession numbers JF906989-JF906999) of 11 Alexandrium strains and used these to design rRNA targeted oligonucleotide probes.Three ribotype-specific probes,M-GC-1,M-PC-2,and M-PC-3,were designed.The former is specific for the GC clade (“Global clade”) of A.minutum,the majority of which have been found non-toxic,and the latter two are specific for the PSP (paralytic shellfish poisoning)-producing PC clade (“Pacific clade”).The specificity of these three probes was confirmed by FISH.All cells in observed fields of view were fluorescently labeled when probes and target species were incubated under optimized FISH conditions.However,the accessibility of rRNA molecules in ribosomes varied among the probe binding positions.Thus,there was variation in the distribution of positive signals in labeled cells within nucleolus and cytosol (M-GC-1,M-PC-3),or just nucleolus (M-PC-2).Our results provide a methodological basis for studying the biogeography and population dynamics of A.minutum,and providing an early warning of toxic HABs.

  4. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report

    Lee SH

    2016-04-01

    Full Text Available Sin Hang Lee,1,21Pathology Department, Milford Hospital, Milford, CT, USA; 2Milford Molecular Diagnostics, Milford, CT, USA Abstract: Lyme disease (LD, the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. Keywords: Lyme disease, Borrelia burgdorferi, homeologous 16S rRNA genes, DNA sequencing

  5. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing

    Chia Sing eChan

    2015-03-01

    Full Text Available The Sungai Klah (SK hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-meter-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0 to 9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC. In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3−V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream and geochemical parameters (broad temperature and pH range. It is speculated that symbiotic relationships occur between the members of the community.

  6. Slow formation of stable complexes during coincubation of minimal rRNA and ribosomal protein S4.

    Mayerle, Megan; Bellur, Deepti L; Woodson, Sarah A

    2011-09-23

    Ribosomal protein S4 binds and stabilizes a five-helix junction or five-way junction (5WJ) in the 5' domain of 16S ribosomal RNA (rRNA) and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and 5WJ reorganize their structures. We show that labile S4 complexes rearrange into stable complexes within a few minutes at 42 °C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show that this structural change depends only on 16S residues within the S4 binding site. SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension) chemical probing experiments showed that S4 strongly stabilizes 5WJ and the helix (H) 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in H16 that makes specific contacts with the S4 N-terminal extension, as well as a right-angle motif between H3, H4, and H18, requires a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of H3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  7. Development of an Analysis Pipeline Characterizing Multiple Hypervariable Regions of 16S rRNA Using Mock Samples.

    Jennifer J Barb

    Full Text Available There is much speculation on which hypervariable region provides the highest bacterial specificity in 16S rRNA sequencing. The optimum solution to prevent bias and to obtain a comprehensive view of complex bacterial communities would be to sequence the entire 16S rRNA gene; however, this is not possible with second generation standard library design and short-read next-generation sequencing technology.This paper examines a new process using seven hypervariable or V regions of the 16S rRNA (six amplicons: V2, V3, V4, V6-7, V8, and V9 processed simultaneously on the Ion Torrent Personal Genome Machine (Life Technologies, Grand Island, NY. Four mock samples were amplified using the 16S Ion Metagenomics Kit™ (Life Technologies and their sequencing data is subjected to a novel analytical pipeline.Results are presented at family and genus level. The Kullback-Leibler divergence (DKL, a measure of the departure of the computed from the nominal bacterial distribution in the mock samples, was used to infer which region performed best at the family and genus levels. Three different hypervariable regions, V2, V4, and V6-7, produced the lowest divergence compared to the known mock sample. The V9 region gave the highest (worst average DKL while the V4 gave the lowest (best average DKL. In addition to having a high DKL, the V9 region in both the forward and reverse directions performed the worst finding only 17% and 53% of the known family level and 12% and 47% of the genus level bacteria, while results from the forward and reverse V4 region identified all 17 family level bacteria.The results of our analysis have shown that our sequencing methods using 6 hypervariable regions of the 16S rRNA and subsequent analysis is valid. This method also allowed for the assessment of how well each of the variable regions might perform simultaneously. Our findings will provide the basis for future work intended to assess microbial abundance at different time points

  8. Molecular identification of Trichinella spiralis and Trichinella britovi by diagnostic multiprimer large mitochondrial rRNA amplification.

    Borsuk, P; Moskwa, B; Pastusiak, K; Cabaj, W

    2003-11-01

    Trichinella parasites with different epidemiological features still occur in Europe and four species of genus Trichinella have been identified: T. spiralis, T. britovi, T. nativa and T. pseudospiralis. Until now, two of them, T. spiralis and T. britovi, have been identified in Poland. In our studies we selected sequence coding for large mitochondrial rRNA (mt LrDNA) as a genetic marker and developed a sensitive LrDNA multiprimer PCR assay allowing for rapid identification of T. spiralis and T. britovi, parasites present in wild and domestic animals in Poland. PMID:14505042

  9. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)1

    Stenger, Brianna L.S.; Clark, Mark E.; Kváč, Martin; Khan, Eakalak; Giddings, Catherine W.; Dyer, Neil W.; Schultz, Jessie L.; McEvoy, John M.

    2015-01-01

    Cryptosporidium is an apicomplexan parasite that causes the disease cryptosporidiosis in humans, livestock, and other vertebrates. Much of the knowledge on Cryptosporidium diversity is derived from 18S rRNA gene (18S rDNA) phylogenies. Eukaryote genomes generally have multiple 18S rDNA copies that evolve in concert, which is necessary for the accurate inference of phylogenetic relationships. However, 18S rDNA copies in some genomes evolve by a birth-and-death process that can result in sequen...

  10. Molecular evolution of rDNA in early diverging Metazoa: First comparative analysis and phylogenetic application of complete SSU rRNA secondary structures in Porifera

    Wörheide Gert

    2008-02-01

    Full Text Available Abstract Background The cytoplasmic ribosomal small subunit (SSU, 18S ribosomal RNA (rRNA is the most frequently-used gene for molecular phylogenetic studies. However, information regarding its secondary structure is neglected in most phylogenetic analyses. Incorporation of this information is essential in order to apply specific rRNA evolutionary models to overcome the problem of co-evolution of paired sites, which violates the basic assumption of the independent evolution of sites made by most phylogenetic methods. Information about secondary structure also supports the process of aligning rRNA sequences across taxa. Both aspects have been shown to increase the accuracy of phylogenetic reconstructions within various taxa. Here, we explore SSU rRNA secondary structures from the three extant classes of Phylum Porifera (Grant, 1836, a pivotal, but largely unresolved taxon of early branching Metazoa. This is the first phylogenetic study of poriferan SSU rRNA data to date that includes detailed comparative secondary structure information for all three sponge classes. Results We found base compositional and structural differences in SSU rRNA among Demospongiae, Hexactinellida (glass sponges and Calcarea (calcareous sponges. We showed that analyses of primary rRNA sequences, including secondary structure-specific evolutionary models, in combination with reconstruction of the evolution of unusual structural features, reveal a substantial amount of additional information. Of special note was the finding that the gene tree topologies of marine haplosclerid demosponges, which are inconsistent with the current morphology-based classification, are supported by our reconstructed evolution of secondary structure features. Therefore, these features can provide alternative support for sequence-based topologies and give insights into the evolution of the molecule itself. To encourage and facilitate the application of rRNA models in phylogenetics of early

  11. Molecular evolution of rDNA in early diverging Metazoa: First comparative analysis and phylogenetic application of complete SSU rRNA secondary structures in Porifera

    2008-01-01

    Background The cytoplasmic ribosomal small subunit (SSU, 18S) ribosomal RNA (rRNA) is the most frequently-used gene for molecular phylogenetic studies. However, information regarding its secondary structure is neglected in most phylogenetic analyses. Incorporation of this information is essential in order to apply specific rRNA evolutionary models to overcome the problem of co-evolution of paired sites, which violates the basic assumption of the independent evolution of sites made by most phylogenetic methods. Information about secondary structure also supports the process of aligning rRNA sequences across taxa. Both aspects have been shown to increase the accuracy of phylogenetic reconstructions within various taxa. Here, we explore SSU rRNA secondary structures from the three extant classes of Phylum Porifera (Grant, 1836), a pivotal, but largely unresolved taxon of early branching Metazoa. This is the first phylogenetic study of poriferan SSU rRNA data to date that includes detailed comparative secondary structure information for all three sponge classes. Results We found base compositional and structural differences in SSU rRNA among Demospongiae, Hexactinellida (glass sponges) and Calcarea (calcareous sponges). We showed that analyses of primary rRNA sequences, including secondary structure-specific evolutionary models, in combination with reconstruction of the evolution of unusual structural features, reveal a substantial amount of additional information. Of special note was the finding that the gene tree topologies of marine haplosclerid demosponges, which are inconsistent with the current morphology-based classification, are supported by our reconstructed evolution of secondary structure features. Therefore, these features can provide alternative support for sequence-based topologies and give insights into the evolution of the molecule itself. To encourage and facilitate the application of rRNA models in phylogenetics of early metazoans, we present 52 SSU rRNA

  12. Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up- and downshift

    Jydegaard-Axelsen, A.M.; Aaes-Jorgensen, A.; Koch, A.G.; Stoumann Jensen, J.; Knochel, S.

    2005-01-01

    Cell morphology, rRNA content, and growth were examined for Listeria monocytogenes LO28 and EGD, respectively, grown in brain-heart infusion (BHI) and on slices of sausage at 10degreesC in 100% CO2, 100% N-2, and air. In CO2, filamentous cells were formed by both strains on sausage slices and by L....... monocytogenes EGD in BHI. Filamentation was not induced by anaerobiosis only. Fluorescent in situ rRNA hybridization (FISH) of cells grown in BHI showed that the L. monocytogenes EGD filaments consisted of chains of individual slightly elongated cells. The rods formed by L. monocytogenes LO28 had the same size...... in air and CO2.. Septation and cell division were induced in the filaments after a CO2 downshift (i.e., exposure to air). In BHI, the number of colony forming units increased rapidly when L. monocytogenes EGD grown in CO2 was exposed to air whereas the number of L. monocytogenes LO28 remained almost...

  13. 16S rRNA gene phylogenesis of culturable predominant bacteria from diseased Apostichopus japonicus (Holothuroidea, Echinodermata)

    Ma, Haiyan; Jiang, Guoliang; Wu, Zhiqiang; Wang, Xin

    2009-06-01

    Cultured Apostichopus japonicus in China suffers from a kind of skin ulceration disease that has caused severe economic loss in recent years. The disease, pathogens of which are supposed to be bacteria by most researchers, is highly infectious and can often cause all individuals in the same culture pool to die in a very short time. The 16S rRNA gene phylogenesis of the culturable bacteria from the lesions of diseased individuals was conducted to study the biodiversity of the bacterial communities in the lesions and to identify probable pathogen(s) associated with this kind of disease. S. japonica samples were selected from a hatchery located in the eastern part of Qingdao, China. Bacterial universal primers GM5F and DS907R were used to amplify the 16S rRNA gene of bacteria colonies, and touchdown PCR was performed to amplify the target sequences. The results suggest that γ- proteobacteria (Alteromonadales and Vibrionales) of CFB group, many strains of which have been also determined as pathogens in other marine species, are the predominant bacterial genera of the diseased Apostichopus japonicus individuals.

  14. 16s rRNA Identification of Pediococcus spp. from Broiler and Studies of Adherence Ability on Immobilized Mucus

    Ema Damayanti

    2015-11-01

    Full Text Available The objectives of this research were to study taxonomical status of lactic acid bacteria (LAB isolated from broiler and adherence ability on mucus in vitro. Molecular analysis was performed by analyzing 16S rRNA gene using universal primer. The adherence assay on mucus was carried out using microplate method with total plate count (TPC, absorbance (A550 and confirmed by scanning electron microscopy (SEM. The results of this studies revealed that three of LAB isolates have closed relation to Pediococcus acidilactici (99.9% species.Three isolates of P. acidilactici have adherence ability on broiler mucus higher than that on porcine mucin with an adherence percentage of 55.5% versus 50.8% and absorbance A550 of 0.061 versus 0.051, respectively. The highest adherence ability showed by P. acidilactici R02 with adherence percentage was 59.3% and absorbance A550 = 0.068. Adherence on mucus were affected by the addition of 3 g/l of gastric juice and 0.3% (b/v of bile salt. Adherence analysis using SEM also showed that the adherence on broiler mucus was higher than the adherence on porcine mucin. Altogether this adherence studies, suggest that three isolates of P. acidilactici LAB were capable of colonizing host intestinal mucus in vitro as important property to be promising probiotic bacteria for broiler.Key words : adherence, broiler, Pediococcus, mucus, 16S rRNA

  15. Analysis of the cystic fibrosis lung microbiota via serial Illumina sequencing of bacterial 16S rRNA hypervariable regions.

    Heather Maughan

    Full Text Available The characterization of bacterial communities using DNA sequencing has revolutionized our ability to study microbes in nature and discover the ways in which microbial communities affect ecosystem functioning and human health. Here we describe Serial Illumina Sequencing (SI-Seq: a method for deep sequencing of the bacterial 16S rRNA gene using next-generation sequencing technology. SI-Seq serially sequences portions of the V5, V6 and V7 hypervariable regions from barcoded 16S rRNA amplicons using an Illumina short-read genome analyzer. SI-Seq obtains taxonomic resolution similar to 454 pyrosequencing for a fraction of the cost, and can produce hundreds of thousands of reads per sample even with very high multiplexing. We validated SI-Seq using single species and mock community controls, and via a comparison to cystic fibrosis lung microbiota sequenced using 454 FLX Titanium. Our control runs show that SI-Seq has a dynamic range of at least five orders of magnitude, can classify >96% of sequences to the genus level, and performs just as well as 454 and paired-end Illumina methods in estimation of standard microbial ecology diversity measurements. We illustrate the utility of SI-Seq in a pilot sample of central airway secretion samples from cystic fibrosis patients.

  16. New mutation points in 23S rRNA gene associated with Helicobacter Pylori resistance to clarithromycin in northeast China

    Qing Hao; Yan Li; Zhi-Jie Zhang; Yong Liu; Hong Gao

    2004-01-01

    AIM: To investigate the resistance rate of Helicobacter pylori (Hpylori) to clarithromycin, metronidazole, amoxicillin and tetracycline to guide clinical practice, and to study the mechanism of H pyloriresistant to clarithromycin.METHODS: Thirty H pyloristrains were isolated from the mucosa of peptic ulcer, gastric tumor and chronic gastritis patients, then the minimal inhibitory concentration (MIC) to clarithromycin, metronidazole, amoxicillin and tetracycline was evaluated by E-test method. The sequence analysis of PCR fragments was conducted in 23S rRNA gene of H pylori resistant to clarithromycin to get the resistance mechanism of the bacteria.RESULTS: Among 30 H pyloristrains, 7 cases were resistant to clarithromycin, 12 to metronidazole, 2 to tetracycline and no strain was found to be resistant to amoxicillin. The resistance rates were 23.3%, 40%, 6.7% and 0%,respectively. Three new mutation points were found to be related to the clarithromycin resistance in H pyloriisolates,which were G2224A, C2245T and T2289C.CONCLUSION: In northeast China, H pylorishows high resistance to metronidazole, while sensitive to amoxicillin.The mechanism of resistance to clarithromycin may be related to the mutation of G2224A, C2245T and T2289C in the 23S rRNA gene.

  17. 16S rRNA Gene Phylogenesis of Culturable Predominant Bacteria from Diseased Apostichopus japonicus(Holothuroidea, Echinodermata)

    MA Haiyan; JIANG Guoliang; WU Zhiqiang; WANG Xin

    2009-01-01

    Cultured Apostichopusjaponicus in China suffers from a kind of skin ulceration disease that has caused severe economic loss in recent years. The disease, pathogens of which are supposed to be bacteria by most researchers, is highly infectious and can often cause all individuals in the same culture pool to die in a very short time. The 16S rRNA gene phylogenesis of the culturable bacteria from the lesions of diseased individuals was conducted to study the biodiversity of the bacterial communities in the lesions and to identify probable pathogen(s) associated with this kind of disease. S. japonica samples were selected from a hatchery located in the eastern part of Qingdao, China. Bacterial universal primers GM5F and DS907R were used to amplify the 16S rRNA gene of bacteria colonies, and touchdown PCR was performed to amplify the target sequences. The results suggest that γ- proteobacteria (Alteromonadales and Vibrionales) of CFB group, many strains of which have been also determined as pathogens in other marine species, are the predominant bacterial genera of the diseased Apostichopusjaponicus individuals.

  18. Genetic relationship between Neobenedenia girellae and N.melleni inferred from 28S rRNA sequences

    WANG Jun; ZHANG Wen; SU Yongquan; DING Shaoxiong

    2004-01-01

    The fragments of 350 bp in 28S rRNA from the closely related monogenea of trematoda, Neobenedenia girellae and N. melleni are obtained by polymerase chain reaction (PCR) amplified using a couple of special primers and then sequenced. The results show that the comparison of 28S rRNA sequences, with only a base varying in 337bp accounting for 0.3% genetic difference, from the relative species N. girellae and N. melleni parasitized on the different fishes in different farms displays that they possess a very high genetic similarity of 99.7%, higher than that of 99.41% for the single species N. melleni sampled in different areas, and the intraspecific divergence of N.melleni is 0.59%. Meanwhile, the interspecific differences between the two Neobenedenia and three Benedenia (i.e., B. lutjani, B. rohdei and B. seriolae) range from 2.08% to11.73%. In addition, UPGMA and MP molecular phylogenetic trees are constructed and proved to be consistent with each other. Though the morphological characteristics and the results of genetic diversity for the two Neobenedenia show a high similarity, whether they belong to a single species or not are still undefined, and the more genes of them should be further investigated, in combination with the systematical and detailed morphological study.

  19. Formation of nucleolar polymorphisms in trisomic chickens and subsequent microevolution of rRNA gene clusters in diploids.

    Delany, M E; Muscarella, D E; Bloom, S E

    1991-01-01

    Variations in nucleolar size are common in animals and man, yet the basis and significance of this variation are not well understood. In this report, we describe the generation de novo of individuals that express nucleolar size variations (polymorphisms) and the underlying basis for this phenotype in a vertebrate animal system (Gallus domesticus). Individuals that express nucleolar size polymorphisms were produced from mating chickens trisomic for the nucleolar organizer (NO) chromosome; 10%-18% of progeny demonstrated nucleolar polymorphisms. These progeny were incorporated into a diploid genetic line in which the polymorphic trait was observed to segregate in Mendelian fashion. An even more dramatic nucleolar size polymorphism (one macro- plus one micronucleolus) evolved in one diploid family over the course of only two generations. These individuals were used to ascertain that the polymorphic-nucleoli phenotype was expressed in tissues derived from the three primary embryonic cell layers in embryos and neonates. Image analysis was conducted on cells of these birds to quantitate the size differences between macro- and micronucleoli (5 mu2 versus 1 mu2, respectively). Finally, these birds were studied with the technique of in situ hybridization, which showed that gene number differences between homologous NO chromosomes (i.e., heterozygosity for rRNA gene copy number), underlies the polymorphic-nucleoli phenotype. Thus, the chicken emerges as an experimental system through which heterozygosity for the rRNA gene copy number can be induced, easily identified, transmitted, and expressed in all somatic tissues.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2061593

  20. Fecal Microbiota in Healthy Subjects Following Omnivore, Vegetarian and Vegan Diets: Culturable Populations and rRNA DGGE Profiling.

    Ferrocino, Ilario; Di Cagno, Raffaella; De Angelis, Maria; Turroni, Silvia; Vannini, Lucia; Bancalari, Elena; Rantsiou, Kalliopi; Cardinali, Gianluigi; Neviani, Erasmo; Cocolin, Luca

    2015-01-01

    In this study, the fecal microbiota of 153 healthy volunteers, recruited from four different locations in Italy, has been studied by coupling viable counts, on different microbiological media, with ribosomal RNA Denaturing Gradient Gel Electrophoresis (rRNA-DGGE). The volunteers followed three different diets, namely omnivore, ovo-lacto-vegetarian and vegan. The results obtained from culture-dependent and -independent methods have underlined a high level of similarity of the viable fecal microbiota for the three investigated diets. The rRNA DGGE profiles were very complex and comprised a total number of bands that varied from 67 to 64 for the V3 and V9 regions of the 16S rRNA gene, respectively. Only a few bands were specific in/of all three diets, and the presence of common taxa associated with the dietary habits was found. As far as the viable counts are concerned, the high similarity of the fecal microbiota was once again confirmed, with only a few of the investigated groups showing significant differences. Interestingly, the samples grouped differently, according to the recruitment site, thus highlighting a higher impact of the food consumed by the volunteers in the specific geographical locations than that of the type of diet. Lastly, it should be mentioned that the fecal microbiota DGGE profiles obtained from the DNA were clearly separated from those produced using RNA, thus underlining a difference between the total and viable populations in the fecal samples. PMID:26035837

  1. Fecal Microbiota in Healthy Subjects Following Omnivore, Vegetarian and Vegan Diets: Culturable Populations and rRNA DGGE Profiling.

    Ilario Ferrocino

    Full Text Available In this study, the fecal microbiota of 153 healthy volunteers, recruited from four different locations in Italy, has been studied by coupling viable counts, on different microbiological media, with ribosomal RNA Denaturing Gradient Gel Electrophoresis (rRNA-DGGE. The volunteers followed three different diets, namely omnivore, ovo-lacto-vegetarian and vegan. The results obtained from culture-dependent and -independent methods have underlined a high level of similarity of the viable fecal microbiota for the three investigated diets. The rRNA DGGE profiles were very complex and comprised a total number of bands that varied from 67 to 64 for the V3 and V9 regions of the 16S rRNA gene, respectively. Only a few bands were specific in/of all three diets, and the presence of common taxa associated with the dietary habits was found. As far as the viable counts are concerned, the high similarity of the fecal microbiota was once again confirmed, with only a few of the investigated groups showing significant differences. Interestingly, the samples grouped differently, according to the recruitment site, thus highlighting a higher impact of the food consumed by the volunteers in the specific geographical locations than that of the type of diet. Lastly, it should be mentioned that the fecal microbiota DGGE profiles obtained from the DNA were clearly separated from those produced using RNA, thus underlining a difference between the total and viable populations in the fecal samples.

  2. Bacterial community analysis of a gas-phase biotrickling filter for biogas mimics desulfurization through the rRNA approach.

    Maestre, Juan P; Rovira, R; Alvarez-Hornos, F J; Fortuny, M; Lafuente, J; Gamisans, X; Gabriel, D

    2010-08-01

    The bacterial composition of a lab-scale biotrickling filter (BTF) treating high loads of H(2)S was investigated by the rRNA approach. Two 16S rRNA gene clone libraries were established 42 and 189 d after reactor startup, while fluorescent in-situ hybridization (FISH) with DNA probes was performed throughout 260d of reactor operation. Diversity, community structure and metamorphosis were studied from reactor startup to fully-established pseudo-steady state operation at near neutral pH and at an inlet H(2)S concentration of 2000 ppmv (load of 55.6g H(2)S m(-3)h(-1)). In addition, FISH was used for assessing the spatial distribution of sulfur-oxidizing bacteria (SOB) along the length of the reactor under pseudo-steady state operation. A major shift in the diversity of the community was observed with the operating time, from a well-diverse community at startup to pseudo-steady state operation with a majority of retrieved sequences affiliated to SOB of the sulfur cycle including Thiothrix spp., Thiobacillus spp., and Sulfurimonas denitrificans. Although aerobic species were predominant along the BTF, a vertical stratification was encountered, in which facultative anaerobes had a major relative abundance in the inlet part of the BTF, where the sulfide to oxygen ratio was higher. The observed changes were related to the trophic properties of the community, the DO concentration, the accumulation of elemental sulfur and the operation at neutral pH. PMID:20554311

  3. IDENTIFICATION OF Staphylococcus sp. STRAINS ISOLATED FROM POSITIVE WIDAL BLOOD BASED ON 16S rRNA GENE SEQUENCES

    Sri Darmawati

    2015-12-01

    Full Text Available The purpose of this study is to identify 8 strains of Staphylococcus genus members isolated from positive Widal blood (4 strains of Staphylococcus saprophyticus, 1 strain of Staphylococcus warneri, 2 strains of Staphylococcus hominis, 1 strain of Staphylococcus xylosus and 1 strain of Staphylococcus capitis based on 16S rRNA gene sequences. The methods used in this study are conducting PCR of 16S rRNA gene, cloning genes using T-Vector pMD20 which is transformed to E. coli DH5α, sequencing. The results show that four strains (BA 47.4, BA 19.2, KD 29.5 and TG 09.1 are identified as Stap. Saprophyticus strains of Stap. saprophyticus members of ATCC 15305T (99.01-100% similarity. The strain of TG 01.3 is identified as Stap. Warneri strain of TG 01.3 of Stap. Warneri members of ATCC 27836T (99.74-99.93% similarity, 2strains (KT 29.2 and KD 35.1 are identified as of Stap. hominis members of DSM 20328T (99.4-99.67% similarity. The strain of KT 30.5 is not identified

  4. lncRNA-Induced Nucleosome Repositioning Reinforces Transcriptional Repression of rRNA Genes upon Hypotonic Stress

    Zhongliang Zhao

    2016-03-01

    Full Text Available The activity of rRNA genes (rDNA is regulated by pathways that target the transcription machinery or alter the epigenetic state of rDNA. Previous work has established that downregulation of rRNA synthesis in quiescent cells is accompanied by upregulation of PAPAS, a long noncoding RNA (lncRNA that recruits the histone methyltransferase Suv4-20h2 to rDNA, thus triggering trimethylation of H4K20 (H4K20me3 and chromatin compaction. Here, we show that upregulation of PAPAS in response to hypoosmotic stress does not increase H4K20me3 because of Nedd4-dependent ubiquitinylation and proteasomal degradation of Suv4-20h2. Loss of Suv4-20h2 enables PAPAS to interact with CHD4, a subunit of the chromatin remodeling complex NuRD, which shifts the promoter-bound nucleosome into the transcriptional “off” position. Thus, PAPAS exerts a “stress-tailored” dual function in rDNA silencing, facilitating either Suv4-20h2-dependent chromatin compaction or NuRD-dependent changes in nucleosome positioning.

  5. ERIC-PCR技术对单增李斯特菌的溯源分析%Biotracing the source of Listeria monocytogenes strains by enterobacterial repetitive intergenic consensus sequence-based PCR

    刘海泉; 朱颖; 姜文洁; 孙晓红; 吴启华; 潘迎捷; 赵勇

    2013-01-01

    Enterobacterial repetitive intergenic consensus sequence (ERIC )-PCR was used to genotype 17 strains of Listeria monocytogenes,which were isolated from pork samples of the three market,and we investigated the correlation between the genotype,regional distribution and prevalence among L monocytogenes strains. L monocytogenes ATCC 19115 was used as positive control. The result showed that 17 isolates were identified as six special genotypes,and genotype IV was the dominant one as the main pollution group,which were isolated from the third market. The strains isolated from the first and second market were genotype I and genotype IV .respcetively. The result suggested that ERIC-PCR was suitable to investigate the biotracing of L. monocytogenes and it was a more rapid,efficient,and accurate molecular typing method than traditional serotyping methods.%以质控菌株ATCC 19115为对照,采用ERIC-PCR方法对从三个市场猪肉样品分离到的17株单增李斯特菌(Listeria monocytogenes)进行了基因分型,探讨了单增李斯特菌基因型与区域分布及流行性的关联性.结果表明,17株单增李斯特菌菌株可分为六个主要基因类群,其中Ⅳ型菌株最多,为主要污染类群,而这些菌株来自于市场三;市场一和市场二分离到的菌株主要分别为Ⅰ型和Ⅳ型.因此,ERIC-PCR方法适用于对单增李斯特菌的溯源分析和流行病学调查,具有简单、方便、快捷、准确的特点.

  6. Local repeat sequence organization of an intergenic spacer in the chloroplast genome of Chlamydomonas reinhardtii leads to DNA expansion and sequence scrambling: a complex mode of “copy-choice replication”?

    Mahendra D Wagle; Subhojit Sen; Basuthkar J Rao

    2001-12-01

    Parent-specific, randomly amplified polymorphic DNA (RAPD) markers were obtained from total genomic DNA of Chlamydomonas reinhardtii. Such parent-specific RAPD bands (genomic fingerprints) segregated uniparentally (through mt+) in a cross between a pair of polymorphic interfertile strains of Chlamydomonas (C. reinhardtii and C. minnesotti), suggesting that they originated from the chloroplast genome. Southern analysis mapped the RAPD-markers to the chloroplast genome. One of the RAPD-markers, ``P2” (1.6 kb) was cloned, sequenced and was fine mapped to the 3 kb region encompassing 3′ end of 23S, full 5S and intergenic region between 5S and psbA. This region seems divergent enough between the two parents, such that a specific PCR designed for a parental specific chloroplast sequence within this region, amplified a marker in that parent only and not in the other, indicating the utility of RAPD-scan for locating the genomic regions of sequence divergence. Remarkably, the RAPD-product, ``P2” seems to have originated from a PCR-amplification of a much smaller (about 600 bp), but highly repeat-rich (direct and inverted) domain of the 3 kb region in a manner that yielded no linear sequence alignment with its own template sequence. The amplification yielded the same uniquely ``sequence-scrambled” product, whether the template used for PCR was total cellular DNA, chloroplast DNA or a plasmid clone DNA corresponding to that region. The PCR product, a ``unique” new sequence, had lost the repetitive organization of the template genome where it had originated from and perhaps represented a ``complex path” of copy-choice replication.

  7. Polyethylene glycol and polyvinylpirrolidone effect on bacterial rRNA extraction and hybridization from cells exposed to tannins Efeito de polietilenoglicol e polivinilpirrolidona na extração e hibridização de rRNA bacteriano de células expostas a taninos

    Pedro Braga Arcuri; Michael Larry Thonney; Peter Schofield; Alice Nelson Pell

    2003-01-01

    In order to detect fluctuations in ruminal microbial populations due to forage tannins using 16S ribosomal RNA (rRNA) probes, recovery of intact rRNA is required. The objective of this work was to evaluate the effect of polyethylene glycol (PEG) and polyvinylpirrolidone (PVP) on extraction of bacterial rRNA, in the presence of tannins from tropical legume forages and other sources, that hybridize with oligonucleotide probes. Ruminococcus albus 8 cells were exposed to 8 g/L tannic acid or 1 g/...

  8. Escherichia coli cafA gene encodes a novel RNase, designated as RNase G, involved in processing of the 5' end of 16S rRNA.

    Wachi, M; Umitsuki, G; Shimizu, M; Takada, A; Nagai, K

    1999-06-01

    We found that the Escherichia coli cafA::cat mutant accumulated a precursor of 16S rRNA. This precursor migrated to the same position with 16.3S precursor found in the BUMMER strain that is known to be deficient in the 5' end processing of 16S rRNA. Accumulation of 16. 3S rRNA in the BUMMER mutant was complemented by introduction of a plasmid carrying the cafA gene. The mutant type cafA gene cloned from the BUMMER strain had a 11-bp deletion in its coding region. A small amount of the mature 16S rRNA was still formed in the cafA::cat mutant. This residual activity was found to be due to RNase E encoded by the rne/ams gene by rifampicin-chase experiments of the cafA::cat ams1 double mutant. These results indicated that the cafA gene encodes a novel RNase responsible for processing of the 5' end of 16S rRNA. PMID:10362534

  9. Sequence Characterization of Mitochondrial 12S rRNA Gene in Mouse Deer (Moschiola indica for PCR-RFLP Based Species Identification

    Chandra Mohan Siddappa

    2013-01-01

    Full Text Available Mitochondrial 12S rRNA has proven to be a useful molecular marker for better conservation and management of the endangered species. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP of the mitochondrial 12S rRNA gene has proven to be a reliable and efficient tool for the identification of different Indian deer species of family cervidae. In the present study, mitochondrial 12S rRNA gene sequence of mouse deer (Moschiola indica belonging to the family Tragulidae was characterized and analysed in silico for its use in species identification. Genomic DNA was isolated from the hair follicles and mitochondrial 12S rRNA gene was amplified using universal primers. PCR product was cloned and sequenced for the first time. The sequence of mouse deer showed 90.04, 90.08, 90.04, 91.2, 90.04, and 90.08% identities with sika deer, sambar, hog deer, musk deer, chital, and barking deer, respectively. Restriction mapping in Lasergene (DNAstar Inc., Madison, WI, USA revealed that mouse deer mitochondrial 12S rRNA gene sequence can be differentiated from the other deer species in PCR-RFLP using RsaI, DdeI, BsrI, and BstSFI. With the help of predicted pattern, mouse deer can be identified using genomic DNA from a variety of biomaterials, thereby providing molecular aid in wildlife forensics and conservation of the species.

  10. Development and evaluation of immunochromatography to detect Gram-negative bacteria producing ArmA 16S rRNA methylase responsible for aminoglycoside resistance.

    Oshiro, Satoshi; Tada, Tatsuya; Kameoka, Yousuke; Suzuki, Kazuo; Ohmagari, Norio; Miyoshi-Akiyama, Tohru; Kirikae, Teruo

    2015-11-01

    Rapid and reliable detection of aminoglycoside-resistant bacteria is an important infection-control measure and a crucial aspect of antimicrobial chemotherapy. The enzyme 16S rRNA methylase has been shown to mediate aminoglycoside resistance in bacteria. This study describes a newly developed immunochromatographic assay using novel monoclonal antibodies (mAbs) that recognize ArmA 16S rRNA methylase. Epitope mapping showed that these mAbs recognized amino acids 1-93 of ArmA, which consists of 257 amino acids. Evaluation of the assay using ArmA producing and non-producing bacterial species, as well as bacteria producing other types of 16S rRNA methylases, indicated that immunochromatographic detection of the ArmA-type 16S rRNA methylase was fully consistent with PCR analysis for armA genes, with all immunochromatographically positive strains being resistant to aminoglycosides (MIC≥128μg/mL). The detection limit of the assay was 12ng ArmA. These findings indicate that this assay can be used for the rapid and reliable detection of the production of ArmA 16S rRNA methylase by Gram-negative bacteria, including Acinetobacter baumannii and Escherichia coli. PMID:26381663

  11. Mutational analysis of the mitochondrial 12S rRNA and tRNASer(UCN) genes in Tunisian patients with nonsyndromic hearing loss

    We explored the mitochondrial 12S rRNA and the tRNASer(UCN) genes in 100 Tunisian families affected with NSHL and in 100 control individuals. We identified the mitochondrial A1555G mutation in one out of these 100 families and not in the 100 control individuals. Members of this family harbouring the A1555G mutation showed phenotypic heterogeneity which could be explained by an eventual nuclear-mitochondrial interaction. So, we have screened three nuclear genes: GJB2, GJB3, and GJB6 but we have not found correlation between the phenotypic heterogeneity and variants detected in these genes. We explored also the entire mitochondrial 12S rRNA and the tRNASer(UCN) genes. We detected five novel polymorphisms: T742C, T794A, A813G, C868T, and C954T, and 12 known polymorphisms in the mitochondrial 12S rRNA gene. None of the 100 families or the 100 controls were found to carry mutations in the tRNASer(UCN) gene. We report here First mutational screening of the mitochondrial 12S rRNA and the tRNASer(UCN) genes in the Tunisian population which describes the second family harbouring the A1555G mutation in Africa and reveals novel polymorphisms in the mitochondrial 12S rRNA gene

  12. Evaluation of 5.8S rRNA to identify Penaeus semisulcatus and its subspecies, Penaeus semisulcatus persicus (Penaeidae and some Decapoda species

    Zahra Noroozi

    2015-10-01

    Full Text Available The green tiger prawn, Penaeus semisulcatus is one of the most important members of the family Penaeidae in the Persian Gulf. Based on the morphological characteristics, two groups, including P. semisulcatus and its subspecies viz. P. s. persicus are recognized. This study was conducted to investigate the genetic distance between P. semisulcatus and P. s. persicus by analyzing partial sequence of 5.8S rRNA. Another objective of this study is to evaluate the ability of 5.8S rRNA to identify the species of Decapoda. The results indicated that the 5.8S rRNA gene of both P. semisulcatus and P. s. persicus were exactly identical, and sequence variation was not observed. The results also indicated that 5.8S rRNA sequences between species of the same genus of analysed species of Decapoda are conserved, and no genetic distance was observed in species level. The low evolutionary rate and efficient conservation of the 5.8S rRNA can be attributed to its role in the translation process.

  13. Genotypic and phenotypic diversity of Ralstonia pickettii and Ralstonia insidiosa isolates from clinical and environmental sources including High-purity Water.

    Ryan, Michael P

    2011-08-30

    Abstract Background Ralstonia pickettii is a nosocomial infectious agent and a significant industrial contaminant. It has been found in many different environments including clinical situations, soil and industrial High Purity Water. This study compares the phenotypic and genotypic diversity of a selection of strains of Ralstonia collected from a variety of sources. Results Ralstonia isolates (fifty-nine) from clinical, industrial and environmental origins were compared genotypically using i) Species-specific-PCR, ii) PCR and sequencing of the 16S-23S rRNA Interspatial region (ISR) iii) the fliC gene genes, iv) RAPD and BOX-PCR and v) phenotypically using biochemical testing. The species specific-PCR identified fifteen out of fifty-nine designated R. pickettii isolates as actually being the closely related species R. insidiosa. PCR-ribotyping of the 16S-23S rRNA ISR indicated few major differences between the isolates. Analysis of all isolates demonstrated different banding patterns for both the RAPD and BOX primers however these were found not to vary significantly. Conclusions R. pickettii species isolated from wide geographic and environmental sources appear to be reasonably homogenous based on genotypic and phenotypic characteristics. R. insidiosa can at present only be distinguished from R. pickettii using species specific PCR. R. pickettii and R. insidiosa isolates do not differ significantly phenotypically or genotypically based on environmental or geographical origin.

  14. Novel Species Including Mycobacterium fukienense sp. Is Found from Tuberc-ulosis Patients in Fujian Province, China, Using Phylogenetic Analysis of Mycobacterium chelonae/abscessus Complex

    ZHANG Yuan Yuan; LI Yan Bing; HUANG Ming Xiang; ZHAO Xiu Qin; ZHANG Li Shui; LIU Wen En; WAN Kang Lin

    2013-01-01

    Objective To identify the novel species ‘Mycobacterium fukienense’ sp. nov of Mycobacterium chelonae/abscessus complex from tuberculosis patients in Fujian Province, China. Methods Five of 27 clinical Mycobacterium isolates (Cls) were previously identified as M. chelonae/abscessus complex by sequencing the hsp65, rpoB, 16S-23S rRNA internal transcribed spacer region (its), recA and sodA house-keeping genes commonly used to describe the molecular characteristics of Mycobacterium. Clinical Mycobacterium isolates were classified according to the gene sequence using a clustering analysis program. Sequence similarity within clusters and diversity between clusters were analyzed. Results The 5 isolates were identified with distinct sequences exhibiting 99.8% homology in the hsp65 gene. However, a complete lack of homology was observed among the sequences of the rpoB, 16S-23S rRNA internal transcribed spacer region (its), sodA, and recA genes as compared with the M. abscessus. Furthermore, no match for rpoB, sodA, and recA genes was identified among the published sequences. Conclusion The novel species, Mycobacterium fukienense, is identified from tuberculosis patients in Fujian Province, China, which does not belong to any existing subspecies of M. chelonea/abscessus complex.

  15. Interordinal mammalian relationships: evidence for paenungulate monophyly is provided by complete mitochondrial 12S rRNA sequences.

    Lavergne, A; Douzery, E; Stichler, T; Catzeflis, F M; Springer, M S

    1996-10-01

    The complete mitochondrial 12S rRNA sequences of 5 placental mammals belonging to the 3 orders Sirenia, Proboscidea, and Hyracoidea are reported together with phylogenetic analyses (distance and parsimony) of a total of 51 mammalian orthologues. This 12S rRNA database now includes the 2 extant proboscideans (the African and Asiatic elephants Loxodonta africana and Elephas maximus), 2 of the 3 extant sirenian genera (the sea cow Dugong dugon and the West Indian manatee Trichechus manatus), and 2 of the 3 extant hyracoid genera (the rock and tree hyraxes Procavia capensis and Dendrohyrax dorsalis). The monophyly of the 3 orders Sirenia, Proboscidea, and Hyracoidea is supported by all kinds of analysis. There are 23 and 3 diagnostic subsitutions shared by the 2 proboscideans and the 2 hyracoids, respectively, but none by the 2 sirenians. The 2 proboscideans exhibit the fastest rates of 12S rRNA evolution among the 11 placental orders studied. Based on various taxonomic sampling methods among eutherian orders and marsupial outgroups, the most strongly supported clade in our comparisons clusters together the 3 orders Sirenia, Proboscidea, and Hyracoidea in the superorder Paenungulata. Within paenungulates, the grouping of sirenians and proboscideans within the mirorder Tethytheria is observed. This branching pattern is supported by all analyses by high bootstrap percentages (BPs) and decay indices. When only one species is selected per order or suborder, the taxonomic sampling leads to a relative variation in bootstrap support of 53% for Tethytheria (BPs ranging from 44 to 93%) and 7% for Paernungulata (92-99%). When each order or suborder is represented by two species, this relative variation decreased to 10% for Tethytheria (78-87%) and 3% for Paenungulata (96-99%). Two nearly exclusive synapomorphies for paenungulates are identified in the form of one transitional compensatory change, but none were detected for tethytherians. Such a robust and reliable resolution of

  16. Eukaryotic rRNA Modification by Yeast 5-Methylcytosine-Methyltransferases and Human Proliferation-Associated Antigen p120.

    Gabrielle Bourgeois

    Full Text Available Modified nucleotide 5-methylcytosine (m5C is frequently present in various eukaryotic RNAs, including tRNAs, rRNAs and in other non-coding RNAs, as well as in mRNAs. RNA:m5C-methyltranferases (MTases Nop2 from S. cerevisiae and human proliferation-associated nucleolar antigen p120 are both members of a protein family called Nop2/NSUN/NOL1. Protein p120 is well-known as a tumor marker which is over-expressed in various cancer tissues. Using a combination of RNA bisulfite sequencing and HPLC-MS/MS analysis, we demonstrated here that p120 displays an RNA:m5C- MTase activity, which restores m5C formation at position 2870 in domain V of 25S rRNA in a nop2Δ yeast strain. We also confirm that yeast proteins Nop2p and Rcm1p catalyze the formation of m5C in domains V and IV, respectively. In addition, we do not find any evidence of m5C residues in yeast 18S rRNA. We also performed functional complementation of Nop2-deficient yeasts by human p120 and studied the importance of different sequence and structural domains of Nop2 and p120 for yeast growth and m5C-MTase activity. Chimeric protein formed by Nop2 and p120 fragments revealed the importance of Nop2 N-terminal domain for correct protein localization and its cellular function. We also validated that the presence of Nop2, rather than the m5C modification in rRNA itself, is required for pre-rRNA processing. Our results corroborate that Nop2 belongs to the large family of pre-ribosomal proteins and possesses two related functions in pre-rRNA processing: as an essential factor for cleavages and m5C:RNA:modification. These results support the notion of quality control during ribosome synthesis by such modification enzymes.

  17. Redescriptions of three trachelocercid ciliates (Protista, Ciliophora, Karyorelictea), with notes on their phylogeny based on small subunit rRNA gene sequences.

    Yan, Ying; Xu, Yuan; Yi, Zhenzhen; Warren, Alan

    2013-09-01

    Three trachelocercid ciliates, Kovalevaia sulcata (Kovaleva, 1966) Foissner, 1997, Trachelocerca sagitta (Müller, 1786) Ehrenberg, 1840 and Trachelocerca ditis (Wright, 1982) Foissner, 1996, isolated from two coastal habitats at Qingdao, China, were investigated using live observation and silver impregnation methods. Data on their infraciliature and morphology are supplied. The small subunit rRNA (SSU rRNA) genes of K. sulcata and Trachelocerca sagitta were sequenced for the first time. Phylogenetic analyses based on SSU rRNA gene sequence data indicate that both organisms, and the previously sequenced Trachelocerca ditis, are located within the trachelocercid assemblage and that K. sulcata is sister to an unidentified taxon forming a clade that is basal to the core trachelocercids. PMID:23847285

  18. YgdE is the 2'-O-ribose methyltransferase RlmM specific for nucleotide C2498 in bacterial 23S rRNA

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M;

    2009-01-01

    The rRNAs of Escherichia coli contain four 2'-O-methylated nucleotides. Similar to other bacterial species and in contrast with Archaea and Eukaryota, the E. coli rRNA modifications are catalysed by specific methyltransferases that find their nucleotide targets without being guided by small...... ribosomes. Nucleotide C2498 is situated within a highly conserved and heavily modified rRNA sequence, and YgdE's activity is influenced by other modification enzymes that target this region. Phylogenetically, YgdE is placed in the cluster of orthologous groups COG2933 together with S...... complementary RNAs. We show here that the ygdE gene encodes the methyltransferase that catalyses 2'-O-methylation at nucleotide C2498 in the peptidyl transferase loop of E. coli 23S rRNA. Analyses of rRNAs using MALDI mass spectrometry showed that inactivation of the ygdE gene leads to loss of methylation at...

  19. The aminoglycoside resistance methyltransferase Sgm impedes RsmF methylation at an adjacent rRNA nucleotide in the ribosomal A site

    Cubrilo, Sonja; Babić, Fedora; Douthwaite, Stephen;

    2009-01-01

    methylated nucleotides including m(4)Cm1402 and m(5)C1407. Modification at m(5)C1407 by the methyltransferase RsmF is impeded as Sgm gains access to its adjacent G1405 target on the 30S ribosomal subunit. An Sgm mutant (G135A), which is impaired in S-adenosylmethionine binding and confers lower resistance......Ribosome-targeting antibiotics block protein synthesis by binding at functionally important regions of the bacterial rRNA. Resistance is often conferred by addition of a methyl group at the antibiotic binding site within an rRNA region that is already highly modified with several nucleotide...... methylations. In bacterial rRNA, each methylation requires its own specific methyltransferase enzyme, and this raises the question as to how an extra methyltransferase conferring antibiotic resistance can be accommodated and how it can gain access to its nucleotide target within a short and functionally...

  20. UV-induced modifications in the peptidyl transferase loop of 23S rRNA dependent on binding of the streptogramin B antibiotic, pristinamycin IA

    Porse, B T; Kirillov, S V; Awayez, M J;

    1999-01-01

    The naturally occurring streptogramin B antibiotic, pristinamycin IA, which inhibits peptide elongation, can produce two modifications in 23S rRNA when bound to the Escherichia coli 70S ribosome and irradiated at 365 nm. Both drug-induced effects map to highly conserved nucleotides within the...... functionally important peptidyl transferase loop of 23S rRNA at positions m2A2503/psi2504 and G2061/A2062. The modification yields are influenced strongly, and differentially, by P-site-bound tRNA and strongly by some of the peptidyl transferase antibiotics tested, with chloramphenicol producing a shift in the...... latter modification to A2062/C2063. Pristinamycin IA can also produce a modification on binding to deproteinized, mature 23S rRNA, at position U2500/C2501. The same modification occurs on an approximately 37-nt fragment, encompassing positions approximately 2496-2532 of the peptidyl transferase loop that...

  1. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

    2007-01-01

    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  2. Detection of Borrelia-specific 16S rRNA sequence in total RNA extracted from Ixodes ricinus ticks

    Ž. Radulović

    2010-08-01

    Full Text Available A reverse transcriptase - polymerase chain reaction based assay for Borrelia species detection in ticks was developed. The method was based on amplification of 552 nucleotide bases long sequence of 16S rRNA, targeted by Borrelia specific primers. In the present study, total RNA extracted from Ixodes ricinus ticks was used as template. The results showed higher sensitivity for Borrelia detection as compared to standard dark-field microscopy. Method specificity was confirmed by cloning and sequencing of obtained 552 base pairs long amplicons. Phylogenetic analysis of obtained sequences showed that they belong to B. lusitaniae and B. afzelii genospecies. RT-PCR based method presented in this paper could be very useful as a screening test for detecting pathogen presence, especially when in investigations is required extraction of total RNA from ticks.

  3. The crystal structure of Mtr4 reveals a novel arch domain required for rRNA processing

    Jackson, R.N.; Robinson, H.; Klauer, A. A.; Hintze, B. J.; van Hoof, A.; Johnson, S. J.

    2010-07-01

    The essential RNA helicase, Mtr4, performs a critical role in RNA processing and degradation as an activator of the nuclear exosome. The molecular basis for this vital function is not understood and detailed analysis is significantly limited by the lack of structural data. In this study, we present the crystal structure of Mtr4. The structure reveals a new arch-like domain that is specific to Mtr4 and Ski2 (the cytosolic homologue of Mtr4). In vivo and in vitro analyses demonstrate that the Mtr4 arch domain is required for proper 5.8S rRNA processing, and suggest that the arch functions independently of canonical helicase activity. In addition, extensive conservation along the face of the putative RNA exit site highlights a potential interface with the exosome. These studies provide a molecular framework for understanding fundamental aspects of helicase function in exosome activation, and more broadly define the molecular architecture of Ski2-like helicases.

  4. Identification of 5-hydroxycytidine at position 2501 concludes characterization of modified nucleotides in E. coli 23S rRNA

    Havelund, Jesper Foged; Giessing, Anders Michael Bernth; Hansen, Trine Møller;

    2011-01-01

    modification as 5-hydroxycytidine-a novel modification in RNA. Identification of 5-hydroxycytidine was completed by liquid chromatography under nonoxidizing conditions using a graphitized carbon stationary phase in combination with ion trap tandem mass spectrometry and by comparing the fragmentation behavior...... rRNA-has previously been characterized in the bacterium Escherichia coli. Despite a first report nearly 20 years ago, the chemical nature of the modification at position 2501 has remained elusive, and attempts to isolate it have so far been unsuccessful. We unambiguously identify this last unknown...... of the natural nucleoside with that of a chemically synthesized ditto. Furthermore, we show that 5-hydroxycytidine is also present in the equivalent position of 23S rRNA from the bacterium Deinococcus radiodurans. Given the unstable nature of 5-hydroxycytidine, this modification might be found in...

  5. Phylogenetic relationship of 16 Oedipodidae species (Insecta: Orthoptera) based on the 16S rRNA gene sequences

    HUI-MENG LU; YUAN HUANG

    2006-01-01

    The sequences of the mitochondrial 16S rRNA gene of 16 Oedipodidae species were amplified and sequenced. All sequences were aligned and analyzed and the phyloge netic relationships were inferred. The properties of 16S gene in Oedipodidae showed typical patterns of many insects such as a high A+T content and variable distance-dependent transition/transversion ratios. The 0.2 weight for sites of loops may be advisable for phylogeny reconstruction using the maximum parsimony method. The phylogenetic analysis results do not support the current subfamily classification systems of Oedipodidae. Bryodemellinae and Bryodeminae are closely related and should be merged as one subfamily. The status of Oedipodinae and Locustinae is also problematic.

  6. Intrageneric relationships of Enterococci as determined by reverse transcriptase sequencing of small-subunit rRNA.

    Williams, A M; Rodrigues, U M; Collins, M D

    1991-01-01

    The 16S ribosomal ribonucleic acid (rRNA) sequences of eleven Enterococcus species were determined by reverse transcription in an attempt to clarify their intrageneric relationships. Comparative analysis of the sequence data revealed the presence of several species groups within the genus. The species E. avium, E. malodoratus, E. pseudoavium and E. raffinosus formed a distinct group as did E. durans, E. faecium, E. hirae and E. mundtii and the pair of species E. casseliflavus and E. gallinarum. Of the remaining species, E. cecorum, E. columbae, E. faecalis and E. saccharolyticus formed distinct lines of descent within the genus, whereas E. solitarius displayed a closer affinity with Tetragenococcus halophilus than with other enterococcal species. PMID:1712504

  7. Avian malaria in captive psittacine birds: detection by microscopy and 18S rRNA gene amplification.

    Belo, N O; Passos, L F; Júnior, L M C; Goulart, C E; Sherlock, T M; Braga, E M

    2009-03-01

    A cross-sectional survey was conducted to estimate the occurrence of malaria infection among captive psittacine birds (n=127) from three zoological gardens in Brazil. Malaria infection was evaluated by the association of direct examination of blood smears with amplification of the 18SSU rRNA gene of the Plasmodium genus, demonstrating an overall occurrence of 36%. Most infected bird species were Amazona aestiva (28/73), Ara ararauna (6/10), and Amazona amazonica (3/10). The low parasitemias observed among the infected birds suggest a chronic infection. The sequence analyses of 10 isolates indicate a potential occurrence of four distinct Plasmodium lineages. These findings provide new data on malarial infection in captive psittacine birds, and emphasize the need for better control of importation and exportation of these birds. PMID:18937986

  8. Erythromycin binding is reduced in ribosomes with conformational alterations in the 23 S rRNA peptidyl transferase loop

    Douthwaite, S; Aagaard, C

    1993-01-01

    induced by mutations in the peptidyl transferase loop, and to determine how these changes affect drug interaction. Mutations at positions 2057 (G-->A) and 2058 (A-->G, or -->U), all of which confer drug resistance, induce a more open conformation in the peptidyl transferase loop. Erythromycin still...... protects against chemical modification in the mutant peptidyl transferase loops, but the affinity of the drug interaction is reduced 20-fold in the 2057A mutant, 10(3)-fold in the 2058U mutant and 10(4)-fold in the 2058G mutant. Single mutations at position 2032 in the adjacent hairpin loop, which have...... previously been shown to alter drug tolerances, gave no detectable effects on the structure of the peptidyl transferase loop or on erythromycin binding. Dual mutations at positions 2032 and 2058, however, induce a marked change in the rRNA conformation with opening of the phylogenetically conserved base...

  9. Microbial community dynamics based on 16S rRNA gene profiles in a Pacific Northwest estuary and its tributaries.

    Bernhard, Anne E; Colbert, Debbie; McManus, James; Field, Katharine G

    2005-03-01

    We analyzed bacterioplankton community structure in Tillamook Bay, Oregon and its tributaries to evaluate phylogenetic variability and its relation to changes in environmental conditions along an estuarine gradient. Using eubacterial primers, we amplified 16S rRNA genes from environmental DNA and analyzed the PCR products by length heterogeneity polymerase chain reaction (LH-PCR), which discriminates products based on naturally occurring length differences. Analysis of LH-PCR profiles by multivariate ordination methods revealed differences in community composition along the estuarine gradient that were correlated with changes in environmental variables. Microbial community differences were also detected among different rivers. Using partial 16S rRNA sequences, we identified members of dominant or unique gene fragment size classes distributed along the estuarine gradient. Gammaproteobacteria and Betaproteobacteria and members of the Bacteroidetes dominated in freshwater samples, while Alphaproteobacteria, Cyanobacteria and chloroplast genes dominated in marine samples. Changes in the microbial communities correlated most strongly with salinity and dissolved silicon, but were also strongly correlated with precipitation. We also identified specific gene fragments that were correlated with inorganic nutrients. Our data suggest that there is a significant and predictable change in microbial species composition along an estuarine gradient, shifting from a more complex community structure in freshwater habitats to a community more typical of open ocean samples in the marine-influenced sites. We also demonstrate the resolution and power of LH-PCR and multivariate analyses to provide a rapid assessment of major community shifts, and show how these shifts correlate with environmental variables. PMID:16329898

  10. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report.

    Lee, Sin Hang

    2016-01-01

    Lyme disease (LD), the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA) gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. PMID:27186082

  11. Investigation of molluscan phylogeny using large-subunit and small-subunit nuclear rRNA sequences.

    Passamaneck, Yale J; Schander, Christoffer; Halanych, Kenneth M

    2004-07-01

    The Mollusca represent one of the most morphologically diverse animal phyla, prompting a variety of hypotheses on relationships between the major lineages within the phylum based upon morphological, developmental, and paleontological data. Analyses of small-ribosomal RNA (SSU rRNA) gene sequence have provided limited resolution of higher-level relationships within the Mollusca. Recent analyses suggest large-subunit (LSU) rRNA gene sequences are useful in resolving deep-level metazoan relationships, particularly when combined with SSU sequence. To this end, LSU (approximately 3.5 kb in length) and SSU (approximately 2 kb) sequences were collected for 33 taxa representing the major lineages within the Mollusca to improve resolution of intraphyletic relationships. Although the LSU and combined LSU+SSU datasets appear to hold potential for resolving branching order within the recognized molluscan classes, low bootstrap support was found for relationships between the major lineages within the Mollusca. LSU+SSU sequences also showed significant levels of rate heterogeneity between molluscan lineages. The Polyplacophora, Gastropoda, and Cephalopoda were each recovered as monophyletic clades with the LSU+SSU dataset. While the Bivalvia were not recovered as monophyletic clade in analyses of the SSU, LSU, or LSU+SSU, the Shimodaira-Hasegawa test showed that likelihood scores for these results did not differ significantly from topologies where the Bivalvia were monophyletic. Analyses of LSU sequences strongly contradict the widely accepted Diasoma hypotheses that bivalves and scaphopods are closely related to one another. The data are consistent with recent morphological and SSU analyses suggesting scaphopods are more closely related to gastropods and cephalopods than to bivalves. The dataset also presents the first published DNA sequences from a neomeniomorph aplacophoran, a group considered critical to our understanding of the origin and early radiation of the Mollusca

  12. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report

    Lee, Sin Hang

    2016-01-01

    Lyme disease (LD), the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA) gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. PMID:27186082

  13. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.

    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina

    2016-05-15

    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis. PMID:27084467

  14. Influence of DNA extraction on oral microbial profiles obtained via 16S rRNA gene sequencing

    Loreto Abusleme

    2014-04-01

    Full Text Available Background and objective: The advent of next-generation sequencing has significantly facilitated characterization of the oral microbiome. Despite great efforts in streamlining the processes of sequencing and data curation, upstream steps required for amplicon library generation could still influence 16S rRNA gene-based microbial profiles. Among upstream processes, DNA extraction is a critical step that could represent a great source of bias. Accounting for bias introduced by extraction procedures is important when comparing studies that use different methods. Identifying the method that best portrays communities is also desirable. Accordingly, the aim of this study was to evaluate bias introduced by different DNA extraction procedures on oral microbiome profiles. Design: Four DNA extraction methods were tested on mock communities consisting of seven representative oral bacteria. Additionally, supragingival plaque samples were collected from seven individuals and divided equally to test two commonly used DNA extraction procedures. Amplicon libraries of the 16S rRNA gene were generated and sequenced via 454-pyrosequencing. Results: Evaluation of mock communities revealed that DNA yield and bacterial species representation varied with DNA extraction methods. Despite producing the lowest yield of DNA, a method that included bead beating was the only protocol capable of detecting all seven species in the mock community. Comparison of the performance of two commonly used methods (crude lysis and a chemical/enzymatic lysis+column-based DNA isolation on plaque samples showed no effect of extraction protocols on taxa prevalence but global community structure and relative abundance of individual taxa were affected. At the phylum level, the latter method improved the recovery of Actinobacteria, Bacteroidetes, and Spirochaetes over crude lysis. Conclusion: DNA extraction distorts microbial profiles in simulated and clinical oral samples, reinforcing the

  15. Variability in abundance of the Bacterial and Archaeal 16S rRNA and amoA genes in water columns of northern South China Sea

    Liu, H.; Yang, C.; Chen, S.; Xie, W.; Wang, P.; Zhang, C. L.

    2014-12-01

    Recent advances in marine microbial ecology have shown that ammonia-oxidizing Archaea (AOA) are more abundant than ammonia-oxidizing bacteria (AOB), although total Bacteria are more abundant than total Archaea in marine environments. This study aimed to examine the spatial distribution and abundance of planktonic archaeal and bacterial 16S rRNA- and amoA genes in the northern South China Sea. Water samples were collected at different depths at six stations (maximum depth ranging from 1800 m to 3200 m)with four stations (B2, B3, B6, B7) located along a transect from the northeastern continental slope to the Bashi Strait and the other two (D3, D5) located southwest of this transect. Quantitative PCR of the 16S rRNA- and amoA genes was used to estimate the abundances of total Archaea, total Bacteria, and AOA and AOB, respectively. At the B series stations, the abundance of bacterial 16S rRNA gene was twofold to 36fold higher than that of the archaeal 16S rRNA gene while fivefold lower to sixfold higher at the two D stations, with both genes showing peak values slightly below sea surface (5-75 m depths) at all stations. The archaeal amoA gene had similar variations with the archaeal 16S rRNA gene, but was 1-4 orders of magnitude lower than the archaeal 16S rRNA gene at all stations. Bacterial amoA gene was below the detection at all stations. Our results also show the difference in depth profiles among these stations, which may be caused by the difference in water movement between these regions. The non-detection of bacterial amoA gene indicates that ammonia-oxidizing Archaea are the dominant group of microorganisms in nitrification of the South China Sea, which is consistent with observations in other oceans.

  16. Diversity, Dynamics and Activity of Bacterial Communities during Production of an Artisanal Sicilian Cheese as Evaluated by 16S rRNA Analysis

    Randazzo, C.L.; Torriani, S.; Akkermans, A.D.L.; Vos, de, R.; Vaughan, E E

    2002-01-01

    The diversity and dynamics of the microbial communities during the manufacturing of Ragusano cheese, an artisanal cheese produced in Sicily (Italy), were investigated by a combination of classical and culture-independent approaches. The latter included PCR, reverse transcriptase-PCR (RT-PCR), and denaturing gradient gel electrophoresis (DGGE) of 16S rRNA genes (rDNA). Bacterial and Lactobacillus group-specific primers were used to amplify the V6 to V8 and V1 to V3 regions of the 16S rRNA gene...

  17. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan

    Martínez, Allyson K.; GORDON, EMILY; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M.; Benedik, Michael J.; Yanofsky, Charles; Mankin, Alexander S.; Vazquez-Laslop, Nora; Sachs, Matthew S.; Cruz-Vera, Luis R.

    2013-01-01

    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome’s ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the con...

  18. Direct 16S rRNA Gene Sequencing from Clinical Specimens, with Special Focus on Polybacterial Samples and Interpretation of Mixed DNA Chromatograms ▿

    Kommedal, Øyvind; Kvello, Kristine; Skjåstad, Rune; Langeland, Nina; Wiker, Harald G.

    2009-01-01

    RipSeq (iSentio, Bergen, Norway) is a web-based application for the analysis of mixed DNA chromatograms. It opens the possibility to analyze chromatograms obtained by direct 16S rRNA gene sequencing from polybacterial human clinical samples. In this study, we used direct 16S rRNA gene sequencing to investigate 264 samples from a wide range of suspected human bacterial infections. The sequence-based identification was compared with the results from routine culture-based identification. A total...

  19. Translation by ribosome shunting on adenovirus and hsp70 mRNAs facilitated by complementarity to 18S rRNA

    Yueh, Andrew; Schneider, Robert J.

    2000-01-01

    Translation initiation on eukaryotic mRNAs involves 40S ribosome association with mRNA caps (m7GpppN), mediated by initiation factor eIF4F. 40S eukaryotic ribosomes and initiation factors undergo 5′ scanning to the initiation codon, with no known role for complementarity between eukaryotic 18S rRNA and the 5′ noncoding region of mRNAs. We demonstrate that the 5′ noncoding region of human adenovirus late mRNAs, known as the tripartite leader, utilizes a striking complementarity to 18S rRNA to ...

  20. Interconversion of active and inactive 30 S ribosomal subunits is accompanied by a conformational change in the decoding region of 16 S rRNA

    Moazed, D; Van Stolk, B J; Douthwaite, S;

    1986-01-01

    Zamir, Elson and their co-workers have shown that 30 S ribosomal subunits are reversibly inactivated by depletion of monovalent or divalent cations. We have re-investigated the conformation of 16 S rRNA in the active and inactive forms of the 30 S subunit, using a strategy that is designed......' regions of 16 S rRNA. The inactive form also shows significantly decreased reactivity at positions 1533 to 1538 (the Shine-Dalgarno region), in agreement with earlier findings. The principal changes in reactivity involve the universally conserved nucleotides G926, C1395, A1398 and G1401. The three purines...

  1. Composition of fecal microbiota of laboratory mice derived from Japanese commercial breeders using 16S rRNA gene clone libraries

    NOZU, Ryoko; UENO, Masami; HAYASHIMOTO, Nobuhito

    2016-01-01

    The fecal microbiota of six mice derived from three Japanese commercial breeders was analyzed by using 16S rRNA gene clone libraries to construct a database for analyzing the gut microbiota of laboratory mice. The 566 clones were obtained from the clone libraries generated from the fecal DNA samples derived from BALB/c, C57BL/6N, DBA/2 and ICR mice. Among these 566 clones, there were 446 unique 16S rRNA gene sequences. When grouped at the 98% similarity level, the 446 unique sequences consisted of 103 Clostridiales, 43 Bacteroidales, 5 Lactobacillus and 3 Erysipelotricaceae, as well as sequences from 11 other phyla. PMID:26902692

  2. Comparative Analysis of 16S rRNA and amoA Genes from Archaea Selected with Organic and Inorganic Amendments in Enrichment Culture

    Xu, Mouzhong; Schnorr, Jon; Keibler, Brandon; Holly M Simon

    2012-01-01

    We took advantage of a plant-root enrichment culture system to characterize mesophilic soil archaea selected through the use of organic and inorganic amendments. Comparative analysis of 16S rRNA and amoA genes indicated that specific archaeal clades were selected under different conditions. Three amoA sequence clades were identified, while for a fourth group, identified by 16S rRNA gene analysis alone and referred to as the “root” clade, we detected no corresponding amoA gene. The amoA-contai...

  3. Frequency and spectrum of mitochondrial 12S rRNA variants in 440 Han Chinese hearing impaired pediatric subjects from two otology clinics

    Zhou Jianjin

    2011-01-01

    Full Text Available Abstract Background Aminoglycoside ototoxicity is one of the common health problems. Mitochondrial 12S rRNA mutations are one of the important causes of aminoglycoside ototoxicity. However, the incidences of 12S rRNA mutations associated with aminoglycoside ototoxicity are less known. Methods A total of 440 Chinese pediatric hearing-impaired subjects were recruited from two otology clinics in the Ningbo and Wenzhou cities of Zhejiang Province, China. These subjects underwent clinical, genetic evaluation and molecular analysis of mitochondrial 12S rRNA. Resultant mtDNA variants were evaluated by structural and phylogenetic analysis. Results The study samples consisted of 227 males and 213 females. The age of all participants ranged from 1 years old to 18 years, with the median age of 9 years. Ninety-eight subjects (58 males and 40 females had a history of exposure to aminoglycosides, accounting for 22.3% cases of hearing loss in this cohort. Molecular analysis of 12S rRNA gene identified 41 (39 known and 2 novel variants. The incidences of the known deafness-associated 1555A > G, 1494C > T and 1095T > C mutations were 7.5%, 0.45% and 0.91% in this entire hearing-impaired subjects, respectively, and 21.4%, 2% and 2% among 98 subjects with aminoglycoside ototoxicity, respectively. The structural and phylogenetic evaluations showed that a novel 747A > G variant and known 839A > G, 1027A > G, 1310C > T and 1413T > C variants conferred increased sensitivity to aminoglycosides or nonsyndromic deafness as they were absent in 449 Chinese controls and localized at highly conserved nucleotides of this rRNA. However, other variants were polymorphisms. Of 44 subjects carrying one of definite or putative deafness-related 12S rRNA variants, only one subject carrying the 1413T > C variant harbored the 235DelC/299DelAT mutations in the GJB2 gene, while none of mutations in GJB2 gene was detected in other 43 subjects. Conclusions Mutations in mitochondrial 12S rRNA

  4. Molecular analysis of the rRNA genes of Babesia spp and Ehrlichia canis detected in dogs from RibeirÃo Preto, Brazil

    de Oliveira, L. P.; Cardozo, G.P.; E.V. Santos; Mansur, M.A.B.; I.A.N. Donini; Zissou, V.G.; P.G. Roberto; M. Marins

    2009-01-01

    The partial DNA sequences of the 18S rRNA gene of Babesia canis and the 16S rRNA gene of Ehrlichia canis detected in dogs from Ribeirão Preto, Brazil, were compared to sequences from other strains deposited in GenBank. The E. canis strain circulating in Ribeirão Preto is identical to other strains previously detected in the region, whereas the subspecies Babesia canis vogeli is the main Babesia strain circulating in dogs from Ribeirão Preto.As sequências parciais dos genes RNAr 18S de Babesia...

  5. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A

    2013-01-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show – using proteomic analysis and dual fluorescence reporter in vivo assays – that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requi...

  6. Phylogenetic analysis of ten species of five genera of Buccinidae from the Chinese coast based on 28S rRNA gene

    DONG Chang-Yong; Hou, Lin; Sui, Na; Zhang, Yun; WANG Ming-Chang; Li, Yan

    2008-01-01

    It has been reported that there are 31 species in 13 genera of the family Buccinidae, distributed along the Chinese coast, but their taxonomic status is still controversial. In the present paper, phylogenetic relationships among ten species in five genera of Buccinidae from the Liaoning, Shandong and Fujian coast and ten species in five genus from the Chinese coast were examined using partial large ribosome subunit 28S rRNA sequences. An approximate 1400 bp fragment of the 28 rRNA gene was o...

  7. Diversity and distribution of 16S rRNA and phenol monooxygenase genes in the rhizosphere and endophytic bacteria isolated from PAH-contaminated sites

    Anping Peng; Juan Liu; Wanting Ling; Zeyou Chen; Yanzheng Gao

    2015-01-01

    This is the first investigation of the diversity and distribution of 16S rRNA and phenol monooxygenase (PHE) genes in endophytic and rhizosphere bacteria of plants at sites contaminated with different levels of PAHs. Ten PAHs at concentrations from 34.22 to 55.29 and 45.79 to 97.81 mg·kg−1 were measured in rhizosphere soils of Alopecurus aequalis Sobol and Oxalis corniculata L., respectively. The diversity of 16S rRNA and PHE genes in rhizosphere soils or plants changed with varying PAH pollu...

  8. Prevalence of A2143G mutation of H. pylori-23S rRNA in Chinese subjects with and without clarithromycin use history

    Ma Junling; Feng Guoshuang; Gu Liankun; Zhou Jing; Zhang Baozhen; Li Qiang; Shen Lin; Zhang Lian; Shen Jing; Liu Zhuoqi; You Wei-Cheng; Deng Dajun

    2008-01-01

    Abstract Background A2143G mutation of 23S rRNA gene of H. pylori results in clarithromycin (CLR) resistance. To investigate the prevalence of the CLR resistance-related A2143G mutation of the H. pylori-specific 23S rRNA gene in Chinese subjects with and without CLR use history, 307 subjects received the treatment with amoxicillin and omeprazole (OA) and 310 subjects received a placebo in 1995, and 153 subjects received a triple therapy with OA and CLR (OAC) in 2000. DNA was extracted from fa...

  9. Estimation of Pig Fecal Contamination in a River Catchment by Real-Time PCR Using Two Pig-Specific Bacteroidales 16S rRNA Genetic Markers▿

    Mieszkin, Sophie; Furet, Jean-Pierre; Corthier, Gérard; Gourmelon, Michèle

    2009-01-01

    The microbiological quality of coastal or river water can be affected by fecal contamination from human or animal sources. To discriminate pig fecal pollution from other pollution, a library-independent microbial source tracking method targeting Bacteroidales host-specific 16S rRNA gene markers by real-time PCR was designed. Two pig-specific Bacteroidales markers (Pig-1-Bac and Pig-2-Bac) were designed using 16S rRNA gene Bacteroidales clone libraries from pig feces and slurry. For these two ...

  10. Analysis of a new strain of Euphorbia mosaic virus with distinct replication specificity unveils a lineage of begomoviruses with short Rep sequences in the DNA-B intergenic region

    Argüello-Astorga Gerardo R

    2010-10-01

    Full Text Available Abstract Background Euphorbia mosaic virus (EuMV is a member of the SLCV clade, a lineage of New World begomoviruses that display distinctive features in their replication-associated protein (Rep and virion-strand replication origin. The first entirely characterized EuMV isolate is native from Yucatan Peninsula, Mexico; subsequently, EuMV was detected in weeds and pepper plants from another region of Mexico, and partial DNA-A sequences revealed significant differences in their putative replication specificity determinants with respect to EuMV-YP. This study was aimed to investigate the replication compatibility between two EuMV isolates from the same country. Results A new isolate of EuMV was obtained from pepper plants collected at Jalisco, Mexico. Full-length clones of both genomic components of EuMV-Jal were biolistically inoculated into plants of three different species, which developed symptoms indistinguishable from those induced by EuMV-YP. Pseudorecombination experiments with EuMV-Jal and EuMV-YP genomic components demonstrated that these viruses do not form infectious reassortants in Nicotiana benthamiana, presumably because of Rep-iteron incompatibility. Sequence analysis of the EuMV-Jal DNA-B intergenic region (IR led to the unexpected discovery of a 35-nt-long sequence that is identical to a segment of the rep gene in the cognate viral DNA-A. Similar short rep sequences ranging from 35- to 51-nt in length were identified in all EuMV isolates and in three distinct viruses from South America related to EuMV. These short rep sequences in the DNA-B IR are positioned downstream to a ~160-nt non-coding domain highly similar to the CP promoter of begomoviruses belonging to the SLCV clade. Conclusions EuMV strains are not compatible in replication, indicating that this begomovirus species probably is not a replicating lineage in nature. The genomic analysis of EuMV-Jal led to the discovery of a subgroup of SLCV clade viruses that contain in

  11. Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

    Wolff Sönksen, Ute; Christensen, Jens Jørgen; Nielsen, Lisbeth;

    2010-01-01

    Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic...

  12. True microbiota involved in chronic lung infection of cystic fibrosis patients found by culturing and 16S rRNA gene analysis

    Rudkjøbing, Vibeke Børsholt; Thomsen, Trine R; Alhede, Morten; Kragh, Kasper N; Nielsen, Per H; Johansen, Ulla; Givskov, Michael; Høiby, Niels; Bjarnsholt, Thomas

    2011-01-01

    Patients suffering from cystic fibrosis (CF) develop chronic lung infection. In this study, we investigated the microorganisms present in transplanted CF lungs (n = 5) by standard culturing and 16S rRNA gene analysis. A correspondence between culturing and the molecular methods was observed. In c...

  13. Macrolide-ketolide inhibition of MLS-resistant ribosomes is improved by alternative drug interaction with domain II of 23S rRNA

    Douthwaite, S; Hansen, L H; Mauvais, P

    2000-01-01

    The macrolide antibiotic erythromycin and its 6-O-methyl derivative (clarithromycin) bind to bacterial ribosomes primarily through interactions with nucleotides in domains II and V of 23S rRNA. The domain II interaction occurs between nucleotide A752 and the macrolide 3-cladinose moiety. Removal ...

  14. [Transport of newly synthesized rRNA from the nucleus to the cytoplasm in freely suspended cells of parsley (Petroselinum sativum)].

    Seitz, U; Seitz, U

    1972-06-01

    A rapidly labelled rRNA precursor can be detected in callus cells of Petroselinum sativum grown on a liquid synthetic medium. Its molecular weight has been calculated to be 2.3×10(6). This value agrees with that of the rRNA precursor from other plant material. In order to follow the synthesis and processing of rRNA in time and to correlate single steps in this process with cell organelles it was necessary to obtain pure fractions of nuclei and ribosomes. The isolation method for nuclei is given in detail. The nucleic acids are separated on polyacrylamide gels of low acrylamide concentration. Pulse-chase experiments show that the rRNA precursor is split into two fragments within the nucleus: an 18S and a 25S component. The 18S RNA leaves the nucleus rapidly. It is already found quantitatively in the ribosomal fraction after 30-60 min chase. At that time the 25S RNA is still within the nucleus; it appears much later in the ribosomes. Since the increase in ribosomal label occurs simultaneously with the decrease in nuclear label, it is concluded that there is no degradation of 18S RNA within the nucleus. Apparently there are two distinct transport mechanisms with different kinetics for the two RNA components. PMID:24477955

  15. Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

    Dam, M; Douthwaite, S; Tenson, T;

    1996-01-01

    Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247....... This is close to a short open reading frame in the 23 S rRNA that encodes a pentapeptide (E-peptide) whose expression in vivo renders cells resistant to erythromycin. Therefore, a possible mechanism of resistance caused by domain II mutations may be related to an increased expression of the E-peptide. To test...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore...

  16. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

    The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

  17. Simultaneous pyrosequencing of the 16S rRNA, IncP-1 trfA, and merA genes

    Holmsgaard, Peter N.; Sørensen, Søren J.; Hansen, Lars Hestbjerg

    2013-01-01

    The use of amplicon pyrosequencing makes it possible to produce thousands of sequences of the same gene at relatively low costs. Here we show that it is possible to simultaneously sequence the 16S rRNA gene, IncP-1 trfA gene and mercury reductase gene (merA) as a way for screening the diversity of...

  18. A single mutation in the 15S rRNA gene confers nonsense suppressor activity and interacts with mRF1 the release factor in yeast mitochondria

    Ali Gargouri

    2015-08-01

    Full Text Available We have determined the nucleotide sequence of the mim3-1 mitochondrial ribosomal suppressor, acting on ochre mitochondrial mutations and one frameshift mutation in Saccharomyces cerevisiae. The 15s rRNA suppressor gene contains a G633 to C transversion. Yeast mitochondrial G633 corresponds to G517 of the E.coli 15S rRNA, which is occupied by an invariant G in all known small rRNA sequences. Interestingly, this mutation has occurred at the same position as the known MSU1 mitochondrial suppressor which changes G633 to A. The suppressor mutation lies in a highly conserved region of the rRNA, known in E.coli as the 530-loop, interacting with the S4, S5 and S12 ribosomal proteins. We also show an interesting interaction between the mitochondrial mim3-1 and the nuclear nam3-1 suppressors, both of which have the same action spectrum on mitochondrial mutations: nam3-1 abolishes the suppressor effect when present with mim3-1 in the same haploid cell. We discuss these results in the light of the nature of Nam3, identified by [1] as the yeast mitochondrial translation release factor. A hypothetical mechanism of suppression by "ribosome shifting" is also discussed in view of the nature of mutations suppressed and not suppressed.

  19. Deletion analysis of the expression of rRNA genes and associated tRNA genes carried by a lambda transducing bacteriophage

    Transducing phage lambda ilv5 carries genes for rRNA's, spacer tRNA's (tRNA1/sup Ile/ and tRNA/sub 1B//sup Ala/), and two other tRNA's (tRNA1/sup Asp/ and tRNA/sup Trp/). We have isolated a mutant of lambda ilv5, lambda ilv5su7, which carries an amber suppressor mutation in the tRNA/sup Trp/ gene. A series of deletion mutants were isolated from the lambda ilv5su7 phage. Genetic and biochemical analyses of these deletion mutants have confirmed our previous conclusion that the genes for tRNA1/sup Asp/ and tRNA/sup Trp/ located at the distal end of the rRNA operon (rrnC) are cotranscribed with other rRNA genes in that operon. In addition, these deletions were used to define roughly the physical location of the promoter(s) of the rRNA operon carried by the lambda ilv5su7 transducing phage

  20. High Prevalence of Metallo-β-Lactamase and 16S rRNA Methylase Coproduction among Imipenem-Resistant Pseudomonas aeruginosa Isolates in Brazil▿

    Doi, Yohei; Ghilardi, Angela C. R.; Adams, Jennifer; de Oliveira Garcia, Doroti; Paterson, David L.

    2007-01-01

    Rates of metallo-β-lactamase and 16S rRNA methylase production were investigated in 51 imipenem-resistant Pseudomonas aeruginosa clinical isolates collected from hospitals in São Paulo, Brazil. Of them, 57% and 75% produced SPM-1 and RmtD, respectively. Of note, 51% produced both enzymes, suggesting that their coproduction is already common in this geographic area.

  1. Identification of Bacterial Species Associated with the Sheep Scab Mite (Psoroptes ovis) by Using Amplified Genes Coding for 16S rRNA

    Hogg, J.C.; Lehane, M. J.

    1999-01-01

    This was the first molecular study of the bacterial flora of the sheep scab mite (Psoroptes ovis). A sequence analysis of genes coding for 16S rRNA revealed that Serratia marcescens and bacteria closely related to Staphylococcus intermedius or Staphylococcus chromogens and Alloiococcus otitidis were present. These bacteria were associated with skin lesions, dermatitis, and otitis media caused by P. ovis.

  2. Comparison of Gull Feces-specific Assays Targeting the 16S rRNA Gene of Catellicoccus Marimammalium and Streptococcus spp.

    Two novel gull-specific qPCR assays were developed using 16S rRNA gene sequences from gull fecal clone libraries: a SYBR-green-based assay targeting Streptococcus spp. (i.e., gull3) and a TaqMan qPCR assay targeting Catellicoccus marimammalium (i.e., gull4). The main objectives ...

  3. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    Karminska, K. H.; Purta, E.; Hansen, L .H.; Bujnicki, J. M.; Vester, B.; Long, Katherine

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...

  4. Acquired macrolide resistance in the human intestinal strain Lactobacillus rhamnosus E41 associated with a transition mutation in 23S rRNA genes

    Flórez García, Ana Belén; Ladero Losada, Víctor Manuel; Álvarez Martín, Pablo; Ammor, Mohammed Salim; Álvarez González, Miguel Ángel; Mayo Pérez, Baltasar

    2007-01-01

    Restriction fragment length polymorphism and DNA sequencing of polymerase chain reaction (PCR) products showed that a Lactobacillus rhamnosus strain of human origin resistant to macrolides, from which no resistance determinants have been detected by specific PCR and microarray screening, contained a heterozygous A → G transition mutation at position 2058 (Escherichia coli numbering) of its 23S rRNA genes.

  5. Evolutionary relationships of Spirurina (Nematoda: Chromadorea: Rhabditida) with special emphasis on dracunculoid nematodes inferred from SSU rRNA gene sequences

    Wijová, Martina; Moravec, František; Horák, Aleš; Lukeš, Julius

    2006-01-01

    Roč. 36, č. 9 (2006), s. 1067-1075. ISSN 0020-7519 R&D Projects: GA ČR(CZ) GA524/06/0170 Institutional research plan: CEZ:AV0Z60220518 Keywords : Nematoda * Spirurina * SSU rRNA gene sequences Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 3.337, year: 2006

  6. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing

    Mehetre, Gajanan T.; Paranjpe, Aditi; Dastager, Syed G.; Dharne, Mahesh S.

    2016-01-01

    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche.

  7. Profiling of 2'-O-Me in human rRNA reveals a subset of fractionally modified positions and provides evidence for ribosome heterogeneity

    Krogh, Nicolai; Jansson, Martin D; Häfner, Sophia J; Tehler, Disa; Birkedal, Ulf; Christensen-Dalsgaard, Mikkel; Lund, Anders H; Nielsen, Henrik

    2016-01-01

    the level of RNA modifications. A comparison to HCT116 cells reveals similar 2'-O-Me profiles with distinct differences at several sites. This study constitutes the first comprehensive mapping of 2'-O-Me sites in human rRNA using a high throughput sequencing approach. It establishes the existence of a...

  8. Prevalence of 16S rRNA methylase, modifying enzyme, and extended-spectrum beta-lactamase genes among Acinetobacter baumannii isolates.

    Liu, Zhenru; Ling, Baodong; Zhou, Liming

    2015-08-01

    Multidrug-resistant Acinetobacter baumannii has become a worldwide problem, and methylation of 16S rRNA has recently emerged as a new mechanism of resistance to aminoglycosides, which is mediated by a newly recognized group of 16S rRNA methylases. 16S rRNA methylase confers a high-level resistance to all 4,6-substituted deoxystreptamine aminoglycosides that are currently used in clinical practice. Some of the A. baumannii isolates have been found to coproduce extended-spectrum beta-lactamases (ESBLs), contributing to their multidrug resistance. The aim of this study was to detect the determinants of the 16S rRNA methylase genes armA, rmtA, rmtB, rmtC, rmtD, rmtE, and npmA, the modifying enzyme genes aac(6')-Ib, ant(3″)-Ia, aph(3')-I, and the extended-spectrum beta-lactamase genes bla(TEM), bla(SHV), and bla(CTX-M-3) among A. baumannii isolates in northeastern Sichuan, China. Minimum inhibitory concentrations (MICs) of 21 different antimicrobial agents against the A. baumannii isolates were determined. The clinical isolates showed a high level of resistance (MIC≧256 μg/ml) to aminoglycosides, which ranged from 50·1 to 83·8%. The resistances to meropenem and imipenem, two of the beta-lactam antibiotics and the most active antibiotics against A. baumannii, were 9·1 and 8·2%, respectively. Among 60 amikacin-resistant isolates, only the 16S rRNA methylase gene armA was found to be prevalent (66·7%), but the other 16S rRNA methylase genes rmtA, rmtB, rmtC, rmtD, rmtE, and npmA were not detected. The prevalences of the modifying enzyme genes aac (6')-Ib, ant (3″)-Ia, and aph (3')-I were 51·7, 81·7, and 58·3%, respectively, which are different from a previous study in which the occurrences of these genes were 3, 64, and 72%, respectively. Among the 40 isolates that were armA-positive, the prevalences of bla(TEM), bla(SHV), and bla(CTX-M-3) genes were detected for the first time in China, and their occurrences were 45, 65, and 52·5%, respectively. In all, A

  9. Discrimination of bacillus anthracis and closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microarray.

    Bavykin, S. G.; Mikhailovich, V. M.; Zakharyev, V. M.; Lysov, Y. P.; Kelly, J. J.; Alferov, O. S.; Jackman, J.; Stahl, D. A.; Mirzabekov, A. D.; Gavin, I. M.; Kukhtin, A. V.; Chandler, D. (Biochip Technology Center); (Engelhardt Inst. of Molecular Biology); (Northwestern Univ.); (Georgetown Univ.)

    2008-01-30

    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 min. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead reflect

  10. Methanosarcina acetivorans 16S rRNA and transcription factor nucleotide fluctuation with implications in exobiology and pathology

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Marchese, P.; Hiciano, O.; Yao, H.; Lieberman, D.; Cheung, T.

    2008-08-01

    Cultures of the methane-producing archaea Methanosarcina, have recently been isolated from Alaskan sediments. It has been proposed that methanogens are strong candidates for exobiological life in extreme conditions. The spatial environmental gradients, such as those associated with the polygons on Mars' surface, could have been produced by past methanogenesis activity. The 16S rRNA gene has been used routinely to classify phenotypes. Using the fractal dimension of nucleotide fluctuation, a comparative study of the 16S rRNA nucleotide fluctuation in Methanosarcina acetivorans C2A, Deinococcus radiodurans, and E. coli was conducted. The results suggest that Methanosarcina acetivorans has the lowest fractal dimension, consistent with its ancestral position in evolution. Variation in fluctuation complexity was also detected in the transcription factors. The transcription factor B (TFB) was found to have a higher fractal dimension as compared to transcription factor E (TFE), consistent with the fact that a single TFB in Methanosarcina acetivorans can code three different TATA box proteins. The average nucleotide pair-wise free energy of the DNA repair genes was found to be highest for Methanosarcina acetivorans, suggesting a relatively weak bonding, which is consistent with its low prevalence in pathology. Multitasking capacity comparison of type-I and type-II topoisomerases has been shown to correlate with fractal dimension using the methicillin-resistant strain MRSA 252. The analysis suggests that gene adaptation in a changing chemical environment can be measured in terms of bioinformatics. Given that the radiation resistant Deinococcus radiodurans is a strong candidate for an extraterrestrial origin and that the cold temperature Psychrobacter cryohalolentis K5 can function in Siberian permafrost, the fractal dimension comparison in this study suggests that a chemical resistant methanogen could exist in extremely cold conditions (such as that which existed on early

  11. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S

    2015-01-01

    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

  12. Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene.

    Yuan, Youhua; Wen, Yan; You, Yuangang; Xing, Yan; Li, Huanying; Weng, Xiaoman; Wu, Nan; Liu, Shuang; Zhang, Shanshan; Zhang, Wenhong; Zhang, Ying

    2015-01-01

    Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP) analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China. PMID:26196543

  13. Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene.

    Youhua Yuan

    Full Text Available Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China.

  14. Combined analyses of the ITS loci and the corresponding 16S rRNA genes reveal high micro- and macrodiversity of SAR11 populations in the Red Sea.

    David Kamanda Ngugi

    Full Text Available Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24 °C throughout the year, and a remarkable uniform temperature (~22 °C and salinity (~41 psu from the mixed layer (~200 m to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS region of SAR11 in different depths of the Red Sea's water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen on the population dynamics of this ubiquitous marine bacterium.

  15. Combined analyses of the ITS loci and the corresponding 16S rRNA genes reveal high micro- and macrodiversity of SAR11 populations in the Red Sea.

    Ngugi, David Kamanda

    2012-11-20

    Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24 °C throughout the year, and a remarkable uniform temperature (~22 °C) and salinity (~41 psu) from the mixed layer (~200 m) to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS) region of SAR11 in different depths of the Red Sea\\'s water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen) on the population dynamics of this ubiquitous marine bacterium.

  16. Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth

    Stern David B

    2010-09-01

    Full Text Available Abstract Background The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. Results AS5-overexpressing (AS5ox plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Conclusions Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

  17. Community analysis of chronic wound bacteria using 16S rRNA gene-based pyrosequencing: impact of diabetes and antibiotics on chronic wound microbiota.

    Lance B Price

    Full Text Available BACKGROUND: Bacterial colonization is hypothesized to play a pathogenic role in the non-healing state of chronic wounds. We characterized wound bacteria from a cohort of chronic wound patients using a 16S rRNA gene-based pyrosequencing approach and assessed the impact of diabetes and antibiotics on chronic wound microbiota. METHODOLOGY/PRINCIPAL FINDINGS: We prospectively enrolled 24 patients at a referral wound center in Baltimore, MD; sampled patients' wounds by curette; cultured samples under aerobic and anaerobic conditions; and pyrosequenced the 16S rRNA V3 hypervariable region. The 16S rRNA gene-based analyses revealed an average of 10 different bacterial families in wounds--approximately 4 times more than estimated by culture-based analyses. Fastidious anaerobic bacteria belonging to the Clostridiales family XI were among the most prevalent bacteria identified exclusively by 16S rRNA gene-based analyses. Community-scale analyses showed that wound microbiota from antibiotic treated patients were significantly different from untreated patients (p = 0.007 and were characterized by increased Pseudomonadaceae abundance. These analyses also revealed that antibiotic use was associated with decreased Streptococcaceae among diabetics and that Streptococcaceae was more abundant among diabetics as compared to non-diabetics. CONCLUSIONS/SIGNIFICANCE: The 16S rRNA gene-based analyses revealed complex bacterial communities including anaerobic bacteria that may play causative roles in the non-healing state of some chronic wounds. Our data suggest that antimicrobial therapy alters community structure--reducing some bacteria while selecting for others.

  18. Pseudomonas sp. strain CA5 (a selenite-reducing bacterium) 16S rRNA gene complete sequence. National Institute of Health, National Center for Biotechnology Information, GenBank sequence. Accession FJ422810.1.

    This study used 1321 base pair 16S rRNA gene sequence methods to confirm the phylogenetic position of a soil isolate as a bacterium belonging to the genus Pesudomonas sp. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification...

  19. Establishment of a continuous culture system for Entamoeba muris and analysis of the small subunit rRNA gene

    Kobayashi S.

    2009-06-01

    Full Text Available We established a culture system for Entamoeba muris (MG-EM-01 strain isolated from a Mongolian gerbil using a modified Balamuth’s egg yolk infusion medium supplemented with 4% adult bovine serum and Bacteroides fragilis cocultured with Escherichia coli. Further, encystation was observed in the culture medium. The morphological characteristics of E. muris are similar to those of Entamoeba coli (E. coli; moreover, the malic isoenzyme electrophoretic band, which shows species-specific electrophoretic mobility, of E. muris had almost the same mobility as that observed with the malic isoenzyme electrophorectic band of E. coli (UZG-EC-01 strain isolated from a gorilla. We determined the small subunit rRNA (SSU-rRNA gene sequence of the MG-EM-01 strain, and this sequence was observed to show 82.7% homology with that of the UZG-EC-01 strain. Further, the resultant phylogenetic tree for molecular taxonomy based on the SSU-rRNA genes of the 21 strains of the intestinal parasitic amoeba species indicated that the MG-EM-01 strain was most closely related to E. coli.

  20. Seabird and louse coevolution: complex histories revealed by 12S rRNA sequences and reconciliation analyses.

    Paterson, A M; Wallis, G P; Wallis, L J; Gray, R D

    2000-09-01

    We investigated the coevolutionary history of seabirds (orders Procellariiformes and Sphenisciformes) and their lice (order Phthiraptera). Independent trees were produced for the seabirds (tree derived from 12S ribosomal RNA, isoenzyme, and behavioral data) and their lice (trees derived from 12S rRNA data). Brook's parsimony analysis (BPA) supported a general history of cospeciation (consistency index = 0.84, retention index = 0.81). We inferred that the homoplasy in the BPA was caused by one intrahost speciation, one potential host-switching, and eight or nine sorting events. Using reconciliation analysis, we quantified the cost of fitting the louse tree onto the seabird tree. The reconciled trees postulated one host-switching, nine cospeciation, three or four intrahost speciation, and 11 to 14 sorting events. The number of cospeciation events was significantly more than would be expected from chance alone (P seabirds and lice. Neither data set displayed significant rate heterogeneity. An examination of the codivergent nodes revealed that seabirds and lice have cospeciated synchronously and that lice have evolved at approximately 5.5 times the rate of seabirds. The degree of sequence divergence supported some of the postulated intrahost speciation events (e.g., Halipeurus predated the evolution of their present hosts). The sequence data also supported some of the postulated host-switching events. These results demonstrate the value of sequence data and reconciliation analyses in unraveling complex histories between hosts and their parasites. PMID:12116418

  1. First microbiota assessments of children's paddling pool waters evaluated using 16S rRNA gene-based metagenome analysis.

    Sawabe, Toko; Suda, Wataru; Ohshima, Kenshiro; Hattori, Masahira; Sawabe, Tomoo

    2016-01-01

    Insufficient chloric sterilization of children's paddling pool waters increases the risk of diarrheal illness. Therefore, we investigated the microbiota changes after children use pools. First, we applied 16S rRNA gene-based metagenome analysis to understand the dynamics of microbiota in pool water, especially with respect to the bio-contamination by potential pathogens. Proteobacteria were major taxa detected in every pool water sample after children spent time in the pool. In more detail, Gammaproteobacteria comprised the dominant class, which was followed by Betaproteobacteria. Five phyla, Bacteroidetes, Firmicutes, Actinobacteria and Deinococcus-Thermus phyla were minor groups. The pool water microbiota are likely to be a consortium of intestinal and skin microbiota from humans. Interestingly, the ratio of Gammaproteobacteria and Betaproteobacteria differed according to the age of the children who used the pool, which means the pool water was additionally contaminated by soil microbiota as a result of the children's behavior. Furthermore, potential pathogens, such as Campylobacter spp., Comamonas testosteroni and Burkholderia pseudomallei, were also found. Considering the standard plate counts, the abundances of these human pathogens are unlikely to be a sufficiently infectious dose. We suggest the importance of sanitary measures in paddling pool waters to reduce bio-contamination from both humans and the environment. PMID:26671497

  2. Identification of bovine Neospora parasites by PCR amplification and specific small-subunit rRNA sequence probe hybridization.

    Ho, M S; Barr, B C; Marsh, A E; Anderson, M L; Rowe, J D; Tarantal, A F; Hendrickx, A G; Sverlow, K; Dubey, J P; Conrad, P A

    1996-05-01

    Neospora is a newly recognized genus of pathogenic coccidia, closely related to Toxoplasma gondii, that can cause abortion or congenital disease in a variety of domestic animal hosts. On the basis of the small-subunit rRNA gene sequences of Neospora spp. and other apicomplexa coccidia, oligonucleotide primers COC-1 and COC-2 were used for PCR amplification of conserved sequences of approximately 300 bp in size. A Neospora-specific chemiluminescent probe hybridized to Southern blots of amplification products from Neospora DNA but not to Southern blots with amplified DNA from the other coccidian parasites tested. A Toxoplasma-specific probe whose sequence differed from that of the probe for Neospora spp. by a single base pair was used to distinguish these parasites by specific Southern blot hybridization. The PCR system detected as few as one Neospora tachyzoite in the culture medium or five tachyzoites in samples of whole blood or amniotic fluid spiked with Neospora parasites. In addition, Neospora PCR products were successfully amplified from whole blood and amniotic fluid samples of experimentally infected bovine and rhesus macaque fetuses. These results indicate that this PCR and probe hybridization system could be a valuable adjunct to serology and immunohistochemistry for the diagnosis of Neospora infections in bovine or primate fetuses. PMID:8727903

  3. Sequencing of 16S rRNA reveals a distinct salivary microbiome signature in Behçet's disease.

    Coit, Patrick; Mumcu, Gonca; Ture-Ozdemir, Filiz; Unal, Ali Ugur; Alpar, Ugur; Bostanci, Nagihan; Ergun, Tulin; Direskeneli, Haner; Sawalha, Amr H

    2016-08-01

    Behçet's disease (BD) is characterized by recurrent oro-genital ulcers, mucocutaneous lesions, and serious organ involvement. We investigated the salivary microbiome in BD using high-throughput sequencing of the 16S rRNA V4 region. Stimulated saliva samples were collected from 31 BD patients and 15 healthy controls, and in 9 BD patients, a second saliva sample was collected following dental and periodontal treatment. Sequence analysis identified a total of 908 operational taxonomic units (OTUs) present across all samples. Patients had a microbial community structure that is significantly less diverse than healthy controls. The most overabundant species in BD was Haemophilus parainfluenzae, while the most depleted included Alloprevotella rava and species in the genus Leptotrichia. Periodontal treatment improved oral health indices in BD but had no short-term effect on bacterial community structure. Neither the BD-associated genetic risk locus within the HLA-B/MICA region nor being on immunosuppressive medications explained the differences between patients and controls. PMID:27283393

  4. Comparison of Bacteroides-Prevotella 16S rRNA genetic markers for fecal samples from different animal species

    Fogarty, L.R.; Voytek, M.A.

    2005-01-01

    To effectively manage surface and ground waters it is necessary to improve our ability to detect and identify sources of fecal contamination. We evaluated the use of the anaerobic bacterial group Bacteroides-Prevotella as a potential fecal indicator. Terminal restriction length polymorphism (T-RFLP) of the 16S rRNA genes from this group was used to determine differences in populations and to identify any unique populations in chickens, cows, deer, dogs, geese, horses, humans, pigs, and seagulls. The group appears to be a good potential fecal indicator in all groups tested except for avians. Cluster analysis of Bacteroides-Prevotella community T-RFLP profiles indicates that Bacteroides-Prevotella populations from samples of the same host species are much more similar to each other than to samples from different source species. We were unable to identify unique peaks that were exclusive to any source species; however, for most host species, at least one T-RFLP peak was identified to be more commonly found in that species, and a combination of peaks could be used to identify the source. T-RFLP profiles obtained from water spiked with known-source feces contained the expected diagnostic peaks from the source. These results indicate that the approach of identifying Bacteroides-Prevotella molecular markers associated with host species might be useful in identifying sources of fecal contamination in the environment.

  5. Microbial succession in the traditional Chinese Luzhou-flavor liquor fermentation process as evaluated by SSU rRNA profiles.

    Xiang, Wenliang; Li, Ke; Liu, Seng; Xing, Yage; Li, Mingyuan; Che, Zhenming

    2013-03-01

    The community succession of microbes inhabited in the fermenting lees of Luzhou-flavor liquor was investigated based on small-subunit rRNA culture independent method. All sequences recovered from fermenting lees respectively fell into the genera of Lactobacillus, Streptococcus, Bacillus, Staphylococcus, Clostridium, Pelobacter, Actobacter, Serratia, Burkholderia, Rhodoccous, Corynebacterium, Arthrobacter, Microbacterium, Curtobacterium, Leptotrichia, Methanocuuleus, Saccharomyces, Zygosaccharomyces, Saccharomycopsis, Pichia, Talaromyces, Aspergillus, Eurotium, Fomitopsis and Trichosporon. The fungal Pichia, Saccharomycopsis and Talaromyces were most abundant in the lees fermented for 1 day, the fungal Eurotium and the bacteria Burkholderia, Streptococcus and Lactobacillus were dominant in the lees fermented for 7 days, only the bacteria Lactobacillus, Burkholderia were prevalent in the lees fermented for 60 days. Most genera almost existed in the fermenting lees, while their distributions were significantly different in 1, 7 and 60 days fermented lees. The prokaryotic community similarity coefficient was from 0.5000 to 0.5455 and followed to 0.1523, and that of eukaryotic community was from 0.5466 to 0.5259 and to 0.3750 when compared at species level. These results suggested that many microbes in lees have community successions associated with fermenting and that such successions maybe contribute the fermentation process of Luzhou-flavor liquor and is main reasons that the characteristic flavor factors are produced. PMID:23180546

  6. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes

    Mu Peng

    2015-09-01

    Full Text Available Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future.

  7. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes.

    Peng, Mu; Zi, Xiaoxue; Wang, Qiuyu

    2015-10-01

    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA) indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future. PMID:26404329

  8. Bacterial diversity assessment of pristine mangrove microbial community from Dhulibhashani, Sundarbans using 16S rRNA gene tag sequencing.

    Basak, Pijush; Pramanik, Arnab; Sengupta, Sohan; Nag, Sudip; Bhattacharyya, Anish; Roy, Debojyoti; Pattanayak, Rudradip; Ghosh, Abhrajyoti; Chattopadhyay, Dhrubajyoti; Bhattacharyya, Maitree

    2016-03-01

    The global knowledge of microbial diversity and function in Sundarbans ecosystem is still scarce, despite global advancement in understanding the microbial diversity. In the present study, we have analyzed the diversity and distribution of bacteria in the tropical mangrove sediments of Sundarbans using 16S rRNA gene amplicon sequencing. Metagenome is comprised of 1,53,926 sequences with 108.8 Mbp data and with 55 ± 2% G + C content. Metagenome sequence data are available at NCBI under the Bioproject database with accession no. PRJNA245459. Bacterial community metagenome sequences were analyzed by MG-RAST software representing the presence of 56,547 species belonging to 44 different phyla. The taxonomic analysis revealed the dominance of phyla Proteobacteria within our dataset. Further taxonomic analysis revealed abundance of Bacteroidetes, Acidobactreia, Firmicutes, Actinobacteria, Nitrospirae, Cyanobacteria, Planctomycetes and Fusobacteria group as the predominant bacterial assemblages in this largely pristine mangrove habitat. The distribution of different community datasets obtained from four sediment samples originated from one sampling station at two different depths providing better understanding of the sediment bacterial diversity and its relationship to the ecosystem dynamics of this pristine mangrove sediment of Dhulibhashani in, Sundarbans. PMID:26981367

  9. DEVELOPMENT OF INTERGENIC SPACERS BASED PCR ASSAY FOR DETECTION OF GIARDIALAMBLIA%犬猫贾第虫IGS序列特异性检测方法的建立

    李雅文; 刘远佳; 郑国超; 谭立娉; 胡伟; 罗琴; 林丽琴; 路鹏云; 李国清

    2013-01-01

    The intergenic spacers (IGS) were amplified in PCR from nuclear ribosomal DNAs of two Giardialamblia strains (assemble D from dog and assemble F from cat) isolated from feces of naturally infected pets in Guangzhou. The PCR products were purified, cloned and sequenced. The resulting nucleotide sequences were compared with related sequences in the GenBank databases. The IGS sequences were 1355 bp for the canine Giardia strain and 1388 bp for the feline Giardia strain. The interspecific difference in the IGS sequence might serve as a genetic marker for the identification and differentiation of Giardia lamblia. Furthermore, a PCR detection method was developed based on IGS sequence. The established PCR assay specifically amplified IGS sequence of G. lamblia but not all control parasites such as Toxocaracanis etc. The minimum detection limit of G.lamblia was 82 fg. Total 84 clinical samples were tested using this method. The positive rate of clinical samples was 3.57%, higher than 2.38%by traditional method.%应用PCR技术对广州市某宠物寄养所采集的一株D型犬源贾第虫和一株F型猫源贾第虫的核糖体IGS序列进行了扩增、克隆、测序,将测序结果与GenBank已上传的贾第虫相应序列进行比对分析,基于贾第虫IGS序列建立了具有良好特异性和敏感性的PCR检测方法,并对84份临床粪样进行了检测。结果显示,D型犬源贾第虫和F型猫源贾第虫的IGS序列长分别为1355 bp和1388 bp,贾第虫IGS序列存在多态性现象,种间差异明显,可以作为区分不同基因型的分子标记;建立的PCR方法能特异性扩增犬源贾第虫核糖体IGS序列,而犬蛔虫等对照虫体DNA均不能扩增,该方法对贾第虫DNA的最小检测量为82 fg,对84份临床粪样的检出率为3.57%,比传统镜检法高出2.38%,具有一定的临床应用价值。

  10. Enxertia intergenérica de cultivares de nespereira no porta-enxerto de marmeleiro 'japonês' Intergeneric grafting of loquat cultivars using 'Japonese' quince tree as rootstock

    Rafael Pio

    2010-12-01

    Full Text Available No Brasil, foram desenvolvidos alguns trabalhos pioneiros com a utilização do marmeleiro (Cydonia oblonga Mill. como porta-enxertos para as nespereiras (Eriobotrya japonica (Thunb. Lindl.. O sucesso da utilização dessa enxertia intergenérica está relacionado, principalmente, à redução do porte da planta. Objetivou-se, neste trabalho estudar técnicas de enxertia de cultivares de nespereiras, utilizando-se o marmeleiro 'Japonês' (Chaenomeles sinensis (Thouin Koehne como nova opção de porta-enxerto. Mudas de marmeleiro 'Japonês' com um ano de idade (altura próxima a 110 cm e diâmetro de 0,85 cm na região de enxertia, a 15 cm acima do colo, mantidos em sacos plásticos com dimensões de 18 x 30 cm (capacidade de 3 L, foram enxertados pelos métodos de borbulhia em placa e garfagem em fenda cheia, em duas diferentes épocas: outono (abril e inverno (julho. Utilizaram-se cinco cultivares de nespereira de importância econômica no Brasil: 'Mizuho', 'Néctar de Cristal' (IAC 866-7, 'Mizauto' (IAC 167-4, 'Mizumo' (IAC 1567-411 e 'Centenária' (IAC 1567-420. Pelo método de borbulhia, não houve nenhuma borbulha brotada quando esta foi realizada no outono, apenas duas borbulhas da 'Mizauto', 'Néctar de Cristal' e 'Centenária' brotaram quando esta foi realizada no inverno, no entanto, com baixo crescimento. Já, por garfagem, maiores porcentagens de brotação e crescimento dos enxertos foram obtidas quando a enxertia foi realizada no inverno, com destaque para as nespereiras 'Mizuho', 'Centenária' e 'Néctar de Cristal'.In Brazil, some pioneer studies were carried out using quince seedlings (Cydonia oblonga Mill. as rootstock for loquat (Eriobotrya japonica (Thunb. Lindl.. The main advantage of this intergeneric grafting use is plant size reduction. The success of using this intergeneric grafting is related mainly to plant size reduction. Therefore, the objective of this work was to study grafting techniques of loquat cultivars using

  11. Prevalence of A2143G mutation of H. pylori-23S rRNA in Chinese subjects with and without clarithromycin use history

    Ma Junling

    2008-05-01

    Full Text Available Abstract Background A2143G mutation of 23S rRNA gene of H. pylori results in clarithromycin (CLR resistance. To investigate the prevalence of the CLR resistance-related A2143G mutation of the H. pylori-specific 23S rRNA gene in Chinese subjects with and without CLR use history, 307 subjects received the treatment with amoxicillin and omeprazole (OA and 310 subjects received a placebo in 1995, and 153 subjects received a triple therapy with OA and CLR (OAC in 2000. DNA was extracted from fasting gastric juice at the end of the intervention trial in 2003. H. pylori infection was determined by H. pylori-specific 23S rRNA PCR, ELISA, and13C-urea breath test assays. Mutations of the 23S rRNA gene were detected by RFLP assays. Results The presence of 23S rRNA due to H. pylori infection in the OA group remained lower than that in the placebo group 7.3 yrs after OA-therapy [51.1% (157/307 vs. 83.9% (260/310, p = 0.0000]. In the OAC group, the 23S rRNA detection rate was 26.8% (41/153 three yrs after OAC-treatment. The A2143G mutation rate among the 23S rRNA-positive subjects in the OAC group [31.7% (13/41] was significantly higher than that in the OA group [10.2% (16/157] and the placebo group [13.8% (36/260]. The frequency of the AAGGG → CTTCA (2222–2226 and AACC → GAAG (2081–2084 sequence alterations in the OAC group was also significantly higher than those in the OA group and the placebo group. Conclusion Primary prevalence of the A2143G mutation was 10~14% among Chinese population without history of CLR therapy. Administration of CLR to eliminate H. pylori infection increased the prevalence of the A2143G mutation in Chinese subjects (32% significantly.

  12. Morphological characteristics and phylogenetic analyses of unusual morphospecies of Microcystis novacekii forming bloom in the Cheffia Dam (Algeria

    Noureddine BOUAÏCHA

    2009-08-01

    Full Text Available The toxicological potential and morphological characteristics and phylogenetic analysis based on the 16S rDNA sequence and the 16S-23S rDNA internal transcribed spacer (ITS were investigated in unusual morphospecies of Microcystis (MCYS-CH01 isolated from the Cheffia Dam in Algeria. The presence of microcystin synthetase genes (mcyA, -B, and -C in isolated colonies of this morphospecies, and the fact that serine/threonine phosphatase (PP2A was inhibited by its crude extract indicated that this morphospecies was microcystin-producer. The morphological features of this unusual morphospecies were very different from any of those described in the literature of all known species of Microcystis. The phylogenic tree based on 16S rDNA sequences shows that this morphospecies is indistinguishable from the reference strain Microcystis aeruginosa PCC 7806 and from many other known Microcystis species and, therefore, this tree did not necessarily correlate to the distinctions between morphospecies. However, phylogenetic analysis based on the 16S-23S rRNA spacer region could be an effective way to assign this unusual morphospecies MCYS-CH01 to the Asian species Microcystis novacekii. Comparison of the ITS sequence of this morphospecies with sequences available in the GenBank database showed that some highly conserved genotypes are found throughout the world.

  13. 23S rRNA nucleotides in the peptidyl transferase center are essential for tryptophanase operon induction.

    Yang, Rui; Cruz-Vera, Luis R; Yanofsky, Charles

    2009-06-01

    Distinct features of the ribosomal peptide exit tunnel are known to be essential for recognition of specific amino acids of a nascent peptidyl-tRNA. Thus, a tryptophan residue at position 12 of the peptidyl-tRNA TnaC-tRNA(Pro) leads to the creation of a free tryptophan binding site within the ribosome at which bound tryptophan inhibits normal ribosome functions. The ribosomal processes that are inhibited are hydrolysis of TnaC-tRNA(Pro) by release factor 2 and peptidyl transfer of TnaC of TnaC-tRNA(Pro) to puromycin. These events are normally performed in the ribosomal peptidyl transferase center. In the present study, changes of 23S rRNA nucleotides in the 2585 region of the peptidyl transferase center, G2583A and U2584C, were observed to reduce maximum induction of tna operon expression by tryptophan in vivo without affecting the concentration of tryptophan necessary to obtain 50% induction. The growth rate of strains with ribosomes with either of these changes was not altered appreciably. In vitro analyses with mutant ribosomes with these changes showed that tryptophan was not as efficient in protecting TnaC-tRNA(Pro) from puromycin action as wild-type ribosomes. However, added tryptophan did prevent sparsomycin action as it normally does with wild-type ribosomes. These findings suggest that these two mutational changes act by reducing the ability of ribosome-bound tryptophan to inhibit peptidyl transferase activity rather than by reducing the ability of the ribosome to bind tryptophan. Thus, the present study identifies specific nucleotides within the ribosomal peptidyl transferase center that appear to be essential for effective tryptophan induction of tna operon expression. PMID:19329641

  14. Combining flow cytometry and 16S rRNA gene pyrosequencing: A promising approach for drinking water monitoring and characterization

    Prest, Emmanuelle I E C

    2014-10-01

    The combination of flow cytometry (FCM) and 16S rRNA gene pyrosequencing data was investigated for the purpose of monitoring and characterizing microbial changes in drinking water distribution systems. High frequency sampling (5min intervals for 1h) was performed at the outlet of a treatment plant and at one location in the full-scale distribution network. In total, 52 bulk water samples were analysed with FCM, pyrosequencing and conventional methods (adenosine-triphosphate, ATP; heterotrophic plate count, HPC). FCM and pyrosequencing results individually showed that changes in the microbial community occurred in the water distribution system, which was not detected with conventional monitoring. FCM data showed an increase in the total bacterial cell concentrations (from 345±15×103 to 425±35×103cellsmL-1) and in the percentage of intact bacterial cells (from 39±3.5% to 53±4.4%) during water distribution. This shift was also observed in the FCM fluorescence fingerprints, which are characteristic of each water sample. A similar shift was detected in the microbial community composition as characterized with pyrosequencing, showing that FCM and genetic fingerprints are congruent. FCM and pyrosequencing data were subsequently combined for the calculation of cell concentration changes for each bacterial phylum. The results revealed an increase in cell concentrations of specific bacterial phyla (e.g., Proteobacteria), along with a decrease in other phyla (e.g., Actinobacteria), which could not be concluded from the two methods individually. The combination of FCM and pyrosequencing methods is a promising approach for future drinking water quality monitoring and for advanced studies on drinking water distribution pipeline ecology. © 2014 Elsevier Ltd.

  15. What does the 5S rRNA multigene family tell us about the origin of the annual Triticeae (Poaceae)?

    Baum, B R; Edwards, T; Johnson, D A

    2013-05-01

    We have investigated the complex relationships among the annual genera within the tribe Triticeae through phylogenetic analyses of the 5S rRNA multigene family. Cloned sequences were assigned to groups of orthologous sequences, called unit classes, that were subjected to several analyses including BLAST (Basic Local Alignment Search Tool) searches to assess possible ancestral relationships with perennial genera; phylogenetic analyses using parsimony (Pars), maximum likelihood (ML), and Bayesian methods; and minimum reticulation networks from the Pars, ML, and Bayesian trees. In this study, we included genera with both annual and perennial species, such as Dasypyrum, Hordeum, and Secale. BLAST pointed to Pseudoroegneria (carrier of the St genome) and possibly Thinopyrum (carrier of the J genome) as the potential next of kin. However, Thinopyrum and Pseudoroegneria have never fallen together on the individual trees with the former generally associated with Crithopsis, Aegilops, Triticum, and Dasypyrum, while the latter is usually associated with the rest of the genera within Triticeae. The "long" unit classes placed Dasypyrum breviaristatum together with Dasypyrum villosum, whereas the "short" unit classes put them far apart on the trees. None of the gene trees alone was able to summarize the complex relationships among the genera, in line with previous results in the Triticeae. However, the application of tools designed to display phylogenetic networks was able to depict the complex links among the genera based on the short and the long gene trees, including the close link between Thinopyrum and Pseudoroegneria suggested by the phylogenetic analyses. In addition, our analyses provide support for the hypothesis that at least some annual Triticeae taxa are derived from their perennial relatives. PMID:23789993

  16. Culture dependent bacteria in commercial fishes: Qualitative assessment and molecular identification using 16S rRNA gene sequencing

    Alikunhi, Nabeel M.

    2016-05-27

    Fish contaminations have been extensively investigated in Saudi coasts, but studies pertaining to bacterial pathogens are meager. We conducted qualitative assessment and molecular identification of culture dependent bacteria in 13 fish species collected from three fishing sites and a local fish market in Jeddah, Saudi Arabia. The bacterial counts of gills, skin, gut and muscle were examined on agar plates of Macconkey’s (Mac), Eosin methylene blue (EMB) and Thiosulfate Citrate Bile Salts (TCBS) culture media. Bacterial counts exhibited interspecific, locational and behavioral differences. Mugil cephalus exhibited higher counts on TCBS (all body-parts), Mac (gills, muscle and gut) and EMB (gills and muscle). Samples of Area I were with higher counts, concurrent to seawater and sediment samples, revealing the influence of residing environment on fish contamination. Among feeding habits, detritivorous fish harbored higher bacterial counts, while carnivorous group accounted for lesser counts. Counts were higher in skin of fish obtained from market compared to field samples, revealing market as a major source of contamination. Bacterial counts of skin were positively correlated with other body-parts indicating influence of surface bacterial biota in overall quality of fish. Hence, hygienic practices and proper storage facilities in the Jeddah fish market is recommended to prevent adverse effect of food-borne illness in consumers. Rahnella aquatilis (Enterobacteriaceae) and Photobacterium damselae (Vibrionaceae) were among the dominant species identified from fish muscle samples using Sanger sequencing of 16S rRNA. This bacterial species are established human pathogens capable of causing foodborne illness with severe antibiotic resistance. Opportunistic pathogens such as Hafnia sp. (Enterobacteriaceae) and Pseudomonas stutzeri (Pseudomonadaceae) were also identified from fish muscle. These findings indicate bacterial contamination risk in commonly consumed fish of

  17. Uncultured bacterial diversity in a seawater recirculating aquaculture system revealed by 16S rRNA gene amplicon sequencing.

    Lee, Da-Eun; Lee, Jinhwan; Kim, Young-Mog; Myeong, Jeong-In; Kim, Kyoung-Ho

    2016-04-01

    Bacterial diversity in a seawater recirculating aquaculture system (RAS) was investigated using 16S rRNA amplicon sequencing to understand the roles of bacterial communities in the system. The RAS was operated at nine different combinations of temperature (15°C, 20°C, and 25°C) and salinity (20‰, 25‰, and 32.5‰). Samples were collected from five or six RAS tanks (biofilters) for each condition. Fifty samples were analyzed. Proteobacteria and Bacteroidetes were most common (sum of both phyla: 67.2% to 99.4%) and were inversely proportional to each other. Bacteria that were present at an average of ≥ 1% included Actinobacteria (2.9%) Planctomycetes (2.0%), Nitrospirae (1.5%), and Acidobacteria (1.0%); they were preferentially present in packed bed biofilters, mesh biofilters, and maturation biofilters. The three biofilters showed higher diversity than other RAS tanks (aerated biofilters, floating bed biofilters, and fish tanks) from phylum to operational taxonomic unit (OTU) level. Samples were clustered into several groups based on the bacterial communities. Major taxonomic groups related to family Rhodobacteraceae and Flavobacteriaceae were distributed widely in the samples. Several taxonomic groups like [Saprospiraceae], Cytophagaceae, Octadecabacter, and Marivita showed a cluster-oriented distribution. Phaeobacter and Sediminicola-related reads were detected frequently and abundantly at low temperature. Nitrifying bacteria were detected frequently and abundantly in the three biofilters. Phylogenetic analysis of the nitrifying bacteria showed several similar OTUs were observed widely through the biofilters. The diverse bacterial communities and the minor taxonomic groups, except for Proteobacteria and Bacteroidetes, seemed to play important roles and seemed necessary for nitrifying activity in the RAS, especially in packed bed biofilters, mesh biofilters, and maturation biofilters. PMID:27033205

  18. Bacterial community structure in High-Arctic snow and freshwater as revealed by pyrosequencing of 16S rRNA genes and cultivation

    Møller, Annette; Søborg, Ditte Andreasen; Al-Soud, Waleed Abu;

    2013-01-01

    controlled the distribution of the Cyanobacteria and algae in the snow while carbon and nitrogen fixed by these autotrophs in turn fed the heterotrophic bacteria. In the lake, a probable lower light input relative to snow resulted in low numbers of Cyanobacteria and chloroplasts and, hence, limited input......The bacterial community structures in High-Arctic snow over sea ice and an ice-covered freshwater lake were examined by pyrosequencing of 16S rRNA genes and 16S rRNA gene sequencing of cultivated isolates. Both the pyrosequence and cultivation data indicated that the phylogenetic composition...... of the microbial assemblages was different within the snow layers and between snow and freshwater. The highest diversity was seen in snow. In the middle and top snow layers, Proteobacteria, Bacteroidetes and Cyanobacteria dominated, although Actinobacteria and Firmicutes were relatively abundant also. High numbers...

  19. Application of 16S rRNA, cytochrome b and control region sequences for understanding the phylogenetic relationships in Oryx species.

    Khan, H A; Arif, I A; Al Homaidan, A A; Al Farhan, A H

    2008-01-01

    The present study reports the application of mitochondrial markers for the molecular phylogeny of Oryx species, including the Arabian oryx (AO), scimitar-horned oryx (SHO) and plains oryx (PO), using the Addax as an outgroup. Sequences of three molecular markers, 16S rRNA, cytochrome b and a control region, for the above four taxa were aligned and the topologies of respective phylogenetic trees were compared. All these markers clearly differentiated the genus Addax from Oryx. However, for species-level grouping, while 16S rRNA and cytochrome b produced similar phylogeny (SHO grouped with PO), the control region grouped SHO with AO. Further studies are warranted to generate more sequencing data, apply multiple bioinformatics tools and to include relevant nuclear markers for phylogenetic analysis of Oryx species. PMID:19224456

  20. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    Bavykin, Sergei G.; Mirzabekov, Andrei D.

    2007-10-30

    The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  1. Phylogeny and Taxonomy of Archaea: A Comparison of the Whole-Genome-Based CVTree Approach with 16S rRNA Sequence Analysis

    Guanghong Zuo

    2015-03-01

    Full Text Available A tripartite comparison of Archaea phylogeny and taxonomy at and above the rank order is reported: (1 the whole-genome-based and alignment-free CVTree using 179 genomes; (2 the 16S rRNA analysis exemplified by the All-Species Living Tree with 366 archaeal sequences; and (3 the Second Edition of Bergey’s Manual of Systematic Bacteriology complemented by some current literature. A high degree of agreement is reached at these ranks. From the newly proposed archaeal phyla, Korarchaeota, Thaumarchaeota, Nanoarchaeota and Aigarchaeota, to the recent suggestion to divide the class Halobacteria into three orders, all gain substantial support from CVTree. In addition, the CVTree helped to determine the taxonomic position of some newly sequenced genomes without proper lineage information. A few discrepancies between the CVTree and the 16S rRNA approaches call for further investigation.

  2. The mitochondrial 16 s rRNA reveals high anthropogenic influence on land snail diversity in a preliminary island survey.

    Abu-Bakar, Siti-Balkhis; Razali, Norhanis M; Naggs, Fred; Wade, Christopher; Mohd-Nor, Siti-Azizah; Aileen-Tan, Shau-Hwai

    2014-03-01

    A total of 30 specimens belonging to five species, namely; Cryptozona siamensis, Sarika resplendens and Sarika sp. from the family Ariophantidae as well as Quantula striata and Quantula sp. from the family Dyakiidae were collected from the Langkawi Island in Northern Peninsular Malaysia. All specimens were identified through comparisons of shell morphology and amplification of a 500 bp segment of the 16S rRNA mtDNA gene. To assess phylogenetic insights, the sequences were aligned using ClustalW and phylogenetic trees were constructed. The analyses showed two major lineages in both Maximum Parsimony and Neighbour Joining phylogenetic trees. Each putative taxonomic group formed a monophyletic cluster. Our study revealed low species and intraspecies genetic diversities based on the 16S rRNA gene sequences. Thus, this study has provided an insight of land snail diversity in populations of an island highly influenced by anthropogenic activities through complementary use of shell morphological and molecular data. PMID:24443224

  3. Phylogenetic relationships of some spirurine nematodes (Nematoda: Chromadorea: Rhabditida: Spirurina) parasitic in fishes inferred from SSU rRNA gene sequences

    Černotíková, Eva; Horák, Aleš; Moravec, František

    2011-01-01

    Roč. 58, č. 2 (2011), s. 135-148. ISSN 0015-5683 R&D Projects: GA ČR(CZ) GA524/06/0170; GA MŠk LC522 Institutional research plan: CEZ:AV0Z60220518 Keywords : Nematoda * Spirurina * SSU rRNA * phylogeny * taxonomy Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 1.812, year: 2011 http://www.paru.cas.cz/folia/pdfs/showpdf.php?pdf=21981

  4. Identification of coagulase-negative staphylococci by using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and rRNA restriction patterns.

    Pennington, T H; Harker, C.; Thomson-Carter, F

    1991-01-01

    A total of 1,417 staphylococcal and micrococcal strains were collected from the beards and scalps of 10 subjects over a period of 8 months. Sixteen strains identified as Staphylococcus epidermidis with an API system had distinctive yellow colonies on nutrient agar plates and sodium dodecyl sulfate-polyacrylamide gel electrophoresis whole-cell polypeptide profiles similar to those of Staphylococcus capitis; this identification was confirmed by analysis of rRNA gene restriction patterns.

  5. Analysis of Diversity and Activity of Sulfate-Reducing Bacterial Communities in Sulfidogenic Bioreactors Using 16S rRNA and dsrB Genes as Molecular Markers▿

    Dar, Shabir A.; Yao, Li; van Dongen, Udo; Kuenen, J. Gijs; Muyzer, Gerard

    2006-01-01

    Here we describe the diversity and activity of sulfate-reducing bacteria (SRB) in sulfidogenic bioreactors by using the simultaneous analysis of PCR products obtained from DNA and RNA of the 16S rRNA and dissimilatory sulfite reductase (dsrAB) genes. We subsequently analyzed the amplified gene fragments by using denaturing gradient gel electrophoresis (DGGE). We observed fewer bands in the RNA-based DGGE profiles than in the DNA-based profiles, indicating marked differences in the populations...

  6. Sensitive PCR diagnosis of Infections by Enterocytozoon bieneusi (microsporidia) using primers based on the region coding for small-subunit rRNA.

    DA SILVA, A. J.; Schwartz, D A; Visvesvara, G S; De Moura, H; Slemenda, S B; Pieniazek, N J

    1996-01-01

    Enterocytozoon bieneusi is the most common microsporidian infecting patients with AIDS. We have developed a PCR primer pair, named EBIEF1/EBIER1, based on the small-subunit rRNA sequence of this microsporidian. Compared with other PCR-based methods, this primer pair shows a higher efficiency of detection in diagnostic applications than does another previously described primer pair, V1/EB450.

  7. 16S rRNA Gene Sequence-Based Identification of Bacteria in Automatically Incubated Blood Culture Materials from Tropical Sub-Saharan Africa.

    Hagen Frickmann

    Full Text Available The quality of microbiological diagnostic procedures depends on pre-analytic conditions. We compared the results of 16S rRNA gene PCR and sequencing from automatically incubated blood culture materials from tropical Ghana with the results of cultural growth after automated incubation.Real-time 16S rRNA gene PCR and subsequent sequencing were applied to 1500 retained blood culture samples of Ghanaian patients admitted to a hospital with an unknown febrile illness after enrichment by automated culture.Out of all 1500 samples, 191 were culture-positive and 98 isolates were considered etiologically relevant. Out of the 191 culture-positive samples, 16S rRNA gene PCR and sequencing led to concordant results in 65 cases at species level and an additional 62 cases at genus level. PCR was positive in further 360 out of 1309 culture-negative samples, sequencing results of which suggested etiologically relevant pathogen detections in 62 instances, detections of uncertain relevance in 50 instances, and DNA contamination due to sample preparation in 248 instances. In two instances, PCR failed to detect contaminants from the skin flora that were culturally detectable. Pre-analytical errors caused many Enterobacteriaceae to be missed by culture.Potentially correctable pre-analytical conditions and not the fastidious nature of the bacteria caused most of the discrepancies. Although 16S rRNA gene PCR and sequencing in addition to culture led to an increase in detections of presumably etiologically relevant blood culture pathogens, the application of this procedure to samples from the tropics was hampered by a high contamination rate. Careful interpretation of diagnostic results is required.

  8. Phylogenetic Relationships of the Marine Haplosclerida (Phylum Porifera) Employing Ribosomal (28S rRNA) and Mitochondrial (cox1, nad1) Gene Sequence Data

    Redmond, Niamh E.; Jean Raleigh; Van Soest, Rob W.M.; Michelle Kelly; Travers, Simon A A; Brian Bradshaw; Salla Vartia; Kelly M Stephens; McCormack, Grace P.

    2011-01-01

    The systematics of the poriferan Order Haplosclerida (Class Demospongiae) has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, ...

  9. Stable morphospecies within the 16S rRNA monophyletic genus .i.Microcystis./i. (KÜTZING) KÜTZING

    Komárková, Jaroslava; Mugnai, M. A.; Sili, C.; Komárek, Ondřej; Turicchia, S.

    -, č. 117 (2005), s. 279-295. ISSN 0342-1120. [Symposium of the International Association for Cyanophyte Research /16./. Luxembourg, 30.08.2004–03.09.2004] R&D Projects: GA AV ČR(CZ) IBS6017004 Grant ostatní: EU(XE) MIDI-CHIP EVK2-CT-1999-00026 Institutional research plan: CEZ:AV0Z60170517 Keywords : Microcystis * morhpospecies * 16S rRNA Subject RIV: EE - Microbiology, Virology

  10. 16S rRNA sequences of Bartonella bacilliformis and cat scratch disease bacillus reveal phylogenetic relationships with the alpha-2 subgroup of the class Proteobacteria.

    O'Connor, S P; Dorsch, M; Steigerwalt, A G; Brenner, D J; Stackebrandt, E

    1991-01-01

    The primary structures of 16S rRNAs of Bartonella bacilliformis, an isolate of the cat scratch disease (CSD) bacillus, and a strain phenotypically similar to the CSD bacillus were determined by reverse transcriptase sequencing. These microorganisms were found to be members of the alpha-2 subgroup of the class Proteobacteria. The sequence from B. bacilliformis was most closely related to the rRNA of Rochalimaea quintana (91.7% homology), the etiologic agent of trench fever. The sequence from t...

  11. 16S rRNA gene pyrosequencing of reference and clinical samples and investigation of the temperature stability of microbiome profiles

    Hang, Jun; Desai, Valmik; Zavaljevski, Nela; Yang, Yu; Lin, Xiaoxu; Satya, Ravi Vijaya; Martinez, Luis J.; Blaylock, Jason M.; Jarman, Richard G.; Thomas, Stephen J.; Kuschner, Robert A.

    2014-01-01

    Background Sample storage conditions, extraction methods, PCR primers, and parameters are major factors that affect metagenomics analysis based on microbial 16S rRNA gene sequencing. Most published studies were limited to the comparison of only one or two types of these factors. Systematic multi-factor explorations are needed to evaluate the conditions that may impact validity of a microbiome analysis. This study was aimed to improve methodological options to facilitate the best technical app...

  12. Dual Priming Oligonucleotides for Broad-Range Amplification of the Bacterial 16S rRNA Gene Directly from Human Clinical Specimens

    Kommedal, Øyvind; Simmon, Keith; Karaca, Dilek; Langeland, Nina; Wiker, Harald G.

    2012-01-01

    Broad-range amplification and sequencing of the bacterial 16S rRNA gene directly from clinical specimens are offered as a diagnostic service in many laboratories. One major pitfall is primer cross-reactivity with human DNA which will result in mixed chromatograms. Mixed chromatograms will complicate subsequent sequence analysis and impede identification. In SYBR green real-time PCR assays, it can also affect crossing threshold values and consequently the status of a specimen as positive or ne...

  13. An effect of 16S rRNA intercistronic variability on coevolutionary analysis in symbiotic bacteria: Molecular phylogeny of Arsenophonus triatominarum

    Šorfová, Pavlína; Škeříková, Andrea; Hypša, Václav

    2008-01-01

    Roč. 31, č. 2 (2008), s. 88-100. ISSN 0723-2020 R&D Projects: GA ČR GA206/04/0520; GA AV ČR IAA601410708 Institutional research plan: CEZ:AV0Z60220518 Keywords : intragenomic heterogeneity * 16S rRNA * coevolution * insect symbionts * molecular phylogeny Subject RIV: EE - Microbiology, Virology Impact factor: 2.582, year: 2008

  14. The chromatin remodeling factor CSB recruits histone acetyltransferase PCAF to rRNA gene promoters in active state for transcription initiation.

    Meili Shen

    Full Text Available The promoters of poised rRNA genes (rDNA are marked by both euchromatic and heterochromatic histone modifications and are associated with two transcription factors, UBF and SL1 that nucleate transcription complex formation. Active rRNA genes contain only euchromatic histone modifications and are loaded with all components of transcriptional initiation complex including RNA polymerase I. Coupled with histone acetylation and RNA polymerase I targeting, poised promoters can be converted to active ones by ATP-dependent chromatin remodeling factor CSB for initiation of rDNA transcription. However, it is not clear how dynamic histone modifications induce the assembly of polymerase I transcription initiation complex to active promoters during such conversion. Here we show that a complex consisting of CSB, RNA polymerase I and histone acetyltransferase PCAF is present at the rDNA promoters in active state. CSB is required for the association of PCAF with rDNA, which induces acetylation of histone H4 and histone H3K9. Overexpression of CSB promotes the association of PCAF with rDNA. Knockdown of PCAF leads to decreased levels of H4ac and H3K9ac at rDNA promoters, prevents the association of RNA polymerase I and inhibits pre-rRNA synthesis. The results demonstrate that CSB recruits PCAF to rDNA, which allows histone acetylation that is required for the assembly of polymerase I transcription initiation complex during the transition from poised to active state of rRNA genes, suggesting that CSB and PCAF play cooperative roles to establish the active state of rRNA genes by histone acetylation.

  15. Congruent Phylogenies of Most Common Small-Subunit rRNA and Dissimilatory Sulfite Reductase Gene Sequences Retrieved from Estuarine Sediments

    Joulian, Catherine; Ramsing, Niels B.; Ingvorsen, Kjeld

    2001-01-01

    The diversity of sulfate-reducing bacteria (SRB) in brackish sediment was investigated using small-subunit rRNA and dissimilatory sulfite reductase (DSR) gene clone libraries and cultivation. The phylogenetic affiliation of the most commonly retrieved clones for both genes was strikingly similar and produced Desulfosarcina variabilis-like sequences from the inoculum but Desulfomicrobium baculatum-like sequences from a high dilution in natural media. Related organisms were subsequently cultiva...

  16. Phylogenetic and genetic diversity analysis in Leptospira species based on the sequence homology pattern of 16S rRNA gene

    Pasupuleti Sreenivasa Rao

    2013-01-01

    Leptospirosis is a bacterial zoonosis, caused by pathogenic spirochete which belongs to the genus Leptospira. It exists in diverse ecological habitats and affects almost all the mammals including humans. Several online databases like NCBI etc will provide the complete genomic sequence data of various Leptospira species. However, the Phylogenetic and genetic diversity Analysis in Leptospira species based on 16S rRNA gene has not studied in detail. Therefore the present study was conducted. Seq...

  17. Characterization by 16S rRNA gene analysis and in situ hybridization of bacteria living in the hindgut of a deposit-feeding echinoid (Echinodermata)

    da Silva, S.G.; Gillan, D. C.; Dubilier, N.; De Ridder, C.

    2006-01-01

    The hindgut caecum of the deposit-feeding echinoid Echinocardium cordatum harbours a symbiotic bacterial microflora, organized into layered mats around detrital particles owing to the proliferation of filamentous bacteria. The bacterial community was analysed using 16S rRNA gene analysis and fluorescence in situ hybridization. The purpose was to characterize its biodiversity and to identify its predominant members. The majority of the 16S sequences belong to the delta -Proteobacteria (61.5%),...

  18. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.

    2015-01-01

    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recov...

  19. 16S rRNA gene based analysis of Enterobacter sakazakii strains from different sources and development of a PCR assay for identification

    Stephan Roger

    2004-11-01

    Full Text Available Abstract Background E. sakazakii is considered to be an opportunistic pathogen, implicated in food borne diseases causing meningitis or enteritis especially in neonates and infants. Cultural standard identification procedures for E. sakazakii include the observation of yellow pigmentation of colonies and a positive glucosidase activity. Up to now, only one PCR system based on a single available 16S rRNA gene sequence has been published for E. sakazakii identification. However, in our hands a preliminary evaluation of this system to a number of target and non-target strains showed significant specificity problems of this system. In this study full-length 16S rRNA genes of thirteen E. sakazakii strains from food, environment and human origin as well as the type strain ATCC 51329 were sequenced. Based on this sequence data a new specific PCR system for E. sakazakii was developed and evaluated. Results By phylogenetic analysis of the new full-length 16S rRNA gene sequence data obtained we could show the presence of a second phylogenetic distinct lineage within the E. sakazakii species. The newly developed 16S rRNA gene targeting PCR system allows identification of E. sakazakii strains from both lineages. The assay's ability to correctly identify different E. sakazakii isolates as well as to differentiate E. sakazakii from other closely related Enterobacteriaceae species and other microorganisms was shown on 75 target and non-target strains. Conclusion By this study we are presenting a specific and reliable PCR identification system, which is able to correctly identify E. sakazakii isolates from both phylogenetic distinct lines within the E. sakazakii species. The impact of this second newly described phylogenetic line within the E. sakazakii species in view of clinical and food safety aspects need further investigation.

  20. 16S rRNA gene based analysis of Enterobacter sakazakii strains from different sources and development of a PCR assay for identification

    Lehner, A J; Tasara, T.; Stephan, R

    2004-01-01

    BACKGROUND: E. sakazakii is considered to be an opportunistic pathogen, implicated in food borne diseases causing meningitis or enteritis especially in neonates and infants. Cultural standard identification procedures for E. sakazakii include the observation of yellow pigmentation of colonies and a positive glucosidase activity. Up to now, only one PCR system based on a single available 16S rRNA gene sequence has been published for E. sakazakii identification. However, in our hands a prelimin...

  1. Molecular phylogeny of the Cricetinae subfamily based on the mitochondrial cytochrome b and 12S rRNA genes and the nuclear vWF gene

    Neumann, K.; Michaux, Johan,; Lebedev, V.; N Yigit; Colak, E.; Ivanova, N.; Poltoraus, A.; Surov, A.; Markov, G.; Maak, S.; Neumann, S.; Gattermann, R.

    2006-01-01

    Despite some popularity of hamsters as pets and laboratory animals there is no reliable phylogeny of the subfamily Cricetinae available so far. Contradicting views exist not only about the actual number of species but also concerning the validity of several genera. We used partial DNA sequences of two mitochondrial (cytochrome b, 12S rRNA) and one partial nuclear gene (von Willebrand Factor exon 28) to provide a first gene tree of the Cricetinae based on 15 taxa comprising six genera: Accordi...

  2. Diversity and distribution of 16S rRNA and phenol monooxygenase genes in the rhizosphere and endophytic bacteria isolated from PAH-contaminated sites

    Peng, Anping; Liu, Juan; Ling, Wanting; Chen, Zeyou; Gao, Yanzheng

    2015-07-01

    This is the first investigation of the diversity and distribution of 16S rRNA and phenol monooxygenase (PHE) genes in endophytic and rhizosphere bacteria of plants at sites contaminated with different levels of PAHs. Ten PAHs at concentrations from 34.22 to 55.29 and 45.79 to 97.81 mg·kg-1 were measured in rhizosphere soils of Alopecurus aequalis Sobol and Oxalis corniculata L., respectively. The diversity of 16S rRNA and PHE genes in rhizosphere soils or plants changed with varying PAH pollution levels, as shown based on PCR-DGGE data. Generally, higher Shannon-Weiner indexes were found in mild or moderate contaminated areas. A total of 82 different bacterial 16S rRNA gene sequences belonging to five phyla; namely, Acfinobacteria, Proteobacteria, Chloroflexi, Cyanophyta, and Bacteroidetes, were obtained from rhizosphere soils. For the 57 identified PHE gene sequences, 18 were excised from rhizosphere bacteria and 39 from endophytic bacteria. The copy numbers of 16S rRNA and PHE genes in rhizosphere and endophytic bacteria varied from 3.83 × 103 to 2.28 × 106 and 4.17 × 102 to 1.99 × 105, respectively. The copy numbers of PHE genes in rhizosphere bacteria were significantly higher than in endophytic bacteria. Results increase our understanding of the diversity of rhizosphere and endophytic bacteria from plants grown in PAH-contaminated sites.

  3. 16S rRNA gene-based metagenomic analysis identifies a novel bacterial co-prevalence pattern in dental caries

    Jagathrakshakan, Sri Nisha; Sethumadhava, Raghavendra Jayesh; Mehta, Dhaval Tushar; Ramanathan, Arvind

    2015-01-01

    Objective: To identify the prevalence of acidogenic and nonacidogenic bacteria in patients with polycaries lesions, and to ascertain caries specific bacterial prevalence in relation to noncaries controls. Materials and Methods: Total genomic DNA extracted from saliva of three adults and four children from the same family were subjected to 16S rRNA gene sequencing analysis on a next generation sequencer, the PGS-Ion Torrent. Those bacterial genera with read counts > 1000 were considered as sig...

  4. New polymorphic mtDNA restriction site in the 12S rRNA gene detected in Tunisian patients with non-syndromic hearing loss

    The 12S rRNA gene was shown to be a hot spot for aminoglycoside-induced and non-syndromic hearing loss since several deafness-associated mtDNA mutations were identified in this gene. Among them, we distinguished the A1555G, the C1494T and the T1095C mutations and C-insertion or deletion at position 961. One hundred Tunisian patients with non-syndromic hearing loss and 100 hearing individuals were analysed in this study. A PCR-RFLP analysis with HaeIII restriction enzyme showed the presence of the A1555G mutation in the 12S rRNA gene in only one out of the 100 patients. In addition, PCR-RFLP and radioactive PCR revealed the presence of a new HaeIII polymorphic restriction site in the same gene of 12S rRNA site in 4 patients with non-syndromic hearing loss. UVIDOC-008-XD analyses showed the presence of this new polymorphic restriction site with a variable heteroplasmic rates at position +1517 of the human mitochondrial genome. On the other hand, direct sequencing of the entire mitochondrial 12S rRNA gene in the 100 patients and in 100 hearing individuals revealed the presence of the A750G and A1438G polymorphisms and the absence of the C1494T, T1095C and 961insC mutations in all the tested individuals. Sequencing of the whole mitochondrial genome in the 4 patients showing the new HaeIII polymorphic restriction site revealed only the presence of the A8860G transition in the MT-ATP6 gene and the A4769G polymorphism in the ND2 gene

  5. Toolbox Approaches Using Molecular Markers and 16S rRNA Gene Amplicon Data Sets for Identification of Fecal Pollution in Surface Water

    Ahmed, W.; Staley, C.; Sadowsky, M J; Gyawali, P.; Sidhu, J. P. S.; Palmer, A.; Beale, D. J.; Toze, S.

    2015-01-01

    In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial...

  6. Polynucleotide Probes That Target a Hypervariable Region of 16S rRNA Genes To Identify Bacterial Isolates Corresponding to Bands of Community Fingerprints

    Heuer, Holger; Hartung, Kathrin; Wieland, Gabriele; Kramer, Ina; Smalla, Kornelia

    1999-01-01

    Temperature gradient gel electrophoresis (TGGE) is well suited for fingerprinting bacterial communities by separating PCR-amplified fragments of 16S rRNA genes (16S ribosomal DNA [rDNA]). A strategy was developed and was generally applicable for linking 16S rDNA from community fingerprints to pure culture isolates from the same habitat. For this, digoxigenin-labeled polynucleotide probes were generated by PCR, using bands excised from TGGE community fingerprints as a template, and applied in ...

  7. Pyrosequencing of 16S rRNA genes in fecal samples reveals high diversity of hindgut microflora in horses and potential links to chronic laminitis

    Steelman Samantha M; Chowdhary Bhanu P; Dowd Scot; Suchodolski Jan; Janečka Jan E

    2012-01-01

    Abstract Background The nutrition and health of horses is closely tied to their gastrointestinal microflora. Gut bacteria break down plant structural carbohydrates and produce volatile fatty acids, which are a major source of energy for horses. Bacterial communities are also essential for maintaining gut homeostasis and have been hypothesized to contribute to various diseases including laminitis. We performed pyrosequencing of 16S rRNA bacterial genes isolated from fecal material to character...

  8. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing.

    Mehetre, Gajanan T; Paranjpe, Aditi; Dastager, Syed G; Dharne, Mahesh S

    2016-01-01

    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. PMID:26950332

  9. Complementarity of the 16S rRNA penultimate stem with sequences downstream of the AUG destabilizes the plastid mRNAs

    Kuroda, Hiroshi; Maliga, Pal

    2001-01-01

    Escherichia coli mRNA translation is facilitated by sequences upstream and downstream of the initiation codon, called Shine–Dalgarno (SD) and downstream box (DB) sequences, respectively. In E.coli enhancing the complementarity between the DB sequences and the 16S rRNA penultimate stem resulted in increased protein accumulation without a significant affect on mRNA stability. The objective of this study was to test whether enhancing the complementarity of plastid mRN...

  10. Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene

    Coêlho, Mariza M.; Ferreira-Nozawa, Monica S.; Nozawa, Sérgio R.; Santos, André L.W.

    2011-01-01

    Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla), were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic...

  11. First Report of the 23S rRNA Gene A2058G Point Mutation Associated With Macrolide Resistance in Treponema pallidum From Syphilis Patients in Cuba.

    Noda, Angel A; Matos, Nelvis; Blanco, Orestes; Rodríguez, Islay; Stamm, Lola Virginia

    2016-05-01

    This study aimed to assess the presence of macrolide-resistant Treponema pallidum subtypes in Havana, Cuba. Samples from 41 syphilis patients were tested for T. pallidum 23S rRNA gene mutations. Twenty-five patients (61%) harbored T. pallidum with the A2058G mutation, which was present in all 8 subtypes that were identified. The A2059G mutation was not detected. PMID:27100771

  12. Evaluation of the 16S and 12S rRNA genes as universal markers for the identification of commercial fish species in South Africa.

    Cawthorn, Donna-Mareè; Steinman, Harris Andrew; Witthuhn, R Corli

    2012-01-01

    The development of DNA-based methods for the identification of fish species is important for fisheries research and control, as well as for the detection of unintentional or fraudulent species substitutions in the marketplace. The aim of this study was to generate a comprehensive reference database of DNA sequences from the mitochondrial 16S and 12S ribosomal RNA (rRNA) genes for 53 commercial fish species in South Africa and to evaluate the applicability of these genetic markers for the identification of fish at the species level. The DNA extracted from all target species was readily amplified using universal primers targeting both rRNA gene regions. Sequences from the 16S and 12S rRNA genes were submitted to GenBank for the first time for 34% and 53% of the fish species, respectively. Cumulative analysis of the 16S rRNA gene sequences revealed mean conspecific, congeneric and confamilial Kimura two parameter (K2P) distances of 0.03%, 0.70% and 5.10% and the corresponding values at the 12S level were 0.03%, 1.00% and 5.57%. K2P neighbour-joining trees based on both sequence datasets generally clustered species in accordance with their taxonomic classifications. The nucleotide variation in both the 16S and 12S sequences was suitable for identifying the large majority of the examined fish specimens to at least the level of genus, but was found to be less useful for the explicit differentiation of certain congeneric fish species. It is recommended that one or more faster-evolving DNA regions be analysed to confirm the identities of closely-related fish species in South Africa. PMID:21963445

  13. Bacterial Diversity Studies Using the 16S rRNA Gene Provide a Powerful Research-Based Curriculum for Molecular Biology Laboratory

    Sarah M. Boomer

    2009-12-01

    Full Text Available We have developed a ten-week curriculum for molecular biology that uses 16S ribosomal RNA genes to characterize and compare novel bacteria from hot spring communities in Yellowstone National Park. The 16S rRNA approach bypasses selective culture-based methods. Our molecular biology course offered the opportunity for students to learn broadly applicable methods while contributing to a long-term research project. Specifically, students isolated and characterized clones that contained novel 16S rRNA inserts using restriction enzyme, DNA sequencing, and computer-based phylogenetic methods. In both classes, students retrieved novel bacterial 16S rRNA genes, several of which were most similar to Green Nonsulfur bacterial isolates. During class, we evaluated student performance and mastery of skills and concepts using quizzes, formal lab notebooks, and a broad project assignment. For this report, we also assessed student performance alongside data quality and discussed the significance, our goal being to improve both research and teaching methods.

  14. Bacterial Diversity Studies Using the 16S rRNA Gene Provide a Powerful Research-Based Curriculum for Molecular Biology Laboratory

    Bryan E. Dutton

    2002-12-01

    Full Text Available We have developed a ten-week curriculum for molecular biology that uses 16S ribosomal RNA genes to characterize and compare novel bacteria from hot spring communities in Yellowstone National Park. The 16S rRNA approach bypasses selective culture-based methods. Our molecular biology course offered the opportunity for students to learn broadly applicable methods while contributing to a long-term research project. Specifically, students isolated and characterized clones that contained novel 16S rRNA inserts using restriction enzyme, DNA sequencing, and computer-based phylogenetic methods. In both classes, students retrieved novel bacterial 16S rRNA genes, several of which were most similar to Green Nonsulfur bacterial isolates. During class, we evaluated student performance and mastery of skills and concepts using quizzes, formal lab notebooks, and a broad project assignment. For this report, we also assessed student performance alongside data quality and discussed the significance, our goal being to improve both research and teaching methods.

  15. A local role for the small ribosomal subunit primary binder rpS5 in final 18S rRNA processing in yeast.

    Andreas Neueder

    Full Text Available In vivo depletion of the yeast small ribosomal subunit (SSU protein S5 (rpS5 leads to nuclear degradation of nascent SSUs and to a perturbed global assembly state of the SSU head domain. Here, we report that rpS5 plays an additional local role at the head/platform interface in efficient SSU maturation. We find that yeast small ribosomal subunits which incorporated an rpS5 variant lacking the seven C-terminal amino acids have a largely assembled head domain and are exported to the cytoplasm. On the other hand, 3' processing of 18S rRNA precursors is inhibited in these ribosomal particles, although they associate with the putative endonuclease Nob1p and other late acting 40S biogenesis factors. We suggest that the SSU head component rpS5 and platform components as rpS14 are crucial constituents of a highly defined spatial arrangement in the head-platform interface of nascent SSUs, which is required for efficient processing of the therein predicted SSU rRNA 3' end. Positioning of rpS5 in nascent SSUs, including its relative orientation towards platform components in the head-platform cleft, will depend on the general assembly and folding state of the head domain. Therefore, the suggested model can explain 18S precursor rRNA 3' processing phenotypes observed in many eukaryotic SSU head assembly mutants.

  16. Analysis of RAPD and mitochondrial 16S rRNA gene sequences from Trichiurus lepturus and Eupleurogrammus muticus in the Yellow Sea

    MENG Zining; ZHUANG Zhimeng; JIN Xianshi; TANG Qisheng; SU Yongquan

    2004-01-01

    Random amplified polymorphic DNA (RAPD) technique is applied to 12 individuals from each species of the hairtail fishes Trichiurus lepturus and Eupleurogrammus muticus in the Yellow Sea. The percentage of polymorphic sites, degree of genetic polymorphism and genetic distance are compared and the phylogenetic tree is constructed by Neighbor-joining method. The partial mitochondrial 16S rRNA gene is amplified by polymerase chain reaction (PCR) and the PCR products are directly sequenced after being purified. These sequences, together with the homologous sequences of another Trichiuridae species Lepidopus caudatus obtained from GenBank, are used to analyze nucleotide difference and to construct a UPGMA phylogenetic tree by means of biological informatics. Analysis shows: (1) the RAPD technique is a highly sensitive method for investigating genetic diversity in T. lepturus, and E. muticus. T. lepturus exhibits a lower polymorphism and genetic diversity than E. muticus; (2) according to the analysis of the partial mitochondrial 16S rRNA gene sequences, a very low intraspecific variation and considerably high divergence among species were found, which reveals a dual nature of conservatism and variability in mitochondrial 16S rRNA gene; (3) five primers generate the species-specific RAPD sites and these sites can be served as the molecular markers for species identification and (4) it can be proved at DNA variation level that T. lepturus and E. muticus are of two species respectively pertaining to different genera, which supports the Nelson taxonomic conclusion.

  17. Population genetic structure of Cheyletus malaccensis (Acari: Cheyletidae) in China based on mitochondrial COI and 12S rRNA genes.

    Yang, Xiaoqiang; Ye, Qingtian; Xin, Tianrong; Zou, Zhiwen; Xia, Bin

    2016-06-01

    Cheyletus malaccensis is a predatory mite widely distributed in grain storages. It has been regarded as an important biological control agent for pest mites. In this study, we investigated the population genetic structure of C. malaccensis distributed in China based on the partial regions of mitochondrial COI and 12S rRNA genes. We collected 256 individuals of C. malaccensis from stored grain in 34 sites of China. We detected 50 COI gene haplotypes and nine 12S rRNA gene haplotypes. There were three clades in the haplotype network and Bayesian and maximum parsimony phylogenetic trees based on COI sequences, and two based on 12S rRNA sequences. The clustering of haplotypes was not correlated with their geographical distributions. The analysis of molecular variance, AMOVA, indicated that the genetic differentiation between populations was relatively weak. The major genetic differentiation was found within populations. We suggest that the genetic structure of C. malaccensis observed in this study may be the result of long-term climate fluctuations and recent human disturbances. PMID:26947027

  18. Deletion analysis of the expression of rRNA genes and associated tRNA genes carried by a lambda transducing bacteriophage. [uv radiation, Escherichia coli

    Morgan, E.A.; Nomura, M.

    1979-01-01

    Transducing phage lambda ilv5 carries genes for rRNA's, spacer tRNA's (tRNA/sub 1//sup Ile/ and tRNA/sub 1B//sup Ala/), and two other tRNA's (tRNA/sub 1//sup Asp/ and tRNA/sup Trp/). We have isolated a mutant of lambda ilv5, lambda ilv5su7, which carries an amber suppressor mutation in the tRNA/sup Trp/ gene. A series of deletion mutants were isolated from the lambda ilv5su7 phage. Genetic and biochemical analyses of these deletion mutants have confirmed our previous conclusion that the genes for tRNA/sub 1//sup Asp/ and tRNA/sup Trp/ located at the distal end of the rRNA operon (rrnC) are cotranscribed with other rRNA genes in that operon. In addition, these deletions were used to define roughly the physical location of the promoter(s) of the rRNA operon carried by the lambda ilv5su7 transducing phage.

  19. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan.

    Martínez, Allyson K; Gordon, Emily; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M; Benedik, Michael J; Yanofsky, Charles; Mankin, Alexander S; Vazquez-Laslop, Nora; Sachs, Matthew S; Cruz-Vera, Luis R

    2014-01-01

    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome's ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the concentration dependence of L-Trp-mediated tna operon induction, whereas the TnaC I19L change suppresses this phenotype, restoring the sensitivity of the translating A2058U mutant ribosome to free L-Trp. These findings suggest that interactions between TnaC residue I19 and 23S rRNA nucleotide A2058 contribute to the creation of a regulatory L-Trp binding site within the translating ribosome. PMID:24137004

  20. Genetic variation and identification of cultivated Fallopia multiflora and its wild relatives by using chloroplast matK and 18S rRNA gene sequences.

    Yan, Ping; Pang, Qi-Hua; Jiao, Xu-Wen; Zhao, Xuan; Shen, Yan-Jing; Zhao, Shu-Jin

    2008-10-01

    FALLOPIA MULTIFLORA (Thunb.) Harald . has been widely and discriminatingly used in China for the study and treatment of anemia, swirl, deobstruent, pyrosis, insomnia, amnesia, atheroma and also for regulating immune functions. However, there is still confusion about the herbal drug's botanical origins and the phylogenetic relationship between the cultivars and the wild relatives. In order to develop an efficient method for identification, a molecular analysis was performed based on 18 S rRNA gene and partial MATK gene sequences. The 18 S rRNA gene sequences of F. MULTIFLORA were 1809 bp in length and were highly conserved, indicating that the cultivars and the wild F. MULTIFLORA have the same botanical origin. Based on our 18 S rRNA gene sequences analysis, F. MULTIFLORA could be easily distinguished at the DNA level from adulterants and some herbs with similar components. The MATK gene partial sequences were found to span 1271 bp. The phylogenetic relation of F. MULTIFLORA based on the MATK gene showed that all samples in this paper were divided into four clades. The sequences of the partial MATK gene had many permutations, which were related to the geographical distributions of the samples. MATK gene sequences provided valuable information for the identification of F. MULTIFLORA. New taxonomic information could be obtained to authenticate the botanical origin of the F. MULTIFLORA, the species and the medicines made of it. PMID:18759218

  1. 30S Subunit-Dependent Activation of the Sorangium cellulosum So ce56 Aminoglycoside Resistance-Conferring 16S rRNA Methyltransferase Kmr

    Savic, Miloje; Sunita, S.; Zelinskaya, Natalia; Desai, Pooja M.; Macmaster, Rachel; Vinal, Kellie

    2015-01-01

    Methylation of bacterial 16S rRNA within the ribosomal decoding center confers exceptionally high resistance to aminoglycoside antibiotics. This resistance mechanism is exploited by aminoglycoside producers for self-protection while functionally equivalent methyltransferases have been acquired by human and animal pathogenic bacteria. Here, we report structural and functional analyses of the Sorangium cellulosum So ce56 aminoglycoside resistance-conferring methyltransferase Kmr. Our results demonstrate that Kmr is a 16S rRNA methyltransferase acting at residue A1408 to confer a canonical aminoglycoside resistance spectrum in Escherichia coli. Kmr possesses a class I methyltransferase core fold but with dramatic differences in the regions which augment this structure to confer substrate specificity in functionally related enzymes. Most strikingly, the region linking core β-strands 6 and 7, which forms part of the S-adenosyl-l-methionine (SAM) binding pocket and contributes to base flipping by the m1A1408 methyltransferase NpmA, is disordered in Kmr, correlating with an exceptionally weak affinity for SAM. Kmr is unexpectedly insensitive to substitutions of residues critical for activity of other 16S rRNA (A1408) methyltransferases and also to the effects of by-product inhibition by S-adenosylhomocysteine (SAH). Collectively, our results indicate that adoption of a catalytically competent Kmr conformation and binding of the obligatory cosubstrate SAM must be induced by interaction with the 30S subunit substrate. PMID:25733511

  2. Comparative analyses of phenotypic methods and 16S rRNA, khe, rpoB genes sequencing for identification of clinical isolates of Klebsiella pneumoniae.

    He, Yanxia; Guo, Xianguang; Xiang, Shifei; Li, Jiao; Li, Xiaoqin; Xiang, Hui; He, Jinlei; Chen, Dali; Chen, Jianping

    2016-07-01

    The present work aimed to evaluate 16S rRNA, khe and rpoB gene sequencing for the identification of Klebsiella pneumoniae in comparison with phenotypic methods. Fifteen clinical isolates were examined, which were initially identified as K. pneumoniae subsp. pneumoniae using the automated VITEK 32 system in two hospitals in Enshi City, China. Their identity was further supported by conventional phenotypic methods on the basis of morphological and biochemical characteristics. Using Bayesian phylogenetic analyses and haplotypes network reconstruction, 13 isolates were identified as K. pneumoniae, whereas the other two isolates (K19, K24) were classified as Shigella sp. and Enterobacter sp., respectively. Of the three genes, 16S rRNA and khe gene could discriminate the clinical isolates at the genus level, whereas rpoB could discriminate Klebsiella at the species and even subspecies level. Overall, the gene tree based on rpoB is more compatible with the currently accepted classification of Klebsiella than those based on 16S rRNA and khe genes, showing that rpoB can be a powerful tool for identification of K. pneumoniae isolates. Above all, our study challenges the utility of khe as a species-specific marker for identification of K. pneumoniae. PMID:27147066

  3. In silico analysis of the 16S rRNA gene of endophytic bacteria, isolated from the aerial parts and seeds of important agricultural crops.

    Bredow, C; Azevedo, J L; Pamphile, J A; Mangolin, C A; Rhoden, S A

    2015-01-01

    Because of human population growth, increased food production and alternatives to conventional methods of biocontrol and development of plants such as the use of endophytic bacteria and fungi are required. One of the methods used to study microorganism diversity is sequencing of the 16S rRNA gene, which has several advantages, including universality, size, and availability of databases for comparison. The objective of this study was to analyze endophytic bacterial diversity in agricultural crops using published papers, sequence databases, and phylogenetic analysis. Fourteen papers were selected in which the ribosomal 16S rRNA gene was used to identify endophytic bacteria, in important agricultural crops, such as coffee, sugar cane, beans, corn, soybean, tomatoes, and grapes, located in different geographical regions (America, Europe, and Asia). The corresponding 16S rRNA gene sequences were selected from the NCBI database, aligned using the Mega 5.2 program, and phylogenetic analysis was undertaken. The most common orders present in the analyzed cultures were Bacillales, Enterobacteriales, and Actinomycetales and the most frequently observed genera were Bacillus, Pseudomonas, and Microbacterium. Phylogenetic analysis showed that only approximately 1.56% of the total sequences were not properly grouped, demonstrating reliability in the identification of microorganisms. This study identified the main genera found in endophytic bacterial cultures from plants, providing data for future studies on improving plant agriculture, biotechnology, endophytic bacterium prospecting, and to help understand relationships between endophytic bacteria and their interactions with plants. PMID:26345903

  4. Targeting single-nucleotide polymorphisms in the 16S rRNA gene to detect and differentiate Legionella pneumophila and non-Legionella pneumophila species.

    Zhan, Xiao-Yong; Hu, Chao-Hui; Zhu, Qing-Yi

    2016-08-01

    A PCR-based method targeting single-nucleotide polymorphisms (SNPs) in the 16S rRNA gene was developed for differential identification of Legionella pneumophila and non-Legionella pneumophila. Based on the bioinformatics analysis for 176 Legionella 16S rRNA gene fragments of 56 different Legionella species, a set of SNPs, A(628)C(629) was found to be highly specific to L. pneumophila strains. A multiplex assay was designed that was able to distinguish sites with limited sequence heterogeneity between L. pneumophila and non-L. pneumophila in the targeted 16S rRNA gene. The assay amplified a 261-bp amplicon for Legionella spp. and a set of 203- and 97-bp amplicons only specific to L. pneumophila species. Among 49 ATCC strains and 284 Legionella isolates from environmental water and clinical samples, 100 % of L. pneumophila and non-L. pneumophila strains were correctly identified and differentiated by this assay. The assay presents a more rapid, sensitive and alternative method to the currently available PCR-sequencing detection and differentiation method. PMID:27112927

  5. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    Rosendahl, G; Douthwaite, S

    1993-01-01

    23 S rRNA. Within the ribosome, L11 also interacts with this rRNA region, although the protection effects are subtly different and extend to nucleotide 1098. The pentameric r-protein complex L10.(L12)4 binds to an adjacent site on the rRNA, protecting riboses at positions 1043, 1046 to 1049, 1053 to...... by L10.(L12)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  6. Hydrogen bonding and packing density are factors most strongly connected to limiting sites of high flexibility in the 16S rRNA in the 30S ribosome

    Ghosh Sujit K

    2009-07-01

    Full Text Available Abstract Background Conformational flexibility in structured RNA frequently is critical to function. The 30S ribosomal subunit exists in different conformations in different functional states due to changes in the central part of the 16S rRNA. We are interested in evaluating the factors that might be responsible for restricting flexibility to specific parts of the 16S rRNA using biochemical data obtained from the 30S subunit in solution. This problem was approached taking advantage of the observation that there must be a high degree of conformational flexibility at sites where UV photocrosslinking occurs and a lack of flexibility inhibits photoreactivity at many other sites that are otherwise suitable for reaction. Results We used 30S x-ray structures to quantify the properties of the nucleotide pairs at UV- and UVA-s4U-induced photocrosslinking sites in 16S rRNA and compared these to the properties of many hundreds of additional sites that have suitable geometry but do not undergo photocrosslinking. Five factors that might affect RNA flexibility were investigated – RNA interactions with ribosomal proteins, interactions with Mg2+ ions, the presence of long-range A minor motif interactions, hydrogen bonding and the count of neighboring heavy atoms around the center of each nucleobase to estimate the neighbor packing density. The two factors that are very different in the unreactive inflexible pairs compared to the reactive ones are the average number of hydrogen bonds and the average value for the number of neighboring atoms. In both cases, these factors are greater for the unreactive nucleotide pairs at a statistically very significant level. Conclusion The greater extent of hydrogen bonding and neighbor atom density in the unreactive nucleotide pairs is consistent with reduced flexibility at a majority of the unreactive sites. The reactive photocrosslinking sites are clustered in the 30S subunit and this indicates nonuniform patterns of

  7. Effect of secondary compounds in forages on rumen micro-organisms quantified by 16S and 18S rRNA

    A gas syringe method was used to evaluate the effect of secondary compounds from plant materials on in vitro fermentation products and microbial biomass. The experiment used Pennisetum purpureum, Morinda citrifolia fruit, Nothopanax scutellarium leaves, Sesbania sesban LS (low saponins type), Sesbania sesban HS (high saponins type) and Sapindus rarak fruit as substrates. The incubation was conducted with and without polyethylene glycol 6000 (PEG) addition for 24 hours. Gas production and short-chain fatty acids (SCFA) were analysed. Prokaryotic and eukaryotic concentrations were measured by quantifying 16S and 18S rRNA. The percentage increase in gas production due to PEG was very small (<5%) for all plant materials, which indicated that the biological effect of tannin in these plant materials is limited. TLC analysis revealed that all materials contained saponin, but only S. rarak, followed by S. sesban, contained a high diversity of saponins. S. sesban gave the highest (234 ml/g) while S. rarak gave the lowest gas production (115 ml/g). S. rarak gave the lowest SCFA production (3.57 mmole/g) and also the lowest ratio of acetate to propionate (1.76), indicating a change in pattern of SCFA production. Total elimination of eukaryotic concentration was evident from the absence of the 18S rRNA band when S. rarak and S. sesban were used as sole substrates. S. rarak also reduced the prokaryotic concentration. To use S. rarak as a defaunating agent without affecting prokaryotes, a crude saponin extract was prepared from S. rarak for further experiment. Different concentrations of crude saponins in a methanol extract of S. rarak fruit dissolved in rumen buffer were added to a substrate consisting of elephant grass and wheat bran (7:3 w/w). Microbial biomass yield was quantified by gravimetry and using rRNA as a marker. Addition of crude saponin extract from S. rarak to a high-roughage diet increased microbial biomass (MB) yield to 1.07 and 1.14 times MB yield of the

  8. Polyethylene glycol and polyvinylpirrolidone effect on bacterial rRNA extraction and hybridization from cells exposed to tannins Efeito de polietilenoglicol e polivinilpirrolidona na extração e hibridização de rRNA bacteriano de células expostas a taninos

    Pedro Braga Arcuri

    2003-09-01

    Full Text Available In order to detect fluctuations in ruminal microbial populations due to forage tannins using 16S ribosomal RNA (rRNA probes, recovery of intact rRNA is required. The objective of this work was to evaluate the effect of polyethylene glycol (PEG and polyvinylpirrolidone (PVP on extraction of bacterial rRNA, in the presence of tannins from tropical legume forages and other sources, that hybridize with oligonucleotide probes. Ruminococcus albus 8 cells were exposed to 8 g/L tannic acid or 1 g/L condensed tannins extracted from Acacia angustissima, banana (Musa sp. skin, Desmodium ovalifolium, red grape (Vitis vinifera skin and Inga edulis, or no tannins. Cells were rinsed with Tris buffer pH 7 containing either 8% PEG or 6% PVP prior to cell lysis. Total RNA samples rinsed with either PEG or PVP migrated through denaturing agarose gels. The 16S rRNA bands successfully hybridized with a R. albus species-specific oligonucleotide probe, regardless of tannin source. The effect of rinsing buffers on the density of 16S rRNA bands, as well as on the hybridization signals was compared. There were significant effects (PA recuperação de RNA ribossômico (rRNA intacto é necessária para a detecção de flutuações na população microbiana ruminal decorrentes dos taninos de forrageiras, utilizando-se sondas para 16S rRNA. O objetivo deste trabalho foi avaliar o efeito de polietilenoglicol (PEG e polivinilpirrolidona (PVP na extração de rRNA bacteriano, em presença de taninos de leguminosas forrageiras tropicais e de outras fontes, que possa ser hibridizado com sondas de oligonucleotídeos. Culturas de Ruminococcus albus 8 foram expostas ou não a 8 g/L de ácido tânico ou a 1 g/L de taninos condensados, extraídos de Acacia angustissima, casca de banana (Musa sp., Desmodium ovalifolium, cascas de uvas vermelhas (Vitis vinifera e Inga edulis. As culturas foram lavadas com tampão Tris pH 7 contendo 8% PEG ou 6% PVP antes do rompimento das c

  9. Allele-specific PCR for detecting the deafness-associated mitochondrial 12S rRNA mutations.

    Ding, Yu; Xia, Bo-Hou; Liu, Qi; Li, Mei-Ya; Huang, Shui-Xian; Zhuo, Guang-Chao

    2016-10-10

    Mutations in mitochondrial 12S rRNA (MT-RNR1) are the important causes of sensorineural hearing loss. Of these mutations, the homoplasmic m.1555A>G or m.1494C>T mutation in the highly conserved A-site of MT-RNR1 gene has been found to be associated with both aminoglycoside-induced and non-syndromic hearing loss in many families worldwide. Since the m.1555A>G and m.1494C>T mutations are sensitive to ototoxic drugs, therefore, screening for the presence of these mutations is important for early diagnosis and prevention of deafness. For this purpose, we recently developed a novel allele-specific PCR (AS-PCR) which is able to simultaneously detect these mutations. To assess its accuracy, in this study, we employed this method to screen the frequency of m.1555A>G and m.1494C>T mutations in 200 deafness patients and 120 healthy subjects. Consequently, four m.1555A>G and four m.1494C>T mutations were identified; among these, only one patient with the m.1494C>T mutation had an obvious family history of hearing loss. Strikingly, clinical evaluation showed that this family exhibited a high penetrance of hearing loss. In particular, the penetrances of hearing loss were 80% with the aminoglycoside included and 20% when excluded. PCR-Sanger sequencing of the mitochondrial genomes confirmed the presence of the m.1494C>T mutation and identified a set of polymorphisms belonging to mitochondrial haplogroup A. However, the lack of functional variants in mitochondrial and nuclear modified genes (GJB2 and TRMU) in this family indicated that mitochondrial haplogroup and nuclear genes may not play important roles in the phenotypic expression of the m.1494C>T mutation. Thus, other modification factors, such as environmental factor, aminoglycosides or epigenetic modification may have contributed to the high penetrance of hearing loss in this family. Taken together, our data showed that this assay is an effective approach that could be used for detection the deafness-associated MT-RNR1

  10. Pattern of antibiotic resistant mastitis in dairy cows

    D. Chandrasekaran

    2014-06-01

    Full Text Available Aim: To study the prevalence of drug resistant mastitis and their pattern of antibiotic resistance in dairy cows from Tamil Nadu. Materials and Methods: Isolation and identification of resistant pathogens were performed from acute clinical mastitis samples. Based on culture, isolation and sensitivity tests, cows with resistant mastitis were grouped as; Group I: Escherichia coli (n=119, Group II: Staphylococcus aureus (n=104 and Group III: Methicillin-resistant Staphylococcal aureus (MRSA (n=12. The isolates were tested using agar disc diffusion method for their antimicrobial susceptibility and modified resazurin assay microdilution technique for minimum inhibitory concentration (MIC to 8 antimicrobial drugs. The organisms were also confirmed for their identity by performing PCR on the bacterial pellet targeting the specific genes such as 16s-23s rRNA, mecA and blaZ respectively for the resistant pathogens and also confirmed by sequencing. Results: Antibiotic resistant mastitis was detected in 235 out of 401 cows accounting to 56.1%. The predominant resistant causative pathogen was E. coli (50.64% followed by S. aureus (44.25% and MRSA (5.11%. In vitro antibiotic sensitivity test and MIC breakpoints, E. coli, S. aureus and MRSA organisms showed more sensitivity to enrofloxacin, amoxicillin + sulbactam, gentamicin and ceftriaxone and had highest resistant to penicillin followed by amoxicillin, oxytetracycline and methicillin. E. coli and S. aureus isolates were found to be resistant to 1 or 2 antimicrobials, whereas most of the MRSA isolates were found to be multi-drug resistant i.e resistance to 3 or more of antimicrobials. Out of 235 milk samples, the specific target gene 16s-23s rRNA (E. coli , 16s-23s rRNA (S. aureus and MRSA (mecA and blaZ could be amplified from 119, 104 and 12 isolates with a percentage positivity of 50.64 (119/235, 89.64 (104/116 and 10.34 (12/116 respectively. Conclusion: Prevalence of antimicrobial resistance (AMR in

  11. Application of 12S rRNA in the identification of Muntiacus crinifons and Muntiacus reevesi%12S rRNA在黑麂和黄麂物种鉴定中的应用

    贺培建; 阮向东; 方盛国

    2004-01-01

    The gene of 12S rRNA exhibits a high degree of conservation during animal evolution. Its sequence shows partial difference among species but little variation among individuals of the same species. Therefore, the 12S rRNA could be used to perform intra-and inter-specific identification studies. All the deer of genus Muntiacus become endangered due to excessive poaching and thus protected by Chinas Wildlife Protection Law at the national and provincial level. In this study, we employed the sequencing of 12S rRNA to identify two confiscated samples and found out that the two samples were Mwttiacus crinifons and Mwttiacus reevesi,respectively. The sequence of the 12S rRNA adopted in this study proved to be a suitable genetic marker for species identification of conservation animals.

  12. Phylogenetic Diversity and Spatial Distribution of the Microbial Community Associated with the Caribbean Deep-water Sponge Polymastia cf. corticata by 16S rRNA, aprA, and amoA Gene Analysis

    Meyer, Birte; Kuever, Jan

    2008-01-01

    Denaturing gradient gel electrophoresis (DGGE)-based analyses of 16S rRNA, aprA, and amoA genes demonstrated that a phylogenetically diverse and complex microbial community was associated with the Caribbean deep-water sponge Polymastia cf. corticata Ridley and Dendy, 1887. From the 38 archaeal and bacterial 16S rRNA phylotypes identified, 53% branched into the sponge-specific, monophyletic sequence clusters determined by previous studies (considering predominantly shallow-water sponge species...

  13. Development of polymerase chain reaction primer sets for diagnosis of Lyme disease and for species-specific identification of Lyme disease isolates by 16S rRNA signature nucleotide analysis.

    1992-01-01

    We have determined and compared partial 16S rRNA sequences from 23 Lyme disease spirochete isolates and aligned these with 8 sequences previously presented. The 16S rRNA signature nucleotide compositions were defined for each isolate and compared with the genomic species signature nucleotide sets previously established. To identify positions truly indicative of species classification which could serve as targets for polymerase chain reaction species-specific identification primers, 16S rRNA-b...

  14. Quantitative identification of fecal water pollution sources by TaqMan real-time PCR assays using Bacteroidales 16S rRNA genetic markers.

    Lee, Dae-Young; Weir, Susan C; Lee, Hung; Trevors, Jack T

    2010-12-01

    PCR-based analysis of Bacteroidales 16S rRNA genes has emerged as a promising tool to identify sources of fecal water pollution. In this study, three TaqMan real-time PCR assays (BacGeneral, BacHuman, and BacBovine) were developed and evaluated for their ability to quantitatively detect general (total), human-specific, and bovine-specific Bacteroidales 16S rRNA genetic markers. The detection sensitivity was determined to be 6.5 copies of 16S rRNA gene for the BacGeneral and BacHuman assays and 10 copies for the BacBovine assay. The assays were capable of detecting approximately one to two cells per PCR. When tested with 70 fecal samples from various sources (human, cattle, pig, deer, dog, cat, goose, gull, horse, and raccoon), the three assays positively identified the target markers in all samples without any false-negative results. The BacHuman and BacBovine assays exhibited false-positive reactions with non-target samples in a few cases. However, the level of the false-positive reactions was about 50 times smaller than that of the true-positive ones, and therefore, these cross-reactions were unlikely to cause misidentifications of the fecal pollution sources. Microbial source-tracking capability was tested at two freshwater streams of which water quality was influenced by human and cattle feces, respectively. The assays accurately detected the presence of the corresponding host-specific markers upon fecal pollution and the persistence of the markers in downstream areas. The assays are expected to reliably determine human and bovine fecal pollution sources in environmental water samples. PMID:20871990

  15. Persistent spread of the rmtB 16S rRNA methyltransferase gene among Escherichia coli isolates from diseased food-producing animals in China.

    Xia, Jing; Sun, Jian; Cheng, Ke; Li, Liang; Fang, Liang-Xing; Zou, Meng-Ting; Liao, Xiao-Ping; Liu, Ya-Hong

    2016-05-30

    A total of 963 non-duplicate Escherichia coli strains isolated from food-producing animals between 2002 and 2012 were screened for the presence of the 16S rRNA methyltransferase genes. Among the positive isolates, resistance determinants to extended spectrum β-lactamases, plasmid-mediated quinolone resistance genes as well as floR and fosA/A3/C2 were detected using PCR analysis. These isolates were further subjected to antimicrobial susceptibility testing, molecular typing, PCR-based plasmid replicon typing and plasmid analysis. Of the 963 E. coli isolates, 173 (18.0%), 3 (0.3%) and 2 (0.2%) were rmtB-, armA- and rmtE-positive strains, respectively. All the 16S rRNA methyltransferase gene-positive isolates were multidrug resistant and over 90% of them carried one or more type of resistance gene. IncF (especially IncFII) and non-typeable plasmids played the main role in the dissemination of rmtB, followed by the IncN plasmids. Plasmids that harbored rmtB ranged in size from 20kb to 340kb EcoRI-RFLP testing of the 109 rmtB-positive plasmids from different years and different origins suggested that horizontal (among diverse animals) and vertical transfer of IncF, non-typeable and IncN-type plasmids were responsible for the spread of rmtB gene. In summary, our findings highlight that rmtB was the most prevalent 16S rRNA methyltransferase gene, which present persistent spread in food-producing animals in China and a diverse group of plasmids was responsible for rmtB dissemination. PMID:27139028

  16. Bacterial communities in haloalkaliphilic sulfate-reducing bioreactors under different electron donors revealed by 16S rRNA MiSeq sequencing

    Zhou, Jiemin [National Key Laboratory of Biochemical Engineering, Institute of Process Engineering, Chinese Academy of Sciences, P.O. Box 353, Beijing 100190 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Zhou, Xuemei; Li, Yuguang [101 Institute, Ministry of Civil Affairs, Beijing 100070 (China); Xing, Jianmin, E-mail: jmxing@ipe.ac.cn [National Key Laboratory of Biochemical Engineering, Institute of Process Engineering, Chinese Academy of Sciences, P.O. Box 353, Beijing 100190 (China)

    2015-09-15

    Highlights: • Bacterial communities of haloalkaliphilic bioreactors were investigated. • MiSeq was first used in analysis of communities of haloalkaliphilic bioreactors. • Electron donors had significant effect on bacterial communities. - Abstract: Biological technology used to treat flue gas is useful to replace conventional treatment, but there is sulfide inhibition. However, no sulfide toxicity effect was observed in haloalkaliphilic bioreactors. The performance of the ethanol-fed bioreactor was better than that of lactate-, glucose-, and formate-fed bioreactor, respectively. To support this result strongly, Illumina MiSeq paired-end sequencing of 16S rRNA gene was applied to investigate the bacterial communities. A total of 389,971 effective sequences were obtained and all of them were assigned to 10,220 operational taxonomic units (OTUs) at a 97% similarity. Bacterial communities in the glucose-fed bioreactor showed the greatest richness and evenness. The highest relative abundance of sulfate-reducing bacteria (SRB) was found in the ethanol-fed bioreactor, which can explain why the performance of the ethanol-fed bioreactor was the best. Different types of SRB, sulfur-oxidizing bacteria, and sulfur-reducing bacteria were detected, indicating that sulfur may be cycled among these microorganisms. Because high-throughput 16S rRNA gene paired-end sequencing has improved resolution of bacterial community analysis, many rare microorganisms were detected, such as Halanaerobium, Halothiobacillus, Desulfonatronum, Syntrophobacter, and Fusibacter. 16S rRNA gene sequencing of these bacteria would provide more functional and phylogenetic information about the bacterial communities.

  17. Bacterial communities in haloalkaliphilic sulfate-reducing bioreactors under different electron donors revealed by 16S rRNA MiSeq sequencing

    Highlights: • Bacterial communities of haloalkaliphilic bioreactors were investigated. • MiSeq was first used in analysis of communities of haloalkaliphilic bioreactors. • Electron donors had significant effect on bacterial communities. - Abstract: Biological technology used to treat flue gas is useful to replace conventional treatment, but there is sulfide inhibition. However, no sulfide toxicity effect was observed in haloalkaliphilic bioreactors. The performance of the ethanol-fed bioreactor was better than that of lactate-, glucose-, and formate-fed bioreactor, respectively. To support this result strongly, Illumina MiSeq paired-end sequencing of 16S rRNA gene was applied to investigate the bacterial communities. A total of 389,971 effective sequences were obtained and all of them were assigned to 10,220 operational taxonomic units (OTUs) at a 97% similarity. Bacterial communities in the glucose-fed bioreactor showed the greatest richness and evenness. The highest relative abundance of sulfate-reducing bacteria (SRB) was found in the ethanol-fed bioreactor, which can explain why the performance of the ethanol-fed bioreactor was the best. Different types of SRB, sulfur-oxidizing bacteria, and sulfur-reducing bacteria were detected, indicating that sulfur may be cycled among these microorganisms. Because high-throughput 16S rRNA gene paired-end sequencing has improved resolution of bacterial community analysis, many rare microorganisms were detected, such as Halanaerobium, Halothiobacillus, Desulfonatronum, Syntrophobacter, and Fusibacter. 16S rRNA gene sequencing of these bacteria would provide more functional and phylogenetic information about the bacterial communities

  18. Multiplex RT-PCR detection of Cucumber mosaic virus subgroups and Tobamoviruses infecting Tomato using 18S rRNA as an internal control

    Shaoning Chen; Hao Gu; Xiaoming Wang; Jishuang Chen; Weimin Zhu

    2011-01-01

    A multiplex reverse-transcription polymerase chain reaction (RT-PCR) protocol was developed for simultaneous detection and discrimination of subgroups of Cucumber mosaic virus (CMV), including its satellite RNA, Tomato mosaic virus (ToMV) and Tobacco mosaic virus (TMV),using 18S rRNA as an internal control.Species- and subgroups-specific primers designed to differentiate CMV subgroups Ⅰ and Ⅱ, ToMV and TMV, were assessed using the cDNA clones of viral genomes, CMV satellite RNA and 18S rRNA gene from tomato (Solanum lycopersicum L.) or tobacco (Nicotiana tobacum).Using total RNA extracted from artificial mixture of tomato leaf tissues infected by each virus, the reaction components and cycling parmeters were optimized and a multiplex RT-PCR procedure was established.Six fragments of 704, 593, 512, 421,385, 255 bp, specific to CMV subgroup ll, CMV subgroup I, ToMV, TMV, satellite RNA and 18S rRNA, respectively, were sinultaneously amplified.The sensitivity of the multiplex RT-PCR method for detecting CMV was 100 times higher than that of double-antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA).This method was successfully used for field detection.Among 141 samples collected from East China through tomato growth seasons, 106 single infections with one of the above isolates were detected and 13 mixed infections were found.The results showed the potential use of this method for investigating the epidemiology of viral diseases infecting tomato.

  19. Metagenomic of Actinomycetes Based on 16S rRNA and nifH Genes in Soil and Roots of Four Indonesian Rice Cultivars Using PCR-DGGE

    Mahyarudin

    2015-07-01

    Full Text Available The research was conducted to study the metagenomic of actinomycetes based on 16S ribosomal RNA (rRNA and bacterial nifH genes in soil and roots of four rice cultivars. The denaturing gradient gel electrophoresis profile based on 16S rRNA gene showed that the diversity of actinomycetes in roots was higher than soil samples. The profile also showed that the diversity of actinomycetes was similar in four varieties of rice plant and three types of agroecosystem. The profile was partially sequenced and compared to GenBank database indicating their identity with closely related microbes. The blast results showed that 17 bands were closely related ranging from 93% to 100% of maximum identity with five genera of actinomycetes, which is Geodermatophilus, Actinokineospora, Actinoplanes, Streptomyces and Kocuria. Our study found that Streptomyces species in soil and roots of rice plants were more varied than other genera, with a dominance of Streptomyces alboniger and Streptomyces acidiscabies in almost all the samples. Bacterial community analyses based on nifH gene denaturing gradient gel electrophoresis showed that diversity of bacteria in soils which have nifH gene was higher than that in rice plant roots. The profile also showed that the diversity of those bacteria was similar in four varieties of rice plant and three types of agroecosystem. Five bands were closely related with nifH gene from uncultured bacterium clone J50, uncultured bacterium clone clod-38, and uncultured bacterium clone BG2.37 with maximum identity 99%, 98%, and 92%, respectively. The diversity analysis based on 16S rRNA gene differed from nifH gene and may not correlate with each other. The findings indicated the diversity of actinomycetes and several bacterial genomes analyzed here have an ability to fix nitrogen in soil and roots of rice plant.

  20. Direct relationship between the level of p53 stabilization induced by rRNA synthesis-inhibiting drugs and the cell ribosome biogenesis rate.

    Scala, F; Brighenti, E; Govoni, M; Imbrogno, E; Fornari, F; Treré, D; Montanaro, L; Derenzini, M

    2016-02-25

    Many drugs currently used in chemotherapy work by hindering the process of ribosome biogenesis. In tumors with functional p53, the inhibition of ribosome biogenesis may contribute to the efficacy of this treatment by inducing p53 stabilization. As the level of stabilized p53 is critical for the induction of cytotoxic effects, it seems useful to highlight those cancer cell characteristics that can predict the degree of p53 stabilization following the treatment with inhibitors of ribosome biogenesis. In the present study we exposed a series of p53 wild-type human cancer cell lines to drugs such as actinomycin D (ActD), doxorubicin, 5-fluorouracil and CX-5461, which hinder ribosomal RNA (rRNA) synthesis. We found that the amount of stabilized p53 was directly related to the level of ribosome biogenesis in cells before the drug treatment. This was due to different levels of inactivation of the ribosomal proteins-MDM2 pathway of p53 digestion. Inhibition of rRNA synthesis always caused cell cycle arrest, independent of the ribosome biogenesis rate of the cells, whereas apoptosis occurred only in cells with a high rDNA transcription rate. The level of p53 stabilization induced by drugs acting in different ways from the inhibition of ribosome biogenesis, such as hydroxyurea (HU) and nutlin-3, was independent of the level of ribosome biogenesis in cells and always lower than that occurring after the inhibition of rRNA synthesis. Interestingly, in cells with a low ribosome biogenesis rate, the combined treatment with ActD and HU exerted an additive effect on p53 stabilization. These results indicated that (i) drugs inhibiting ribosome biogenesis may be highly effective in p53 wild-type cancers with a high ribosome biogenesis rate, as they induce apoptotic cell death, and (ii) the combination of drugs capable of stabilizing p53 through different mechanisms may be useful for treating cancers with a low ribosome biogenesis rate. PMID:25961931