
Sample records for 12s rrna c1494t

  1. Clinical and molecular analysis of a four-generation Chinese family with aminoglycoside-induced and nonsyndromic hearing loss associated with the mitochondrial 12S rRNA C1494T mutation

    We report here the clinical, genetic, and molecular characterization of a four-generation Chinese family with aminoglycoside-induced and nonsyndromic hearing loss. Five of nine matrilineal relatives had aminoglycoside-induced hearing loss. These matrilineal relatives exhibited variable severity and audiometric configuration of hearing impairment, despite sharing some common features: being bilateral and having sensorineural hearing impairment. Sequence analysis of mitochondrial DNA (mtDNA) in the pedigree identified 16 variants and the homoplasmic 12S rRNA C1494T mutation, which was associated with hearing loss in the other large Chinese family. In fact, the occurrence of the C1494T mutation in these genetically unrelated pedigrees affected by hearing impairment strongly indicated that this mutation is involved in the pathogenesis of aminoglycoside-induced and nonsyndromic hearing loss. However, incomplete penetrance of hearing loss indicated that the C1494T mutation itself is not sufficient to produce a clinical phenotype but requires the involvement of modifier factors for the phenotypic expression. Those mtDNA variants, showing no evolutional conservation, may not have a potential modifying role in the pathogenesis of the C1494T mutation. However, nuclear background seems to contribute to the phenotypic variability of matrilineal relatives in this family. Furthermore, aminoglycosides modulate the expressivity and penetrance of deafness associated with the C1494T mutation in this family

  2. Coexistence of mitochondrial 12S rRNA C1494T and CO1/tRNASer(UCN) G7444A mutations in two Han Chinese pedigrees with aminoglycoside-induced and non-syndromic hearing loss

    Mutations in mitochondrial DNA are one of the important causes of hearing loss. We report here the clinical, genetic, and molecular characterization of two Han Chinese pedigrees with maternally transmitted aminoglycoside-induced and nonsyndromic bilateral hearing loss. Clinical evaluation revealed the wide range of severity, age-at-onset, and audiometric configuration of hearing impairment in matrilineal relatives in these families. The penetrances of hearing loss in these pedigrees were 20% and 18%, when aminoglycoside-induced deafness was included. When the effect of aminoglycosides was excluded, the penetrances of hearing loss in these seven pedigrees were 10% and 15%. Sequence analysis of the complete mitochondrial genomes in these pedigrees showed the presence of the deafness-associated 12S rRNA C1494T and CO1/tRNASer(UCN) G7444A mutations. Their distinct sets of mtDNA polymorphism belonged to Eastern Asian haplogroup C4a1, while other previously identified six Chinese mitochondrial genomes harboring the C1494T mutation belong to haplogroups D5a2, D, R, and F1, respectively. This suggested that the C1494T or G7444A mutation occurred sporadically and multiplied through evolution of the mitochondrial DNA (mtDNA). The absence of functionally significant mutations in tRNA and rRNAs or secondary LHON mutations in their mtDNA suggest that these mtDNA haplogroup-specific variants may not play an important role in the phenotypic expression of the 12S rRNA C1494T and CO1/tRNASer(UCN) G7444A mutations in those Chinese families. However, aminoglycosides and other nuclear modifier genes play a modifying role in the phenotypic manifestation of the C1494T mutation in these Chinese families

  3. Molecular genetic characterization of two pedigrees with mitochondrial 12S rRNA C1494T mutation and aminoglycoside-induced hearing loss%两个线粒体12S rRNA C1494T突变及药物性耳聋家系的分子遗传学研究

    李海峰; 陈智斌; 邢光前


    目的:探讨2个氨基糖甙类药物性耳聋及非综合征型耳聋家系的分子遗传学特征.方法:收集家系成员外周血样,常规方法提取基因组DNA.首先,利用基因芯片对中国人4个常见耳聋基因的9个突变热点进行分子筛查,9个位点分别为:CJB2基因的35 delG、176 de116、235 delC和299 delAT;GJB3基因的538 C>T;PDS基因的IVS7-2 A>G和2168 A>G以及mtDNA 12S rRNA基因的1494 C>T和1555 A>G.然后,对两家系的先证者分别进行线粒体DNA全序列及核基因TRMU和MTO1编码区的PCR扩增和测序分析.结果:芯片检测发现两家系的7名母系成员均存在同质性mtDNA 12S rRNA C1494T突变.与修正的剑桥参考序列相比,2名先证者的mtDNA全序列分析共检测到53个碱基变异,但除已知的12S rRNA C1494T突变外,其余52个碱基变异均为已报道的多态性位点;两家系先证者线粒体单体型分别是D4和D5a;TRMU和MTO1基因序列分析无异常发现.结论:线粒体DNA 12SrRNA C1494T突变是两个家系耳聋发生的主要分子基础,而氨基糖甙类抗生素的应用增强了该突变的表型表达:未能证实线粒体单体型以及核基因TRMU和MTO1对家系成员C1494T突变的表型具有修饰作用.%Objective:To explore the molecular genetic characterization of two families with aminoglycoside-induced and nonsyndromie sensofineural hearing loss. Methods:Blood samples were obtained from 7 maternal members and I married-in spouse of the two families. Genomic DNA was extracted with conventional method. Firstly, 9 hot spots for mutations in four most common pathologic genes, GJB2, GJB3, SLC26A4 and mitochondrial 12S rRNA, were screened with the DNA mieroarray to detect the deafness-associated mutations. The whole mitochondrial genomes and nuclear modifier genes TRMU and MTO1 of two probands were then PCR amplified and submitted for sequence analysis. Results:Mitochondrial 12S rRNA C1494T mutation was detected in all 7 maternal members of

  4. mtDNA mutation C1494T, haplogroup A, and hearing loss in Chinese

    Mutation C1494T in mitochondrial 12S rRNA gene was recently reported in two large Chinese families with aminoglycoside-induced and nonsyndromic hearing loss (AINHL) and was claimed to be pathogenic. This mutation, however, was first reported in a sample from central China in our previous study that was aimed to reconstruct East Asian mtDNA phylogeny. All these three mtDNAs formed a subclade defined by mutation C1494T in mtDNA haplogroup A. It thus seems that mutation C1494T is a haplogroup A-associated mutation and this matrilineal background may contribute a high risk for the penetrance of mutation C1494T in Chinese with AINHL. To test this hypothesis, we first genotyped mutation C1494T in 553 unrelated individuals from three regional Chinese populations and performed an extensive search for published complete or near-complete mtDNA data sets (>3000 mtDNAs), we then screened the C1494T mutation in 111 mtDNAs with haplogroup A status that were identified from 1823 subjects across China. The search for published mtDNA data sets revealed no other mtDNA besides the above-mentioned three carrying mutation C1494T. None of the 553 randomly selected individuals and the 111 haplogroup A mtDNAs was found to bear this mutation. Therefore, our results suggest that C1494T is a very rare event. The mtDNA haplogroup A background in general is unlikely to play an active role in the penetrance of mutation C1494T in AINHL

  5. New polymorphic mtDNA restriction site in the 12S rRNA gene detected in Tunisian patients with non-syndromic hearing loss

    The 12S rRNA gene was shown to be a hot spot for aminoglycoside-induced and non-syndromic hearing loss since several deafness-associated mtDNA mutations were identified in this gene. Among them, we distinguished the A1555G, the C1494T and the T1095C mutations and C-insertion or deletion at position 961. One hundred Tunisian patients with non-syndromic hearing loss and 100 hearing individuals were analysed in this study. A PCR-RFLP analysis with HaeIII restriction enzyme showed the presence of the A1555G mutation in the 12S rRNA gene in only one out of the 100 patients. In addition, PCR-RFLP and radioactive PCR revealed the presence of a new HaeIII polymorphic restriction site in the same gene of 12S rRNA site in 4 patients with non-syndromic hearing loss. UVIDOC-008-XD analyses showed the presence of this new polymorphic restriction site with a variable heteroplasmic rates at position +1517 of the human mitochondrial genome. On the other hand, direct sequencing of the entire mitochondrial 12S rRNA gene in the 100 patients and in 100 hearing individuals revealed the presence of the A750G and A1438G polymorphisms and the absence of the C1494T, T1095C and 961insC mutations in all the tested individuals. Sequencing of the whole mitochondrial genome in the 4 patients showing the new HaeIII polymorphic restriction site revealed only the presence of the A8860G transition in the MT-ATP6 gene and the A4769G polymorphism in the ND2 gene

  6. Louse (Insecta : Phthiraptera) mitochondrial 12S rRNA secondary structure is highly variable

    Page, R.D.M.; Cruickshank, R.; Johnson, K P


    Lice are ectoparasitic insects hosted by birds and mammals. Mitochondrial 12S rRNA sequences obtained from lice show considerable length variation and are very difficult to align. We show that the louse 12S rRNA domain III secondary structure displays considerable variation compared to other insects, in both the shape and number of stems and loops. Phylogenetic trees constructed from tree edit distances between louse 12S rRNA structures do not closely resemble trees constructed from sequence ...

  7. Mitochondrial COX2 G7598A Mutation May Have a Modifying Role in the Phenotypic Manifestation of Aminoglycoside Antibiotic-Induced Deafness Associated with 12S rRNA A1555G Mutation in a Han Chinese Pedigree

    Chen, Tianbin; Liu, Qicai; Jiang, Ling; Liu, Can


    Recent studies suggest that certain mitochondrial haplogroup markers and some specific variants in mitochondrial haplogroup may also influence the phenotypic expression of particular mitochondrial disorders. In this report, the clinical, genetic, and molecular characterization were identified in a Chinese pedigree with the aminoglycoside antibiotic (AmAn)-induced deafness and nonsyndromic hearing loss (NSHL). The pathogenic gene responsible for this hereditary NSHL pedigree was determined by Microarray chip, which possessed the nine NSHL hot-spot mutations, including GJB2 (35delG, 176dell6bp, 235de1C, and 299delAT), GJB3 (538C>T), SLC26A4 (IVS7-2A>G and 2168A>G), and mitochondrial DNA (mtDNA) 12S rRNA (C1494T and A1555G). Only the homoplasmic A1555G mutation was detected, which was confirmed by direct sequencing. Also, real-time amplification refractory mutation system quantitative polymerase chain reaction methodology was performed to calculate the A1555G mutation load. The proband's complete mtDNA genome were amplified and direct sequencing was performed to determine the mitochondrial haplogroup and private mutations. The proband's mitochondrial haplogroup belonges to M7b1 and a private mutation MTCOX2 G7598A (p.Ala 5 Thr) is found. Phylogenetic analysis of COX2 polypeptide sequences demonstrates that the alanine residue is relatively conserved, but owing to the missense mutation (p.Ala 5 Thr), its side chain hydrophobicity will be changed, and what is more, as it is adjacent to a glutamine residue, which is highly conserved and hydrophilic, in an evolutionary stable domain; G7598A (p.Ala 5 Thr) may alter the protein secondary structure and physiological function of COX2 and, thus, aggravate the mitochondrial dysfunction conferred by the A1555G mutation. Furthermore, the G7598A mutation is absent in 100 unrelated healthy controls; therefore, G7598A (p.Ala 5 Thr) in the mitochondrial haplogoup M7b1 may have a modifying role, enhancing its penetrance and severity

  8. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness.

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan


    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general. PMID:26119842

  9. The phylogenetic relationship of the family Lutjanidae based on analyses of AFLP and mitochondrial 12S rRNA sequences

    ZHANG Junbin; LIU Xin


    Fishes of the family Lutjanidae are commercially important in South China Sea. However,the phylogeny of Lutjanids is still unclear and there are many controversies over it. Herein, studies about the phylogeny of Lutjanids were performed based on Amplified Fragment Length Polymorphism (AFLP) analysis of genome DNA and sequence analysis of mitochondrial 12S rRNA gene, and 10 Lutjanidae species and 1 Lethrinidae species were employed.The topologies of minimum evolution (ME) trees based on the two analyses respectively were congruent except for positions of genera Pristipomoides and Caesio. The optimal substitution model TrN + G for DNA sequences of 12S rRNA genes in Lutjanids was obtained using MODELTEST 3.6 software and maximum likelihood (ML) analysis supports the topology displayed by the ME tree. The test of log-likelihood suggests that the use of molecular clock calibrations to estimate species divergence time appeared valid. Phylogenetic analyses using AFLP data and DNA sequences of mitochondrial 12S rRNA genes indicated the monophyly of Lutjanus genra. However, further studies are required to reveal the phylogenetic relationship among other genera. In addition, the results demonstrated that AFLP genetic marker was suitable for the phylogenetic analysis of Lutjanids.

  10. Application of 12S rRNA in the identification of Muntiacus crinifons and Muntiacus reevesi%12S rRNA在黑麂和黄麂物种鉴定中的应用

    贺培建; 阮向东; 方盛国


    The gene of 12S rRNA exhibits a high degree of conservation during animal evolution. Its sequence shows partial difference among species but little variation among individuals of the same species. Therefore, the 12S rRNA could be used to perform intra-and inter-specific identification studies. All the deer of genus Muntiacus become endangered due to excessive poaching and thus protected by Chinas Wildlife Protection Law at the national and provincial level. In this study, we employed the sequencing of 12S rRNA to identify two confiscated samples and found out that the two samples were Mwttiacus crinifons and Mwttiacus reevesi,respectively. The sequence of the 12S rRNA adopted in this study proved to be a suitable genetic marker for species identification of conservation animals.

  11. Interordinal mammalian relationships: evidence for paenungulate monophyly is provided by complete mitochondrial 12S rRNA sequences.

    Lavergne, A; Douzery, E; Stichler, T; Catzeflis, F M; Springer, M S


    The complete mitochondrial 12S rRNA sequences of 5 placental mammals belonging to the 3 orders Sirenia, Proboscidea, and Hyracoidea are reported together with phylogenetic analyses (distance and parsimony) of a total of 51 mammalian orthologues. This 12S rRNA database now includes the 2 extant proboscideans (the African and Asiatic elephants Loxodonta africana and Elephas maximus), 2 of the 3 extant sirenian genera (the sea cow Dugong dugon and the West Indian manatee Trichechus manatus), and 2 of the 3 extant hyracoid genera (the rock and tree hyraxes Procavia capensis and Dendrohyrax dorsalis). The monophyly of the 3 orders Sirenia, Proboscidea, and Hyracoidea is supported by all kinds of analysis. There are 23 and 3 diagnostic subsitutions shared by the 2 proboscideans and the 2 hyracoids, respectively, but none by the 2 sirenians. The 2 proboscideans exhibit the fastest rates of 12S rRNA evolution among the 11 placental orders studied. Based on various taxonomic sampling methods among eutherian orders and marsupial outgroups, the most strongly supported clade in our comparisons clusters together the 3 orders Sirenia, Proboscidea, and Hyracoidea in the superorder Paenungulata. Within paenungulates, the grouping of sirenians and proboscideans within the mirorder Tethytheria is observed. This branching pattern is supported by all analyses by high bootstrap percentages (BPs) and decay indices. When only one species is selected per order or suborder, the taxonomic sampling leads to a relative variation in bootstrap support of 53% for Tethytheria (BPs ranging from 44 to 93%) and 7% for Paernungulata (92-99%). When each order or suborder is represented by two species, this relative variation decreased to 10% for Tethytheria (78-87%) and 3% for Paenungulata (96-99%). Two nearly exclusive synapomorphies for paenungulates are identified in the form of one transitional compensatory change, but none were detected for tethytherians. Such a robust and reliable resolution of

  12. Seabird and louse coevolution: complex histories revealed by 12S rRNA sequences and reconciliation analyses.

    Paterson, A M; Wallis, G P; Wallis, L J; Gray, R D


    We investigated the coevolutionary history of seabirds (orders Procellariiformes and Sphenisciformes) and their lice (order Phthiraptera). Independent trees were produced for the seabirds (tree derived from 12S ribosomal RNA, isoenzyme, and behavioral data) and their lice (trees derived from 12S rRNA data). Brook's parsimony analysis (BPA) supported a general history of cospeciation (consistency index = 0.84, retention index = 0.81). We inferred that the homoplasy in the BPA was caused by one intrahost speciation, one potential host-switching, and eight or nine sorting events. Using reconciliation analysis, we quantified the cost of fitting the louse tree onto the seabird tree. The reconciled trees postulated one host-switching, nine cospeciation, three or four intrahost speciation, and 11 to 14 sorting events. The number of cospeciation events was significantly more than would be expected from chance alone (P seabirds and lice. Neither data set displayed significant rate heterogeneity. An examination of the codivergent nodes revealed that seabirds and lice have cospeciated synchronously and that lice have evolved at approximately 5.5 times the rate of seabirds. The degree of sequence divergence supported some of the postulated intrahost speciation events (e.g., Halipeurus predated the evolution of their present hosts). The sequence data also supported some of the postulated host-switching events. These results demonstrate the value of sequence data and reconciliation analyses in unraveling complex histories between hosts and their parasites. PMID:12116418

  13. Sequence Characterization of Mitochondrial 12S rRNA Gene in Mouse Deer (Moschiola indica for PCR-RFLP Based Species Identification

    Chandra Mohan Siddappa


    Full Text Available Mitochondrial 12S rRNA has proven to be a useful molecular marker for better conservation and management of the endangered species. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP of the mitochondrial 12S rRNA gene has proven to be a reliable and efficient tool for the identification of different Indian deer species of family cervidae. In the present study, mitochondrial 12S rRNA gene sequence of mouse deer (Moschiola indica belonging to the family Tragulidae was characterized and analysed in silico for its use in species identification. Genomic DNA was isolated from the hair follicles and mitochondrial 12S rRNA gene was amplified using universal primers. PCR product was cloned and sequenced for the first time. The sequence of mouse deer showed 90.04, 90.08, 90.04, 91.2, 90.04, and 90.08% identities with sika deer, sambar, hog deer, musk deer, chital, and barking deer, respectively. Restriction mapping in Lasergene (DNAstar Inc., Madison, WI, USA revealed that mouse deer mitochondrial 12S rRNA gene sequence can be differentiated from the other deer species in PCR-RFLP using RsaI, DdeI, BsrI, and BstSFI. With the help of predicted pattern, mouse deer can be identified using genomic DNA from a variety of biomaterials, thereby providing molecular aid in wildlife forensics and conservation of the species.

  14. Mutational analysis of the mitochondrial 12S rRNA and tRNASer(UCN) genes in Tunisian patients with nonsyndromic hearing loss

    We explored the mitochondrial 12S rRNA and the tRNASer(UCN) genes in 100 Tunisian families affected with NSHL and in 100 control individuals. We identified the mitochondrial A1555G mutation in one out of these 100 families and not in the 100 control individuals. Members of this family harbouring the A1555G mutation showed phenotypic heterogeneity which could be explained by an eventual nuclear-mitochondrial interaction. So, we have screened three nuclear genes: GJB2, GJB3, and GJB6 but we have not found correlation between the phenotypic heterogeneity and variants detected in these genes. We explored also the entire mitochondrial 12S rRNA and the tRNASer(UCN) genes. We detected five novel polymorphisms: T742C, T794A, A813G, C868T, and C954T, and 12 known polymorphisms in the mitochondrial 12S rRNA gene. None of the 100 families or the 100 controls were found to carry mutations in the tRNASer(UCN) gene. We report here First mutational screening of the mitochondrial 12S rRNA and the tRNASer(UCN) genes in the Tunisian population which describes the second family harbouring the A1555G mutation in Africa and reveals novel polymorphisms in the mitochondrial 12S rRNA gene

  15. Frequency and spectrum of mitochondrial 12S rRNA variants in 440 Han Chinese hearing impaired pediatric subjects from two otology clinics

    Zhou Jianjin


    Full Text Available Abstract Background Aminoglycoside ototoxicity is one of the common health problems. Mitochondrial 12S rRNA mutations are one of the important causes of aminoglycoside ototoxicity. However, the incidences of 12S rRNA mutations associated with aminoglycoside ototoxicity are less known. Methods A total of 440 Chinese pediatric hearing-impaired subjects were recruited from two otology clinics in the Ningbo and Wenzhou cities of Zhejiang Province, China. These subjects underwent clinical, genetic evaluation and molecular analysis of mitochondrial 12S rRNA. Resultant mtDNA variants were evaluated by structural and phylogenetic analysis. Results The study samples consisted of 227 males and 213 females. The age of all participants ranged from 1 years old to 18 years, with the median age of 9 years. Ninety-eight subjects (58 males and 40 females had a history of exposure to aminoglycosides, accounting for 22.3% cases of hearing loss in this cohort. Molecular analysis of 12S rRNA gene identified 41 (39 known and 2 novel variants. The incidences of the known deafness-associated 1555A > G, 1494C > T and 1095T > C mutations were 7.5%, 0.45% and 0.91% in this entire hearing-impaired subjects, respectively, and 21.4%, 2% and 2% among 98 subjects with aminoglycoside ototoxicity, respectively. The structural and phylogenetic evaluations showed that a novel 747A > G variant and known 839A > G, 1027A > G, 1310C > T and 1413T > C variants conferred increased sensitivity to aminoglycosides or nonsyndromic deafness as they were absent in 449 Chinese controls and localized at highly conserved nucleotides of this rRNA. However, other variants were polymorphisms. Of 44 subjects carrying one of definite or putative deafness-related 12S rRNA variants, only one subject carrying the 1413T > C variant harbored the 235DelC/299DelAT mutations in the GJB2 gene, while none of mutations in GJB2 gene was detected in other 43 subjects. Conclusions Mutations in mitochondrial 12S rRNA

  16. Allele-specific PCR for detecting the deafness-associated mitochondrial 12S rRNA mutations.

    Ding, Yu; Xia, Bo-Hou; Liu, Qi; Li, Mei-Ya; Huang, Shui-Xian; Zhuo, Guang-Chao


    Mutations in mitochondrial 12S rRNA (MT-RNR1) are the important causes of sensorineural hearing loss. Of these mutations, the homoplasmic m.1555A>G or m.1494C>T mutation in the highly conserved A-site of MT-RNR1 gene has been found to be associated with both aminoglycoside-induced and non-syndromic hearing loss in many families worldwide. Since the m.1555A>G and m.1494C>T mutations are sensitive to ototoxic drugs, therefore, screening for the presence of these mutations is important for early diagnosis and prevention of deafness. For this purpose, we recently developed a novel allele-specific PCR (AS-PCR) which is able to simultaneously detect these mutations. To assess its accuracy, in this study, we employed this method to screen the frequency of m.1555A>G and m.1494C>T mutations in 200 deafness patients and 120 healthy subjects. Consequently, four m.1555A>G and four m.1494C>T mutations were identified; among these, only one patient with the m.1494C>T mutation had an obvious family history of hearing loss. Strikingly, clinical evaluation showed that this family exhibited a high penetrance of hearing loss. In particular, the penetrances of hearing loss were 80% with the aminoglycoside included and 20% when excluded. PCR-Sanger sequencing of the mitochondrial genomes confirmed the presence of the m.1494C>T mutation and identified a set of polymorphisms belonging to mitochondrial haplogroup A. However, the lack of functional variants in mitochondrial and nuclear modified genes (GJB2 and TRMU) in this family indicated that mitochondrial haplogroup and nuclear genes may not play important roles in the phenotypic expression of the m.1494C>T mutation. Thus, other modification factors, such as environmental factor, aminoglycosides or epigenetic modification may have contributed to the high penetrance of hearing loss in this family. Taken together, our data showed that this assay is an effective approach that could be used for detection the deafness-associated MT-RNR1

  17. Molecular phylogeny of the Cricetinae subfamily based on the mitochondrial cytochrome b and 12S rRNA genes and the nuclear vWF gene

    Neumann, K.; Michaux, Johan,; Lebedev, V.; N Yigit; Colak, E.; Ivanova, N.; Poltoraus, A.; Surov, A.; Markov, G.; Maak, S.; Neumann, S.; Gattermann, R.


    Despite some popularity of hamsters as pets and laboratory animals there is no reliable phylogeny of the subfamily Cricetinae available so far. Contradicting views exist not only about the actual number of species but also concerning the validity of several genera. We used partial DNA sequences of two mitochondrial (cytochrome b, 12S rRNA) and one partial nuclear gene (von Willebrand Factor exon 28) to provide a first gene tree of the Cricetinae based on 15 taxa comprising six genera: Accordi...

  18. Evaluation of the 16S and 12S rRNA genes as universal markers for the identification of commercial fish species in South Africa.

    Cawthorn, Donna-Mareè; Steinman, Harris Andrew; Witthuhn, R Corli


    The development of DNA-based methods for the identification of fish species is important for fisheries research and control, as well as for the detection of unintentional or fraudulent species substitutions in the marketplace. The aim of this study was to generate a comprehensive reference database of DNA sequences from the mitochondrial 16S and 12S ribosomal RNA (rRNA) genes for 53 commercial fish species in South Africa and to evaluate the applicability of these genetic markers for the identification of fish at the species level. The DNA extracted from all target species was readily amplified using universal primers targeting both rRNA gene regions. Sequences from the 16S and 12S rRNA genes were submitted to GenBank for the first time for 34% and 53% of the fish species, respectively. Cumulative analysis of the 16S rRNA gene sequences revealed mean conspecific, congeneric and confamilial Kimura two parameter (K2P) distances of 0.03%, 0.70% and 5.10% and the corresponding values at the 12S level were 0.03%, 1.00% and 5.57%. K2P neighbour-joining trees based on both sequence datasets generally clustered species in accordance with their taxonomic classifications. The nucleotide variation in both the 16S and 12S sequences was suitable for identifying the large majority of the examined fish specimens to at least the level of genus, but was found to be less useful for the explicit differentiation of certain congeneric fish species. It is recommended that one or more faster-evolving DNA regions be analysed to confirm the identities of closely-related fish species in South Africa. PMID:21963445

  19. Population genetic structure of Cheyletus malaccensis (Acari: Cheyletidae) in China based on mitochondrial COI and 12S rRNA genes.

    Yang, Xiaoqiang; Ye, Qingtian; Xin, Tianrong; Zou, Zhiwen; Xia, Bin


    Cheyletus malaccensis is a predatory mite widely distributed in grain storages. It has been regarded as an important biological control agent for pest mites. In this study, we investigated the population genetic structure of C. malaccensis distributed in China based on the partial regions of mitochondrial COI and 12S rRNA genes. We collected 256 individuals of C. malaccensis from stored grain in 34 sites of China. We detected 50 COI gene haplotypes and nine 12S rRNA gene haplotypes. There were three clades in the haplotype network and Bayesian and maximum parsimony phylogenetic trees based on COI sequences, and two based on 12S rRNA sequences. The clustering of haplotypes was not correlated with their geographical distributions. The analysis of molecular variance, AMOVA, indicated that the genetic differentiation between populations was relatively weak. The major genetic differentiation was found within populations. We suggest that the genetic structure of C. malaccensis observed in this study may be the result of long-term climate fluctuations and recent human disturbances. PMID:26947027

  20. Characterization of 12S rRNA gene for meat identification of common wild and domestic small herbivores as an aid to wildlife forensic

    E. Joseph


    Full Text Available Aim: Chital and sambar are the common wild small herbivores, which are vulnerable to poaching for their meat. Many times poachers claim the wild meat to be that of goat or sheep. Hence, authentic evidences are required to stop such wildlife crime. The present investigation was carried out to study the species specific PCR-RFLP patterns for meat identification of chital and sambar and then differentiation from the meat of goat and sheep. Materials and Methods: Extracted DNA from meat samples were subjected to PCR using the universal primers of 12S rRNA gene. The PCR products were subjected to RFLP and sequencing. Results: The size of amplified PCR products was similar (440 bp in each species and sequence alignment showed more than 89 % similarities among these species. However, phylogenetic analysis revealed that Chital and Sambar are in one cluster while Goat and sheep are in other cluster. To differentiate between species, restriction digestion of the PCR products was carried out to produce characteristic PCR-RFLP patterns for each species. Restriction digestion with RsaI and AluI enzymes produced distinct PCR-RFLP patterns that differentiated the meat of wild species (chital-sambar from that of domestic species (goat-sheep. BsrI restriction digestion revealed unique PCR-RFLP pattern in chital differentiating it from the meat of other three species. Restriction digestion with DdeI enzyme led to the production of distinct PCR-RFLP patterns for chital and sambar to identify their meat individually. Conclusion: This study showed the effectiveness of 12S rRNA gene polymorphism in meat identification. The data can be used as evidence against the poachers to convict the wildlife crime in the court of law [Vet World 2013; 6(5.000: 254-259

  1. Nuclear modifier MTO2 modulates the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    Xiangyu He

    Full Text Available The phenotypic manifestations of mitochondrial DNA (mtDNA mutations are modulated by mitochondrial DNA haplotypes, nuclear modifier genes and environmental factors. The yeast mitochondrial 15S rRNA C1477G (P(R or P(R 454 mutation corresponds to the human 12S rRNA C1494T and A1555G mutations, which are well known as primary factors for aminoglycoside-induced nonsyndromic deafness. Here we report that the deletion of the nuclear modifier gene MTO2 suppressed the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae. First, the strain with a single mtDNA C1477G mutation exhibited hypersensitivity to neomycin. Functional assays indicated that the steady-state transcription level of mitochondrial DNA, the mitochondrial respiratory rate, and the membrane potential decreased significantly after neomycin treatment. The impaired mitochondria could not produce sufficient energy to maintain cell viability. Second, when the mto2 null and the mitochondrial C1477G mutations co-existed (mto2(P(R, the oxygen consumption rate in the double mutant decreased markedly compared to that of the control strains (MTO2(P(S, mto2(P(S and MTO2(P(R. The expression levels of the key glycolytic genes HXK2, PFK1 and PYK1 in the mto2(P(R strain were stimulated by neomycin and up-regulated by 89%, 112% and 55%, respectively. The enhanced glycolysis compensated for the respiratory energy deficits, and could be inhibited by the glycolytic enzyme inhibitor. Our findings in yeast will provide a new insight into the pathogenesis of human deafness.

  2. Prevalence of the A1555G (12S rRNA and tRNA Ser(UCN mitochondrial mutations in hearing-impaired Brazilian patients

    Abreu-Silva R.S.


    Full Text Available Mitochondrial mutations are responsible for at least 1% of the cases of hereditary deafness, but the contribution of each mutation has not yet been defined in African-derived or native American genetic backgrounds. A total of 203 unselected hearing-impaired patients were screened for the presence of the mitochondrial mutation A1555G in the 12S rRNA gene and mutations in the tRNA Ser(UCN gene in order to assess their frequency in the ethnically admixed Brazilian population. We found four individuals with A1555G mutation (2%, which is a frequency similar to those reported for European-derived populations in unselected samples. On the other hand, complete sequencing of the tRNA Ser(UCN did not reveal reported pathogenic substitutions, namely A7445G, 7472insC, T7510C, or T7511C. Instead, other rare substitutions were found such as T1291C, A7569G, and G7444A. To evaluate the significance of these findings, 110 "European-Brazilians" and 190 "African-Brazilians" unrelated hearing controls were screened. The T1291C, A7569G and G7444A substitutions were each found in about 1% (2/190 of individuals of African ancestry, suggesting that they are probably polymorphic. Our results indicate that screening for the A1555G mutation is recommended among all Brazilian deaf patients, while testing for mutations in the tRNA Ser(UCN gene should be considered only when other frequent deafness-causing mutations have been excluded or in the presence of a maternal transmission pattern.

  3. Extremely low penetrance of deafness associated with the mitochondrial 12S rRNA mutation in 16 Chinese families: Implication for early detection and prevention of deafness

    Mutations in mitochondrial DNA (mtDNA) have been found to be associated with sensorineural hearing loss. We report here the clinical, genetic, and molecular characterization of 16 Chinese pedigrees (a total of 246 matrilineal relatives) with aminoglycoside-induced impairment. Clinical evaluation revealed the variable phenotype of hearing impairment including audiometric configuration in these subjects, although these subjects share some common features: being bilateral and sensorineural hearing impairment. Strikingly, these Chinese pedigrees exhibited extremely low penetrance of hearing loss, ranging from 4% to 18%, with an average of 8%. In particular, nineteen of 246 matrilineal relatives in these pedigrees had aminoglycoside-induced hearing loss. Mutational analysis of the mtDNA in these pedigrees showed the presence of homoplasmic 12S rRNA A1555G mutation, which has been associated with hearing impairment in many families worldwide. The extremely low penetrance of hearing loss in these Chinese families carrying the A1555G mutation strongly supports the notion that the A1555G mutation itself is not sufficient to produce the clinical phenotype. Children carrying the A1555G mutation are susceptible to the exposure of aminoglycosides, thereby inducing or worsening hearing impairment, as in the case of these Chinese families. Using those genetic and molecular approaches, we are able to diagnose whether children carry the ototoxic mtDNA mutation. Therefore, these data have been providing valuable information and technology to predict which individuals are at risk for ototoxicity, to improve the safety of aminoglycoside therapy, and eventually to decrease the incidence of deafness

  4. 两个母系遗传氨基糖苷类抗生素致聋家系线粒体DNA 12S rRNA A1555G突变的分子遗传学研究%Molecular Genetic Study of Two Chinese Pedigrees with Maternally Inherited Hearing Loss Mitochondrial 12S RRNA A1555G Mutation

    孙艺; 杨长亮; 罗燕云; 阳光; 杨慧; 朱丽; 姚行齐


    目的 探讨两个氨基糖苷类药物性耳聋大家系的分子遗传学特征.方法 对两个非综合征型感音神经耳聋大家系的成员进行病史调查、全身体检、纯音听阈、声导抗检查;收集、整理临床听力学资料;进行家系遗传学特征的分析并绘制系谱图.收集两个大家系成员的外周静脉血样本,从白细胞中提取基因组DNA,聚合酶链反应扩增,应用直接测序法检测中国人常见的药物性耳聋相关基因——线粒体DNA12S rRNA A1555G突变.结果 根据调查两个家系均来自湖北省,所有母系受检者存在线粒体DNA 12S rRNA 1555位点A→G的突变.结论 线粒体DNA A1555G点突变是导致两个大家系致聋的主要因素之一,具有母系遗传耳聋特点.

  5. 两个携带线粒体12S rRNA 1494C>T突变的耳聋家系的遗传学特征%Characterization of two Chinese families with aminoglycoside-induced and nonsyndromic hearing loss both carrying a mitochondrial 12S rRNA 1494C>T mutation

    龚莎莎; 管敏鑫; 陈波蓓; 彭光华; 郑静; 张婷; 郑斌娇; 方芳; 张初琴; 吕建新


    Objective To evaluate the effect of mitochondrial DNA(mtDNA) secondary mutations,haplotypes,GJB2 gene mutations on phenotype of 1494C > T mutation,and to study the molecular pathogenic mechanism of maternally transmitted aminoglycoside-induced and nonsyndromic hearing loss.Methods Two Chinese Han pedigrees of maternally transmitted aminoglycoside induced and nonsyndromic hearing loss were collected.The two probands and their family members underwent clinical,genetic and molecular evaluations including audiological examinations and mutational analysis of mitochondrial genome and GJB2 gene.Results Clinical evaluation revealed wide range of severity,age-at-onset and audiometric configuration of hearing impairment in matrilineal relatives in both families,for which the penetrance of hearing loss was respectively 42.9 % and 28.6% when aminoglycoside-induced deafness was included.When the effect of aminoglycosides was excluded,the penetrances of hearing loss were 14.3% and 14.3%.Sequence analysis of mitochondrial genomes identified a known 12S rRNA 1494C>T mutation,in addition with distinct sets of mtDNA polymorphisms belonging to Eastern Asian haplogroups C4a1a and B4b1c,respectively.Conclusion Mitochondrial 12S rRNA 1494C>T mutation probably underlie the deafness in both families.Lack of significant mutation in the GJB2 gene ruled out involvement of GJB2 in the phenotypic expression.However,aminoglycosides and other nuclear modifier genes may still modify the phenotype of the 1494C>T mutation in these families.The B4b1c is a newly identified haplogroup in aminoglycoside-induced and nonsyndromic hearing loss family carrying the 1494C>T mutation.The 1494C>T mutation seems to have occurred sporadically through evolution.

  6. Human TRMU encoding the mitochondrial 5-methylaminomethyl-2-thiouridylate-methyltransferase is a putative nuclear modifier gene for the phenotypic expression of the deafness-associated 12S rRNA mutations

    Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations

  7. Mitochondrial 12S rRNA A1555G mutation associated with nonsyndromic hearing loss in twenty-five Han Chinese pedigrees%25个携带线粒体12S rRNA A1555G 突变的中国汉族非综合征型耳聋家系

    彭光华; 朱翌; 吕建新; 陈波蓓; 管敏鑫; 郑斌娇; 方芳; 伍越; 梁玲芝; 郑静; 南奔宇; 余啸; 唐霄雯


    Mitochondrial 12S rRNA A1555AG mutation is one of the important causes of aminoglycoside-induced and nonsyndromic deafness. We report here the cilinical, genetic and molecular characterization of 25 Chinese families carrying the A1555G mutation.Clinical and genetic characterizations of these Chinese families exhibited a wide range of penetrance, severity and age-at-onset of hearing impairment. The average penetrances of deafness were 28.1% and 21.5%, respectively, when aminoglycoside-induced hearing loss was included or excluded. Furthermore, the average age-of-onset for deafness without aminoglycoside exposure ranged from 1 and 15 years old. Their mitochondrial genomes exhibited distinct sets of polymorphisms including 16 novel variants, belonging to ten Eastern Asian haplogroups A, B, D, F, G, M, N and R, respectively. Strikingly, these Chinese families carrying mitochondrial haplogroup B exhibited higher penetrance and expressivity of hearing loss. In addition, 7 known secondary mutations and 21 variants resided at the highly conservative residues may enhance the penetrace of hearing loss in these Chinese families. Moreover, the absence of mutation in GJB2 gene suggested that GJB2 may not be a modifier for the phenotypic expression of the A1555G mutation in these Chinese families. These observations suggested that mitochondrial haplotypes and other modifiers may modulate the variable penetrance and expressivity of deafness among these Chinese families.%线粒体12S rRNA A1555G 突变是引起氨基糖甙类药物诱导的非综合征型耳聋的重要原因之一.文章对 收集的25 个携带A1555G 突变的中国汉族非综合征型耳聋家系进行了临床和分子遗传学评估.结果表明,这 25 个家系的母系成员在耳聋外显率、听力损失严重程度和发病年龄上存在较大差异.当包括和不包括氨基糖 甙类药物使用史时,耳聋的平均外显率分别为28.1%和21.5%,排除氨基糖甙类药物

  8. Analysis on hot spot mutations of GJB2 gene and mitochondrial DNA 12S rRNA among consanguineous induced deafness families%近亲婚配致聋家系中患者GJB2和线粒体DNA 12S rRNA基因突变热点分析

    杨威; 付四清; 董家曙; 王春芳; 陈观明


    Objective: To analyze the frequencies of hot spot mutations of the two common deafness gene - GJB2 and mitochondrial DNA 12S rRNA in the consanguineous induced deafness families. Methods: 25 consanguineous induced deafness families received comprehensive physical examination and pure tone test, 48 cases were found, 3 mi venous blood samples were obtained to extract DNA, polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) targeted to specific genes were performed, the cases with mutation were confirmed by gene sequencing. Results: 1 case was found with 235delC homozygous mutation of GJB2 gene, 3 cases were found with heterozygous mutation; no A 1555G mutation was found in mitochondrial DNA 12S rRNA. Conclusion: The most of consanguineous induced deafness are autosomal recessive inheritance, but the incidence of 235delC mutation of GJB2 gene is low.%目的:分析GJB2和线粒体DNA 12S rRNA两种常见耳聋致病基因突变热点在近亲婚配致聋家系患者中的发生频率.方法:对25个近亲结婚致聋核心家系的后代进行全面的体格检查和纯音测试,共发现患者48例,采静脉血3 ml,提取DNA,针对特定基因,进行聚合酶链式反应(Polymerase chain reaction,PCR)及限制性片段长度多态性(Restriction fragmentlength polymorphism,RFLP)分析,发现突变者测序验证.结果:发现GJB2基因235delC纯合突变1例,杂合突变3例;未发现线粒体DNA 12S rRNA A1555G突变.结论:近亲结婚家系中遗传性聋多为常染色体隐性遗传,但GJB2基因235delc突变的发生率较低.

  9. 线粒体tRNAThr T15943C突变可能是影响耳聋相关12s rRNA A1555G突变表型表达的新突变位点%Mitochondrial tRNAThr T15943C mutation may be a new position that affects the phenotypic expression of deafness associated 12s rRNA A1555G mutation

    肖红利; 何哲耘; 高应龙; 阳娅玲; 郑静; 蔡朝阳; 郑斌娇; 唐霄雯; 管敏鑫


    目的 通过对一个中国汉族耳聋家系进行分析研究,探索与耳聋相关的新的继发突变位点.方法 对一个中国汉族耳聋家系进行临床和分子遗传学特征分析,然后建立永生化淋巴母细胞系,从细胞倍增时间和活性氧等部分功能实验方面进行验证.结果 家系内听力下降的母系成员在听力损失程度和听力曲线方面存在差异.该家系耳聋外显率较高,包括药物致聋的耳聋外显率为66.7%,而非药物致聋的外显率为44.4%.对先证者及母系成员进行线粒体DNA全序列分析,发现除了12s rRNA A1555G和tRNAThrT15943C突变位点外,其余33个均为已报道的多态性位点.进一步的单体型进化树分析发现,该家系属于东亚线粒体单体型F.15943位点位于tRNAThr T茎结构上,该位点发生T-C碱基变化时会破坏tRNAThr二级结构上十分保守的T-A碱基对.细胞功能实验表明,与相同F单体型的正常对照组和仅携带12s rRNA A1555G单突变家系相比,该双突变耳聋家系永生细胞系的细胞倍增时间均较其他两个对照组延长,活性氧水平则增高.结论 线粒体tRNAThr T15943C突变可能作为潜在的修饰因子与12s rRNAA1555G突变相互作用,从而增强耳聋外显率和表现度.%Objective To identify secondary mutations associated with deafness in a Chinese family affected with deafness.Methods The family has been subjected to clinical and molecular analyses,in addition with measurement of reactive oxygen species and doubling time after establishment of immortalized lymphocyte cell lines.Results The results showed that the hearing loss level and audiometric configuration were discrepant among the family members with maternally transmitted hearing loss.The penetrance of hearing loss in this family was respectively 66.7% and 44.4% when aminoglycoside-induced hearing loss was included or excluded.Analysis of whole mitochondrial genome has found 33 variants as previously reported

  10. The coexistence of mitochondrial ND6 T14484C and 12S rRNA A1555G mutations in a Chinese family with Leber's hereditary optic neuropathy and hearing loss

    We report here the clinical, genetic and molecular characterization of one three-generation Han Chinese family with Leber's hereditary optic neuropathy (LHON) and hearing loss. Four of 14 matrilineal relatives exhibited the moderate central vision loss at the average age of 12.5 years. Of these, one subject exhibited both LHON and mild hearing impairment. Sequence analysis of the complete mitochondrial genomes in the pedigree showed the presence of homoplasmic LHON-associated ND6 T14484C mutation, deafness-associated 12S rRNA A1555 mutation and 47 other variants belonging to Eastern Asian haplogroup H2. None of other mitochondrial variants was evolutionarily conserved and functional significance. Therefore, the coexistence of the A1555G mutation and T14484C mutations in this Chinese family indicate that the A1555G mutation may play a synergistic role in the phenotypic manifestation of LHON associated ND6 T14484C mutation. However, the incomplete penetrance of vision and hearing loss suggests the involvement of nuclear modifier genes and environmental factors in the phenotypic expression of these mtDNA mutations

  11. MRPS18CP2 alleles and DEFA3 absence as putative chromosome 8p23.1 modifiers of hearing loss due to mtDNA mutation A1555G in the 12S rRNA gene

    Fischel-Ghodsian Nathan


    Full Text Available Abstract Background Mitochondrial DNA (mtDNA mutations account for at least 5% of cases of postlingual, nonsyndromic hearing impairment. Among them, mutation A1555G is frequently found associated with aminoglycoside-induced and/or nonsyndromic hearing loss in families presenting with extremely variable clinical phenotypes. Biochemical and genetic data have suggested that nuclear background is the main factor involved in modulating the phenotypic expression of mutation A1555G. However, although a major nuclear modifying locus was located on chromosome 8p23.1 and regardless intensive screening of the region, the gene involved has not been identified. Methods With the aim to gain insights into the factors that determine the phenotypic expression of A1555G mutation, we have analysed in detail different genetic and genomic elements on 8p23.1 region (DEFA3 gene absence, CLDN23 gene and MRPS18CP2 pseudogene in a group of 213 A1555G carriers. Results Family based association studies identified a positive association for a polymorphism on MRPS18CP2 and an overrepresentation of DEFA3 gene absence in the deaf group of A1555G carriers. Conclusion Although none of the factors analysed seem to have a major contribution to the phenotype, our findings provide further evidences of the involvement of 8p23.1 region as a modifying locus for A1555G 12S rRNA gene mutation.

  12. 线粒体tRNAIle A4317G 突变可能影响12S rRNAA1555G 突变相关的耳聋表型表达%Mitochondrial tRNAIle A4317G mutation may influence the phenotypic manifestation of deafness-associated 12S rRNA A1555G mutation

    梁玲芝; 吕建新; 管敏鑫; 伍越; 阳娅玲; 蔡沁; 肖红利; 郑静; 郑斌娇; 唐霄雯; 朱翌


    Mitochondrial 12S rRNA A1555G mutation has been associated with both aminoglycoside-induced and non-syndromic hearing loss. In this report, we performed a clinical and genetic evaluation, and mitochondrial genome analysis of one hearing-impaired Chinese family carrying the A1555G mutation. Strikingly, the penetrances of hearing loss in this family, which were 81% and 66.7%, respectively, when aminoglycoside-induced hearing loss was included or excluded. The penetrances of hearing loss in this family were significantly higher than those in other Chinese families carrying the A1555G mutation. Sequence analysis of their mitochondrial genomes revealed the presence of homoplasmic tRNAIle A4317G mutations and 38 mtDNA polymorphisms belonging to East-Asian haplogroup B4clb2. Further analysis revealed that other mitochondrial DNA variants were not functional significantly, while the A4317G mutation is localized to a highly conserved nucleotide (conventional site 59) at tRNAIle TΨC loop of tRNAIle. The mutation may alter secondary structure and function of this tRNA, thereby leading to mitochondrial dysfunction. Allelic analysis showed that this mutation was absent in 961 hearing normal Chinese controls. Thus, the altered tRNAIle metabolism by the A4317G mutation may aggravate mitochondrial dysfunction associated with the A1555G mutation, and contribute to the higher penetrance of hearing loss. Therefore, the tRNAIle A4317G mutation may act as a mitochondrial modifier to influence the phenotypic manifestation of the A1555G mutation.%线粒体12S rRNA 基因A1555G 突变与非综合征型耳聋和氨基糖甙类抗生素(Aminoglycoside antibiotics,AmAn)致聋相关.文章通过对一个携带线粒体12S rRNA A1555G 突变的中国汉族母系遗传耳聋大家系成员进行听力学检查和遗传学分析,发现该家系耳聋外显率很高,包括AmAn 使用史的耳聋外显率为81%,不包括AmAn 使用史的耳聋外显率66.7%,明显高于其他携带A1555G 突变

  13. Heteroplasmy Levels of Mitochondrial 12S rRNA A1555G Mutation in Pedigrees with Aminoglycoside-Induced and Non-Syndromic Hearing Loss as Detected Using SNaPshot Technique%线粒体12SrRNAA1555G突变耳聋家系的异质率研究

    朱玉华; 翟所强; 戴朴


    Objective To study heteroplasmy levels and inheritance patterns of the mitochondrial 12S rRNA A1555G mutation in a K-11 pedigree with aminoglycoside-induced and non-syndromic hearing loss using the SNaPshot technique. Methods Comprehensive history and physical examination were obtained, including history of aminoglycoside use and genetic factors related to the hearing impairment among the pedigree members. Age-appropriate audiological tests were performed and the PTA calculated. Genomic DNA was isolated from whole blood and the level of heteroplasmy in peripheral blood leuko-cytes was determined using SNaPshot technology. Results There were four generations in this K-11 pedigree. Deafness was the only clinical phenotype. The onset age and extent of hearing loss were different among maternal members. The average het-eroplasmy rate of this K-11 pedigree was 87.99%(ranging from 82.32%to 94.65%), and the average heteroplasmy rates of generations II to IV were 88.27%, 86.78%, and 90.31%, respectively. Conclusion There are random shifts in the heteroplasmy level between mothers and offspring with the A1555G mutation in K-11 pedigrees. However, there seems a trend of gradual increase over generations.%目的:利用SNaPshot技术检测线粒体12S rRNA A1555G异质性突变耳聋家系(K-11)母系成员的突变异质率,探讨家系中异质率的分布状况和遗传规律。方法通过家系调查,对线粒体12S rRNA A1555G异质性突变耳聋家系母系成员进行全身系统检查及临床听力学检测;提取基因组和线粒体DNA,针对12S rRNA A1555G突变,设计SnaPshot引物和探针,并对K-11家系母系成员进行异质率检测,分析K-11家系母系成员突变异质率的分布特点和遗传规律。结果 K-11家系共四代,耳聋是此家系的唯一临床表型,家系母系耳聋成员的听力下降时间、程度和听力曲线类型具有明显的个体差异;家系中每位家系母系成员的12S rRNA A1555G突变

  14. 利用12S rRNA基因的限制性酶切末端片段长度多态性鉴定动物种类%Identification of Animal Species by Terminal Restriction Fragment Length Polymorphism (T-RFLP) of Mitochondrial 12S rRNA Gene

    汪琦; 张昕; 赵大贺; 马海萍; 陈广全; 张惠媛


    目的:建立一种精确可靠的鉴定常见的10种动物(猪、狗、牛、山羊、绵羊、马、鸡、鼠、三文鱼和鹿)的方法.方法:利用12S rRNA基因的限制性酶切末端片段长度多态性(terminal restriction fragment length polymorphism,T-RFLP)鉴别动物种类.将线粒体12S rRNA基因通过引物的5'端用FAM荧光标记,从基因组DNA中扩增450bp的目的片段.引物对1(下游引物FAM标记,上游引物不标记)扩增的PCR产物用限制性内切酶Alu Ⅰ酶切.引物对2(上游引物FAM标记,下游引物不标记)扩增的PCR产物用限制性内切酶Tru9 Ⅰ酶切.得到的酶切产物分别在遗传分析仪ABI 3100上进行毛细管电泳,片段大小用Peak Scanner 1.0软件分析.结果:根据Alu Ⅰ酶切图谱能够区分鸡、马、猪和三文鱼,而鹿和牛、山羊和绵羊、鼠和狗因酶切图谱相同无法分开.根据Tru9 Ⅰ酶切图谱,能够进一步将鹿和牛、山羊和绵羊、鼠和狗分开.同一种动物不同个体的酶切图谱完全相同,结果具有可重复性.没有出现物种内多态的现象.大多数情况下,实际得到的末端片段长度与理论值非常接近,只存在2~5bp的差异.结论:该方法操作简单、结果精确,适用于鉴定动物种类.

  15. Modifier factors influencing the phenotypic manifestation of the deafness-associated mitochondrial DNA mutations%修饰因子对线粒体DNA突变致聋的影响

    杨爱芬; 郑静; 吕建新; 管敏鑫


    Mutations in the mitochondrial DNA have been found to be one of the most important causes of sensorineural hearing loss. In particular, these mutations often occur in the mitochondrial 12S rRNA and tRNA genes. Of these, the homoplasmic A1555G and C1494T mutations in the 12S rRNA have been associated with both aminoglycoside induced and nonsyndromic hearing impairment in many families worldwide. Children carrying the A1555G or C1494T mutation are susceptible to the exposure of ototoxic drugs, thereby inducing or worsening hearing loss. Individuals harboring A1555G or C1494T mutation can also develop hearing loss even in the absence of aminoglycoside exposure. However, matrilineal relatives of intra-families or inter-families carrying the A1555G or C1494T mutation exhibit a wide range of severity,age-at-onset, and audiometric configuration of hearing impairment. These indicate that the A1555G or C1494T mutation is a primary factor underlying the development of deafness but insufficient to produce the clinical phenotype. Thus, other modifier factors, such as aminoglycoside (s), mitochondrial DNA haplotype(s) or nuclear modifier gene(s), play a role in the phenotypic expression of the deafness-associated mitochondrial 12S rRNA A1555G or C1494T mutation. In this review, we summarize the modifier factors for the phenotypic expression of deafness-associated 12S rRNA A1555G and C1494T mutations and propose the molecular pathogenetic mechanism of maternally inherited deafness.%线粒体DNA突变是引起感音神经性耳聋的重要原因之一,这些突变主要位于线粒体12SrRNA和tRNA基因上.其中12S rRNA基因上的同质性A1555G和C1494T突变与氨基糖甙类抗生素造成的耳聋相关.携带这两个突变的个体对耳毒性药物高度敏感,导致临床上常见的"一针致聋"现象.但携带A1555G或C1494T突变的个体在没用药的情况下也能产生非综合征型耳聋,而且同一家系内和不同家系间的母系成员在听力损失


    CHANG Liang; ZHONG Su; ZHAO Nan; LIU Ping; ZHAO Yangyu; QIAO Jie


    Objective The study is to identify the carrier rate of common deafness mutation in Chinese pregnant women via detecting deafness gene mutations with gene chip. Methods The pregnant women in obstetric clinic without hearing impairment and hearing disorders family history were selected. The informed consent was signed. Peripheral blood was taken to extract genom-ic DNA. Application of genetic deafness gene chip for detecting 9 mutational hot spot of the most common 4 Chinese deafness genes, namely GJB2 (35delG,176del16bp, 235delC, 299delAT), GJB3 (C538T) ,SLC26A4 ( IVS72A>G, A2168G) and mito-chondrial DNA 12S rRNA (A1555G, C1494T) . Further genetic testing were provided to the spouses and newborns of the screened carriers. Results Peripheral blood of 430 pregnant women were detected,detection of deafness gene mutation carri-ers in 24 cases(4.2%), including 13 cases of the GJB2 heterozygous mutation, 3 cases of SLC26A4 heterozygous mutation, 1 cases of GJB3 heterozygous mutation, and 1 case of mitochondrial 12S rRNA mutation. 18 spouses and 17 newborns took fur-ther genetic tests, and 6 newborns inherited the mutation from their mother. Conclusion The common deafness genes muta-tion has a high carrier rate in pregnant women group,235delC and IVS7-2A>G heterozygous mutations are common.

  17. 邯郸地区新生儿听力与药物性耳聋易感基因突变联合筛查研究%Neonatal hearing screening combined with drug-induced deafness susceptibility genes mutation screening in Handan area

    陈丁莉; 李守霞; 要跟东; 冯海芹; 郭丽丽; 孙彩霞; 杨志明; 张晓芳


    Objectives To evaluate the feasibility and significance of universal neonatal hearing screening combined with mitochondria deafness genes screening using newborn cord blood. Methods One thousand newborns were enrolled in the study. Routine hearing screening was carried out and meanwhile the cord bloods were collected for mitochondria DNA screening. Mutations of A1555G and C1494T on mitochondria gene 12S rRNA were screened using Sanger sequencer. Results In hearing screening, 141 (14.1%) of the 1000 newborns were identified to be at risk, of whom 11 (1.1%) were confirmed to have hearing loss. In gene screening. AI555G mutation was found in 4 (0.4%) of the 1000 newborns and C1494T mutation was found in 2 (0.2%) infants, though they were all identified as normal in the first-step hearing screening. Conclusions Mitochondria deafness genes screening can complement hearing screening, and may effectively help to avoid later healing loss in children sensitive to aminoglycoside antibiotics.%目的 探讨在新生儿听力筛查同时,采用新生儿脐带血进行线粒体耳聋基因筛查的可行性及其意义.方法 收集邯郸地区新生儿1 000例为研究对象,进行常规听力筛查,同时采集脐带血,用于线粒体DNA的筛查.采用Sanger测序法检测线粒体12S rRNA A1555G和C1494T两个突变位点.结果 在1000名新生儿中,初次听力筛查有141例(14.1%) 未通过,经过复筛后仍有11例 (1.1%) 未通过新生儿听力筛查.线粒体12S rRNA检测发现携带A1555G突变4例(0.4%),C1494T突变2例 (0.2%),而该6例新生儿均通过了初次听力筛查.结论 线粒体耳聋基因筛查可以有效补充听力筛查的不足,早期发现对氨基糖苷类抗生素敏感的个体,避免药物性耳聋的发生.

  18. Regiospecificity of Chlorophenol Reductive Dechlorination by Vitamin B12s

    Smith, Mark H.; Woods, Sandra L.


    Vitamin B12, reduced by titanium (III) citrate to vitamin B12s, catalyzes the reductive dechlorination of chlorophenols. Reductive dechlorination of pentachlorophenol and of all tetrachlorophenol and trichlorophenol isomers was observed. Reaction of various chlorophenols with vitamin B12 favored reductive dechlorination at positions adjacent to another chlorinated carbon, but chlorines ortho to the hydroxyl group of a phenol were particularly resistant to reductive dechlorination, even if the...

  19. 11个携带线粒体tRNASer(UCN)G7444A突变的中国汉族非综合征型耳聋家系分析评估%Evaluation of mitochondrial tRNASer(UCN) G7444A mutation associated with non-syndromic hearing loss in eleven Han Chinese pedigrees

    唐霄雯; 管敏鑫; 阳娅玲; 高应龙; 肖红利; 何哲耘; 郑静; 郑斌娇; 吕建新; 金龙金


    Chinese Han pedigrees with mitochondrial tRNASer(UCN) G7444A mutation underwent audiological testing, deafness associated mutational hot spots screen-ing and pedigree assessment.Results: Among the 2 650 Han Chinese non-syndromic deafness subjects, 22 pa-tients belonging to 11 pedigrees carried mitochondrial tRNASer(UCN) G7444A mutation, account for 0.7%. Num-ber of pedigree carry both mitochondrial tRNASer(UCN) G7444A mutation and mitochondrial 12S rRNA A1555G, mitochondrial 12S rRNA C1494T orGJB2 c.235delC mutation were 3, 1, 2 respectively. Clinical data showed that there were huge difference in the severity of hearing loss, age of onset and penetrance among these 11 Chi-nese Han non-syndromic deafness pedigrees. The average penetrance of these pedigrees carrying mitochondrial tRNASer(UCN) G7444A mutation and mitochondrial 12S rRNA A1555G, C1494T orGJB2 c.235delC mutation were 29.4%, 42.9% and 19.0% respectively. The average penetrance of 4 pedigrees carrying the mitochondrial tRNASer(UCN) G7444A mutation and mitochondrial 12S rRNA A1555G or C1494T mutation is signiifcantly higher than that of carry mitochondrial tRNASer(UCN) G7444A mutation, it was 14.0%.Conclusion: Mitochondrial tRNASer(UCN) G7444A mutation and mitochondrial 12S rRNA A1555G or C1494T mutations may co-modulate the variable penetrance and expressivity of deafness among these Han Chinese non-syndromic pedigrees.

  20. Cadmium increases catechol 2,3-dioxygenase activity in Variovorax sp. 12S, a metal-tolerant and phenol-degrading strain.

    Hupert-Kocurek, Katarzyna; Saczyńska, Agnieszka; Piotrowska-Seget, Zofia


    A Gram-negative bacterium, designated as strain 12S, was isolated from a heavy metal-polluted soil. According to the biochemical characteristics, FAME analysis, and 16S rRNA gene sequence analysis, the isolated strain was identified as Variovorax sp. 12S. In the presence of 0.1 mM cadmium, 12S was able to completely utilize up to 1.5 mM of phenol as the sole carbon and energy source in an MSM-TRIS medium. Degradation of phenol was accompanied by a slow bacterial growth rate and an extension of the lag phase. The cells grown on phenol showed catechol 2,3-dioxygenase (C23O) activity. The activity of C23O from 12S cultivated in medium with Cd(2+) was almost 20 % higher than in the control. Since environmental contamination with aromatic compounds is often accompanied by the presence of heavy metals, Variovorax sp. 12S and its C23O appear to be very powerful and useful tools in the biotreatment of wastewaters and soil decontamination. PMID:23934429

  1. Extremely low penetrance of hearing loss in four Chinese families with the mitochondrial 12S rRNA A1555G mutation

    Mutations in mitochondrial DNA (mtDNA) have been found to be associated with sensorineural hearing loss. We report here the clinical, genetic, and molecular characterization of four Chinese pedigrees with aminoglycoside-induced and nonsyndromic hearing impairment. Clinical evaluation revealed the variable phenotype of hearing impairment including audiometric configuration in these subjects, although these subjects share some common features: bilateral and sensorineural hearing impairment. Strikingly, these Chinese pedigrees exhibited extremely low penetrance of hearing loss (5.2%, 4.8%, 4.2%, and 13.3%, respectively, and with an average 8% penetrance). In particular, four of all five affected matrilineal relatives of these pedigrees had aminoglycoside-induced hearing loss. Sequence analysis of the complete mitochondrial genomes in these pedigrees showed the distinct sets of mtDNA polymorphism, in addition to the identical homoplasmic A1555G mutation, associated with hearing impairment in many families from different genetic backgrounds. The fact that mtDNA of those pedigrees belonged to different haplogroups R9a, N9a, D4a, and D4 suggested that the A1555G mutation occurred sporadically and multiplied through evolution of the mtDNA in China. However, there was the absence of functionally significant mutations in tRNA and rRNAs or secondary LHON mutations in these Chinese families. These data imply that the nuclear background or/and mitochondrial haplotype may not play a significant role in the phenotypic expression of the A1555G mutation in these Chinese pedigrees. However, aminoglycoside appears to be a major modifier factor for the phenotypic manifestation of the A1555G mutation in these Chinese families

  2. Phylogenetic relationships of Salmonella based on rRNA sequences

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.


    separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

  3. Allele Frequency of D12S1632, D12S329, D12S96, D16S3096 and D16S2624 in four Ethnic Groups and Its Relationship With Metabolic Syndrome in Tehran Lipid and Glucose Study



    Full Text Available Background Variation in drug resistance and susceptibility to various diseases may be related to difference in allele frequencies of the variants at the population level. Objectives The present study aimed to investigate the allele frequencies of five short tandem repeats (STR loci in two different chromosomes of candidates from Tehran Lipid and Glucose Study. Materials and Methods For this study, a representative sample of 563 individuals (130 affected by metabolic syndrome from Tehran, including four different ethnic groups of Iran, was selected. Five STRs including D12S1632, D12S329, D12S96, D16S3096 and D16S2624 were analyzed using the fragment analysis method. Allele frequency, polymorphism information content (PIC values, observed and expected heterozygosity, discrimination power, matching probability, power of discrimination, power of exclusion and paternity index were calculated for the whole sample. Results There was no significant deviation in allelic frequencies from Hardy-Weinberg equilibrium for all the studied markers except for D12S1632 and D12S329. The long alleles in D12S329 were significantly more frequent in patients with metabolic syndrome (P < 0.05. Conclusions This study revealed allele frequency of some STRs on chromosome 12 and 16 for the first time in Iran, and indicated differences between subjects with metabolic syndrome and subjects in the control group.

  4. Downregulation of rRNA Transcription Triggers Cell Differentiation

    Yuki Hayashi; Takao Kuroda; Hiroyuki Kishimoto; Changshan Wang; Atsushi Iwama; Keiji Kimura


    Responding to various stimuli is indispensable for the maintenance of homeostasis. The downregulation of ribosomal RNA (rRNA) transcription is one of the mechanisms involved in the response to stimuli by various cellular processes, such as cell cycle arrest and apoptosis. Cell differentiation is caused by intra- and extracellular stimuli and is associated with the downregulation of rRNA transcription as well as reduced cell growth. The downregulation of rRNA transcription during differentiati...

  5. Phylogenetic analysis of the order Pleuronectiformes (Teleostei based on sequences of 12S and 16S mitochondrial genes

    Marisa F.C. Azevedo


    Full Text Available The fish order Pleuronectiformes, composed of 14 families, has two suborders: Psettodoidei (with one family and Pleuronectoidei (with thirteen families. The relationships among families of Pleuronectoidei and among the genera of their families have extensively been debated and a consensus has not yet been reached. In the present study, partial sequences of the 12S and 16S mitochondrial rRNA genes were obtained from 19 species belonging to the families Achiridae, Bothidae, Cynoglossidae, Paralichthyidae, Pleuronectidae, Scophthalmidae, and Soleidae. Additional sequences of 42 pleuronectiform species were obtained from GenBank. Phylogenetic analyses were conducted by the methods of maximum-parsimony, maximum-likelihood and Bayesian inference. Our results corroborate the monophyletic status of all families, excluding Paralichthyidae. In the family Achiridae, the genus Catathyridium (freshwater was the sister group of Trinectes (saltwater, and Hypoclinemus (freshwater was the sister group of Achirus (saltwater. Assuming that the putative ancestor of achirids lived in saltwater, it is suggested that the freshwater habitats in South America were colonized independently by different achirid lineages.

  6. Downregulation of rRNA transcription triggers cell differentiation.

    Yuki Hayashi

    Full Text Available Responding to various stimuli is indispensable for the maintenance of homeostasis. The downregulation of ribosomal RNA (rRNA transcription is one of the mechanisms involved in the response to stimuli by various cellular processes, such as cell cycle arrest and apoptosis. Cell differentiation is caused by intra- and extracellular stimuli and is associated with the downregulation of rRNA transcription as well as reduced cell growth. The downregulation of rRNA transcription during differentiation is considered to contribute to reduced cell growth. However, the downregulation of rRNA transcription can induce various cellular processes; therefore, it may positively regulate cell differentiation. To test this possibility, we specifically downregulated rRNA transcription using actinomycin D or a siRNA for Pol I-specific transcription factor IA (TIF-IA in HL-60 and THP-1 cells, both of which have differentiation potential. The inhibition of rRNA transcription induced cell differentiation in both cell lines, which was demonstrated by the expression of the common differentiation marker CD11b. Furthermore, TIF-IA knockdown in an ex vivo culture of mouse hematopoietic stem cells increased the percentage of myeloid cells and reduced the percentage of immature cells. We also evaluated whether differentiation was induced via the inhibition of cell cycle progression because rRNA transcription is tightly coupled to cell growth. We found that cell cycle arrest without affecting rRNA transcription did not induce differentiation. To the best of our knowledge, our results demonstrate the first time that the downregulation of rRNA levels could be a trigger for the induction of differentiation in mammalian cells. Furthermore, this phenomenon was not simply a reflection of cell cycle arrest. Our results provide a novel insight into the relationship between rRNA transcription and cell differentiation.

  7. Determination of standard molar Gibbs energy of formation of Sm6UO12(s)

    The standard molar Gibbs energies of formation of Sm6UO12(s) have been measured using an oxygen concentration cell with yttria stabilized zirconia as solid electrolyte. ΔfGom(T) for Sm6UO12(s) has been calculated using the measured and required thermodynamic data from the literature. The calculated Gibbs energy expression in the temperature range 899 to 1127 K can be given as: ΔfGom(Nd6UO12, s,T)/(±2.3) kJ∙ mol-1 = -6681 +1.099 (T/K) (899-1127 K)(T/K). (author)

  8. ADAM 12-S cleaves IGFBP-3 and IGFBP-5 and is inhibited by TIMP-3

    Loechel, F; Fox, J W; Murphy, G;


    that it cleaves insulin-like growth factor binding protein-3 (IGFBP-3). This result supports a role for ADAM 12-S in the degradation of IGFBP-3 in the blood of pregnant women. Furthermore, we tested for proteolysis of other members of the IGF binding protein family and found that ADAM 12-S cleaves...... IGFBP-5 in addition to IGFBP-3, but does not cleave IGFBP-1, -2, -4, or -6. ADAM 12-S may therefore be the IGFBP-5 protease that is secreted by osteoblasts and other cells. Cleavage of both IGFBP-3 and -5 by ADAM 12-S was inhibited by TIMP-3, raising the possibility that TIMP-3 is a physiological...

  9. Phylogenetic relationships of Salmonella based on rRNA sequences

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.


    To establish the phylogenetic relationships between the subspecies of Salmonella enterica (official name Salmonella choleraesuis), Salmonella bongori and related members of Enterobacteriaceae, sequence comparison of rRNA was performed by maximum-likelihood analysis. The two Salmonella species were...

  10. Further data on the microsatellite locus D12S67 in worldwide populations: an unusual distribution of D12S67 alleles in Native Americans.

    Mitchell, R J; Federle, L; Sofro, A S; Papiha, S S; Briceno, I; Bernal, J E


    We report the frequencies of alleles at the microsatellite locus D12S67 in 2 widely separated ethnic groups of the world: 2 populations from Sulawesi, an island in the Indonesian archipelago, and 5 Native American tribes of Colombia, South America. The allele frequencies in the Minihasans and Torajans of Sulawesi are similar to each other (but the modal class allele is different) and in general agreement with those reported in mainland Asian groups, but different from both Europeans and Chinese Han of Taiwan. The 5 Native American tribes (Arsario, Kogui, Ijka, Wayuu, and Coreguaje) display different allele frequencies from those seen in Sulawesi populations, in other groups from Europe and mainland Asia, and in Chinese Han of Taiwan. Native Americans exhibit a bimodal distribution of alleles, unlike other groups, with significant differences among the tribes. The Arsario and Kogui have no admixture with Europeans or Africans and are the most distinctive, while the Wayuu have the most admixture and show most similarity to other groups. The data suggest that nonadmixed Native Americans may be quite distinctive with respect to this marker. The most common allele varies across the 5 tribes, from 249 base pairs to 261 base pairs. All samples exhibit Hardy-Weinberg genotype proportions; heterozygosities are lowest in the 2 nonadmixed Native American tribes. Examination of all the available data indicates that some east Asian and southeast Asian groups are characterized by a high frequency of smaller sized D12S67 alleles, while other populations have a greater proportion of the larger sized alleles. The cumulative, though still highly restricted, population data on locus D12S67 demonstrate that it may be of considerable value in anthropological genetic studies of ethnic groups. Data are required on Native Americans outside Colombia before this marker can be used in admixture studies of this group. PMID:11048795

  11. rRNA fragmentation induced by a yeast killer toxin.

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm


    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  12. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette


    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  13. Non-uniform phenotyping of D12S391 resolved by second generation sequencing

    Dalsgaard, S; Rockenbauer, E; Buchard, A;


    Non-uniform phenotyping of five case work samples were observed in the D12S391 locus. The samples were typed at least twice with the AmpFℓSTR(®) NGM SElect™ PCR Amplification Kit and different alleles were called with GeneMapper(®) ID-X in the different experiments. Detailed analyses of the elect......Non-uniform phenotyping of five case work samples were observed in the D12S391 locus. The samples were typed at least twice with the AmpFℓSTR(®) NGM SElect™ PCR Amplification Kit and different alleles were called with GeneMapper(®) ID-X in the different experiments. Detailed analyses...... of the electropherograms suggested that the individuals were heterozygous with two alleles that differed in size by one nucleotide. This was confirmed by amplifying the samples with the PowerPlex(®) ESX 17 system. D12S391 is a complex STR with variable numbers of AGAT and AGAC repeats. Second generation sequencing...

  14. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    Triman, K; Becker, E; Dammel, C;


    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alle...

  15. Phylogeny of higher taxa of hexapoda according to 12sRNA sequences


    The phylogenetic relationship of Hexapoda has been debated for a long time, which will be resolved mainly depending on the settlement of monophyly, affinities and interrelationships among Protura, Collembola and Diplura. Mitochondrial 12sRNA gene about 355 bp fragments from one proturan species, two collembolan species, two dipluran species and one oribatid species were sequenced. The Kimura 2-parameter distances were calculated and a series of molecular phylogenetic trees were reconstructed by using the N-J method, from which the following points were drawn: (ⅰ) Protura and Collembola compose a monophyletic group representing absent-cerci; (ⅱ) Diplura is not a monophyletic group, in which Campodeoid with filiform cerci belongs to a clade and Japygoid with pincer cerci and Ectognatha com-pose another clade, that is, Insecta s. str. stemmed from Japygoid. So it would be suggested that the phylogenetic relationship of Hexapoda is [Parainsecta (Collembola + Pro-tura) +Campodeoid +Insecta (Japygoid + Ectognatha)].

  16. 'View From A Bridge': A New Perspective on Eukaryotic rRNA Base Modification.

    Sharma, Sunny; Lafontaine, Denis L J


    Eukaryotic rRNA are modified frequently, although the diversity of modifications is low: in yeast rRNA, there are only 12 different types out of a possible natural repertoire exceeding 112. All nine rRNA base methyltransferases (MTases) and one acetyltransferase have recently been identified in budding yeast, and several instances of crosstalk between rRNA, tRNA, and mRNA modifications are emerging. Although the machinery has largely been identified, the functions of most rRNA modifications remain to be established. Remarkably, a eukaryote-specific bridge, comprising a single ribosomal protein (RP) from the large subunit (LSU), contacts four rRNA base modifications across the ribosomal subunit interface, potentially probing for their presence. We hypothesize in this article that long-range allosteric communication involving rRNA modifications is taking place between the two subunits during translation or, perhaps, the late stages of ribosome assembly. PMID:26410597

  17. Structures of Pathogenic Fungal FKBP12s Reveal Possible Self-Catalysis Function

    Tonthat, Nam K.; Juvvadi, Praveen Rao; Zhang, Hengshan; Lee, Soo Chan; Venters, Ron; Spicer, Leonard; Steinbach, William J.; Heitman, Joseph


    ABSTRACT Invasive fungal infections remain difficult to treat and require novel targeting strategies. The 12-kDa FK506-binding protein (FKBP12) is a ubiquitously expressed peptidyl-prolyl isomerase with considerable homology between fungal pathogens and is thus a prime candidate for future targeting efforts to generate a panfungal strategy. Despite decades of research on FKBPs, their substrates and mechanisms of action remain unclear. Here we describe structural, biochemical, and in vivo analyses of FKBP12s from the pathogenic fungi Candida albicans, Candida glabrata, and Aspergillus fumigatus. Strikingly, multiple apo A. fumigatus and C. albicans FKBP12 crystal structures revealed a symmetric, intermolecular interaction involving the deep insertion of an active-site loop proline into the active-site pocket of an adjacent subunit. Such interactions have not been observed in previous FKBP structures. This finding indicates the possibility that this is a self-substrate interaction unique to the A. fumigatus and C. albicans fungal proteins that contain this central proline. Structures obtained with the proline in the cis and trans states provide more data in support of self-catalysis. Moreover, cysteine cross-linking experiments captured the interacting dimer, supporting the idea that it forms in solution. Finally, genetic studies exploring the impact of mutations altering the central proline and an adjacent residue provide evidence that any dimeric state formed in vivo, where FKBP12 concentrations are low, is transient. Taken together, these findings suggest a unique mechanism of self-substrate regulation by fungal FKBP12s, lending further novel understanding of this protein for future drug-targeting efforts. PMID:27118592

  18. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E


    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  19. Mitochondrial COX2 G7598A Mutation May Have a Modifying Role in the Phenotypic Manifestation of Aminoglycoside Antibiotic-Induced Deafness Associated with 12S rRNA A1555G Mutation in a Han Chinese Pedigree

    Chen, Tianbin; Liu, Qicai; Jiang, Ling; Liu, Can; Ou, Qishui


    Recent studies suggest that certain mitochondrial haplogroup markers and some specific variants in mitochondrial haplogroup may also influence the phenotypic expression of particular mitochondrial disorders. In this report, the clinical, genetic, and molecular characterization were identified in a Chinese pedigree with the aminoglycoside antibiotic (AmAn)-induced deafness and nonsyndromic hearing loss (NSHL). The pathogenic gene responsible for this hereditary NSHL pedigree was determined by ...

  20. Solid Oxide Galvanic Cell to determine thermochemical data of Dy6UO12(s)

    The rare earth elements such as Sm, Eu, Gd, and Dy have very high thermal neutron absorption cross sections and their oxides are utilized as burnable poisons in nuclear reactor to maintain constant reactivity of the core. These oxides form solid solution with urania as their ionic radii are within 20% of that of urania. Rare earth oxides-urania solid solutions are also beneficial in preventing oxidation of UO2(s). RE6UOI2(s) (RE = rare earth) type of compounds are known to exist in RE-U-O system and their formation cannot be ruled out under transient conditions. The data on Gibbs energy of formation of compounds in RE-U-O system is therefore essential to predict the feasibility. Theoretically, the measurement of the e.m.f. of a suitable galvanic cell is one of the most accurate methods to obtain Gibbs energy of formation of compounds if e.m.f cell operates reversibly. In this study, the standard molar Gibbs energy of formation of Dy6UOI2(s) was determined using solid oxide galvanic cell technique. The Gibbs energy of formation of Dy6UO12(s) is reported for the first time

  1. A phylogeny of the Passerida (Aves:Passeriformes) based on mitochondrial 12S ribosomal RNA gene

    Lina Wu; Yanfeng Sun; Juyong Li; Yaqing Li; Yuefeng Wu; and Dongming Li


    Background:Passerida is the largest avian radiation within the order Passeriformes. Current understanding of the high-level relationships within Passerida is based on DNA–DNA hybridizations;however, the phylogenetic relationships within this assemblage have been the subject of many debates. Methods:We analyzed the 12S ribosomal RNA gene from 49 species of Passerida, representing 14 currently recognized families, to outline the phylogenetic relationships within this group. Results:Our results identified the monophyly of the three superfamilies in Passerida:Sylvioidea, Muscicapoidea and Passeroidea. However, current delimitation of some species is at variance with our phylogeny estimate. First, the Parus major, which had been placed as a distinct clade sister to Sylvioidea was identified as a member of the super family;second, the genus Regulus was united with the Sturnidae and nested in the Muscicapoidea clade instead of being a clade of Passerida. Conclusion:Our results were consistent with Johansson’s study of the three superfamilies except for the al ocation of two families, Paridae and Regulidae.

  2. Distribution of tritium labeled 12(S) hydroxy-eicosatetraenoic acid (12-HETE) in the rat.

    Clouet, P; Niot, I; Bouchard, P; Gree, R; Lellouche, J P; Beaucourt, J P; Fonlupt, P; Duperray, B; Bezard, J; Lagarde, M


    The in vivo metabolism of 12-(S)-Hydroxy-eicosatetraenoic acid (12-HETE), the end-lipoxygenase product of arachidonic acid in platelets, has been investigated in the rat. Fifty microcuries of 5,6-[3H]-12-HETE (50 Ci/mmol) were injected to anesthetized rats and the radioactivity was followed in plasma. At the end of the experiment, various organs of the animal were removed and the radioactivity attached to them was determined. The label of the plasma plateaued to approximately one third of the initial radioactivity ten minutes after the injection. Among the various organs tested (brain, heart, intestine, kidney, liver, lungs, spleen, testis/uterus) the kidney was far the most active to accumulate 12-HETE and/or its labeled metabolites, and no radioactivity could be detected in urine during the course of the experiment. The analysis of lipid extracts from the various tissues revealed that 12-HETE was not accumulating in its unesterified form but was likely bound to phospholipids. We conclude that, although the label providing from the initial 12-HETE did not completely disappear from plasma, circulating 12-HETE cannot be considered as a circulating marker of cell activation. PMID:1771238

  3. High throughput 16S rRNA gene amplicon sequencing

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup;

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r...... belonging to the phylum Chloroflexi. Based on knowledge about their ecophysiology, other control measures were introduced and the bulking problem was reduced after 2 months. Besides changes in the filament abundance and composition also other changes in the microbial community were observed that likely...... correlated with the bacterial species composition in 25 Danish full-scale WWTPs with nutrient removal. Examples of properties were SVI, filament index, floc size, floc strength, content of cations and amount of extracellular polymeric substances. Multivariate statistics provided several important insights...

  4. Fragmentation of 23S rRNA in Strains of Proteus and Providencia Results from Intervening Sequences in the rrn (rRNA) Genes

    Miller, Wayne L.; Pabbaraju, Kanti; Sanderson, Kenneth E.


    Intervening sequences (IVSs) were originally identified in the rrl genes for 23S rRNA (rrl genes, for large ribosomal subunit, part of rrn operon encoding rRNA) of Salmonella enterica serovars Typhimurium LT2 and Arizonae. These sequences are transcribed but later removed during RNase III processing of the rRNA, resulting in fragmentation of the 23S species; IVSs are uncommon, but have been reported in at least 10 bacterial genera. Through PCR amplification of IVS-containing regions of the rr...

  5. Fragmentations of the large-subunit rRNA in the family Rhizobiaceae.

    Selenska-Pobell, S; Evguenieva-Hackenberg, E


    A 130-nucleotide-long rRNA species corresponding to the 5' end of the 23S rRNA gene was found in 96 strains belonging to different Rhizobium, Bradyrhizobium, and Agrobacterium species. Additional fragmentation in the central region of the large-subunit rRNA occurred in all agrobacteria, except Agrobacterium vitis, and in most Rhizobium leguminosarum and Rhizobium etli strains but did not occur in any of the other rhizobia and bradyrhizobia studied.

  6. Novel mutation in 16S rRNA associated with streptomycin dependence in Mycobacterium tuberculosis.

    Honoré, N; Marchal, G.; Cole, S T


    Molecular characterization of a streptomycin-dependent mutant of Mycobacterium tuberculosis revealed the presence of a novel mutation in the rrs gene encoding 16S rRNA. Insertion of an additional cytosine in the 530 loop of 16S rRNA, a region known to be involved in streptomycin susceptibility and resistance, was associated with streptomycin dependence.

  7. The effect of secondary compounds on the rumen microbial population structure measured by 16S rRNA and 18S rRNA

    Full text: Plant secondary compounds in the forages have an important role in determining forage quality. A method for evaluating their effects on microbial population structure was carried out using the in vitro gas syringe system followed by extraction of RNA and gel separation of 16S rRNA and 18S rRNA. Quantification of 16S rRNA and 18S rRNA bands indicated the prokaryote and eukaryote populations, respectively. Five types of plant materials, i.e. Nothopanax scutellarium (Mangkokan) leaves, Morinda citrifolia (Mengkudu) fruit, Sapindus rarak (lerak) fruit and two types of Sesbania sesban leaves (hgh saponin and low saponin) were tested and Pennisetum purpureum (rumput gajah, Indonesian name) was used as a control roughage. Presence of saponin in these plant materials was determined qualitatively by thin layer chromatography. Eukaryote population was found to be significantly affected by the above plant materials. Both types of S. sesban leaves caused total elimination of eukaryotes. S. rarak reduced both eukaryote and prokaryote populations. The observed inhibition of eukaryote population might be due to the presence of saponin in these plant materials. In another experiment, a methanol extract of S. rarak which contained saponin was included and its effect on in vitro fermentation of P. purpureum was evaluated. The results showed that at higher levels of inclusion of S. rarak methanol extract, eukaroytes were totally eliminated. Comparison was made between microbial mass calculated based on difference between apparent undigested residue and true undigested residue and microbial mass calculations based on 16S rRNA and 18S rRNA. Microbial mass calculated by difference method was much higher than the microbial mass calculated on the basis of 16S rRNA and 18S rRNA. The quantification of RNA can be a useful and rapid technique for an accurate assessment of the effect of new forage materials on the microbial population structure. Other parameters from in vitro

  8. Partial analysis of the central domain of the Bacillus sphaericus JG-A12 S-layer protein

    310 amino acids from the central domain of the B. sphaericus JG-A12 S-layer were analyzed. In contrast to the N-terminal domain of this protein, which possesses a unique structure, the part studied in this work shares a significant identity with the corresponding parts of several other B. sphaericus S-layers. (orig.)

  9. Phylogenetic relationships linking Duttaphrynus (Amphibia: Anura: Bufonidae) species based on 12S and 16S rDNA sequences.

    Pratihar, Suman; Bhattacharya, Manojit; Deuti, Kaushik


    Genus Duttaphrynus (Amphibia: Anura: Bufonidae) is endemic to southwestern and southern China and throughout southern Asia. Duttaphrynus phylogeny was also under debate for many years. 12S and 16S rDNAs help us to elucidate Duttaphrynus phylogeny. PMID:26155970

  10. Subnuclear partitioning of rRNA genes between the nucleolus and nucleoplasm reflects alternative epiallelic states

    Pontvianne, Frederic; Blevins, Todd; Chandrasekhara, Chinmayi; Mozgová, Iva; Hassel, Christiane; Pontes, Olga M.F.; Tucker, Sarah; Mokroš, Petr; Muchová, Veronika; Fajkus, Jiří; Pikaard, Craig S.


    Eukaryotes can have thousands of 45S ribosomal RNA (rRNA) genes, many of which are silenced during development. Using fluorescence-activated sorting techniques, we show that active rRNA genes in Arabidopsis thaliana are present within sorted nucleoli, whereas silenced rRNA genes are excluded. DNA methyltransferase (met1), histone deacetylase (hda6), or chromatin assembly (caf1) mutants that disrupt silencing abrogate this nucleoplasmic–nucleolar partitioning. Bisulfite sequencing data indicate that active nucleolar rRNA genes are nearly completely demethylated at promoter CGs, whereas silenced genes are nearly fully methylated. Collectively, the data reveal that rRNA genes occupy distinct but changeable nuclear territories according to their epigenetic state. PMID:23873938

  11. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    Cangelosi, G A; Brabant, W H


    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA probes to measure steady-state cellular pre-16S rRNA pools during growth state transitions in Escherichia coli. Pre-16S rRNA became undetectable when cells entered the stationary phase on rich medium and was replenished upon restoration of favorable growth conditions. These fluctuations were of much greater magnitude than concurrent fluctuations in the mature 16S rRNA pool. The extent of pre-16S rRNA depletion depended upon the circumstances limiting growth. It was significantly more pronounced in carbon-energy-starved cells than in nitrogen-starved cells or in cells treated with energy uncouplers. In the presence of the transcriptional inhibitor rifampin, rates of pre-16S rRNA depletion in carbon-energy-starved cells and nitrogen-starved cells were similar, suggesting that the difference between these conditions resides primarily at the level of pre-rRNA synthesis. Chloramphenicol, which inhibits the final steps in rRNA maturation, halted pre-16S rRNA depletion under all conditions. The data show that E. coli cells continue to process pre-rRNA after growth and rrn operon transcription cease, leading to drainage of the pre-rRNA pool. This supports the feasibility of using pre-rRNA-targeted probes to monitor bacterial growth in natural systems, with the caveat that patterns of pre-rRNA depletion vary with the conditions limiting growth. PMID:9226253

  12. Sequencing of 16S rRNA Gene: A Rapid Tool for Identification of Bacillus anthracis

    Sacchi, Claudio T.; Whitney, Anne M.; Mayer, Leonard W.; Morey, Roger; Steigerwalt, Arnold; Boras, Ariana; Weyant, Robin S.; Popovic, Tanja


    In a bioterrorism event, a tool is needed to rapidly differentiate Bacillus anthracis from other closely related spore-forming Bacillus species. During the recent outbreak of bioterrorism-associated anthrax, we sequenced the 16S rRNA generom these species to evaluate the potential of 16S rRNA gene sequencing as a diagnostic tool. We found eight distinct 16S types among all 107 16S rRNA gene seqs fuences that differed from each other at 1 to 8 positions (0.06% to 0.5%). All 86 B. anthracis had...

  13. Electron transfer. 93. Further reactions of transition-metal-center oxidants with vitamin B12s (Cob(I)alamin)

    Vitamin B12s (cob(I)alamin) reduces europium(III), titanium(IV) (TiO(C2O4)22-), and uranium(VI) in aqueous solution. These oxidants undergo one-electron changes, leading in each case to the cobalt product cob(II)alamin (B12r). The reduction of Eu3+, which is inhibited by TES buffer, but not by glycine, is outer sphere. Its limiting specific rate (1 x 102 M-1 s-1), incorporated in the Marcus treatment, yields a B12s,B12r self-exchange rate of 104.8±0.5 M-1 s-1. Reductions of TiO(C2O4)22- are accelerated by H+ and by acetic acid. Kinetic patterns suggest three competing reaction paths involving varying degrees of protonation of the Ti(IV) center or its association with acetic acid. The very rapid reduction of U(VI) (k = 4 x 106 M-1 s-1) yields U(V) in several buffering media, even when B12s is taken in excess. The much slower conversion of U(V) to U(IV), although thermodynamically favored, appears to be retarded by the extensive reorganization of the coordination sphere of oxo-bound U(V) that must accompany its acceptance of an additional electron. The observed specific rate for the B12s-U(VI) reaction is in reasonable agreement, in the framework of the Marcus formalism, with reported values of the formal potential and the self-exchange rate for U(V,VI). 37 references, 4 tables

  14. Recognition determinants for proteins and antibiotics within 23S rRNA

    Douthwalte, S; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup;


    Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of...... molecular genetic and biochemical probing techniques, we have concentrated on regions of the rRNA that are connected with specific functions. These are located in different domains within the 23S rRNA and include the ribosomal GTPase-associated center in domain II, which contains the binding sites for r......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...

  15. Investigation of molluscan phylogeny on the basis of 18S rRNA sequences.

    Winnepenninckx, B; Backeljau, T; De Wachter, R


    The 18S rRNA sequences of 12 molluscs, representing the extant classes Gastropoda, Bivalvia, Polyplacophora, Scaphopoda, and Caudofoveata, were determined and compared with selected known 18S rRNA sequences of Metazoa, including other Mollusca. These data do not provide support for a close relationship between Platyhelminthes (Turbellaria) and Mollusca, but rather suggest that the latter group belongs to a clade of eutrochozoan coelomates. The 18S rRNA data fail to recover molluscan, bivalve, or gastropod monophyly. However, the branching pattern of the eutrochozoan phyla and classes is unstable, probably due to the explosive Cambrian radiation during which these groups arose. Similarly, the 18S rRNA data do not provide a reliable signal for the molluscan interclass relationships. Nevertheless, we obtained strong preliminary support for phylogenetic inferences at more restricted taxonomic levels, such as the monophyly of Polyplacophora, Caenogastropoda, Euthyneura, Heterodonta, and Arcoida. PMID:8952075

  16. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria

    Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.


    Roč. 15, APR 2015 (2015). ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EE - Microbiology , Virology Impact factor: 2.729, year: 2014

  17. Inhibition of Escherichia coli precursor-16S rRNA processing by mouse intestinal contents

    Licht, Tine Rask; Tolker-Nielsen, Tim; Holmstrøm, Kim; Krogfelt, Karen A.; Molin, Søren


    . We have applied fluorescence in situ hybridization of pre-16S rRNA to Escherichia coli cells growing in vitro in extracts from two different compartments of the mouse intestine: the caecal mucus layer, where E. coli grew rapidly, and the contents of the caecum, which supported much slower bacterial......The correlation between ribosome content and growth rate found in many bacterial species has proved useful for estimating the growth activity of individual cells by quantitative in situ rRNA hybridization. However, in dynamic environments, the stability of mature ribosomal RNA causes problems in...... using cellular rRNA contents for direct monitoring of bacterial growth activity in situ. In a recent paper, Cangelosi and Brabant suggested monitoring the content of precursors in rRNA synthesis (pre-rRNAs) as an alternative approach. These are rapidly broken down after the cessation of bacterial growth...

  18. Mutations in the 16S rRNA Genes of Helicobacter pylori Mediate Resistance to Tetracycline

    Trieber, Catharine A.; Taylor, Diane E.


    Low-cost and rescue treatments for Helicobacter pylori infections involve combinations of several drugs including tetracycline. Resistance to tetracycline has recently emerged in H. pylori. The 16S rRNA gene sequences of two tetracycline-resistant clinical isolates (MIC = 64 μg/ml) were determined and compared to the consensus H. pylori 16S rRNA sequence. One isolate had four nucleotide substitutions, and the other had four substitutions and two deletions. Natural transformation with the 16S ...

  19. 16S rRNA Mutation Associated with Tetracycline Resistance in a Gram-Positive Bacterium

    Ross, Jeremy I.; Eady, E Anne; Cove, Jonathan H.; Cunliffe, William J.


    A genetic basis for tetracycline resistance in cutaneous propionibacteria was suggested by comparing the nucleotide sequences of the 16S rRNA genes from 16 susceptible and 21 resistant clinical isolates and 6 laboratory-selected tetracycline-resistant mutants of a susceptible strain. Fifteen clinical isolates resistant to tetracycline were found to have cytosine instead of guanine at a position cognate with Escherichia coli 16S rRNA base 1058 in a region important for peptide chain terminatio...

  20. Functional interactions within 23S rRNA involving the peptidyltransferase center.

    Douthwaite, S


    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S rRNA peptidyltransferase loop. All three base substitutions at position 2032 produce an erythromycin-hypersensitive phenotype. The 2032 substitutions were compared with and combined with a 12-bp deletion muta...

  1. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin


    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  2. Sources of blood meals of sylvatic Triatoma guasayana near Zurima, Bolivia, assayed with qPCR and 12S cloning.

    David E Lucero


    Full Text Available In this study we compared the utility of two molecular biology techniques, cloning of the mitochondrial 12S ribosomal RNA gene and hydrolysis probe-based qPCR, to identify blood meal sources of sylvatic Chagas disease insect vectors collected with live-bait mouse traps (also known as Noireau traps. Fourteen T. guasayana were collected from six georeferenced trap locations in the Andean highlands of the department of Chuquisaca, Bolivia.We detected four blood meals sources with the cloning assay: seven samples were positive for human (Homo sapiens, five for chicken (Gallus gallus and unicolored blackbird (Agelasticus cyanopus, and one for opossum (Monodelphis domestica. Using the qPCR assay we detected chicken (13 vectors, and human (14 vectors blood meals as well as an additional blood meal source, Canis sp. (4 vectors.We show that cloning of 12S PCR products, which avoids bias associated with developing primers based on a priori knowledge, detected blood meal sources not previously considered and that species-specific qPCR is more sensitive. All samples identified as positive for a specific blood meal source by the cloning assay were also positive by qPCR. However, not all samples positive by qPCR were positive by cloning. We show the power of combining the cloning assay with the highly sensitive hydrolysis probe-based qPCR assay provides a more complete picture of blood meal sources for insect disease vectors.

  3. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    Park, Y K; Park, K C; Park, C H; Kim, N S


    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  4. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    William Orsi

    Full Text Available The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC, nitrate, sulfide, and dissolved inorganic carbon (DIC. These correlations are supported by terminal restriction length polymorphism (TRFLP analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  5. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    Ostergaard, P; Phan, H; Johansen, L B;


    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

  6. Molecular phylogeny of Pneumocystis based on 5.8S rRNA gene and the internal transcribed spacers of rRNA gene sequences


    To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis.

  7. KMo12S14

    Villars, P.; Cenzual, K.; Daams, J.; Gladyshevskii, R.; Shcherban, O.; Dubenskyy, V.; Melnichenko-Koblyuk, N.; Pavlyuk, O.; Savysyuk, I.; Stoyko, S.; Sysa, L.

    This document is part of Subvolume A6 `Structure Types. Part 6: Space Groups (166) R-3m - (160) R3m' of Volume 43 `Crystal Structures of Inorganic Compounds' of Landolt-Börnstein - Group III `Condensed Matter'.

  8. Primary and secondary structures of Tetrahymena and aphid 5.8S rRNAs: structural features of 5.8S rRNA which interacts with the 28S rRNA containing the hidden break.

    Fujiwara, H.; H. Ishikawa


    The Tetrahymena 5.8S rRNA is 154 nucleotides long, the shortest so far reported except for the split 5.8S rRNAs of Diptera (m5.8S plus 2S rRNA). In this molecule several nucleotides are deleted in the helix e (GC-rich stem) region. Upon constructing the secondary structure in accordance with "burp-gun" model, the Tetrahymena 5.8S rRNA forms a wide-open "muzzle" of the terminal regions due to both extra nucleotides and several unpaired bases. The aphid 5.8S rRNA consists of 161 nucleotides and...

  9. Na2.9KMo12S14: a novel quaternary reduced molybdenum sulfide containing Mo12clusters with a channel structure

    Gougeon, Patrick; Gall, Philippe; Diala, Salloum


    The crystal structure of trisodium potassium dodecamolybdenum tetradecasulfide, Na2.9 (2)KMo12S14, consists of Mo12S14S6 cluster units interconnected through interunit Mo-S bonds and delimiting channels in which the Na+ cations are disordered. The cluster units are centered at Wyckoff positions 2d and have point-group symmetry 3.2. The K atom lies on sites with 3.2 symmetry (Wyckoff site 2c) between two consecutive Mo12S14S6 units. One of the three independent S atoms and one Na atom lie on s...

  10. Na2.9KMo12S14: a novel quaternary reduced molybdenum sulfide containing Mo12 clusters with a channel structure

    Patrick Gougeon; Philippe Gall; Diala Salloum


    The crystal structure of trisodium potassium dodecamolybdenum tetradecasulfide, Na2.9 (2)KMo12S14, consists of Mo12S14S6 cluster units interconnected through interunit Mo—S bonds and delimiting channels in which the Na+ cations are disordered. The cluster units are centered at Wyckoff positions 2d and have point-group symmetry 3.2. The K atom lies on sites with 3.2 symmetry (Wyckoff site 2c) between two consecutive Mo12S14S6 units. One of the three independent S atoms and one Na a...

  11. Exploring microbial diversity and taxonomy using SSU rRNA hypervariable tag sequencing.

    Susan M Huse


    Full Text Available Massively parallel pyrosequencing of hypervariable regions from small subunit ribosomal RNA (SSU rRNA genes can sample a microbial community two or three orders of magnitude more deeply per dollar and per hour than capillary sequencing of full-length SSU rRNA. As with full-length rRNA surveys, each sequence read is a tag surrogate for a single microbe. However, rather than assigning taxonomy by creating gene trees de novo that include all experimental sequences and certain reference taxa, we compare the hypervariable region tags to an extensive database of rRNA sequences and assign taxonomy based on the best match in a Global Alignment for Sequence Taxonomy (GAST process. The resulting taxonomic census provides information on both composition and diversity of the microbial community. To determine the effectiveness of using only hypervariable region tags for assessing microbial community membership, we compared the taxonomy assigned to the V3 and V6 hypervariable regions with the taxonomy assigned to full-length SSU rRNA sequences isolated from both the human gut and a deep-sea hydrothermal vent. The hypervariable region tags and full-length rRNA sequences provided equivalent taxonomy and measures of relative abundance of microbial communities, even for tags up to 15% divergent from their nearest reference match. The greater sampling depth per dollar afforded by massively parallel pyrosequencing reveals many more members of the "rare biosphere" than does capillary sequencing of the full-length gene. In addition, tag sequencing eliminates cloning bias and the sequences are short enough to be completely sequenced in a single read, maximizing the number of organisms sampled in a run while minimizing chimera formation. This technique allows the cost-effective exploration of changes in microbial community structure, including the rare biosphere, over space and time and can be applied immediately to initiatives, such as the Human Microbiome Project.

  12. Binding of 12-s-12 dimeric surfactants to calf thymus DNA: Evaluation of the spacer length influence.

    Sarrión, Beatriz; Bernal, Eva; Martín, Victoria Isabel; López-López, Manuel; López-Cornejo, Pilar; García-Calderón, Margarita; Moyá, María Luisa


    Several cationic dimeric surfactants have shown high affinity towards DNA. Bis-quaternary ammonium salts (m-s-m) have been the most common type of dimeric surfactants investigated and it is generally admitted that those that posses a short spacer (s≤3) show better efficiency to bind or compact DNA. However, experimental results in this work show that 12-s-12 surfactants with long spacers make the surfactant/ctDNA complexation more favorable than those with short spacers. A larger contribution of the hydrophobic interactions, which control the binding Gibbs energy, as well as a higher average charge of the surfactant molecules bound to the nucleic acid, which favors the electrostatic attractions, could explain the experimental observations. Dimeric surfactants with intermediate spacer length seem to be the less efficient for DNA binding. PMID:27108208

  13. Strength and Regulation of Seven rRNA Promoters in Escherichia coli.

    Michihisa Maeda

    Full Text Available The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed.

  14. A yeast transcription system for the 5S rRNA gene.

    Keulen, H.; Thomas, D. Y.


    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA gen...

  15. Oligonucleotide Fingerprinting of rRNA Genes for Analysis of Fungal Community Composition

    Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James


    Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones d...

  16. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    Cangelosi, G A; Brabant, W H


    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA prob...

  17. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira


    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  18. TaxMan: a server to trim rRNA reference databases and inspect taxonomic coverage

    Brandt, B. W.; Bonder, M. J.; Huse, S.M.; Zaura, E.


    Amplicon sequencing of the hypervariable regions of the small subunit ribosomal RNA gene is a widely accepted method for identifying the members of complex bacterial communities. Several rRNA gene sequence reference databases can be used to assign taxonomic names to the sequencing reads using BLAST, USEARCH, GAST or the RDP classifier. Next-generation sequencing methods produce ample reads, but they are short, currently ∼100-450 nt (depending on the technology), as compared to the full rRNA g...

  19. In Vivo Effect of NusB and NusG on rRNA Transcription Antitermination

    Torres, Martha; Balada, Joan-Miquel; Zellars, Malcolm; Squires, Craig; Squires, Catherine L.


    Similarities between lambda and rRNA transcription antitermination have led to suggestions that they involve the same Nus factors. However, direct in vivo confirmation that rRNA antitermination requires all of the lambda Nus factors is lacking. We have therefore analyzed the in vivo role of NusB and NusG in rRNA transcription antitermination and have established that both are essential for it. We used a plasmid test system in which reporter gene mRNA was measured to monitor rRNA antiterminato...

  20. The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

    Hori, H; Sawada, M.; Osawa, S; Murao, K; Ishikura, H


    The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

  1. Methyltransferase Erm(37) Slips on rRNA to Confer Atypical Resistance in Mycobacterium tuberculosis

    Madsen, Ch. T.; Jakobsen, L.; Buriánková, Karolína; Doucet-Populaire, F.; Perdonet, J. L.; Douthwaite, S.


    Roč. 280, č. 47 (2005), s. 38942-38947. ISSN 0021-9258 R&D Projects: GA ČR GA310/03/0292 Institutional research plan: CEZ:AV0Z50200510 Keywords : methyltransferase erm * mycobacterium tuberculosis * rRNA Subject RIV: EE - Microbiology, Virology Impact factor: 5.854, year: 2005

  2. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten; Dalgaard, Jacob; Lykke-Andersen, Jens; Phan, Hoa T.N.; Trevisanato, Siro; Østergaard, Laust; Larsen, Niels; Leffers, Henrik


    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows is a...

  3. An alternative strategy for bacterial ribosome synthesis: Bacillus subtilis rRNA transcription regulation

    Krásný, Libor; Gourse, Richard. L.


    Roč. 23, č. 22 (2004), s. 4473-4483. ISSN 0261-4189 Grant ostatní: National Institutes of Health(US) RO1 GM37048 Institutional research plan: CEZ:AV0Z5052915 Keywords : B. subtilis , GTP concentrations, rRNA transcription Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 10.492, year: 2004

  4. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    Rosendahl, G; Hansen, L H; Douthwaite, S


    reveals increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits......The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea and...... chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...

  5. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    van Wezel, G P; Krab, I M; Douthwaite, S; Bibb, M J; Vijgenboom, E; Bosch, L


    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, correspondi...

  6. Supramolecular hydrogel of kanamycin selectively sequesters 16S rRNA

    Yang, Zhimou; Kuang, Yi; Li, Xinming; Zhou, Ning; Zhang, Ye; Xu, Bing


    As the first example of hydrogelator derived from aminoglycoside antibiotics, the hydrogel of kanamycin indicates that the hydrogel of aminoglycosides preserve the specific interaction with their macromolecular targets (e.g., 16S rRNA), thus illustrating a simple approach to explore and identify possible biological targets of supramolecular nanofibers/hydrogels.

  7. EmtA, a rRNA methyltransferase conferring high-level evernimicin resistance

    Mann, P. A.; Xiong, L.; Mankin, A. S.; Chau, A. S.; Najarian, D. J.; Mendrick, C. A.; Cramer, C. A.; Aarestrup, Frank Møller; Hare, R. S.; Black, T. A.; McNicholas, P. M.


    unique to the 23S rRNA extracted from resistant ribosomes. The pause corresponded to methylation of residue G2470 (Escherichia coli numbering). RNA footprinting revealed that G2470 is located within the evernimicin-binding site on the ribosome, thus providing an explanation for the reduced binding of the...

  8. Oral microbiome profiles: 16S rRNA pyrosequencing and microarray assay comparison.

    Jiyoung Ahn

    Full Text Available OBJECTIVES: The human oral microbiome is potentially related to diverse health conditions and high-throughput technology provides the possibility of surveying microbial community structure at high resolution. We compared two oral microbiome survey methods: broad-based microbiome identification by 16S rRNA gene sequencing and targeted characterization of microbes by custom DNA microarray. METHODS: Oral wash samples were collected from 20 individuals at Memorial Sloan-Kettering Cancer Center. 16S rRNA gene survey was performed by 454 pyrosequencing of the V3-V5 region (450 bp. Targeted identification by DNA microarray was carried out with the Human Oral Microbe Identification Microarray (HOMIM. Correlations and relative abundance were compared at phylum and genus level, between 16S rRNA sequence read ratio and HOMIM hybridization intensity. RESULTS: The major phyla, Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, and Fusobacteria were identified with high correlation by the two methods (r = 0.70∼0.86. 16S rRNA gene pyrosequencing identified 77 genera and HOMIM identified 49, with 37 genera detected by both methods; more than 98% of classified bacteria were assigned in these 37 genera. Concordance by the two assays (presence/absence and correlations were high for common genera (Streptococcus, Veillonella, Leptotrichia, Prevotella, and Haemophilus; Correlation = 0.70-0.84. CONCLUSION: Microbiome community profiles assessed by 16S rRNA pyrosequencing and HOMIM were highly correlated at the phylum level and, when comparing the more commonly detected taxa, also at the genus level. Both methods are currently suitable for high-throughput epidemiologic investigations relating identified and more common oral microbial taxa to disease risk; yet, pyrosequencing may provide a broader spectrum of taxa identification, a distinct sequence-read record, and greater detection sensitivity.

  9. Genes involved in the synthesis of the exopolysaccharide methanolan by the obligate methylotroph Methylobacillus sp strain 12S.

    Yoshida, Takako; Ayabe, Yuko; Yasunaga, Masaaki; Usami, Yusuke; Habe, Hiroshi; Nojiri, Hideaki; Omori, Toshio


    Methylobacillus sp. strain 12S produces an exopolysaccharide (EPS), methanolan, composed of glucose, mannose and galactose. Twenty-four ORFs flanking a Tn5 insertion site in an EPS-deficient mutant were identified, and 21 genes (epsCBAKLDEFGHIJMNOPQRSTU) were predicted to participate in methanolan synthesis on the basis of the features of the primary sequence. Gene disruption analyses revealed that epsABCEFGIJNOP and epsR are required for methanolan synthesis, whereas epsKD and epsH are not essential. EpsFG and EpsE showed homology with Wzc (chain length regulator) and Wza (export protein) of group 1 capsule-producing Escherichia coli, suggesting that methanolan was synthesized via a Wzy-like biosynthesis system. This possibility was supported by the fact that the putative hydropathy profiles of EpsH and EpsM were similar to those of Wzx and Wzy, which are also involved in the flipping of the repeating unit in the cytoplasmic membrane and the polymerization of the capsule in the Wzy-dependent system. EpsBJNOP and EpsR are probably glycosyltransferases involved in the synthesis of the repeating unit onto the lipid carrier. In particular, EpsB appeared to catalyse the initial transfer of the glucose moiety. On the basis of their predicted location in the cells, it is proposed that EpsI and EpsL are involved in methanolan export to the cell surface. E. coli strains expressing EpsQ, EpsS and EpsT showed enhanced activities of GDP-mannose pyrophosphorylase, UDP-galactose 4-epimerase and UDP-glucose pyrophosphorylase, respectively, revealing that they were responsible for the production of the activated compositional sugars of methanolan. EpsU contains a conserved a lytic transglycosylase motif, indicating that it could participate in the degradation of polysaccharides. EpsA and EpsK, which have conserved DNA-binding and cAMP-binding motifs, respectively, were deduced to be transcriptional regulators. In particular, EpsA seems to positively regulate the transcription of

  10. Nucleolin is required for DNA methylation state and the expression of rRNA gene variants in Arabidopsis thaliana.

    Frédéric Pontvianne


    Full Text Available In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1. Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre-rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis.

  11. A phylogeny of the Passerida(Aves: Passeriformes)based on mitochondrial 12S ribosomal RNA gene

    Lina; Wu; Yanfeng; Sun; Juyong; Li; Yaqing; Li; Yuefeng; Wu; Dongming; Li


    Background: Passerida is the largest avian radiation within the order Passeriformes. Current understanding of the high-level relationships within Passerida is based on DNA–DNA hybridizations; however, the phylogenetic relationships within this assemblage have been the subject of many debates.Methods: We analyzed the 12 S ribosomal RNA gene from 49 species of Passerida, representing 14 currently recognized families, to outline the phylogenetic relationships within this group.Results: Our results identified the monophyly of the three superfamilies in Passerida: Sylvioidea, Muscicapoidea and Passeroidea. However, current delimitation of some species is at variance with our phylogeny estimate. First, the Parus major, which had been placed as a distinct clade sister to Sylvioidea was identified as a member of the super family;second, the genus Regulus was united with the Sturnidae and nested in the Muscicapoidea clade instead of being a clade of Passerida.Conclusion: Our results were consistent with Johansson’s study of the three superfamilies except for the al ocation of two families, Paridae and Regulidae.

  12. 12S-lipoxygenase protein associates with α-actin fibers in human umbilical artery vascular smooth muscle cells

    The current study sets out to characterize the intracellular localization of the platelet-type 12S-lipoxygenase (12-LO), an enzyme involved in angiotensin-II induced signaling in vascular smooth muscle cells (VSMC). Immunohistochemical analysis of VSMC in vitro or human umbilical arteries in vivo showed a clear cytoplasmic localization. On immunogold electron microscopy, 12-LO was found primarily associated with cytoplasmic VSMC muscle fibrils. Upon angiotensin-II treatment of cultured VSMC, immunoprecipitated 12-LO was found bound to α-actin, a component of the cytoplasmic myofilaments. 12-LO/α-actin binding was blocked by VSMC pretreatment with the 12-LO inhibitors, baicalien or esculetine and the protein synthesis inhibitor, cycloheximide. Moreover, the binding of 12-LO to α-actin was not associated with 12-LO serine or tyrosine phosphorylation. These observations suggest a previously unrecognized angiotensin-II dependent protein interaction in VSMC through which 12-LO protein may be trafficked, for yet undiscovered purposes towards the much more abundantly expressed cytoskeletal protein α-actin

  13. EXTraS discovery of an 1.2-s X-ray pulsar in M 31

    Esposito, P; Belfiore, A; Novara, G; Sidoli, L; Castillo, G A Rodríguez; De Luca, A; Tiengo, A; Haberl, F; Salvaterra, R; Read, A M; Salvetti, D; Sandrelli, S; Marelli, M; Wilms, J; D'Agostino, D


    During a search for coherent signals in the X-ray archival data of XMM-Newton, we discovered a modulation at 1.2 s in 3XMM J004301.4+413017 (3X J0043), a source lying in the direction of an external arm of M 31. This short period indicates a neutron star (NS). Between 2000 and 2013, the position of 3X J0043 was imaged by public XMM-Newton observations 35 times. The analysis of these data allowed us to detect an orbital modulation at 1.27 d and study the long-term properties of the source. The emission of the pulsar was rather hard (most spectra are described by a power law with $\\Gamma < 1$) and, assuming the distance to M 31, the 0.3-10 keV luminosity was variable, from $\\sim$$3\\times10^{37}$ to $2\\times10^{38}$ erg s$^{-1}$. The analysis of optical data shows that, while 3X J0043 is likely associated to a globular cluster in M 31, a counterpart with $V\\gtrsim22$ outside the cluster cannot be excluded. Considering our findings, there are two main viable scenarios for 3X J0043: a peculiar low-mass X-ray bi...

  14. EXTraS discovery of an 1.2-s X-ray pulsar in M 31

    Esposito, P.; Israel, G. L.; Belfiore, A.; Novara, G.; Sidoli, L.; Rodríguez Castillo, G. A.; De Luca, A.; Tiengo, A.; Haberl, F.; Salvaterra, R.; Read, A. M.; Salvetti, D.; Sandrelli, S.; Marelli, M.; Wilms, J.; D'Agostino, D.


    During a search for coherent signals in the X-ray archival data of XMM-Newton, we discovered a modulation at 1.2 s in 3XMM J004301.4+413017 (3X J0043), a source lying in the direction of an external arm of M 31. This short period indicates a neutron star (NS). Between 2000 and 2013, the position of 3X J0043 was imaged by public XMM-Newton observations 35 times. The analysis of these data allowed us to detect an orbital modulation at 1.27 d and study the long-term properties of the source. The emission of the pulsar was rather hard (most spectra are described by a power law with Γ < 1) and, assuming the distance to M 31, the 0.3-10 keV luminosity was variable, from ˜3 × 1037 to 2 × 1038 erg s-1. The analysis of optical data shows that, while 3X J0043 is likely associated to a globular cluster in M 31, a counterpart with V ≳ 22 outside the cluster cannot be excluded. Considering our findings, there are two main viable scenarios for 3X J0043: a peculiar low-mass X-ray binary, similar to 4U 1822-37 or 4U 1626-67, or an intermediate-mass X-ray binary resembling Her X-1. Regardless of the exact nature of the system, 3X J0043 is the first accreting NS in M 31 in which the spin period has been detected.

  15. Partnering to reduce waste at Y-12 through Y-12's multi-organizational reduce/reuse/recycle team

    BWXT Y-12, L.L.C., the Maintenance and Operations (M and O) contractor at the Y-12 National Security Complex (Y-12), practices pollution prevention in daily operations because it recognizes that the implementation of pollution prevention (P2) projects impacting all waste types, discharges, and emissions at the complex saves resources across the board. Projects that reduce solid industrial waste save numerous resources, including valuable landfill space. At Y- 12, most of the solid industrial waste that is not reduced, reused, or recycled is transported to an industrial waste landfill located on the U.S. Department of Energy (DOE) Oak Ridge Reservation (ORR). While the current landfill still has capacity, in the past the industrial waste generation across the ORR was impacted when the new landfill was not available to receive waste, but the old landfill was reaching capacity. The potential of having waste with absolutely nowhere to go is simply not an option for a facility with ongoing operations. Avoiding this potential scenario in the memorable past has made Y-12 very aware of the importance of reducing all waste types. While Y-12 aggressively pursues pollution prevention implementation on all waste types, this paper will highlight the use of systems, people, and pollution prevention integration in projects used by Y-12 to holistically reduce the amount of industrial waste being sent to the on-site landfill. Specifically, the design and use of Y-12's Environmental Management System (EMS), the creation of a multi-disciplinary team, and the buy-in and creativity of the site project, Infrastructure Reduction (IR), that generates the largest volumes of waste will be discussed. (authors)

  16. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment.

    Kwasniewska, Jolanta; Jaskowiak, Joanna


    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  17. A renaissance for the pioneering 16S rRNA gene

    Tringe, Susannah; Hugenholtz, Philip


    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  18. Rapid identification of Renibacterium salmoninarum using an oligonucleotide probe complementary to 16S rRNA.

    Mattsson, J G; Gersdorf, H; Jansson, E; Hongslo, T; Göbel, U B; Johansson, K E


    Bacterial kidney disease in salmonid fish is caused by the slow-growing Gram-positive rod, Renibacterium salmoninarum. The partial sequence of 16S rRNA from R. salmoninarum was determined and compared with published bacterial 16S rRNA sequences. From this sequence information, a 30-bases-long oligonucleotide was designed and used as a specific probe for identification of R. salmoninarum in filter hybridization experiments. Strong specific hybridization signals were observed for all strains of R. salmoninarum tested. Furthermore, no cross-hybridization could be seen against 22 other bacterial species, among them other salmonid fish pathogens. The detection limit for the probe in direct filter hybridization by the dot-blot technique was 2.5 x 10(4) bacteria. It was also possible to detect R. salmoninarum in clinical samples by direct filter hybridization. PMID:8455640

  19. Phylogeny of the malarial genus Plasmodium, derived from rRNA gene sequences.

    Escalante, A A; Ayala, F. J.


    Malaria is among mankind's worst scourges, affecting many millions of people, particularly in the tropics. Human malaria is caused by several species of Plasmodium, a parasitic protozoan. We analyze the small subunit rRNA gene sequences of 11 Plasmodium species, including three parasitic to humans, to infer their evolutionary relationships. Plasmodium falciparum, the most virulent of the human species, is closely related to Plasmodium reichenowi, which is parasitic to chimpanzee. The estimate...

  20. Direct ribosome isolation from soil to extract bacterial rRNA for community analysis.

    Felske, A; B. Engelen; Nübel, U; Backhaus, H


    A simple method that combines an adapted ribosome isolation method and a common RNA extraction step has been developed for selective recovery of intact rRNA from natural microbial communities in soil. After mechanical cell lysis, ribosomes are separated by centrifugation steps, avoiding massive humic acid contamination and RNA degradation. The protocol accommodates the complex composition of soils by blocking adsorbing surfaces and humic acids with polyvinylpyrrolidone and bovine serum albumi...

  1. New bioinformatic tools for analysis of nucleotide modifications in eukaryotic rRNA

    Piekna-Przybylska, Dorota; Decatur, Wayne A.; Fournier, Maurille J.


    This report presents a valuable new bioinformatics package for research on rRNA nucleotide modifications in the ribosome, especially those created by small nucleolar RNA:protein complexes (snoRNPs). The interactive service, which is not available elsewhere, enables a user to visualize the positions of pseudouridines, 2′-O-methylations, and base methylations in three-dimensional space in the ribosome and also in linear and secondary structure formats of ribosomal RNA. Our tools provide additio...

  2. rRNA genes from the lower chordate Herdmania momus: structural similarity with higher eukaryotes.

    Degnan, B M; Yan, J.; Hawkins, C J; Lavin, M F


    Ascidians, primitive chordates that have retained features of the likely progenitors to all vertebrates, are a useful model to study the evolutionary relationship of chordates to other animals. We have selected the well characterized ribosomal RNA (rRNA) genes to investigate this relationship, and we describe here the cloning and characterization of an entire ribosomal DNA (rDNA) tandem repeat unit from a lower chordate, the ascidian Herdmania momus. rDNA copy number and considerable sequence...

  3. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    Haltiner, M M; Smale, S T; Tjian, R


    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this...

  4. 18S rRNA suggests that Entoprocta are protostomes, unrelated to Ectoprocta

    Mackey, L.Y.; Winnepenninckx, B.; Wachter, R.; Backeljau, T.; Emschermann, P.; Garey, J.R.


    The Ento- and Ectoprocta are sometimes placed together in the Bryozoa, which have variously been regarded as proto- or deuterostomes. However, Entoprocta have also been allied to the pseudocoelomates, while Ectoprocta are often united with the Brachiopoda and Phoronida in the (super)phylum Lophophorata. Hence, the phylogenetic relationships of these taxa are still much debated. We determined complete 18S rRNA sequences of two entoprocts, an ectoproct, an inarticulate brachiopod, a phoronid, t...

  5. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    Mohammad Bagher Javadi Nobandegani; Halimi Mohd Saud; Wong Mui Yun


    Phosphate solubilizing bacteria (PSB) can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang) oil palm field (University Putra Malaysia). Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta sub...

  6. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    Anna eKiryk


    Full Text Available Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer´s disease (AD and may play a role in dementia. Moreover aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3 and dentate gyrus. Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that thirty-six transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the dentate gyrus a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving

  7. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.


    A 16S rRNA gene database ( addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  8. rRNA Binding Sites and the Molecular Mechanism of Action of the Tetracyclines.

    Chukwudi, Chinwe U


    The tetracycline antibiotics are known to be effective in the treatment of both infectious and noninfectious disease conditions. The 16S rRNA binding mechanism currently held for the antibacterial action of the tetracyclines does not explain their activity against viruses, protozoa that lack mitochondria, and noninfectious conditions. Also, the mechanism by which the tetracyclines selectively inhibit microbial protein synthesis against host eukaryotic protein synthesis despite conservation of ribosome structure and functions is still questionable. Many studies have investigated the binding of the tetracyclines to the 16S rRNA using the small ribosomal subunit of different bacterial species, but there seems to be no agreement between various reports on the exact binding site on the 16S rRNA. The wide range of activity of the tetracyclines against a broad spectrum of bacterial pathogens, viruses, protozoa, and helminths, as well as noninfectious conditions, indicates a more generalized effect on RNA. In the light of recent evidence that the tetracyclines bind to various synthetic double-stranded RNAs (dsRNAs) of random base sequences, suggesting that the double-stranded structures may play a more important role in the binding of the tetracyclines to RNA than the specific base pairs, as earlier speculated, it is imperative to consider possible alternative binding modes or sites that could help explain the mechanisms of action of the tetracyclines against various pathogens and disease conditions. PMID:27246781

  9. Characterization of Hydrocortisone Biometabolites and 18S rRNA Gene in Chlamydomonas reinhardtii Cultures

    Seyed Bagher Mosavi-Azam


    Full Text Available A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1. This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25ºC for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17b-Dihydroxyandrost-4-en-3-one (2, 11b-hydroxyandrost-4-en-3,17-dione (3, 11b,17a,20b,21-tetrahydroxypregn-4-en-3-one (4 and prednisolone (5 were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  10. Molecular systematics of Volvocales (Chlorophyceae, Chlorophyta) based on exhaustive 18S rRNA phylogenetic analyses.

    Nakada, Takashi; Misawa, Kazuharu; Nozaki, Hisayoshi


    The taxonomy of Volvocales (Chlorophyceae, Chlorophyta) was traditionally based solely on morphological characteristics. However, because recent molecular phylogeny largely contradicts the traditional subordinal and familial classifications, no classification system has yet been established that describes the subdivision of Volvocales in a manner consistent with the phylogenetic relationships. Towards development of a natural classification system at and above the generic level, identification and sorting of hundreds of sequences based on subjective phylogenetic definitions is a significant step. We constructed an 18S rRNA gene phylogeny based on 449 volvocalean sequences collected using exhaustive BLAST searches of the GenBank database. Many chimeric sequences, which can cause fallacious phylogenetic trees, were detected and excluded during data collection. The results revealed 21 strongly supported primary clades within phylogenetically redefined Volvocales. Phylogenetic classification following PhyloCode was proposed based on the presented 18S rRNA gene phylogeny along with the results of previous combined 18S and 26S rRNA and chloroplast multigene analyses. PMID:18430591

  11. Details of gastropod phylogeny inferred from 18S rRNA sequences.

    Winnepenninckx, B; Steiner, G; Backeljau, T; De Wachter, R


    Some generally accepted viewpoints on the phylogenetic relationships within the molluscan class Gastropoda are reassessed by comparing complete 18S rRNA sequences. Phylogenetic analyses were performed using the neighbor-joining and maximum parsimony methods. The previously suggested basal position of Archaeogastropoda, including Neritimorpha and Vetigastropoda, in the gastropod clade is confirmed. The present study also provides new molecular evidence for the monophyly of both Caenogastropoda and Euthyneura (Pulmonata and Opisthobranchia), making Prosobranchia paraphyletic. The relationships within Caenogastropoda and Euthyneura data turn out to be very unstable on the basis of the present 18S rRNA sequences. The present 18S rRNA data question, but are insufficient to decide on, muricacean (Neogastropoda), neotaenioglossan, pulmonate, or stylommatophoran monophyly. The analyses also focus on two systellommatophoran families, namely, Veronicellidae and Onchidiidae. It is suggested that Systellommatophora are not a monophyletic unit but, due to the lack of stability in the euthyneuran clade, their affinity to either Opisthobranchia or Pulmonata could not be determined. PMID:9479694

  12. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S


    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  13. Stereoselective chemo-enzymatic oxidation routes for (1R,3E,7E,11S,12S)-3,7,18-dolabellatriene

    Christian eGörner; Max eHirte; Stephanie eHuber; Patrick eSchrepfer; Thomas Bartholomäus Brück


    The diterpene (1R,3E,7E,11S,12S)-3,7,18-dolabellatriene from the marine brown alga Dilophus spiralis belongs to the dolabellanes natural product family and has antimicrobial activity against multi-drug resistant Staphylococcus aureus (MRSA). Recently, we generated a CotB2 diterpene synthase mutant (W288G), which instead of its native product cyclooctat-9-en-7-ol, generates (1R,3E,7E,11S,12S)-3,7,18-dolabellatriene. In vivo CotB2 W288G reconstitution in an E. coli based terpene production syst...

  14. Stereoselective chemo-enzymatic oxidation routes for (1R,3E,7E,11S,12S)-3,7,18-dolabellatriene

    Görner, Christian; Hirte, Max; Huber, Stephanie; Schrepfer, Patrick; Brück, Thomas


    The diterpene (1R,3E,7E,11S,12S)-3,7,18-dolabellatriene from the marine brown alga Dilophus spiralis belongs to the dolabellanes natural product family and has antimicrobial activity against multi-drug resistant Staphylococcus aureus. Recently, we generated a CotB2 diterpene synthase mutant (W288G), which instead of its native product cyclooctat-9-en-7-ol, generates (1R,3E,7E,11S,12S)-3,7,18-dolabellatriene. In vivo CotB2 W288G reconstitution in an Escherichia coli based terpene production sy...

  15. Induction of cell cycle progression by adenovirus E1A gene 13S- and 12S-mRNA products in quiescent rat cells.

    Nakajima, T.; Masuda-Murata, M; Hara, E; Oda, K.


    Rat 3Y1 cell lines that express either adenovirus type 12 E1A 13S mRNA or 12S mRNA in response to dexamethasone treatment were established by introduction of recombinant vector DNA containing the E1A 13S- or 12S-mRNA cDNA placed downstream of the hormone-inducible promoter of mouse mammary tumor virus. These cell lines were growth arrested, and the induction of cell cycle progression was analyzed by flow cytometry after switch on of the cDNA by the addition of dexamethasone. The results indic...

  16. Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome

    Carlos; W; Nossa; William; E; Oberdorf; Jφrn; A; Aas; Bruce; J; Paster; Todd; Z; DeSantis; Eoin; L; Brodie; Daniel; Malamud; Michael; A; Poles


    AIM:To design and validate broad-range 16S rRNA primers for use in high throughput sequencing to classify bacteria isolated from the human foregut microbiome.METHODS:A foregut microbiome dataset was constructed using 16S rRNA gene sequences obtained from oral,esophageal,and gastric microbiomes produced by Sanger sequencing in previous studies represented by 219 bacterial species.Candidate primers evaluated were from the European rRNA database.To assess the effect of sequence length on accuracy of classifica...

  17. Primary and secondary structure of 5.8S rRNA from the silkgland of Bombyx mori.

    Fujiwara, H.; Kawata, Y.; H. Ishikawa


    Nucleotide sequence of 5.8S rRNA of the silkworm, Bombyx mori has been determined by gel sequencing methods. The 5.8S rRNA was the longest so far reported, with the 5'-terminal sequence several nucleotides longer than those of the other organisms. Upon constructing the secondary structure in accordance with the "burp gun" model (12), the Bombyx 5.8S rRNA formed a wide-open "muzzle" due to several unpaired bases at the ends. The overall structure also appeared less stable with less G . C pairs...

  18. An efficient rRNA removal method for RNA sequencing in GC-rich bacteria

    Peano Clelia


    Full Text Available Abstract Background Next generation sequencing (NGS technologies have revolutionized gene expression studies and functional genomics analysis. However, further improvement of RNA sequencing protocols is still desirable, in order to reduce NGS costs and to increase its accuracy. In bacteria, a major problem in RNA sequencing is the abundance of ribosomal RNA (rRNA, which accounts for 95-98% of total RNA and can therefore hinder sufficient coverage of mRNA, the main focus of transcriptomic studies. Thus, efficient removal of rRNA is necessary to achieve optimal coverage, good detection sensitivity and reliable results. An additional challenge is presented by microorganisms with GC-rich genomes, in which rRNA removal is less efficient. Results In this work, we tested two commercial kits for rRNA removal, either alone or in combination, on Burkholderia thailandensis. This bacterium, chosen as representative of the important Burkholderia genus, which includes both pathogenic and environmental bacteria, has a rather large (6.72 Mb and GC-rich (67.7% genome. Each enriched mRNA sample was sequenced through paired-end Illumina GAIIx run in duplicate, yielding between 10 and 40 million reads. We show that combined treatment with both kits allows an mRNA enrichment of more than 238-fold, enabling the sequencing of almost all (more than 90% B. thailandensis transcripts from less than 10 million reads, without introducing any bias in mRNA relative abundance, thus preserving differential expression profile. Conclusions The mRNA enrichment protocol presented in this work leads to an increase in detection sensitivity up to 770% compared to total RNA; such increased sensitivity allows for a corresponding reduction in the number of sequencing reads necessary for the complete analysis of whole transcriptome expression profiling. Thus we can conclude that the MICROBExpress/Ovation combined rRNA removal method could be suitable for RNA sequencing of whole

  19. Mitochondrial 12S Ribosomal RNA A1555G Mutation Associated with Cardiomyopathy and Hearing Loss following High-Dose Chemotherapy and Repeated Aminoglycoside Exposure

    Skou, Anne-Sofie; Tranebjærg, Lisbeth; Jensen, Tim;


    A 19-month-old girl with the A1555G mitochondrial mutation in the 12S ribosomal RNA gene and acute myelogenous leukemia developed dilated cardiomyopathy and bilateral sensorineural hearing loss before undergoing allogeneic stem cell transplantation. She had received gentamicin during episodes of ...... febrile neutropenia. Testing for the A1555G mutation is recommended in patients frequently treated with aminoglycosides....

  20. Species identification and profiling of complex microbial communities using shotgun Illumina sequencing of 16S rRNA amplicon sequences.

    Ong, SH; Kukkillaya, VU; Wilm, A; Lay, C; Ho, EX; Low, L; Hibberd, ML; Nagarajan, N.


    The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequenc...

  1. Intervening Sequences in rrl Genes and Fragmentation of 23S rRNA in Genera of the Family Enterobacteriaceae

    Pronk, Loes M; Sanderson, Kenneth E.


    Intervening sequences (IVSs) in the rrl genes for 23S rRNA are transcribed but later removed by RNase III without religation during RNA processing, leading to fragmented rRNA. We examined about 240 strains of the family Enterobacteriaceae for presence of IVSs using PCR. No IVSs were detected in strains belonging to Escherichia, Shigella, Enterobacter, Erwinia, Ewingella, Hafnia, Kluyvera, Morganella, Pantoea, or Serratia. Previously unreported IVSs were detected in Klebsiella oxytoca, Citroba...

  2. Transcriptional down-regulation and rRNA cleavage in Dictyostelium discoideum mitochondria during Legionella pneumophila infection.

    Chenyu Zhang

    Full Text Available Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial

  3. Renibacterium salmoninarum isolates from different sources possess two highly conserved copies of the rRNA operon .

    Grayson, T H; Alexander, S M; Cooper, L F; Gilpin, M L


    The nucleotide sequences of the rRNA genes and the 5' flanking region were determined for R. salmoninarum ATCC 33209T from overlapping products generated by PCR amplification from the genomic DNA. Comparison of the sequences with rRNA genes from a variety of bacteria demonstrated the close relatedness between R. salmoninarum and the high G+C group of the actinobacteria, in particular, Arthrobacter species. A regulatory element within the 5' leader of the rRNA operon was identical to an element, CL2, described for mycobacteria. PCR, DNA sequence analysis, and DNA hybridisation were performed to examine variation between isolates from diverse sources which represented the four 16S-23S rRNA intergenic spacer sequevars previously described for R. salmoninarum. Two 23S-5S rRNA intergenic spacer sequevars of identical length were found. DNA hybridisation using probes complementary to 23S rDNA and 16S rDNA identified two rRNA operons which were identical or nearly identical amongst 40 isolates sourced from a variety of countries. PMID:11016696

  4. Molecular epidemiology of Plasmodium species prevalent in Yemen based on 18 s rRNA

    A Azazy Ahmed


    Full Text Available Abstract Background Malaria is an endemic disease in Yemen and is responsible for 4.9 deaths per 100,000 population per year and 43,000 disability adjusted life years lost. Although malaria in Yemen is caused mainly by Plasmodium falciparum and Plasmodium vivax, there are no sequence data available on the two species. This study was conducted to investigate the distribution of the Plasmodium species based on the molecular detection and to study the molecular phylogeny of these parasites. Methods Blood samples from 511 febrile patients were collected and a partial region of the 18 s ribosomal RNA (18 s rRNA gene was amplified using nested PCR. From the 86 positive blood samples, 13 Plasmodium falciparum and 4 Plasmodium vivax were selected and underwent cloning and, subsequently, sequencing and the sequences were subjected to phylogenetic analysis using the neighbor-joining and maximum parsimony methods. Results Malaria was detected by PCR in 86 samples (16.8%. The majority of the single infections were caused by P. falciparum (80.3%, followed by P. vivax (5.8%. Mixed infection rates of P. falciparum + P. vivax and P. falciparum + P. malariae were 11.6% and 2.3%, respectively. All P. falciparum isolates were grouped with the strain 3D7, while P. vivax isolates were grouped with the strain Salvador1. Phylogenetic trees based on 18 s rRNA placed the P. falciparum isolates into three sub-clusters and P. vivax into one cluster. Sequence alignment analysis showed 5-14.8% SNP in the partial sequences of the 18 s rRNA of P. falciparum. Conclusions Although P. falciparum is predominant, P. vivax, P. malariae and mixed infections are more prevalent than has been revealed by microscopy. This overlooked distribution should be considered by malaria control strategy makers. The genetic polymorphisms warrant further investigation.

  5. The role of human ribosomal proteins in the maturation of rRNA and ribosome production

    Robledo, Sara; Rachel A Idol; Crimmins, Dan L.; Ladenson, Jack H.; Mason, Philip J.; Bessler, Monica


    Production of ribosomes is a fundamental process that occurs in all dividing cells. It is a complex process consisting of the coordinated synthesis and assembly of four ribosomal RNAs (rRNA) with about 80 ribosomal proteins (r-proteins) involving more than 150 nonribosomal proteins and other factors. Diamond Blackfan anemia (DBA) is an inherited red cell aplasia caused by mutations in one of several r-proteins. How defects in r-proteins, essential for proliferation in all cells, lead to a hum...

  6. Structures of nucleolus and transcription sites of rRNA genes in rat liver cells


    We observed the ultrastructure of nucleolus in rat liver cells by conventional electronmicroscopy, and employed cytochemistry NAMA-Ur DNA specific stain method to analyze the distributionand position of nucleolar DNA in situ. The results showed that nucleolar DNA of rat livercells comes from nucleolus-associated chromatin, and continuously extends in the dense fibrillarcomponent (DFC) of nucleolus, localizes at the periphery of fibrillar center (FC) and in DFC. Furthermore,by employing anti-DNA/RNA hybrid antibodies, we directly and selectively labeled transcriptionsites of rRNA genes and testified that localization of transcription sites not only to DFC butalso to the periphery of FC.

  7. Altered features in the secondary structure of Vicia faba 5.8s rRNA.

    Nazar, R N; Wildeman, A G


    We have re-examined the nucleotide sequence of Vicia faba (broad bean) 5.8S rRNA using partial chemical degradation and a new approach to high temperature (65-80 degrees C) sequencing gels. The results indicate that the secondary structure was not completely disrupted in previous studies (Tanaka, Y., Dyer, T.A. and Brownlee, G.G. (1980) Nucleic Acid Res. 8, 1259-1272) and explain ambiguities between the nucleotide sequence and T1 ribonuclease digests. Despite this revision, estimates in the s...

  8. Functional interactions within 23S rRNA involving the peptidyltransferase center

    Douthwaite, S


    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S r...... chloramphenicol. Introduction of the domain II deletion into these double-mutation constructs gives rise to erythromycin resistance. The results are interpreted as indicating that position 2032 interacts with the peptidyltransferase loop and that there is a functional connection between domains II and V....

  9. Evolution of green plants as deduced from 5S rRNA sequences

    Hori, Hiroshi; Lim, Byung-Lak; OSAWA, Syozo


    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land pl...

  10. Negative in vitro selection identifies the rRNA recognition motif for ErmE methyltransferase

    Nielsen, A K; Douthwaite, S; Vester, B


    the adjacent single-stranded region around A2058. An RNA transcript of 72 nt that displays this motif functions as an efficient substrate for the ErmE methyltransferase. Pools of degenerate RNAs were formed by doping 34-nt positions that extend over and beyond the putative Erm recognition motif within...... contained substitutions at single sites, and these are confined to 12 nucleotide positions. These nucleotides, corresponding to A2051-A2060, C2611, and A2614 in 23S rRNA, presumably comprise the RNA recognition motif for ErmE methyltransferase. The structure formed by these nucleotides is highly conserved...


    G. S. Andriiash


    Full Text Available The phylogenetic relationships of strainsproducers of essential amino acids of aspartate family Brevibacterium sp. UCM Ac-674 (Brevibacterium sp. 90, Brevibacterium sp. IMV Ac-5004 (Brevibacterium sp. 90H, Brevibacterium sp. UCM Ac-675 (Brevibacterium sp. E531, mutant strain Brevibacterium sp. IMV B-7447 from the «Collections strains and lines of plants for food and agricultural biotechnology SO “Institute for Food Biotechnology and Genomics” of National Academy of Sciences of Ukraine were investigated. The affiliation strain Brevibacterium sp. IMV B-7447 to the genus Brevibacterium within the sequences of the genes based on 16S rRNA was confirmed. The dendogram of phylogenetic relationships of studied strains and related strains Brevibacterium from database GenBank was constructed. It was shown that by the criterion of homology gene sequences based on 16S rRNA the investigated strains-producers belong to three phylogenetic groups. It was established that the mutant strain Brevibacterium sp. ІMV B-7447 has no analogues in the database GenBank.

  12. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.


    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  13. Analysis of the Precursor rRNA Fractions of Rapidly Growing Mycobacteria: Quantification by Methods That Include the Use of a Promoter (rrnA P1) as a Novel Standard†

    Menéndez, María del Carmen; Rebollo, María José; Núñez, María del Carmen; Cox, Robert A.; García, María Jesús


    Mycobacterial species are able to control rRNA production through variations in the number and strength of promoters controlling their rrn operons. Mycobacterium chelonae and M. fortuitum are members of the rapidly growing mycobacterial group. They carry a total of five promoters each, encoded, respectively, by one and two rrn operons per genome. Quantification of precursor rrn transcriptional products (pre-rrn) has allowed detection of different promoter usage during cell growth. Bacteria growing in several culture media with different nutrient contents were compared. Balanced to stationary phases were analyzed. Most promoters were found to be used at different levels depending on the stage of bacterial growth and the nutrient content of the culture medium. Some biological implications are discussed. Sequences of the several promoters showed motifs that could be correlated to their particular level of usage. A product corresponding to the first rrnA promoter in both species, namely, rrnA P1, was found to contribute at a low and near-constant level to pre-rRNA synthesis, regardless of the culture medium used and the stage of growth analyzed. This product was used as a standard to quantitate rRNA gene expression by real-time PCR when M. fortuitum infected macrophages. It was shown that this bacterium actively synthesizes rRNA during the course of infection and that one of its rrn operons is preferentially used under such conditions. PMID:15629925

  14. Changes in rRNA levels during stress invalidates results from mRNA blotting: Fluorescence in situ rRNA hybridization permits renormalization for estimation of cellular mRNA levels

    Hansen, M.C.; Nielsen, A.K.; Molin, Søren; Hammer, Karin; Kilstrup, Mogens


    experiments, in which mRNA levels routinely are normalized to a fixed amount of extracted total RNA. The cellular levels of specific mRNA species were estimated using a renormalization with the total RNA content per cell. By a combination of fluorescence in situ rRNA hybridization, which estimates the...... relative level of rRNA per cell, and slot blotting to rRNA probes, which estimates the level of rRNA per extracted total RNA, the amount of RNA per cell was calculated in a series of heat shock experiments with the gram-positive bacterium Lactococcus lactis. It was found that the level of rRNA per cell......Regulation of gene expression can be analyzed by a number of different techniques. Some techniques monitor the level of specific mRNA directly, and others monitor indirectly by determining the level of enzymes encoded by the mRNA. Each method has its own inherent way of normalization. When results...

  15. Phylogenetic Relationship of Duttaphrynus melanostictus From India and China as Revealed from the Study of 12S and 16S mtDNA Genes

    Sanjib Kr. Das; Debojyoti Dutta


    In the present study, the phylogenetic relationship of Duttaphrynus melanostictus from West Bengal, India with other members of the Bufonidiae group was undertaken using partial mitochondrial DNA (mtDNA) genes. Mitochondria were isolated from the liver of Duttaphrynus melanostictus by a non-conventional method of membrane filtration. The technique allows trapping of mitochondria on cellulose acetate membrane followed by mtDNA isolation. 12S ribosomal RNA and 16S ribosomal RNA was sequenced wi...

  16. Stabilizing effects of excipients on dissociation of intact (146S) foot-and-mouth disease virions into 12S particles during storage as oil-emulsion vaccine.

    Harmsen, M M; Fijten, H P D; Westra, D F; Dekker, A


    Most conventional foot-and-mouth disease virus (FMDV) vaccines contain oil-adjuvant. Their potency decreases upon prolonged storage. Intact (146S) FMDV particles can dissociate into 12S degradation products with a concomitant decrease in immunogenicity. We therefore measured virion stability in vaccines using two previously developed ELISAs to separately quantify 12S and 146S particles. Virions completely dissociated into 12S particles within 3 months after oil-emulsification. Dissociation occurred at a much lower rate in a comparable aqueous solution that was not oil-emulsified. Thus, oil-emulsification stimulates virion dissociation, presumably due to the protein denaturing effect of the oil-water interface. In real-time stability studies the stability of oil-adjuvanted virions of four different FMDV strains was significantly increased by addition of sucrose and BSA in a synergistic manner. Contrary to BSA addition, the effect of sucrose addition was concentration dependent. This study illustrates the importance of analysing antigen integrity after oil-emulsification and provides methods for FMDV vaccine stabilization. PMID:25843267

  17. Experimental study of changes of skin blister fluid NPY, IL-12, sICAM-1 and GM-CSF levels in patients with vitiligo in progressive stage

    Objective: To explore the significance of changes of skin blister fluid NPY, IL-12, sICAM-1 and GM-CSF levels in patients with vitiligo in progressive stage. Methods: 80 patients with vitiligo in progressive stage were divided into two groups (vulgaris vitiligo groups : n=54, segmental vitiligo groups : n=26) Their blister fluid levels of NPY and GM-CSF were determined by radioimmunoassay(RIA), and IL-12 and sICAM-1 were determined by enzyme immunoassay. Results: The levels of skin blister fluid NPY were definitely higher in vitiliginous skin than those in non-vitiliginous patches in segmental vitiligo groups (P0.05). The levels of skin blister fluid IL-12, sICAM-1 and GM-CSF were all obviously higher in vitiliginous skin than that in non-vitiliginous patches in vulgaris vitiligo groups (P0.05). Conclusion: The changes of skin blister fluid NPY, IL-12, sICAM-1 and GM-CSF levels in vitiliginous skin may be closely related to development of difference type vitiligo patients with vitiligo, determination of 4 indexes might be helpful for studying the pathogenesis and clinical diagnosis of vitiligo. (authors)

  18. Stereoselective chemo-enzymatic oxidation routes for (1R,3E,7E,11S,12S-3,7,18-dolabellatriene

    Christian eGörner


    Full Text Available The diterpene (1R,3E,7E,11S,12S-3,7,18-dolabellatriene from the marine brown alga Dilophus spiralis belongs to the dolabellanes natural product family and has antimicrobial activity against multi-drug resistant Staphylococcus aureus (MRSA. Recently, we generated a CotB2 diterpene synthase mutant (W288G, which instead of its native product cyclooctat-9-en-7-ol, generates (1R,3E,7E,11S,12S-3,7,18-dolabellatriene. In vivo CotB2 W288G reconstitution in an E. coli based terpene production system, allowed efficient production of this olefinic macrocycle. To diversify the 3,7,18-dolabellatriene bioactivity we evaluated chemical and enzymatic methods for selective oxidation. Epoxidation by acetic peracid, which was formed in situ by a lipase catalyzed reaction of acetic acid with H2O2, provided efficient access to two monooxidized dolabellanes and to a novel di-epoxidated dolabellane species. These compounds could act as synthons en-route to new dolabellanes with diversified bioactivities. Furthermore, we demonstrate the almost quantitative 3,7,18-dolabellatriene conversion into the new, non-natural compound (1R,3E,7E,11S,12S,18R-dolabella-3,7-diene-20-ol by hydroboration-oxidation with an enantiomeric excess of 94 %, for the first time.

  19. 12(S)-HETE increases intracellular Ca(2+) in lymph-endothelial cells disrupting their barrier function in vitro; stabilization by clinical drugs impairing calcium supply.

    Nguyen, Chi Huu; Brenner, Stefan; Huttary, Nicole; Li, Yuanfang; Atanasov, Atanas Georgiev; Dirsch, Verena M; Holzner, Silvio; Stadler, Serena; Riha, Juliane; Krieger, Sigurd; Milovanovic, Danijela; Fristiohardy, Adryan; Simonitsch-Klupp, Ingrid; Dolznig, Helmut; Saiko, Philipp; Szekeres, Thomas; Giessrigl, Benedikt; Jäger, Walter; Krupitza, Georg


    Secretion of 12(S)-HETE by breast cancer emboli provokes "circular chemorepellent induced defects" (CCIDs) in the adjacent lymphatic vasculature facilitating their intravasation and lymph node metastasis which determines prognosis. Therefore, elucidating the mechanism of lymph endothelial cell (LEC) wall disintegration may provide cues for anti-metastatic intervention. The role of intracellular free Ca(2+) for CCID formation was investigated in LECs using MCF-7 or MDA-MB231 breast cancer cell spheroids in a three-dimensional cell co-culture model. 12(S)-HETE elevated the Ca(2+) level in LEC by activating PLC/IP3. Downstream, the Ca(2+)-calmodulin kinase MYLK contributed to the phosphorylation of Ser19-MLC2, LEC contraction and CCID formation. Approved clinical drugs, lidoflazine, ketotifen, epiandrosterone and cyclosporine, which reportedly disturb cellular calcium supply, inhibited 12(S)-HETE-induced Ca(2+) increase, Ser19-MLC2 phosphorylation and CCID formation. This treatment strategy may reduce spreading of breast cancer through lymphatics. PMID:27390016

  20. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics.

    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G


    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  1. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing


    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  2. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes.

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing


    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  3. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    Recht, M I; Douthwaite, S; Dahlquist, K D;


    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  4. Mapping important nucleotides in the peptidyl transferase centre of 23 S rRNA using a random mutagenesis approach

    Porse, B T; Garrett, R A


    Random mutations were generated in the lower half of the peptidyl transferase loop in domain V of 23 S rRNA from Escherichia coli using a polymerase chain reaction (PCR) approach, a rapid procedure for identifying mutants and a plasmid-based expression system. The effects of 21 single......-site mutations, at 18 different positions, on cell growth, mutant rRNA incorporation into ribosomes and peptidyl transferase activity of the mutant ribosomes were analysed. The general importance of the whole region for the peptidyl transferase centre was emphasized by the finding that 14 of the mutants were...... sick, or very sick, when ribosomes containing chromosomal-encoded 23 S rRNA were inhibited by erythromycin, and all except one of these exhibited low levels of peptidyl transferase activity in their mutated ribosomes. Two mutations, psi 2580-->C and U2584-->G that both yielded inactive ribosomes were...

  5. 16S rRNA gene sequencing as a tool to study microbial populations in foods and process environments

    Buschhardt, Tasja; Hansen, Tina Beck; Bahl, Martin Iain; Asser Hansen, Martin; Abu Al-Soud, Waleed; Aabo, Søren

    and their role in food safety. During method optimization, we have identified several factors which distort the characterization of microbial populations, including DNA extraction methods, DNA polymerases, and most importantly the analyzed fragment of the 16S rRNA gene. Methods: This study...... culture methods as cross reference. Results: Taxonomic assignments and abundances of sequences in the total community and in the Enterobacteriaceae subpopulation were affected by the 16S rRNA gene variable region, DNA extraction methods, and polymerases chosen. However, community compositions were very......Introduction: Methodological constraints during culturing and biochemical testing have left the true microbiological diversity of foods and process environments unexplored. Culture-independent molecular methods, such as 16S rRNA gene sequencing, may provide deeper insight into microbial communities...

  6. 16S rRNA amplicon sequencing dataset for conventionalized and conventionally raised zebrafish larvae.

    Davis, Daniel J; Bryda, Elizabeth C; Gillespie, Catherine H; Ericsson, Aaron C


    Data presented here contains metagenomic analysis regarding the sequential conventionalization of germ-free zebrafish embryos. Zebrafish embryos that underwent a germ-free sterilization process immediately after fertilization were promptly exposed to and raised to larval stage in conventional fish water. At 6 days postfertilization (dpf), these "conventionalized" larvae were compared to zebrafish larvae that were raised in conventional fish water never undergoing the initial sterilization process. Bacterial 16S rRNA amplicon sequencing was performed on DNA isolated from homogenates of the larvae revealing distinct microbiota variations between the two groups. The dataset described here is also related to the research article entitled "Microbial modulation of behavior and stress responses in zebrafish larvae" (Davis et al., 2016) [1]. PMID:27508247

  7. Multi-site-specific 16S rRNA methyltransferase RsmF from Thermus thermophilus

    Demirci, Hasan; Larsen, Line H G; Hansen, Trine;


    Cells devote a significant effort toward the production of multiple modified nucleotides in rRNAs, which fine tune the ribosome function. Here, we report that two methyltransferases, RsmB and RsmF, are responsible for all four 5-methylcytidine (m(5)C) modifications in 16S rRNA of Thermus...... thermophilus. Like Escherichia coli RsmB, T. thermophilus RsmB produces m(5)C967. In contrast to E. coli RsmF, which introduces a single m(5)C1407 modification, T. thermophilus RsmF modifies three positions, generating m(5)C1400 and m(5)C1404 in addition to m(5)C1407. These three residues are clustered near...

  8. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    Junko Obata

    Full Text Available While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating.

  9. Phylogenetic relationships of Arthrospira strains inferred from 16S rRNA gene and cpcBA-IGS sequences

    Chi-Yong Ahn


    Full Text Available Arthrospira platensis and Arthrospira maxima are species of cyanobacteria used in health foods, animal feed, food additives, and fine chemicals. This study conducted a comparison of the 16S rRNA gene and cpcBA-intergenic spacer (cpcBA-IGS sequences in Arthrospira strains from culture collections around the world. A cluster analysis divided the 10 Arthrospira strains into two main genotypic clusters, designated I and II, where Group I contained A. platensis SAG 86.79, UTEX 2340, A. maxima KCTC AG30054, and SAG 49.88, while Group II contained A. platensis PCC 9108, NIES 39, NIES 46, and SAG 257.80. However, although A. platensis PCC 9223 belonged to Group II-2 based on its cpcBA-IGS sequence, this strain also belonged to Group I based on its 16S rRNA gene sequence. Phylogenetic analyses based on the 16S rRNA gene and cpcBA-IGS sequences showed no division between A. platensis and A. maxima, plus the 16S rRNA gene and cpcBAIGS sequence clusters did not indicate any well-defined geographical distribution, instead overlapping in a rather interesting way. Therefore, the current study supports some previous conclusions based on 16S rRNA gene and cpcBA-IGS sequences, which found that Arthrospira taxa are monophyletic. However, when compared with 16S rRNA sequences, cpcBA-IGS sequences may be better suited to resolve close relationships and intraspecies variability.

  10. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Nathan D. Olson


    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  11. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio


    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae. PMID:19656941

  12. Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus

    Verma Mansi; Lal Devi; Lal Rup


    Abstract Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplemen...

  13. Single Nucleotide Polymorphism of SSU rRNA Gene among ‎Plasmodium Knowlesi Isolates of Sabah

    Fread Anderios; Daw Khin Saw Naing; Zaw Lin


    ackground: ‎The advent of PCR (Polymerase Chain Reaction) assays helped in correctly identifying ‎Plasmodium knowlesi, which was previously misdiagnosed by microscopy as Plasmodium ‎malarie in Sabah, Malaysia. The PCR-based diagnosis of P. knowlesi in Sabah is currently using a ‎set of oligonucleotide primers namely Pmk8 and Pmk9 that target one of the parasite’s small ‎subunit rRNA (SSU rRNA) genes. PCR also helped in discovering a variant form of P. malariae ‎which has a deletion of 19 bp ...

  14. Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

    Dron, M; Rahire, M; Rochaix, J D


    The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stre...

  15. SSU rRNA reveals a sequential increase in shell complexity among the euglyphid testate amoebae (Rhizaria: Euglyphida)

    Lara, Enrique; Heger, Thierry J; Mitchell, Edward A D; Meisterfeld, Ralf; Ekelund, Flemming


    The existing data on the molecular phylogeny of filose testate amoebae from order Euglyphida has revealed contradictions between traditional morphological classification and SSU rRNA phylogeny and, moreover, the position of several important genera remained unknown. We therefore carried out a study...... aiming to fill several important gaps and better understand the relationships among the main euglyphid testate amoebae and the evolutionary steps that led to the present diversity at a higher level. We obtained new SSU rRNA sequences from five genera and seven species. This new phylogeny obtained shows...

  16. The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis

    Cole, J. R.; Chai, B.; Farris, R. J.; Wang, Q; Kulam, S. A.; McGarrell, D. M.; Garrity, G M; Tiedje, J M


    The Ribosomal Database Project (RDP-II) provides the research community with aligned and annotated rRNA gene sequences, along with analysis services and a phylogenetically consistent taxonomic framework for these data. Updated monthly, these services are made available through the RDP-II website ( RDP-II release 9.21 (August 2004) contains 101 632 bacterial small subunit rRNA gene sequences in aligned and annotated format. High-throughput tools for initial taxonomic p...

  17. Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up- and downshift

    Jydegaard-Axelsen, A.M.; Aaes-Jorgensen, A.; Koch, A.G.; Stoumann Jensen, J.; Knochel, S.


    Cell morphology, rRNA content, and growth were examined for Listeria monocytogenes LO28 and EGD, respectively, grown in brain-heart infusion (BHI) and on slices of sausage at 10degreesC in 100% CO2, 100% N-2, and air. In CO2, filamentous cells were formed by both strains on sausage slices and by L...... unchanged. On sausage slices, the number of colony forming units also increased rapidly for both strains in response to CO2 downshift. Large variations in rRNA content of individual cells were observed in the tested scenarios. The results demonstrate the risk of underestimating the number of infectious...

  18. Assessing the Fecal Microbiota: An Optimized Ion Torrent 16S rRNA Gene-Based Analysis Protocol

    Foroni, Elena; Duranti, Sabrina; Turroni, Francesca; Lugli, Gabriele Andrea; Sanchez, Borja; Martín, Rebeca; Gueimonde, Miguel; van Sinderen, Douwe; Margolles, Abelardo; Ventura, Marco


    Assessing the distribution of 16S rRNA gene sequences within a biological sample represents the current state-of-the-art for determination of human gut microbiota composition. Advances in dissecting the microbial biodiversity of this ecosystem have very much been dependent on the development of novel high-throughput DNA sequencing technologies, like the Ion Torrent. However, the precise representation of this bacterial community may be affected by the protocols used for DNA extraction as well as by the PCR primers employed in the amplification reaction. Here, we describe an optimized protocol for 16S rRNA gene-based profiling of the fecal microbiota. PMID:23869230

  19. Molecular genetic monitoring of bacterial communities in manzala lake, egypt, based on 16S rRNA gene analysis

    El Saied, H.E.


    A first molecular genetic study on the diversity of bacterial communities at Manzala Lake, Egypt, was determined by culture-independent 16S rRNA gene analysis. Bulk DNAs were extracted from water and sediment at two different sampling sites namely; Bashtir and Genka, in the lake. The 16S rRNA gene was positively amplified by polymerase chain reaction (PCR) from bulk DNA of each sample, cloned and sequenced. The sequence analysis of one hundred clones from each clone library obtained number of...

  20. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

    Manal Helal

    Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

  1. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.


    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stab...

  2. Interaction of the tylosin-resistance methyltransferase RlmA II at its rRNA target differs from the orthologue RlmA I

    Douthwaite, Stephen; Jakobsen, Lene; Yoshizawa, Satoko;


    footprint contacts with nucleotides in stem-loops 33, 34 and 35, and does not interact elsewhere in the rRNA. Binding of RlmA(II) to the rRNA is dependent on the cofactor S-adenosylmethionine (or S-adenosylhomocysteine). RlmA(II) interacts with the same rRNA region as the orthologous enzyme RlmA(I) that...

  3. Automated identification of medically important bacteria by 16S rRNA gene sequencing using a novel comprehensive database, 16SpathDB

    Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung


    Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB ( based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiol...

  4. Domain V of 23S rRNA contains all the structural elements necessary for recognition by the ErmE methyltransferase

    Vester, B; Douthwaite, S


    enzyme efficiently modifies 23S rRNA in vitro. Removal of most of the 23S rRNA structure, so that only domain V (nucleotides 2000 to 2624) remains, does not affect the efficiency of modification by the methyltransferase. In addition, modification still occurs after the rRNA tertiary structure has been......The ErmE methyltransferase from the erythromycin-producing actinomycete Saccharopolyspora erythraea dimethylates the N-6 position of adenine 2058 in domain V of 23S rRNA. This modification confers resistance to erythromycin and to other macrolide, lincosamide, and streptogramin B antibiotics. We...

  5. Estimation of 16S rRNA gene copy number in several probiotic Lactobacillus strains isolated from the gastrointestinal tract of chicken

    Lee, Chin Mei; Sieo, Chin Chin; Abdullah, Norhani; Ho, Yin Wan


    The copy numbers of 16S rRNA genes in 12 probiotic Lactobacillus strains of poultry origin were analyzed. Genomic DNA of the strains was digested with restriction endonucleases that do not cut within the 16S rRNA gene of the strains. This was followed by Southern hybridization with a biotinylated probe complementary to the 16S rRNA gene. The copy number of the 16S rRNA gene within a Lactobacillus species was found to be conserved. From the hybridization results, Lactobacillus salivarius I 24 ...

  6. The secondary structure of large-subunit rRNA divergent domains, a marker for protist evolution

    Lenaers, G; Nielsen, Henrik; Engberg, J;


    ), Tetrahymena thermophila (ciliate), Physarum polycephalum and Dictyostelium discoideum (slime moulds), Crithidia fasciculata and Giardia lamblia (parasitic flagellates). The folding for the D3, D7a and D10 divergent domains has been refined and a consensus model for the protist 24-26S rRNA structure is...

  7. Variation in secondary structure of the 16S rRNA molecule in cyanobacteria with implications for phylogenetic analysis

    Řeháková, Klára; Johansen, J. R.; Bowen, M.B.; Martin, M.P.; Sheil, C.A.


    Roč. 14, č. 2 (2014), s. 161-178. ISSN 1802-5439 Institutional support: RVO:60077344 Keywords : 16S rRNA secondary structure * cyanobacteria * phylogeny Subject RIV: EE - Microbiology, Virology Impact factor: 1.930, year: 2014

  8. The Cfr rRNA methyltransferase confers resistance to Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A antibiotics

    Long, K. S.; Poehlsgaard, Jacob; Kehrenberg, C.; Schwarz, S.; Vester, B.


    A novel multidrug resistance phenotype mediated by the Cfr rRNA methyltransferase is observed in Staphylococcus aureus and Escherichia coli. The cfr gene has previously been identified as a phenicol and lincosamide resistance gene on plasmids isolated from Staphylococcus spp. of animal origin and...

  9. A pseudouridylation switch in rRNA is implicated in ribosome function during the life cycle of Trypanosoma brucei.

    Chikne, Vaibhav; Doniger, Tirza; Rajan, K Shanmugha; Bartok, Osnat; Eliaz, Dror; Cohen-Chalamish, Smadar; Tschudi, Christian; Unger, Ron; Hashem, Yaser; Kadener, Sebastian; Michaeli, Shulamit


    The protozoan parasite Trypanosoma brucei, which causes devastating diseases in humans and animals in sub-Saharan Africa, undergoes a complex life cycle between the mammalian host and the blood-feeding tsetse fly vector. However, little is known about how the parasite performs most molecular functions in such different environments. Here, we provide evidence for the intriguing possibility that pseudouridylation of rRNA plays an important role in the capacity of the parasite to transit between the insect midgut and the mammalian bloodstream. Briefly, we mapped pseudouridines (Ψ) on rRNA by Ψ-seq in procyclic form (PCF) and bloodstream form (BSF) trypanosomes. We detected 68 Ψs on rRNA, which are guided by H/ACA small nucleolar RNAs (snoRNA). The small RNome of both life cycle stages was determined by HiSeq and 83 H/ACAs were identified. We observed an elevation of 21 Ψs modifications in BSF as a result of increased levels of the guiding snoRNAs. Overexpression of snoRNAs guiding modification on H69 provided a slight growth advantage to PCF parasites at 30 °C. Interestingly, these modifications are predicted to significantly alter the secondary structure of the large subunit (LSU) rRNA suggesting that hypermodified positions may contribute to the adaption of ribosome function during cycling between the two hosts. PMID:27142987

  10. FiveS rRNA sequences and fatty acid profiles of colourless sulfur-oxidising bacteria

    LokaBharathi, P.A.; Ortiz-conde, B.A; Nair, S.; Chandramohan, D.; Colwell, R.R.

    these at the molecular level, 5S ribosomal ribonucleic acid (5S rRNA) sequences have been determined. Fatty acid profiles showed strain 29 to be related to Pseudomonas vesicularis with an E.D. of 5.965 and similarity index of 0.182. The nearest organism of strain 82...

  11. Comparison of gull-specific assays targeting 16S rRNA gene of Catellicoccus marimammalium and Streptococcus spp.

    Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...

  12. Species identification and profiling of complex microbial communities using shotgun Illumina sequencing of 16S rRNA amplicon sequences.

    Swee Hoe Ong

    Full Text Available The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequencing of the bacterial 16S rRNA gene, optimized to amplify more than 90% of sequences in the Greengenes database and with the ability to distinguish nearly twice as many species-level OTUs compared to existing protocols. Using several in silico and experimental datasets, we demonstrate that despite the presence of multiple variable and conserved regions, the resulting shotgun sequences can be used to accurately quantify the constituents of complex microbial communities. The reconstruction of a significant fraction of the 16S rRNA gene also enabled high precision (>90% in species-level identification thereby opening up potential application of this approach for clinical microbial characterization.

  13. 16S rRNA gene sequencing in routine identification of anaerobic bacteria isolated from blood cultures

    Justesen, Ulrik Stenz; Skov, Marianne Nielsine; Knudsen, Elisa;


    A comparison between conventional identification and 16S rRNA gene sequencing of anaerobic bacteria isolated from blood cultures in a routine setting was performed (n = 127). With sequencing, 89% were identified to the species level, versus 52% with conventional identification. The times for...... identification were 1.5 days and 2.8 days, respectively....

  14. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)

    Stenger, B.L.S.; Clark, M.E.; Kváč, Martin; Khan, E.; Giddings, C.W.; Dyer, N.W.; Schultz, J.L.; McEvoy, J.M.


    Roč. 32, JUN 2015 (2015), s. 113-123. ISSN 1567-1348 R&D Projects: GA MŠk(CZ) LH11061 Institutional support: RVO:60077344 Keywords : Cryptosporidium * Paralogy * 18S rRNA * 18S rDNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 3.015, year: 2014

  15. Taxonomy of the genus Rhexinema (Ulvophyceae) based on phylogeny of the 18S rRNA and morphology

    Caisová, Lenka


    Roč. 48, č. 4 (2009), s. 15-15. ISSN 0031-8884. [International Phycological Congress /9./. 02.08.2009-08.08.2009, Tokyo] Institutional research plan: CEZ:AV0Z60050516 Keywords : Rhexinema * 18S rRNA * morphology Subject RIV: EF - Botanics

  16. De novo Synthesis and Assembly of rRNA into Ribosomal Subunits during Cold Acclimation in Escherichia coli.

    Piersimoni, Lolita; Giangrossi, Mara; Marchi, Paolo; Brandi, Anna; Gualerzi, Claudio O; Pon, Cynthia L


    During the cold adaptation that follows a cold stress, bacterial cells undergo many physiological changes and extensive reprogramming of their gene expression pattern. Bulk gene expression is drastically reduced, while a set of cold shock genes is selectively and transiently expressed. The initial stage of cold acclimation is characterized by the establishment of a stoichiometric imbalance of the translation initiation factors (IFs)/ribosomes ratio that contributes to the preferential translation of cold shock transcripts. Whereas de novo synthesis of the IFs following cold stress has been documented, nothing was known concerning the activity of the rrn operons during the cold acclimation period. In this work, we focus on the expression of the rrn operons and the fate of rRNA after temperature downshift. We demonstrate that in Escherichia coli, rRNA synthesis does not stop during the cold acclimation phase, but continues with greater contribution of the P2 compared to the P1 promoter and all seven rrn operons are active, although their expression levels change with respect to pre-stress conditions. Eight hours after the 37°→10°C temperature downshift, the newly transcribed rRNA represents up to 20% of total rRNA and is preferentially found in the polysomes. However, with respect to the de novo synthesis of the IFs, both rRNA transcription and maturation are slowed down drastically by cold stress, thereby accounting in part for the stoichiometric imbalance of the IFs/ribosomes. Overall, our data indicate that new ribosomes, which are possibly suitable to function at low temperature, are slowly assembled during cold acclimation. PMID:26953262

  17. Efficient subtraction of insect rRNA prior to transcriptome analysis of Wolbachia-Drosophila lateral gene transfer

    Kumar Nikhil


    Full Text Available Abstract Background Numerous methods exist for enriching bacterial or mammalian mRNA prior to transcriptome experiments. Yet there persists a need for methods to enrich for mRNA in non-mammalian animal systems. For example, insects contain many important and interesting obligate intracellular bacteria, including endosymbionts and vector-borne pathogens. Such obligate intracellular bacteria are difficult to study by traditional methods. Therefore, genomics has greatly increased our understanding of these bacteria. Efficient subtraction methods are needed for removing both bacteria and insect rRNA in these systems to enable transcriptome-based studies. Findings A method is described that efficiently removes >95% of insect rRNA from total RNA samples, as determined by microfluidics and transcriptome sequencing. This subtraction yielded a 6.2-fold increase in mRNA abundance. Such a host rRNA-depletion strategy, in combination with bacterial rRNA depletion, is necessary to analyze transcription of obligate intracellular bacteria. Here, transcripts were identified that arise from a lateral gene transfer of an entire Wolbachia bacterial genome into a Drosophila ananassae chromosome. In this case, an rRNA depletion strategy is preferred over polyA-based enrichment since transcripts arising from bacteria-to-animal lateral gene transfer may not be poly-adenylated. Conclusions This enrichment method yields a significant increase in mRNA abundance when poly-A selection is not suitable. It can be used in combination with bacterial rRNA subtraction to enable experiments to simultaneously measure bacteria and insect mRNA in vector and endosymbiont biology experiments.

  18. Sites of interaction of streptogramin A and B antibiotics in the peptidyl transferase loop of 23 S rRNA and the synergism of their inhibitory mechanisms

    Porse, B T; Garrett, R A


    nucleotides in the peptidyl transferase loop of 23 S rRNA, including the two mutated nucleotides. An rRNA footprinting study, performed both in vivo and in vitro, on the A and B components complexed to Bacillus megaterium ribosomes, indicated that similar drug-induced effects occur on free ribosomes and...

  19. Development of a Multiplex PCR Method for Detection of the Genes Encoding 16S rRNA, Coagulase, Methicillin Resistance and Enterotoxins in Staphylococcus aureus

    A multiplex PCR method was developed for simultaneous detection of the genes encoding methicillin resistance (mecA), staphylococcal enterotoxins A, B and C (sea, seb and sec), coagulase (coa) and 16S rRNA. The primers for amplification of the 16S rRNA gene were specific for Staphylococcus spp., and ...

  20. Comparison of COBAS AMPLICOR Neisseria gonorrhoeae PCR, including confirmation with N. gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    Luijt, D.S.; Bos, P.A.; van Zwet, A.A.; Voorst-Vader, P.C.; Schirm, J.


    : A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased

  1. Comparison of COBAS AMPLICOR Neissefia gonorrhoeae PCR, including confirmation with N-gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    Luijt, DS; Bos, PAJ; van Zwet, AA; Vader, PCV; Schirm, J


    A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased t

  2. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    Liu, M; Kirpekar, F; Van Wezel, G P;


    Streptomyces species indicates that in vivo TlrB modifies nucleotide G748 within helix 35 of 23S rRNA. Purified recombinant TlrB retains its activity and specificity in vitro and modifies G748 in 23S rRNA as well as in a 74 nucleotide RNA containing helix 35 and surrounding structures. Modification is...

  3. Absolute Quantification of Enterococcal 23S rRNA Gene Using Digital PCR.

    Wang, Dan; Yamahara, Kevan M; Cao, Yiping; Boehm, Alexandria B


    We evaluated the ability of chip-based digital PCR (dPCR) to quantify enterococci, the fecal indicator recommended by the United States Environmental Protection Agency (USEPA) for water-quality monitoring. dPCR uses Poisson statistics to estimate the number of DNA fragments in a sample with a specific sequence. Underestimation may occur when a gene is redundantly encoded in the genome and multiple copies of that gene are on one DNA fragment. When genomic DNA (gDNA) was extracted using two commercial DNA extraction kits, we confirmed that dPCR could discern individual copies of the redundant 23s rRNA gene in the enterococcal genome. dPCR quantification was accurate when compared to the nominal concentration inferred from fluorometer measurements (linear regression slope = 0.98, intercept = 0.03, R(2) = 0.99, and p value humic acid caused a similar level of inhibition in both dPCR and qPCR, but calcium inhibited dPCR to a lesser degree than qPCR. Inhibition of dPCR was partially relieved when the number of thermal cycles was increased. Based on these results, we conclude that dPCR is a viable option for enumerating enterococci in ambient water. PMID:26903207

  4. Molecular identification of adulteration in mutton based on mitochondrial 16S rRNA gene.

    Xu, Jia; Zhao, Wei; Zhu, Mengru; Wen, Yuanju; Xie, Tao; He, Xiaoqian; Zhang, Yongfeng; Cao, Suizhong; Niu, Lili; Zhang, Hongping; Zhong, Tao


    The aim of this study is to set up a protocol for identification of the adulteration in mutton based on mitochondrial 16S rRNA gene. The multiplex polymerase chain reaction (multi-PCR) assay was carried out to trace the impure DNA in mutton. A universal primer pair yielded an approximate 610 bp fragment in mutton, pork, duck, chicken, horse and cat meats. The amplicons of multi-PCR assay represented the species-specific products, which could be discriminated by the size ranging from 106 bp to 532 bp. Subsequently, the authentication of each fragment was also confirmed by sequencing. Random analyses of adulterants with various meats yielded the identical results to their components, showing the suitability of the multi-PCR assay for tracing of adulterant meats with high-accuracy and precision. This assay was sensitive to detect the species-specific DNA in different proportional mixtures of mutton and duck/pork (9.1%-90.9%). In conclusion, this multi-PCR assay successfully discriminated the double-, triple-, quadruple-, and quintuple-mixtures containing variant counterparts. This method will be particularly useful in the detection of mutton adulteration in processed foods further. PMID:24739005

  5. Oxazolidinone resistance mutations in 23S rRNA of Escherichia coli reveal the central region of domain V as the primary site of drug action

    Xiong, L; Kloss, P; Douthwaite, S; Andersen, N M; Swaney, S; Shinabarger, D L; Mankin, A S


    resistance mutations were clustered in the vicinity of the central loop of domain V of 23S rRNA, suggesting that this rRNA region plays a major role in the interaction of the drug with the ribosome. Although the central loop of domain V is an essential integral component of the ribosomal peptidyl transferase......, we selected Escherichia coli oxazolidinone-resistant mutants, which contained a randomly mutagenized plasmid-borne rRNA operon. The same mutation, G2032 to A, was identified in the 23S rRNA genes of several independent resistant isolates. Engineering of this mutation by site-directed mutagenesis in...... the wild-type rRNA operon produced an oxazolidinone resistance phenotype, establishing that the G2032A substitution was the determinant of resistance. Engineered U and C substitutions at G2032, as well as a G2447-to-U mutation, also conferred resistance to oxazolidinone. All the characterized...

  6. Phylogenetic Relationship of Duttaphrynus melanostictus From India and China as Revealed from the Study of 12S and 16S mtDNA Genes

    Sanjib Kr. Das


    Full Text Available In the present study, the phylogenetic relationship of Duttaphrynus melanostictus from West Bengal, India with other members of the Bufonidiae group was undertaken using partial mitochondrial DNA (mtDNA genes. Mitochondria were isolated from the liver of Duttaphrynus melanostictus by a non-conventional method of membrane filtration. The technique allows trapping of mitochondria on cellulose acetate membrane followed by mtDNA isolation. 12S ribosomal RNA and 16S ribosomal RNA was sequenced with primers designed in our laboratory. mtDNA sequence from 18 different Bufo sp. found across the world were used for the phylogenetic analysis. Results were interpreted from the transition/transversion of nucleotides, genetic distance and maximum parsimony analysis. The findings indicates that D. melanostictus is very closely related to the Bufo melanostictus of China. The possible reasons of such close similarity between two distantly residing species (D. melanostictus of India and Bufo melanostictus of China have been discussed.

  7. Hole doping into Co-12s2 copper oxides with s fluorite-structured layers between CuO2 planes

    In this work, the first three members (s=1, 2, 3) of the Co-12s2 homologous series of multi-layered copper oxides are gradually doped with holes through high-pressure oxygenation (HPO). The phases differ from each other only by thickness of the fluorite-structured layer block (Ce,Y,Ca)-[O2-(Ce,Y)]s-1, between two identical CuO2 planes. High-resolution transmission-electron microscopy (HRTEM) and electron diffraction (ED) analyses together with both synchrotron X-ray and neutron powder diffraction data, reveal that as a consequence of HPO the charge-reservoir CoO4-tetrahedra chains get broken and the lattice symmetry of the Co-12s2 phases changes from orthorhombic to tetragonal. Oxygen contents are analyzed for the samples with wet-chemical and thermogravimetric techniques. The valence state of copper in the CuO2 plane is determined from Cu L-edge X-ray absorption near-edge structure (XANES) spectra to be compared with the values estimated through bond-valence-sum (BVS) calculations from the crystal structure data. The positive charge induced by oxygen loading (or aliovalent CaII-for-YIII substitution in CoSr2YCu2O7+δ) is found not to be completely accommodated in the CuO2 planes but be rather effectively trapped at the charge-reservoir Co atoms. Superconductivity appears in the Co-1212 (CoSr2YCu2O7+δ) samples with the copper valence of 2.13 or higher, whereas in the Co-1222 (CoSr2(Ce0.25Y0.75)2Cu2O9+δ) and Co-1232 (CoSr2(Ce0.67Y0.33)3Cu2O11+δ) samples Cu valence does not increase high enough to induce superconductivity

  8. Cu22Bi12S21Cl16-A mixed conductor with fast one-dimensional copper(I) ion transport

    Melting reactions of Cu, CuCl, S, and Bi2S3 yield black, shiny needles of Cu22(1)Bi12S21(1)Cl16(1). The compound decomposes peritectically at 649(5) K. Oxidation state +I of the copper atoms is supported by Cu-K-XANES. The compound crystallizes in the hexagonal space group P6/m with a=2116.7(7) pm and c=395.17(5) pm. Seven anions coordinate each of the two independent bismuth cations in the shape of mono-capped trigonal prisms. These polyhedra share edges and faces to form trigonal and hexagonal tubes running along [0 0 1]. The hexagonal tubes are centered by chloride ions, which are surrounded by disordered copper cations. The majority of copper cations are distributed over numerous sites between the tubes. The Joint Probability Density Function (JPDF) reveals a continuous pathway along [0 0 1]. The high mobility of the copper cations along [0 0 1] was demonstrated by impedance spectroscopy and DC polarization measurements on single crystals. The ionic conductivity at 450 K is about σion=0.06 S cm-1, and the activation energy for Cu+ ion conduction is Ea=0.44 eV. The chemical diffusion coefficient of copper is in the order of Dcuδ=1019 cm-3 at 420 K. The electronic band gap (p-type conductor) was determined as Eg=0.06 eV. At room temperature the thermal conductivity of a pressed pellet is about κ=0.3 W K-1 m-1 and the Seebeck coefficient is S=43 μV K-1. -- Graphical Abstract: Copper cations easily move through the rigid tubular crystal structure of Cu22Bi12S21Cl16. Display Omitted

  9. An updated 18S rRNA phylogeny of tunicates based on mixture and secondary structure models

    Shenkar Noa


    Full Text Available Abstract Background Tunicates have been recently revealed to be the closest living relatives of vertebrates. Yet, with more than 2500 described species, details of their evolutionary history are still obscure. From a molecular point of view, tunicate phylogenetic relationships have been mostly studied based on analyses of 18S rRNA sequences, which indicate several major clades at odds with the traditional class-level arrangements. Nonetheless, substantial uncertainty remains about the phylogenetic relationships and taxonomic status of key groups such as the Aplousobranchia, Appendicularia, and Thaliacea. Results Thirty new complete 18S rRNA sequences were acquired from previously unsampled tunicate species, with special focus on groups presenting high evolutionary rate. The updated 18S rRNA dataset has been aligned with respect to the constraint on homology imposed by the rRNA secondary structure. A probabilistic framework of phylogenetic reconstruction was adopted to accommodate the particular evolutionary dynamics of this ribosomal marker. Detailed Bayesian analyses were conducted under the non-parametric CAT mixture model accounting for site-specific heterogeneity of the evolutionary process, and under RNA-specific doublet models accommodating the occurrence of compensatory substitutions in stem regions. Our results support the division of tunicates into three major clades: 1 Phlebobranchia + Thaliacea + Aplousobranchia, 2 Appendicularia, and 3 Stolidobranchia, but the position of Appendicularia could not be firmly resolved. Our study additionally reveals that most Aplousobranchia evolve at extremely high rates involving changes in secondary structure of their 18S rRNA, with the exception of the family Clavelinidae, which appears to be slowly evolving. This extreme rate heterogeneity precluded resolving with certainty the exact phylogenetic placement of Aplousobranchia. Finally, the best fitting secondary-structure and CAT-mixture models

  10. 16S rRNA gene survey of microbial communities in Winogradsky columns.

    Ethan A Rundell

    Full Text Available A Winogradsky column is a clear glass or plastic column filled with enriched sediment. Over time, microbial communities in the sediment grow in a stratified ecosystem with an oxic top layer and anoxic sub-surface layers. Winogradsky columns have been used extensively to demonstrate microbial nutrient cycling and metabolic diversity in undergraduate microbiology labs. In this study, we used high-throughput 16s rRNA gene sequencing to investigate the microbial diversity of Winogradsky columns. Specifically, we tested the impact of sediment source, supplemental cellulose source, and depth within the column, on microbial community structure. We found that the Winogradsky columns were highly diverse communities but are dominated by three phyla: Proteobacteria, Bacteroidetes, and Firmicutes. The community is structured by a founding population dependent on the source of sediment used to prepare the columns and is differentiated by depth within the column. Numerous biomarkers were identified distinguishing sample depth, including Cyanobacteria, Alphaproteobacteria, and Betaproteobacteria as biomarkers of the soil-water interface, and Clostridia as a biomarker of the deepest depth. Supplemental cellulose source impacted community structure but less strongly than depth and sediment source. In columns dominated by Firmicutes, the family Peptococcaceae was the most abundant sulfate reducer, while in columns abundant in Proteobacteria, several Deltaproteobacteria families, including Desulfobacteraceae, were found, showing that different taxonomic groups carry out sulfur cycling in different columns. This study brings this historical method for enrichment culture of chemolithotrophs and other soil bacteria into the modern era of microbiology and demonstrates the potential of the Winogradsky column as a model system for investigating the effect of environmental variables on soil microbial communities.

  11. In situ hybridization of phytoplankton using fluorescently labeled rRNA probes.

    Groben, René; Medlin, Linda


    Phytoplankton are one of the major components of ecosystem processes and play an important role in many biogeochemical cycles in the marine and freshwater environment. Despite their importance, many microalgae are poorly described and little is known of broad spatial and temporal scale trends in their abundance and distribution. Reasons for this are that microalgae are often small, lack distinct morphological features, and are unculturable, which make analyses difficult. It is now possible by using molecular biological techniques to advance our knowledge of aquatic biodiversity and to understand how biodiversity supports ecosystem structure, dynamics, and resilience. We present in this chapter a brief review of the progress that has been made in analyzing microalgae from populations to the species level. The described methods range from DNA fingerprinting techniques, such as random amplified polymorphic DNA (RAPD), amplified fragment length polymorphisms (AFLPs), and simple sequence repeats (SSRs), to microsatellites, which are used in population studies, to sequence analysis, which help to reconstruct the evolutionary history of organisms and to examine relationships at various taxonomic levels. Special emphasis is given to the application of molecular probes for the identification and characterization of microalgal taxa. The fast and secure identification of phytoplankton, especially of toxic species, is important from an ecological and economical point of view and whole-cell hybridization with specific fluorochrome-labeled probes followed by fluorescence microscopy or flow cytometry offers a fast method for this purpose. In this context, we present a detailed protocol for fluorescence in situ hybridization (FISH) of ribosomal RNA (rRNA) probes that can be applied to many algal cell types and discuss practical considerations of its use. PMID:15865974

  12. Phylogenetic relationships between Sarcocystis species from reindeer and other Sarcocystidae deduced from ssu rRNA gene sequences

    Dahlgren, S.S.; Oliveira, Rodrigo Gouveia; Gjerde, B.


    Six Sarcocystis species from reindeer (S. grueneri, S. rangi, S. tarandivulpes, S. hardangeri, S. rangiferi and S. tarandi) have previously been genetically characterised. The aim of this study was to identify possible definitive hosts for S. hardangeri, S. rangiferi and S. tarandi by including the...... six species in phylogenetic analyses of the Sarcocystidae, and also to investigate the phylogenetic relationships between the species from reindeer and those from other hosts. The study also aimed at revealing whether the inclusion of six Sarcocystis species from the same intermediate host would have...... any effect on previously inferred phylogenetic relationships within the Sarcocystidae. The complete small subunit (ssu) rRNA gene sequences of all six Sarcocystis species from reindeer were used in the phylogenetic analyses along with ssu rRNA gene sequences of 85 other members of the Coccidea. Trees...

  13. Distribution of DNA and localization of rRNA transcription in G2 phase nucleolus of Physarum polycephalum


    Using electron microscopy, NAMA-Ur DNA selective staining and BrUTP incorporation, the nucleo lus ultrastructure, the distribution of DNA and the rRNA transcription sites in nucleolus of G2 phase Physarum poly cephalum were studied. The nucleolus was found to be different in structure from that of other plant cells. Fibrillar cen tern (FCs) were present in a large amount all over the nucleolus. DNA was distributed both in dense fibrillar components (DFC) and in FC. The DNA in the nucleolus was less condensed than that of the chromosome territory. These changes suggested that the transcription was active within the nucleolus. BrUTP incorporation localized the rRNA transcription in DFC and at the interface of FC and DFC, suggesting that the DNA in FC is in a storage form and only the rDNA in DFC is transcribed.

  14. Phylogeny of the cuttlefishes (Mollusca:Cephalopoda) based on mitochondrial COI and 16S rRNA gene sequence data

    LIN Xiangzhi; ZHENG Xiaodong; XIAO Shu; WANG Rucai


    To clarify cuttlefish phylogeny, mitochondrial cytochrome c oxidase subunit I (COI) gene and partial 16S rRNA gene are sequenced for 13 cephalopod species. Phylogenetic trees are constructed, with the neighbor-joining method.Coleoids are divided into two main lineages, Decabrachia and Octobrachia. The monophyly of the order Sepioidea,which includes the families Sepiidae, Sepiolidae and Idiosepiidae, is not supported. From the two families of Sepioidea examined, the Sepiolidae are polyphyletic and are excluded from the order. On the basis of 16S rRNA and amino acid of COI gene sequences data, the two genera (Sepiella and Sepia) from the Sepiidae can be distinguished, but do not have a visible boundary using COI gene sequences. The reason is explained. This suggests that the 16S rDNA of cephalopods is a precious tool to analyze taxonomic relationships at the genus level, and COI gene is fitter at a higher taxonomic level (i.e., family).

  15. YccW is the m5C methyltransferase specific for 23S rRNA nucleotide 1962

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M;


    . However, YccW does not methylate assembled 50S subunits, and this is somewhat surprising as the published crystal structures show nucleotide C1962 to be fully accessible at the subunit interface. YccW-directed methylation at nucleotide C1962 is conserved in bacteria, and loss of this methylation in E....... coli marginally reduces its growth rate. YccW had previously eluded identification because it displays only limited sequence similarity to the m(5)C methyltransferases RsmB and RsmF and is in fact more similar to known m(5)U (5-methyluridine) RNA methyltransferases. In keeping with the previously...... proposed nomenclature system for bacterial rRNA methyltransferases, yccW is now designated as the rRNA large subunit methyltransferase gene rlmI....

  16. Validation of a PCR Assay for Chlamydophila abortus rRNA gene detection in a murine model

    Francielle Gibson da Silva-Zacarias


    Full Text Available Chlamydophila abortus (C. abortus is associated with reproductive problems in cattle, sheep, and goats. Diagnosis of C. abortus using embryonated chicken eggs or immortalized cell lines has a very low sensitivity. Polymerase chain reaction (PCR assays have been used to detect C. abortus infection in clinical specimens and organ fragments, such as placenta, fetal organs, vaginal secretions, and semen. The aim of this study was to develop a PCR assay for the amplification of an 856-bp fragment of the rRNA gene of the Chlamydiaceae family. The PCR assay was evaluated using organs from 15 mice experimentally infected with the S26/3 reference strain of C. abortus. The results of the rRNA PCR were compared to the results from another PCR system (Omp2 PCR that has been previously described for the Omp2 (outer major protein gene from the Chlamydiaceae family. From the 15 C. abortus-inoculated mice, 13 (K=0.84, standard error =0.20 tested positive using the rRNA PCR assay and 9 (K=0.55, standard error=0.18 tested positive using the Omp2 PCR assay. The detection limit, measured using inclusion-forming units (IFU, for C. abortus with the rRNA PCR (1.05 IFU was 100-fold lower than for the Omp2 PCR (105 IFU. The higher sensitivity of the rRNA PCR, as compared to the previously described PCR assay, and the specificity of the assay, demonstrated using different pathogenic microorganisms of the bovine reproductive system, suggest that the new PCR assay developed in this study can be used for the molecular diagnosis of C. abortus in abortion and other reproductive failures in bovines, caprines, and ovines.Chlamydophila abortus (C. abortus é frequentemente associada a distúrbios reprodutivos em bovinos, ovinos e caprinos. Para o diagnóstico, os métodos de cultivo em ovo embrionado de galinha e em células de linhagem contínua apresentam baixa sensibilidade. A reação em cadeia da polimerase (PCR tem sido utilizada em placenta, órgãos fetais, secre

  17. Identification of bacteria associated with underground parts of Crocus sativus by 16S rRNA gene targeted metagenomic approach.

    Ambardar, Sheetal; Sangwan, Naseer; Manjula, A; Rajendhran, J; Gunasekaran, P; Lal, Rup; Vakhlu, Jyoti


    Saffron (Crocus sativus L), an autumn-flowering perennial sterile plant, reproduces vegetatively by underground corms. Saffron has biannual corm-root cycle that makes it an interesting candidate to study microbial dynamics in its rhizosphere and cormosphere (area under influence of corm). Culture independent 16S rRNA gene metagenomic study of rhizosphere and cormosphere of Saffron during flowering stage revealed presence of 22 genera but none of the genus was common in all the three samples. Bulk soil bacterial community was represented by 13 genera with Acidobacteria being dominant. In rhizosphere, out of eight different genera identified, Pseudomonas was the most dominant genus. Cormosphere bacteria comprised of six different genera, dominated by the genus Pantoea. This study revealed that the bacterial composition of all the three samples is significantly different (P rhizosphere, cormosphere and bulk soil of Saffron, using cultivation independent 16S rRNA gene targeted metagenomic approach. PMID:24989343

  18. Community structure, cellular rRNA content, and activity of sulfate-reducing bacteria in marine Arctic sediments

    Ravenschlag, K.; Sahm, K.; Knoblauch, C.;


    The community structure of sulfate-reducing bacteria (SRB) of a marine Arctic sediment (Smeerenburg-fjorden, Svalbard) a-as characterized by both fluorescence in situ hybridization (FISH) and rRNA slot blot hybridization by using group- and genus-specific 16S rRNA-targeted oligonucleotide probes......, The SRB community was dominated by members of the Desulfosarcina-Desulfococcus group. This group accounted for up to 73% of the SRB detected and up to 70% of the SRB rRNA detected. The predominance was shown to be a common feature for different stations along the coast of Svalbard, In a top......-Desulfococcus group. A group of clone sequences (group SVAL1) most closely related to Desulfosarcina variabilis (91.2% sequence similarity) was dominant and was shown to be most abundant in situ, accounting for up to 54.8% of the total SRB detected. A comparison of the two methods used for quantification showed...

  19. rRNA Gene Expression of Abundant and Rare Activated-Sludge Microorganisms and Growth Rate Induced Micropollutant Removal.

    Vuono, David C; Regnery, Julia; Li, Dong; Jones, Zackary L; Holloway, Ryan W; Drewes, Jörg E


    The role of abundant and rare taxa in modulating the performance of wastewater-treatment systems is a critical component of making better predictions for enhanced functions such as micropollutant biotransformation. In this study, we compared 16S rRNA genes (rDNA) and rRNA gene expression of taxa in an activated-sludge-treatment plant (sequencing batch membrane bioreactor) at two solids retention times (SRTs): 20 and 5 days. These two SRTs were used to influence the rates of micropollutant biotransformation and nutrient removal. Our results show that rare taxa (micropollutant biotransformation. An analysis of micropollutant-associated degradation genes via metagenomics and direct measurements of a suite of micropollutants and nutrients further corroborates the loss of enhanced functions at 5-day SRT operation. This work advances our knowledge of the underlying ecosystem properties and dynamics of abundant and rare organisms associated with enhanced functions in engineered systems. PMID:27196630

  20. Determination of 16S rRNA Sequences of Enterococci and Application to Species Identification of Nonmotile Enterococcus gallinarum Isolates

    Patel, Robin; Piper, Kerryl E.; Rouse, Mark S; Steckelberg, James M.; Uhl, Jim R.; Kohner, Peggy; Hopkins, Marlene K.; Cockerill, Franklin R.; Kline, Bruce C.


    The 16S rRNA sequences of enterococcal species E. faecium, E. faecalis, E. gallinarum, E. casseliflavus/flavescens, E. dispar, E. pseudoavium, E. sulfureus, E. malodoratus, E. raffinosus, E. cecorum, E. hirae, E. saccharolyticus, E. seriolicida, E. mundtii, E. avium, E. durans, E. columbae, and E. solitarius are presented herein. These data were utilized to confirm the species identification of two nonmotile E. gallinarum isolates which had been previously phenotypically identified as E. faec...

  1. Unique 16S rRNA sequences of Eurythenes gryllus (Crustacea: Amphipoda: Lysianassidae) from the Gulf of Mexico abyssal plain

    Elva Escobar-Briones; Eduardo Nájera-Hillman; Fernando Álvarez


    Amphipods of the species Eurythenes gryllus were collected at 2 locations on the abyssal plain (~3 400 m) of the Gulf of Mexico in order to test whether or not these scavenger amphipods are isolated in this peripheral sea or show connectivity by their predominant swimming behavior, moving horizontally along the abyssal water masses in the region. Partial sequences of the mitochondrial 16S rRNA gene from 2 individuals of E. gryllus were determined and showed small differences when compared to ...

  2. Molecular characterization of Sarcocystis species from Polish roe deer based on ssu rRNA and cox1 sequence analysis.

    Kolenda, Rafał; Ugorski, Maciej; Bednarski, Michał


    Sarcocysts from four Polish roe deer were collected and examined by light microscopy, small subunit ribosomal RNA (ssu rRNA), and the subunit I of cytochrome oxidase (cox1) sequence analysis. This resulted in identification of Sarcocystis gracilis, Sarcocystis oviformis, and Sarcocystis silva. However, we were unable to detect Sarcocystis capreolicanis, the fourth Sarcocystis species found previously in Norwegian roe deer. Polish sarcocysts isolated from various tissues differed in terms of their shape and size and were larger than the respective Norwegian isolates. Analysis of ssu rRNA gene revealed the lack of differences between Sarcocystis isolates belonging to one species and a very low degree of genetic diversity between Polish and Norwegian sarcocysts, ranging from 0.1% for Sarcocystis gracilis and Sarcocystis oviformis to 0.44% for Sarcocystis silva. Contrary to the results of the ssu rRNA analysis, small intraspecies differences in cox1 sequences were found among Polish Sarcocystis gracilis and Sarcocystis silva isolates. The comparison of Polish and Norwegian cox1 sequences representing the same Sarcocystis species revealed similar degree of sequence identity, namely 99.72% for Sarcocystis gracilis, 98.76% for Sarcocystis silva, and 99.85% for Sarcocystis oviformis. Phylogenetic reconstruction and genetic population analyses showed an unexpected high degree of identity between Polish and Norwegian isolates. Moreover, cox1 gene sequences turned out to be more accurate than ssu rRNA when used to reveal phylogenetic relationships among closely related species. The results of our study revealed that the same Sarcocystis species isolated from the same hosts living in different geographic regions show a very high level of genetic similarity. PMID:24948101

  3. Influence of DNA extraction on oral microbial profiles obtained via 16S rRNA gene sequencing

    Diaz, Patricia I.; Abusleme, Loreto; Hong, Bo-Young; Amanda K. Dupuy; Linda D Strausbaugh


    Background and objective: The advent of next-generation sequencing has significantly facilitated characterization of the oral microbiome. Despite great efforts in streamlining the processes of sequencing and data curation, upstream steps required for amplicon library generation could still influence 16S rRNA gene-based microbial profiles. Among upstream processes, DNA extraction is a critical step that could represent a great source of bias. Accounting for bias introduced by extraction proced...

  4. Use of 16S rRNA Sequencing for Identification of Actinobacillus ureae Isolated from a Cerebrospinal Fluid Sample

    Whitelaw, A. C.; Shankland, I. M.; Elisha, B. G.


    Actinobacillus ureae, previously Pasteurella ureae, has on rare occasions been described as a cause of human infection. Owing to its rarity, it may not be easily identified in clinical microbiology laboratories by standard tests. This report describes a patient with acute bacterial meningitis due to A. ureae. The identity of the isolate was determined by means of DNA sequence analysis of a portion of the 16S rRNA gene.

  5. Analysis of Mixed Sequencing Chromatograms and Its Application in Direct 16S rRNA Gene Sequencing of Polymicrobial Samples▿

    Kommedal, Øyvind; Karlsen, Bjarte; Sæbø, Øystein


    Investigation of clinical samples by direct 16S rRNA gene sequencing provides the possibility to detect nonviable bacteria and bacteria with special growth requirements. This approach has been particularly valuable for the diagnosis of patients who have received antibiotics prior to sample collection. In specimens containing more than one bacterium, direct sequencing gives mixed chromatograms that complicate further interpretation. We designed an algorithm able to analyze these ambiguous chro...

  6. The Identification of Discriminating Patterns from 16S rRNA Gene to Generate Signature for Bacillus Genus.

    More, Ravi P; Purohit, Hemant J


    The 16S ribosomal RNA (16S rRNA) gene has been widely used for the taxonomic classification of bacteria. A molecular signature is a set of nucleotide patterns, which constitute a regular expression that is specific to each particular taxon. Our main goal was to identify discriminating nucleotide patterns in 16S rRNA gene and then to generate signatures for taxonomic classification. To demonstrate our approach, we used the phylum Firmicutes as a model using representative taxa Bacilli (class), Bacillales (order), Bacillaceae (family), and Bacillus (genus), according to their dominance at each hierarchical taxonomic level. We applied combined composite vector and multiple sequence alignment approaches to generate gene-specific signatures. Further, we mapped all the patterns into the different hypervariable regions of 16S rRNA gene and confirmed the most appropriate distinguishing region as V3-V4 for targeted taxa. We also examined the evolution in discriminating patterns of signatures across taxonomic levels. We assessed the comparative classification accuracy of signatures with other methods (i.e., RDP Classifier, KNN, and SINA). Results revealed that the signatures for taxa Bacilli, Bacillales, Bacillaceae, and Bacillus could correctly classify isolate sequences with sensitivity of 0.99, 0.97, 0.94, and 0.89, respectively, and specificity close to 0.99. We developed signature-based software DNA Barcode Identification (DNA BarID) for taxonomic classification that is available at website . This pattern-based study provides a deeper understanding of taxon-specific discriminating patterns in 16S rRNA gene with respect to taxonomic classification. PMID:27104769

  7. Cilantro microbiome before and after nonselective pre-enrichment for Salmonella using 16S rRNA and metagenomic sequencing

    Jarvis, Karen G.; White, James R.; Grim, Christopher J.; Ewing, Laura; Ottesen, Andrea R; Beaubrun, Junia Jean-Gilles; Pettengill, James B; Brown, Eric; Hanes, Darcy E.


    Background Salmonella enterica is a common cause of foodborne gastroenteritis in the United States and is associated with outbreaks in fresh produce such as cilantro. Salmonella culture-based detection methods are complex and time consuming, and improvments to increase detection sensitivity will benefit consumers. In this study, we used 16S rRNA sequencing to determine the microbiome of cilantro. We also investigated changes to the microbial community prior to and after a 24-hour nonselective...

  8. Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

    Xiao Li Shi

    Full Text Available The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX, which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

  9. Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿

    wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu


    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative s...

  10. An intramolecular recombination mechanism for the formation of the rRNA gene palindrome of Tetrahymena thermophila.

    Butler, D. K.; Yasuda, L E; Yao, M C


    Large palindromic DNAs are found in a wide variety of eukaryotic cells. In Tetrahymena thermophila, a large palindrome is formed from a single rRNA gene (rDNA) during nuclear differentiation. We present evidence that a key step in the formation of the rDNA palindrome of T. thermophila involves homologous intramolecular recombination. Heteroduplex micronuclear rDNA molecules were constructed in vitro and microinjected into developing macronuclei, where they formed palindromes. Analysis of the ...

  11. Analysis of 16S rRNA amplicon sequencing options on the Roche/454 next-generation titanium sequencing platform.

    Hideyuki Tamaki

    Full Text Available BACKGROUND: 16S rRNA gene pyrosequencing approach has revolutionized studies in microbial ecology. While primer selection and short read length can affect the resulting microbial community profile, little is known about the influence of pyrosequencing methods on the sequencing throughput and the outcome of microbial community analyses. The aim of this study is to compare differences in output, ease, and cost among three different amplicon pyrosequencing methods for the Roche/454 Titanium platform METHODOLOGY/PRINCIPAL FINDINGS: The following three pyrosequencing methods for 16S rRNA genes were selected in this study: Method-1 (standard method is the recommended method for bi-directional sequencing using the LIB-A kit; Method-2 is a new option designed in this study for unidirectional sequencing with the LIB-A kit; and Method-3 uses the LIB-L kit for unidirectional sequencing. In our comparison among these three methods using 10 different environmental samples, Method-2 and Method-3 produced 1.5-1.6 times more useable reads than the standard method (Method-1, after quality-based trimming, and did not compromise the outcome of microbial community analyses. Specifically, Method-3 is the most cost-effective unidirectional amplicon sequencing method as it provided the most reads and required the least effort in consumables management. CONCLUSIONS: Our findings clearly demonstrated that alternative pyrosequencing methods for 16S rRNA genes could drastically affect sequencing output (e.g. number of reads before and after trimming but have little effect on the outcomes of microbial community analysis. This finding is important for both researchers and sequencing facilities utilizing 16S rRNA gene pyrosequencing for microbial ecological studies.

  12. Sequence analysis of 16S rRNA from mycoplasmas by direct solid-phase DNA sequencing.

    Pettersson, B; Johansson, K. E.; Uhlén, M


    Automated solid-phase DNA sequencing was used for determination of partial 16S ribosomal DNA sequences of mycoplasmas. The sequence information was used to establish phylogenetic relationships of 11 different mycoplasmas whose 16S rRNA sequences had not been determined earlier. A biotinylated fragment corresponding to positions 344 to 939 in the Escherichia coli sequence was generated by PCR. The PCR product was immobilized onto streptavidin-coated paramagnetic beads, and direct sequencing wa...

  13. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes

    Mu Peng; Xiaoxue Zi; Qiuyu Wang


    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacte...

  14. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    Martins Cesar


    Full Text Available Abstract Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s occurring in 39.6% of the analyzed individuals (both male and female were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement.

  15. Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing.

    Shin, Jongoh; Lee, Sooin; Go, Min-Jeong; Lee, Sang Yup; Kim, Sun Chang; Lee, Chul-Ho; Cho, Byung-Kwan


    Demands for faster and more accurate methods to analyze microbial communities from natural and clinical samples have been increasing in the medical and healthcare industry. Recent advances in next-generation sequencing technologies have facilitated the elucidation of the microbial community composition with higher accuracy and greater throughput than was previously achievable; however, the short sequencing reads often limit the microbial composition analysis at the species level due to the high similarity of 16S rRNA amplicon sequences. To overcome this limitation, we used the nanopore sequencing platform to sequence full-length 16S rRNA amplicon libraries prepared from the mouse gut microbiota. A comparison of the nanopore and short-read sequencing data showed that there were no significant differences in major taxonomic units (89%) except one phylotype and three taxonomic units. Moreover, both sequencing data were highly similar at all taxonomic resolutions except the species level. At the species level, nanopore sequencing allowed identification of more species than short-read sequencing, facilitating the accurate classification of the bacterial community composition. Therefore, this method of full-length 16S rRNA amplicon sequencing will be useful for rapid, accurate and efficient detection of microbial diversity in various biological and clinical samples. PMID:27411898

  16. TaxCollector: Modifying Current 16S rRNA Databases for the Rapid Classification at Six Taxonomic Levels

    Eric W. Triplett


    Full Text Available The high level of conservation of 16S ribosomal RNA gene (16S rRNA in all Prokaryotes makes this gene an ideal tool for the rapid identification and classification of these microorganisms. Databases such as the Ribosomal Database Project II (RDP-II and the Greengenes Project offer access to sets of ribosomal RNA sequence databases useful in identification of microbes in a culture-independent analysis of microbial communities. However, these databases do not contain all of the taxonomic levels attached to the published names of the bacterial and archaeal sequences. TaxCollector is a set of scripts developed in Python language that attaches taxonomic information to all 16S rRNA sequences in the RDP-II and Greengenes databases. These modified databases are referred to as TaxCollector databases, which when used in conjunction with BLAST allow for rapid classification of sequences from any environmental or clinical source at six different taxonomic levels, from domain to species. The TaxCollector database prepared from the RDP-II database is an important component of a new 16S rRNA pipeline called PANGEA. The usefulness of TaxCollector databases is demonstrated with two very different datasets obtained using samples from a clinical setting and an agricultural soil. The six TaxCollector scripts are freely available on and on

  17. A nested array of rRNA targeted probes for the detection and identification of enterococci by reverse hybridization.

    Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W


    Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants. PMID:11249027

  18. The conformation of 23S rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase

    Vester, B; Hansen, L H; Douthwaite, S


    it was shown that the A2057 and U2611 mutations alone and in combination alter the reactivity of A2058 and adjacent bases. However, mutagenizing position G-->A2032 in an adjacent loop, which has been implicated to interact with A2058, alters neither the ErmE methylation at A2058 nor the accessibility...... effects of mutations around position A2058 on methylation. Mutagenizing A2058 (to G or U) completely abolishes methylation of 23S rRNA by ErmE. No methylation occurred at other sites in the rRNA, demonstrating the fidelity of ErmE for A2058. Breaking the neighboring G2057-C2611 Watson-Crick base pair by...... introducing either an A2057 or a U2611 mutation, greatly reduces the rate of methylation at A2058. Methylation remains impaired after these mutations have been combined to create a new A2057-U2611 Watson-Crick base interaction. The conformation of this region in 23S rRNA was probed with chemical reagents and...

  19. Evolutionary History of the Chaetognaths Inferred from Actin and 18S-28S rRNA Paralogous Genes

    J.P. Casanova


    Full Text Available The chaetognaths constitute a small and enigmatic phylum of marine invertebrates whose phylogenetic affinities remain uncertain. Our phylogenetical investigations inferred from partial paralogous 18S-28S rRNA genes suggest that the event resulting in the presence of two classes of rRNA genes would have occurred at approximately 300-400 million years and prior to the radiation of extant chaetognath, whereas the taxon, according to both molecular and paleontological data, would be dated from at least the Early Cambrian. These divergent rRNA genes could be the result of a whole ribosomal cluster duplication or of an allopolyploid event during a crisis period, since, the fossil are lacking posterioly to the post-Carboniferous period (c.a., 300 million years. In addition, actin phylogeny evidenced that the cytoplasmic chaetognath actin clustered with the cytoplasmic insect actins, while the muscular chaetognath actins are placed basal to all muscular vertebrate actins. The present study suggests that the gene conversion mechanisms could be inefficient in this taxon; this could explain the conservation of extremely divergent paralogous sequences in the chaetognath genomes which could be correlated to the difficulties to identify a sister group between chaetognaths and other taxa among metazoans.

  20. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.


    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show this structural change depends only on 16S residues within the S4 binding site. SHAPE chemical-probing experiments showed that S4 strongly stabilizes the five-helix junction and helix 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in helix 16 that makes specific contacts with the S4 N-terminal extension, and a right angle motif between helices 3, 4 and 18, require a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of helix 3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  1. Limitations of metazoan 18S rRNA sequence data : implications for reconstructing a phylogeny of the animal kingdom and inferring the reality of the cambrian explosion

    Abouheif, Ehab; Zardoya, Rafael; Meyer, Axel


    We document the phylogenetic behavior of the 18S rRNA molecule in 67 taxa from 28 metazoan phyla and assess the effects of among-site rate variation on reconstructing phylogenies of the animal kingdom. This empirical assessment was undertaken to clarify further the limits of resolution of the 18S rRNA gene as a phylogenetic marker and to address the question of whether 18S rRNA phylogenies can be used as a source of evidence to infer the reality of a Cambrian explosion. A notable degree of am...

  2. Quantification of Hyphomicrobium Populations in Activated Sludge from an Industrial Wastewater Treatment System as Determined by 16S rRNA Analysis

    Layton, A C; Karanth, P. N.; Lajoie, C. A.; Meyers, A J; Gregory, I. R.; Stapleton, R. D.; Taylor, D E; Sayler, G. S.


    The bacterial community structure of the activated sludge from a 25 million-gal-per-day industrial wastewater treatment plant was investigated using rRNA analysis. 16S ribosomal DNA (rDNA) libraries were created from three sludge samples taken on different dates. Partial rRNA gene sequences were obtained for 46 rDNA clones, and nearly complete 16S rRNA sequences were obtained for 18 clones. Seventeen of these clones were members of the beta subdivision, and their sequences showed high homolog...

  3. High pressure high temperature (HPHT) synthesis and magnetism of Cr-12s2 copper oxides with fluorite-structured layers between CuO{sub 2} planes

    Awana, V.P.S. [SMC, National Institute for Materials Science (NIMS), 1-1 Namiki, Tsukuba, Ibaraki 305-0044 (Japan); National Physical Laboratory, Dr. K.S. Krishnan Marg, New Delhi 110 012 (India)], E-mail:; Ubaldini, A.; Balamurugan, S. [SMC, National Institute for Materials Science (NIMS), 1-1 Namiki, Tsukuba, Ibaraki 305-0044 (Japan); Kishan, H. [National Physical Laboratory, Dr. K.S. Krishnan Marg, New Delhi 110 012 (India); Takayama-Muromachi, E. [SMC, National Institute for Materials Science (NIMS), 1-1 Namiki, Tsukuba, Ibaraki 305-0044 (Japan)


    The three first members of the Cr-12s2 (s = 1, 2, 3) homologous series, i.e. CrSr{sub 2}YCu{sub 2}O{sub 8} (Cr-1212), CrSr{sub 2}(Y{sub 1.5}Ce{sub 0.5})Cu{sub 2}O{sub 10} (Cr-1222) and CrSr{sub 2}(Y{sub 1}Ce{sub 2})Cu{sub 2}O{sub 12}(Cr-1232) are synthesized by high pressure high temperature (HPHT) 6 GPa and 1550 deg. C process. Though the Cr-1212 and Cr-1232 could not be formed in single phase with full Cr, the Cr-1222 is achieved in pure phase with space group I4/mmm. These compounds belong to the multi-layered copper oxides series that differ from each other only in terms of the (Ce,Y)-[O{sub 2}-(Ce,Y)]{sub s-1} layer blocks between two identical CuO{sub 2} planes with s = 1, 2 and 3. At 5 K, the magnetization M(H) experiments showed some ferromagnetic like hysteresis loops though the characteristic M{sub r} and H{sub c} were not seen clearly. None of the studied compounds exhibited superconductivity down to 5 K.

  4. High pressure high temperature (HPHT) synthesis and magnetism of Cr-12s2 copper oxides with fluorite-structured layers between CuO2 planes

    The three first members of the Cr-12s2 (s = 1, 2, 3) homologous series, i.e. CrSr2YCu2O8 (Cr-1212), CrSr2(Y1.5Ce0.5)Cu2O10 (Cr-1222) and CrSr2(Y1Ce2)Cu2O12(Cr-1232) are synthesized by high pressure high temperature (HPHT) 6 GPa and 1550 deg. C process. Though the Cr-1212 and Cr-1232 could not be formed in single phase with full Cr, the Cr-1222 is achieved in pure phase with space group I4/mmm. These compounds belong to the multi-layered copper oxides series that differ from each other only in terms of the (Ce,Y)-[O2-(Ce,Y)]s-1 layer blocks between two identical CuO2 planes with s = 1, 2 and 3. At 5 K, the magnetization M(H) experiments showed some ferromagnetic like hysteresis loops though the characteristic Mr and Hc were not seen clearly. None of the studied compounds exhibited superconductivity down to 5 K

  5. Sulphate reduction and vertical distribution of sulphate-reducing bacteria quantified by rRNA slot-blot hybridization in a coastal marine sediment

    Sahm, K.; MacGregor, BJ; Jørgensen, BB; Stahl, DA


    In the past, enumeration of sulphate-reducing bacteria (SRB) by cultivation-based methods generally contradicted measurements of sulphate reduction, suggesting unrealistically high respiration rates per cell. Here, we report evidence that quantification of SRB rRNA by slot-blot hybridization is a...... between 18% and 25% to the prokaryotic rRNA pool. The dominant SRB were related to complete oxidizing genera (Desulphococcus, Desulphosarcina and Desulphobacterium), while Desulpho-bacter could not be detected. The vertical profile and quantity of rRNA from SRB was compared with sulphate reduction rates...... (SRR) measured with (SO42-)-S-35 tracer in whole-core incubations. While SRB abundance was highest near the surface, peaking at around 1.5cm, measured sulphate reduction rates were lowest in this region. A second peak of SRB rRNA was observed at the transition zone from oxidized to reduced sediment...

  6. Transport of rRNA into cytoplasm required for initiation of S phase in root meristem cells in Helianthus annuus L

    Cold treatment (10degC) of root meristems during a period longer than duration of the cell cycle in 20degC causes a blocking of most cells in G1. One of the causes of cell cycle blockade is the decrease of rRNA synthesis and inhibition of rRNA transport into cytoplasm. Transfer of seedlings to 20degC results in increase of rRNA synthesis and its transport to cytoplasm as well as transition of almost all cells from G1 to S during 3 hours. Synchronization of DNA replication, comprising cells within rows of cells, is preceded by similar transport patter of rRNA to cytoplasm. (Author)

  7. A rapid method for sequencing of rRNA gene(s) amplified by polymerase chain reaction using an automated DNA sequencer

    Dwivedi, P.P.; Patel, B.K.C.; Rees, G.N.; Ollivier, Bernard


    A method for DNA sequencing of ribosomal RNA (rRNA) genes, amplified by polymerase chain reaction (PCR), using internal primers, designed on the basis of conserved regions of rRNA genes for determining a near complete sequence (99%) of the gene using an automated DNA sequencer (Applied Biosystem Incorporation, USA) is described. The procedure is extremely rapid as cloning of the gene is not required for sequence determination. In addition time consuming steps such as ethanol precipitation and...

  8. Molecular evolution of rDNA in early diverging Metazoa: First comparative analysis and phylogenetic application of complete SSU rRNA secondary structures in Porifera

    Wörheide Gert; Erpenbeck Dirk; Voigt Oliver


    Abstract Background The cytoplasmic ribosomal small subunit (SSU, 18S) ribosomal RNA (rRNA) is the most frequently-used gene for molecular phylogenetic studies. However, information regarding its secondary structure is neglected in most phylogenetic analyses. Incorporation of this information is essential in order to apply specific rRNA evolutionary models to overcome the problem of co-evolution of paired sites, which violates the basic assumption of the independent evolution of sites made by...

  9. Update and evaluation of 16SpathDB, an automated comprehensive database for identification of medically important bacteria by 16S rRNA gene sequencing

    Yeung, Shiu-yan; 楊兆恩


    Identification of pathogens is one of the important duties of clinical microbiology laboratory. Traditionally, phenotypic tests are used to identify the bacteria. However, due to some limitations of the phenotypic tests, the bacteria may not be identified sometimes and cannot be identified promptly. 16S rRNA gene sequencing is a rapid and accurate method to achieve this target. It is especially useful for identify rare or slow growing bacteria. However, the interpretation of the 16S rRNA gene...

  10. Soil Acidobacterial 16S rRNA Gene Sequences Reveal Subgroup Level Differences between Savanna-Like Cerrado and Atlantic Forest Brazilian Biomes

    Catão, Elisa C. P.; Lopes, Fabyano A. C.; Janaína F. Araújo; Alinne P. de Castro; Barreto, Cristine C.; Mercedes M.C. Bustamante; Betania F. Quirino; Krüger, Ricardo H.


    16S rRNA sequences from the phylum Acidobacteria have been commonly reported from soil microbial communities, including those from the Brazilian Savanna (Cerrado) and the Atlantic Forest biomes, two biomes that present contrasting characteristics of soil and vegetation. Using 16S rRNA sequences, the present work aimed to study acidobacterial diversity and distribution in soils of Cerrado savanna and two Atlantic forest sites. PCA and phylogenetic reconstruction showed that the acidobacterial ...

  11. Identificación de Yarrowia lipolytica (Ascomycota: Hemiascomycetes como contaminante en la obtención de amplificados del gen 28S rRNA de moluscos

    Jenny Chirinos


    Full Text Available En el presente trabajo se identifica una secuencia de DNA no esperada proveniente de los amplificados del gen 28S rRNA de moluscos terrestres. Las extracciones de DNA se realizaron del tejido del pie de caracoles terrestres por el método del CTAB modificado. Las PCRs fueron llevadas a cabo con primers universales para el gen COI e iniciadores diseñados para moluscos, para el marcador 16S rRNA, 28S rRNA y la región ITS-2. Los tamaños aproximados de las bandas de los amplificados de moluscos fueron de 706 pb para el COI, 330 pb para el 16S rRNA, 900 pb para el ITS-2 y 583 pb para el 28S rRNA; un amplificado del último marcador fue de una longitud inesperada, ~340 pb. Las secuencias de DNA fueron comparadas con la base de datos del GenBank mediante el programa BLASTn y la muestra con la banda de tamaño inesperado resultó en un 100% de identidad y cobertura del 99% con el gen 26S rRNA de la levadura Yarrowia lipolytica. El análisis filogenético con Neighbour-Joining y los valores de divergencia confirmaron la identificación, proporcionando resultados que apoyan la ubicación taxonómica de la especie dentro del clado de los Hemiascomycetes.

  12. Microbial Dark Matter: Unusual intervening sequences in 16S rRNA genes of candidate phyla from the deep subsurface

    Jarett, Jessica; Stepanauskas, Ramunas; Kieft, Thomas; Onstott, Tullis; Woyke, Tanja


    The Microbial Dark Matter project has sequenced genomes from over 200 single cells from candidate phyla, greatly expanding our knowledge of the ecology, inferred metabolism, and evolution of these widely distributed, yet poorly understood lineages. The second phase of this project aims to sequence an additional 800 single cells from known as well as potentially novel candidate phyla derived from a variety of environments. In order to identify whole genome amplified single cells, screening based on phylogenetic placement of 16S rRNA gene sequences is being conducted. Briefly, derived 16S rRNA gene sequences are aligned to a custom version of the Greengenes reference database and added to a reference tree in ARB using parsimony. In multiple samples from deep subsurface habitats but not from other habitats, a large number of sequences proved difficult to align and therefore to place in the tree. Based on comparisons to reference sequences and structural alignments using SSU-ALIGN, many of these ?difficult? sequences appear to originate from candidate phyla, and contain intervening sequences (IVSs) within the 16S rRNA genes. These IVSs are short (39 - 79 nt) and do not appear to be self-splicing or to contain open reading frames. IVSs were found in the loop regions of stem-loop structures in several different taxonomic groups. Phylogenetic placement of sequences is strongly affected by IVSs; two out of three groups investigated were classified as different phyla after their removal. Based on data from samples screened in this project, IVSs appear to be more common in microbes occurring in deep subsurface habitats, although the reasons for this remain elusive.

  13. Analysis of the function of E. coli 23S rRNA helix-loop 69 by mutagenesis

    Maiväli Ülo


    Full Text Available Abstract Background The ribosome is a two-subunit enzyme known to exhibit structural dynamism during protein synthesis. The intersubunit bridges have been proposed to play important roles in decoding, translocation, and the peptidyl transferase reaction; yet the physical nature of their contributions is ill understood. An intriguing intersubunit bridge, B2a, which contains 23S rRNA helix 69 as a major component, has been implicated by proximity in a number of catalytically important regions. In addition to contacting the small ribosomal subunit, helix 69 contacts both the A and P site tRNAs and several translation factors. Results We scanned the loop of helix 69 by mutagenesis and analyzed the mutant ribosomes using a plasmid-borne IPTG-inducible expression system. We assayed the effects of 23S rRNA mutations on cell growth, contribution of mutant ribosomes to cellular polysome pools and the ability of mutant ribosomes to function in cell-free translation. Mutations A1912G, and A1919G have very strong growth phenotypes, are inactive during in vitro protein synthesis, and under-represented in the polysomes. Mutation Ψ1917C has a very strong growth phenotype and leads to a general depletion of the cellular polysome pool. Mutation A1916G, having a modest growth phenotype, is apparently defective in the assembly of the 70S ribosome. Conclusion Mutations A1912G, A1919G, and Ψ1917C of 23S rRNA strongly inhibit translation. Mutation A1916G causes a defect in the 50S subunit or 70S formation. Mutations Ψ1911C, A1913G, C1914A, Ψ1915C, and A1918G lack clear phenotypes.

  14. Application of rRNA probes and fluorescence in situ hybridization for rapid detection of the toxic dinoflagellate Alexandrium minutum

    TANG Xianghai; YU Rencheng; ZHOU Mingjiang; YU Zhigang


    The dinoflagellate Alexandrium minutum is often associated with harmful algal blooms (HABs).This species consists of many strains that differ in their ability to produce toxins but have similar morphology,making identification difficult.In this study,species-specific rRNA probes were designed for whole-cell fluorescence in situ hybridization (FISH) to distinguish A.minutum from two phylogenetic clades.We acquired the complete SSU to LSU rDNA sequences (GenBank accession numbers JF906989-JF906999) of 11 Alexandrium strains and used these to design rRNA targeted oligonucleotide probes.Three ribotype-specific probes,M-GC-1,M-PC-2,and M-PC-3,were designed.The former is specific for the GC clade (“Global clade”) of A.minutum,the majority of which have been found non-toxic,and the latter two are specific for the PSP (paralytic shellfish poisoning)-producing PC clade (“Pacific clade”).The specificity of these three probes was confirmed by FISH.All cells in observed fields of view were fluorescently labeled when probes and target species were incubated under optimized FISH conditions.However,the accessibility of rRNA molecules in ribosomes varied among the probe binding positions.Thus,there was variation in the distribution of positive signals in labeled cells within nucleolus and cytosol (M-GC-1,M-PC-3),or just nucleolus (M-PC-2).Our results provide a methodological basis for studying the biogeography and population dynamics of A.minutum,and providing an early warning of toxic HABs.

  15. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report

    Lee SH


    Full Text Available Sin Hang Lee,1,21Pathology Department, Milford Hospital, Milford, CT, USA; 2Milford Molecular Diagnostics, Milford, CT, USA Abstract: Lyme disease (LD, the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. Keywords: Lyme disease, Borrelia burgdorferi, homeologous 16S rRNA genes, DNA sequencing

  16. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing

    Chia Sing eChan


    Full Text Available The Sungai Klah (SK hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-meter-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0 to 9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC. In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3−V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream and geochemical parameters (broad temperature and pH range. It is speculated that symbiotic relationships occur between the members of the community.

  17. Slow formation of stable complexes during coincubation of minimal rRNA and ribosomal protein S4.

    Mayerle, Megan; Bellur, Deepti L; Woodson, Sarah A


    Ribosomal protein S4 binds and stabilizes a five-helix junction or five-way junction (5WJ) in the 5' domain of 16S ribosomal RNA (rRNA) and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and 5WJ reorganize their structures. We show that labile S4 complexes rearrange into stable complexes within a few minutes at 42 °C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show that this structural change depends only on 16S residues within the S4 binding site. SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension) chemical probing experiments showed that S4 strongly stabilizes 5WJ and the helix (H) 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in H16 that makes specific contacts with the S4 N-terminal extension, as well as a right-angle motif between H3, H4, and H18, requires a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of H3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  18. Development of an Analysis Pipeline Characterizing Multiple Hypervariable Regions of 16S rRNA Using Mock Samples.

    Jennifer J Barb

    Full Text Available There is much speculation on which hypervariable region provides the highest bacterial specificity in 16S rRNA sequencing. The optimum solution to prevent bias and to obtain a comprehensive view of complex bacterial communities would be to sequence the entire 16S rRNA gene; however, this is not possible with second generation standard library design and short-read next-generation sequencing technology.This paper examines a new process using seven hypervariable or V regions of the 16S rRNA (six amplicons: V2, V3, V4, V6-7, V8, and V9 processed simultaneously on the Ion Torrent Personal Genome Machine (Life Technologies, Grand Island, NY. Four mock samples were amplified using the 16S Ion Metagenomics Kit™ (Life Technologies and their sequencing data is subjected to a novel analytical pipeline.Results are presented at family and genus level. The Kullback-Leibler divergence (DKL, a measure of the departure of the computed from the nominal bacterial distribution in the mock samples, was used to infer which region performed best at the family and genus levels. Three different hypervariable regions, V2, V4, and V6-7, produced the lowest divergence compared to the known mock sample. The V9 region gave the highest (worst average DKL while the V4 gave the lowest (best average DKL. In addition to having a high DKL, the V9 region in both the forward and reverse directions performed the worst finding only 17% and 53% of the known family level and 12% and 47% of the genus level bacteria, while results from the forward and reverse V4 region identified all 17 family level bacteria.The results of our analysis have shown that our sequencing methods using 6 hypervariable regions of the 16S rRNA and subsequent analysis is valid. This method also allowed for the assessment of how well each of the variable regions might perform simultaneously. Our findings will provide the basis for future work intended to assess microbial abundance at different time points

  19. Molecular identification of Trichinella spiralis and Trichinella britovi by diagnostic multiprimer large mitochondrial rRNA amplification.

    Borsuk, P; Moskwa, B; Pastusiak, K; Cabaj, W


    Trichinella parasites with different epidemiological features still occur in Europe and four species of genus Trichinella have been identified: T. spiralis, T. britovi, T. nativa and T. pseudospiralis. Until now, two of them, T. spiralis and T. britovi, have been identified in Poland. In our studies we selected sequence coding for large mitochondrial rRNA (mt LrDNA) as a genetic marker and developed a sensitive LrDNA multiprimer PCR assay allowing for rapid identification of T. spiralis and T. britovi, parasites present in wild and domestic animals in Poland. PMID:14505042

  20. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)1

    Stenger, Brianna L.S.; Clark, Mark E.; Kváč, Martin; Khan, Eakalak; Giddings, Catherine W.; Dyer, Neil W.; Schultz, Jessie L.; McEvoy, John M.


    Cryptosporidium is an apicomplexan parasite that causes the disease cryptosporidiosis in humans, livestock, and other vertebrates. Much of the knowledge on Cryptosporidium diversity is derived from 18S rRNA gene (18S rDNA) phylogenies. Eukaryote genomes generally have multiple 18S rDNA copies that evolve in concert, which is necessary for the accurate inference of phylogenetic relationships. However, 18S rDNA copies in some genomes evolve by a birth-and-death process that can result in sequen...

  1. Molecular evolution of rDNA in early diverging Metazoa: First comparative analysis and phylogenetic application of complete SSU rRNA secondary structures in Porifera

    Wörheide Gert


    Full Text Available Abstract Background The cytoplasmic ribosomal small subunit (SSU, 18S ribosomal RNA (rRNA is the most frequently-used gene for molecular phylogenetic studies. However, information regarding its secondary structure is neglected in most phylogenetic analyses. Incorporation of this information is essential in order to apply specific rRNA evolutionary models to overcome the problem of co-evolution of paired sites, which violates the basic assumption of the independent evolution of sites made by most phylogenetic methods. Information about secondary structure also supports the process of aligning rRNA sequences across taxa. Both aspects have been shown to increase the accuracy of phylogenetic reconstructions within various taxa. Here, we explore SSU rRNA secondary structures from the three extant classes of Phylum Porifera (Grant, 1836, a pivotal, but largely unresolved taxon of early branching Metazoa. This is the first phylogenetic study of poriferan SSU rRNA data to date that includes detailed comparative secondary structure information for all three sponge classes. Results We found base compositional and structural differences in SSU rRNA among Demospongiae, Hexactinellida (glass sponges and Calcarea (calcareous sponges. We showed that analyses of primary rRNA sequences, including secondary structure-specific evolutionary models, in combination with reconstruction of the evolution of unusual structural features, reveal a substantial amount of additional information. Of special note was the finding that the gene tree topologies of marine haplosclerid demosponges, which are inconsistent with the current morphology-based classification, are supported by our reconstructed evolution of secondary structure features. Therefore, these features can provide alternative support for sequence-based topologies and give insights into the evolution of the molecule itself. To encourage and facilitate the application of rRNA models in phylogenetics of early

  2. Molecular evolution of rDNA in early diverging Metazoa: First comparative analysis and phylogenetic application of complete SSU rRNA secondary structures in Porifera


    Background The cytoplasmic ribosomal small subunit (SSU, 18S) ribosomal RNA (rRNA) is the most frequently-used gene for molecular phylogenetic studies. However, information regarding its secondary structure is neglected in most phylogenetic analyses. Incorporation of this information is essential in order to apply specific rRNA evolutionary models to overcome the problem of co-evolution of paired sites, which violates the basic assumption of the independent evolution of sites made by most phylogenetic methods. Information about secondary structure also supports the process of aligning rRNA sequences across taxa. Both aspects have been shown to increase the accuracy of phylogenetic reconstructions within various taxa. Here, we explore SSU rRNA secondary structures from the three extant classes of Phylum Porifera (Grant, 1836), a pivotal, but largely unresolved taxon of early branching Metazoa. This is the first phylogenetic study of poriferan SSU rRNA data to date that includes detailed comparative secondary structure information for all three sponge classes. Results We found base compositional and structural differences in SSU rRNA among Demospongiae, Hexactinellida (glass sponges) and Calcarea (calcareous sponges). We showed that analyses of primary rRNA sequences, including secondary structure-specific evolutionary models, in combination with reconstruction of the evolution of unusual structural features, reveal a substantial amount of additional information. Of special note was the finding that the gene tree topologies of marine haplosclerid demosponges, which are inconsistent with the current morphology-based classification, are supported by our reconstructed evolution of secondary structure features. Therefore, these features can provide alternative support for sequence-based topologies and give insights into the evolution of the molecule itself. To encourage and facilitate the application of rRNA models in phylogenetics of early metazoans, we present 52 SSU rRNA

  3. Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up- and downshift

    Jydegaard-Axelsen, A.M.; Aaes-Jorgensen, A.; Koch, A.G.; Stoumann Jensen, J.; Knochel, S.


    Cell morphology, rRNA content, and growth were examined for Listeria monocytogenes LO28 and EGD, respectively, grown in brain-heart infusion (BHI) and on slices of sausage at 10degreesC in 100% CO2, 100% N-2, and air. In CO2, filamentous cells were formed by both strains on sausage slices and by L....... monocytogenes EGD in BHI. Filamentation was not induced by anaerobiosis only. Fluorescent in situ rRNA hybridization (FISH) of cells grown in BHI showed that the L. monocytogenes EGD filaments consisted of chains of individual slightly elongated cells. The rods formed by L. monocytogenes LO28 had the same size...... in air and CO2.. Septation and cell division were induced in the filaments after a CO2 downshift (i.e., exposure to air). In BHI, the number of colony forming units increased rapidly when L. monocytogenes EGD grown in CO2 was exposed to air whereas the number of L. monocytogenes LO28 remained almost...

  4. 16S rRNA gene phylogenesis of culturable predominant bacteria from diseased Apostichopus japonicus (Holothuroidea, Echinodermata)

    Ma, Haiyan; Jiang, Guoliang; Wu, Zhiqiang; Wang, Xin


    Cultured Apostichopus japonicus in China suffers from a kind of skin ulceration disease that has caused severe economic loss in recent years. The disease, pathogens of which are supposed to be bacteria by most researchers, is highly infectious and can often cause all individuals in the same culture pool to die in a very short time. The 16S rRNA gene phylogenesis of the culturable bacteria from the lesions of diseased individuals was conducted to study the biodiversity of the bacterial communities in the lesions and to identify probable pathogen(s) associated with this kind of disease. S. japonica samples were selected from a hatchery located in the eastern part of Qingdao, China. Bacterial universal primers GM5F and DS907R were used to amplify the 16S rRNA gene of bacteria colonies, and touchdown PCR was performed to amplify the target sequences. The results suggest that γ- proteobacteria (Alteromonadales and Vibrionales) of CFB group, many strains of which have been also determined as pathogens in other marine species, are the predominant bacterial genera of the diseased Apostichopus japonicus individuals.

  5. 16s rRNA Identification of Pediococcus spp. from Broiler and Studies of Adherence Ability on Immobilized Mucus

    Ema Damayanti


    Full Text Available The objectives of this research were to study taxonomical status of lactic acid bacteria (LAB isolated from broiler and adherence ability on mucus in vitro. Molecular analysis was performed by analyzing 16S rRNA gene using universal primer. The adherence assay on mucus was carried out using microplate method with total plate count (TPC, absorbance (A550 and confirmed by scanning electron microscopy (SEM. The results of this studies revealed that three of LAB isolates have closed relation to Pediococcus acidilactici (99.9% species.Three isolates of P. acidilactici have adherence ability on broiler mucus higher than that on porcine mucin with an adherence percentage of 55.5% versus 50.8% and absorbance A550 of 0.061 versus 0.051, respectively. The highest adherence ability showed by P. acidilactici R02 with adherence percentage was 59.3% and absorbance A550 = 0.068. Adherence on mucus were affected by the addition of 3 g/l of gastric juice and 0.3% (b/v of bile salt. Adherence analysis using SEM also showed that the adherence on broiler mucus was higher than the adherence on porcine mucin. Altogether this adherence studies, suggest that three isolates of P. acidilactici LAB were capable of colonizing host intestinal mucus in vitro as important property to be promising probiotic bacteria for broiler.Key words : adherence, broiler, Pediococcus, mucus, 16S rRNA

  6. Analysis of the cystic fibrosis lung microbiota via serial Illumina sequencing of bacterial 16S rRNA hypervariable regions.

    Heather Maughan

    Full Text Available The characterization of bacterial communities using DNA sequencing has revolutionized our ability to study microbes in nature and discover the ways in which microbial communities affect ecosystem functioning and human health. Here we describe Serial Illumina Sequencing (SI-Seq: a method for deep sequencing of the bacterial 16S rRNA gene using next-generation sequencing technology. SI-Seq serially sequences portions of the V5, V6 and V7 hypervariable regions from barcoded 16S rRNA amplicons using an Illumina short-read genome analyzer. SI-Seq obtains taxonomic resolution similar to 454 pyrosequencing for a fraction of the cost, and can produce hundreds of thousands of reads per sample even with very high multiplexing. We validated SI-Seq using single species and mock community controls, and via a comparison to cystic fibrosis lung microbiota sequenced using 454 FLX Titanium. Our control runs show that SI-Seq has a dynamic range of at least five orders of magnitude, can classify >96% of sequences to the genus level, and performs just as well as 454 and paired-end Illumina methods in estimation of standard microbial ecology diversity measurements. We illustrate the utility of SI-Seq in a pilot sample of central airway secretion samples from cystic fibrosis patients.

  7. New mutation points in 23S rRNA gene associated with Helicobacter Pylori resistance to clarithromycin in northeast China

    Qing Hao; Yan Li; Zhi-Jie Zhang; Yong Liu; Hong Gao


    AIM: To investigate the resistance rate of Helicobacter pylori (Hpylori) to clarithromycin, metronidazole, amoxicillin and tetracycline to guide clinical practice, and to study the mechanism of H pyloriresistant to clarithromycin.METHODS: Thirty H pyloristrains were isolated from the mucosa of peptic ulcer, gastric tumor and chronic gastritis patients, then the minimal inhibitory concentration (MIC) to clarithromycin, metronidazole, amoxicillin and tetracycline was evaluated by E-test method. The sequence analysis of PCR fragments was conducted in 23S rRNA gene of H pylori resistant to clarithromycin to get the resistance mechanism of the bacteria.RESULTS: Among 30 H pyloristrains, 7 cases were resistant to clarithromycin, 12 to metronidazole, 2 to tetracycline and no strain was found to be resistant to amoxicillin. The resistance rates were 23.3%, 40%, 6.7% and 0%,respectively. Three new mutation points were found to be related to the clarithromycin resistance in H pyloriisolates,which were G2224A, C2245T and T2289C.CONCLUSION: In northeast China, H pylorishows high resistance to metronidazole, while sensitive to amoxicillin.The mechanism of resistance to clarithromycin may be related to the mutation of G2224A, C2245T and T2289C in the 23S rRNA gene.

  8. 16S rRNA Gene Phylogenesis of Culturable Predominant Bacteria from Diseased Apostichopus japonicus(Holothuroidea, Echinodermata)

    MA Haiyan; JIANG Guoliang; WU Zhiqiang; WANG Xin


    Cultured Apostichopusjaponicus in China suffers from a kind of skin ulceration disease that has caused severe economic loss in recent years. The disease, pathogens of which are supposed to be bacteria by most researchers, is highly infectious and can often cause all individuals in the same culture pool to die in a very short time. The 16S rRNA gene phylogenesis of the culturable bacteria from the lesions of diseased individuals was conducted to study the biodiversity of the bacterial communities in the lesions and to identify probable pathogen(s) associated with this kind of disease. S. japonica samples were selected from a hatchery located in the eastern part of Qingdao, China. Bacterial universal primers GM5F and DS907R were used to amplify the 16S rRNA gene of bacteria colonies, and touchdown PCR was performed to amplify the target sequences. The results suggest that γ- proteobacteria (Alteromonadales and Vibrionales) of CFB group, many strains of which have been also determined as pathogens in other marine species, are the predominant bacterial genera of the diseased Apostichopusjaponicus individuals.

  9. Genetic relationship between Neobenedenia girellae and N.melleni inferred from 28S rRNA sequences

    WANG Jun; ZHANG Wen; SU Yongquan; DING Shaoxiong


    The fragments of 350 bp in 28S rRNA from the closely related monogenea of trematoda, Neobenedenia girellae and N. melleni are obtained by polymerase chain reaction (PCR) amplified using a couple of special primers and then sequenced. The results show that the comparison of 28S rRNA sequences, with only a base varying in 337bp accounting for 0.3% genetic difference, from the relative species N. girellae and N. melleni parasitized on the different fishes in different farms displays that they possess a very high genetic similarity of 99.7%, higher than that of 99.41% for the single species N. melleni sampled in different areas, and the intraspecific divergence of N.melleni is 0.59%. Meanwhile, the interspecific differences between the two Neobenedenia and three Benedenia (i.e., B. lutjani, B. rohdei and B. seriolae) range from 2.08% to11.73%. In addition, UPGMA and MP molecular phylogenetic trees are constructed and proved to be consistent with each other. Though the morphological characteristics and the results of genetic diversity for the two Neobenedenia show a high similarity, whether they belong to a single species or not are still undefined, and the more genes of them should be further investigated, in combination with the systematical and detailed morphological study.

  10. Formation of nucleolar polymorphisms in trisomic chickens and subsequent microevolution of rRNA gene clusters in diploids.

    Delany, M E; Muscarella, D E; Bloom, S E


    Variations in nucleolar size are common in animals and man, yet the basis and significance of this variation are not well understood. In this report, we describe the generation de novo of individuals that express nucleolar size variations (polymorphisms) and the underlying basis for this phenotype in a vertebrate animal system (Gallus domesticus). Individuals that express nucleolar size polymorphisms were produced from mating chickens trisomic for the nucleolar organizer (NO) chromosome; 10%-18% of progeny demonstrated nucleolar polymorphisms. These progeny were incorporated into a diploid genetic line in which the polymorphic trait was observed to segregate in Mendelian fashion. An even more dramatic nucleolar size polymorphism (one macro- plus one micronucleolus) evolved in one diploid family over the course of only two generations. These individuals were used to ascertain that the polymorphic-nucleoli phenotype was expressed in tissues derived from the three primary embryonic cell layers in embryos and neonates. Image analysis was conducted on cells of these birds to quantitate the size differences between macro- and micronucleoli (5 mu2 versus 1 mu2, respectively). Finally, these birds were studied with the technique of in situ hybridization, which showed that gene number differences between homologous NO chromosomes (i.e., heterozygosity for rRNA gene copy number), underlies the polymorphic-nucleoli phenotype. Thus, the chicken emerges as an experimental system through which heterozygosity for the rRNA gene copy number can be induced, easily identified, transmitted, and expressed in all somatic tissues.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2061593

  11. Fecal Microbiota in Healthy Subjects Following Omnivore, Vegetarian and Vegan Diets: Culturable Populations and rRNA DGGE Profiling.

    Ferrocino, Ilario; Di Cagno, Raffaella; De Angelis, Maria; Turroni, Silvia; Vannini, Lucia; Bancalari, Elena; Rantsiou, Kalliopi; Cardinali, Gianluigi; Neviani, Erasmo; Cocolin, Luca


    In this study, the fecal microbiota of 153 healthy volunteers, recruited from four different locations in Italy, has been studied by coupling viable counts, on different microbiological media, with ribosomal RNA Denaturing Gradient Gel Electrophoresis (rRNA-DGGE). The volunteers followed three different diets, namely omnivore, ovo-lacto-vegetarian and vegan. The results obtained from culture-dependent and -independent methods have underlined a high level of similarity of the viable fecal microbiota for the three investigated diets. The rRNA DGGE profiles were very complex and comprised a total number of bands that varied from 67 to 64 for the V3 and V9 regions of the 16S rRNA gene, respectively. Only a few bands were specific in/of all three diets, and the presence of common taxa associated with the dietary habits was found. As far as the viable counts are concerned, the high similarity of the fecal microbiota was once again confirmed, with only a few of the investigated groups showing significant differences. Interestingly, the samples grouped differently, according to the recruitment site, thus highlighting a higher impact of the food consumed by the volunteers in the specific geographical locations than that of the type of diet. Lastly, it should be mentioned that the fecal microbiota DGGE profiles obtained from the DNA were clearly separated from those produced using RNA, thus underlining a difference between the total and viable populations in the fecal samples. PMID:26035837

  12. Fecal Microbiota in Healthy Subjects Following Omnivore, Vegetarian and Vegan Diets: Culturable Populations and rRNA DGGE Profiling.

    Ilario Ferrocino

    Full Text Available In this study, the fecal microbiota of 153 healthy volunteers, recruited from four different locations in Italy, has been studied by coupling viable counts, on different microbiological media, with ribosomal RNA Denaturing Gradient Gel Electrophoresis (rRNA-DGGE. The volunteers followed three different diets, namely omnivore, ovo-lacto-vegetarian and vegan. The results obtained from culture-dependent and -independent methods have underlined a high level of similarity of the viable fecal microbiota for the three investigated diets. The rRNA DGGE profiles were very complex and comprised a total number of bands that varied from 67 to 64 for the V3 and V9 regions of the 16S rRNA gene, respectively. Only a few bands were specific in/of all three diets, and the presence of common taxa associated with the dietary habits was found. As far as the viable counts are concerned, the high similarity of the fecal microbiota was once again confirmed, with only a few of the investigated groups showing significant differences. Interestingly, the samples grouped differently, according to the recruitment site, thus highlighting a higher impact of the food consumed by the volunteers in the specific geographical locations than that of the type of diet. Lastly, it should be mentioned that the fecal microbiota DGGE profiles obtained from the DNA were clearly separated from those produced using RNA, thus underlining a difference between the total and viable populations in the fecal samples.

  13. Bacterial community analysis of a gas-phase biotrickling filter for biogas mimics desulfurization through the rRNA approach.

    Maestre, Juan P; Rovira, R; Alvarez-Hornos, F J; Fortuny, M; Lafuente, J; Gamisans, X; Gabriel, D


    The bacterial composition of a lab-scale biotrickling filter (BTF) treating high loads of H(2)S was investigated by the rRNA approach. Two 16S rRNA gene clone libraries were established 42 and 189 d after reactor startup, while fluorescent in-situ hybridization (FISH) with DNA probes was performed throughout 260d of reactor operation. Diversity, community structure and metamorphosis were studied from reactor startup to fully-established pseudo-steady state operation at near neutral pH and at an inlet H(2)S concentration of 2000 ppmv (load of 55.6g H(2)S m(-3)h(-1)). In addition, FISH was used for assessing the spatial distribution of sulfur-oxidizing bacteria (SOB) along the length of the reactor under pseudo-steady state operation. A major shift in the diversity of the community was observed with the operating time, from a well-diverse community at startup to pseudo-steady state operation with a majority of retrieved sequences affiliated to SOB of the sulfur cycle including Thiothrix spp., Thiobacillus spp., and Sulfurimonas denitrificans. Although aerobic species were predominant along the BTF, a vertical stratification was encountered, in which facultative anaerobes had a major relative abundance in the inlet part of the BTF, where the sulfide to oxygen ratio was higher. The observed changes were related to the trophic properties of the community, the DO concentration, the accumulation of elemental sulfur and the operation at neutral pH. PMID:20554311


    Sri Darmawati


    Full Text Available The purpose of this study is to identify 8 strains of Staphylococcus genus members isolated from positive Widal blood (4 strains of Staphylococcus saprophyticus, 1 strain of Staphylococcus warneri, 2 strains of Staphylococcus hominis, 1 strain of Staphylococcus xylosus and 1 strain of Staphylococcus capitis based on 16S rRNA gene sequences. The methods used in this study are conducting PCR of 16S rRNA gene, cloning genes using T-Vector pMD20 which is transformed to E. coli DH5α, sequencing. The results show that four strains (BA 47.4, BA 19.2, KD 29.5 and TG 09.1 are identified as Stap. Saprophyticus strains of Stap. saprophyticus members of ATCC 15305T (99.01-100% similarity. The strain of TG 01.3 is identified as Stap. Warneri strain of TG 01.3 of Stap. Warneri members of ATCC 27836T (99.74-99.93% similarity, 2strains (KT 29.2 and KD 35.1 are identified as of Stap. hominis members of DSM 20328T (99.4-99.67% similarity. The strain of KT 30.5 is not identified

  15. lncRNA-Induced Nucleosome Repositioning Reinforces Transcriptional Repression of rRNA Genes upon Hypotonic Stress

    Zhongliang Zhao


    Full Text Available The activity of rRNA genes (rDNA is regulated by pathways that target the transcription machinery or alter the epigenetic state of rDNA. Previous work has established that downregulation of rRNA synthesis in quiescent cells is accompanied by upregulation of PAPAS, a long noncoding RNA (lncRNA that recruits the histone methyltransferase Suv4-20h2 to rDNA, thus triggering trimethylation of H4K20 (H4K20me3 and chromatin compaction. Here, we show that upregulation of PAPAS in response to hypoosmotic stress does not increase H4K20me3 because of Nedd4-dependent ubiquitinylation and proteasomal degradation of Suv4-20h2. Loss of Suv4-20h2 enables PAPAS to interact with CHD4, a subunit of the chromatin remodeling complex NuRD, which shifts the promoter-bound nucleosome into the transcriptional “off” position. Thus, PAPAS exerts a “stress-tailored” dual function in rDNA silencing, facilitating either Suv4-20h2-dependent chromatin compaction or NuRD-dependent changes in nucleosome positioning.

  16. Polyethylene glycol and polyvinylpirrolidone effect on bacterial rRNA extraction and hybridization from cells exposed to tannins Efeito de polietilenoglicol e polivinilpirrolidona na extração e hibridização de rRNA bacteriano de células expostas a taninos

    Pedro Braga Arcuri; Michael Larry Thonney; Peter Schofield; Alice Nelson Pell


    In order to detect fluctuations in ruminal microbial populations due to forage tannins using 16S ribosomal RNA (rRNA) probes, recovery of intact rRNA is required. The objective of this work was to evaluate the effect of polyethylene glycol (PEG) and polyvinylpirrolidone (PVP) on extraction of bacterial rRNA, in the presence of tannins from tropical legume forages and other sources, that hybridize with oligonucleotide probes. Ruminococcus albus 8 cells were exposed to 8 g/L tannic acid or 1 g/...

  17. Double trouble for grasshopper molecular systematics: intra-individual heterogeneity of both mitochondrial 12S-valine-16S and nuclear internal transcribed spacer ribosomal DNA sequences in Hesperotettix viridis

    Hesperotettix viridis grasshoppers (Orthoptera: Acrididae:Melanoplinae) exhibit intra-individual variation in both mitochondrial 12S-valine-16S and nuclear internal transcribed spacer (ITS) ribosomal DNA sequences. These findings violate core assumptions underlying DNA sequence data obtained via pol...

  18. Escherichia coli cafA gene encodes a novel RNase, designated as RNase G, involved in processing of the 5' end of 16S rRNA.

    Wachi, M; Umitsuki, G; Shimizu, M; Takada, A; Nagai, K


    We found that the Escherichia coli cafA::cat mutant accumulated a precursor of 16S rRNA. This precursor migrated to the same position with 16.3S precursor found in the BUMMER strain that is known to be deficient in the 5' end processing of 16S rRNA. Accumulation of 16. 3S rRNA in the BUMMER mutant was complemented by introduction of a plasmid carrying the cafA gene. The mutant type cafA gene cloned from the BUMMER strain had a 11-bp deletion in its coding region. A small amount of the mature 16S rRNA was still formed in the cafA::cat mutant. This residual activity was found to be due to RNase E encoded by the rne/ams gene by rifampicin-chase experiments of the cafA::cat ams1 double mutant. These results indicated that the cafA gene encodes a novel RNase responsible for processing of the 5' end of 16S rRNA. PMID:10362534

  19. Development and evaluation of immunochromatography to detect Gram-negative bacteria producing ArmA 16S rRNA methylase responsible for aminoglycoside resistance.

    Oshiro, Satoshi; Tada, Tatsuya; Kameoka, Yousuke; Suzuki, Kazuo; Ohmagari, Norio; Miyoshi-Akiyama, Tohru; Kirikae, Teruo


    Rapid and reliable detection of aminoglycoside-resistant bacteria is an important infection-control measure and a crucial aspect of antimicrobial chemotherapy. The enzyme 16S rRNA methylase has been shown to mediate aminoglycoside resistance in bacteria. This study describes a newly developed immunochromatographic assay using novel monoclonal antibodies (mAbs) that recognize ArmA 16S rRNA methylase. Epitope mapping showed that these mAbs recognized amino acids 1-93 of ArmA, which consists of 257 amino acids. Evaluation of the assay using ArmA producing and non-producing bacterial species, as well as bacteria producing other types of 16S rRNA methylases, indicated that immunochromatographic detection of the ArmA-type 16S rRNA methylase was fully consistent with PCR analysis for armA genes, with all immunochromatographically positive strains being resistant to aminoglycosides (MIC≥128μg/mL). The detection limit of the assay was 12ng ArmA. These findings indicate that this assay can be used for the rapid and reliable detection of the production of ArmA 16S rRNA methylase by Gram-negative bacteria, including Acinetobacter baumannii and Escherichia coli. PMID:26381663

  20. Evaluation of 5.8S rRNA to identify Penaeus semisulcatus and its subspecies, Penaeus semisulcatus persicus (Penaeidae and some Decapoda species

    Zahra Noroozi


    Full Text Available The green tiger prawn, Penaeus semisulcatus is one of the most important members of the family Penaeidae in the Persian Gulf. Based on the morphological characteristics, two groups, including P. semisulcatus and its subspecies viz. P. s. persicus are recognized. This study was conducted to investigate the genetic distance between P. semisulcatus and P. s. persicus by analyzing partial sequence of 5.8S rRNA. Another objective of this study is to evaluate the ability of 5.8S rRNA to identify the species of Decapoda. The results indicated that the 5.8S rRNA gene of both P. semisulcatus and P. s. persicus were exactly identical, and sequence variation was not observed. The results also indicated that 5.8S rRNA sequences between species of the same genus of analysed species of Decapoda are conserved, and no genetic distance was observed in species level. The low evolutionary rate and efficient conservation of the 5.8S rRNA can be attributed to its role in the translation process.

  1. Eukaryotic rRNA Modification by Yeast 5-Methylcytosine-Methyltransferases and Human Proliferation-Associated Antigen p120.

    Gabrielle Bourgeois

    Full Text Available Modified nucleotide 5-methylcytosine (m5C is frequently present in various eukaryotic RNAs, including tRNAs, rRNAs and in other non-coding RNAs, as well as in mRNAs. RNA:m5C-methyltranferases (MTases Nop2 from S. cerevisiae and human proliferation-associated nucleolar antigen p120 are both members of a protein family called Nop2/NSUN/NOL1. Protein p120 is well-known as a tumor marker which is over-expressed in various cancer tissues. Using a combination of RNA bisulfite sequencing and HPLC-MS/MS analysis, we demonstrated here that p120 displays an RNA:m5C- MTase activity, which restores m5C formation at position 2870 in domain V of 25S rRNA in a nop2Δ yeast strain. We also confirm that yeast proteins Nop2p and Rcm1p catalyze the formation of m5C in domains V and IV, respectively. In addition, we do not find any evidence of m5C residues in yeast 18S rRNA. We also performed functional complementation of Nop2-deficient yeasts by human p120 and studied the importance of different sequence and structural domains of Nop2 and p120 for yeast growth and m5C-MTase activity. Chimeric protein formed by Nop2 and p120 fragments revealed the importance of Nop2 N-terminal domain for correct protein localization and its cellular function. We also validated that the presence of Nop2, rather than the m5C modification in rRNA itself, is required for pre-rRNA processing. Our results corroborate that Nop2 belongs to the large family of pre-ribosomal proteins and possesses two related functions in pre-rRNA processing: as an essential factor for cleavages and m5C:RNA:modification. These results support the notion of quality control during ribosome synthesis by such modification enzymes.

  2. Redescriptions of three trachelocercid ciliates (Protista, Ciliophora, Karyorelictea), with notes on their phylogeny based on small subunit rRNA gene sequences.

    Yan, Ying; Xu, Yuan; Yi, Zhenzhen; Warren, Alan


    Three trachelocercid ciliates, Kovalevaia sulcata (Kovaleva, 1966) Foissner, 1997, Trachelocerca sagitta (Müller, 1786) Ehrenberg, 1840 and Trachelocerca ditis (Wright, 1982) Foissner, 1996, isolated from two coastal habitats at Qingdao, China, were investigated using live observation and silver impregnation methods. Data on their infraciliature and morphology are supplied. The small subunit rRNA (SSU rRNA) genes of K. sulcata and Trachelocerca sagitta were sequenced for the first time. Phylogenetic analyses based on SSU rRNA gene sequence data indicate that both organisms, and the previously sequenced Trachelocerca ditis, are located within the trachelocercid assemblage and that K. sulcata is sister to an unidentified taxon forming a clade that is basal to the core trachelocercids. PMID:23847285

  3. YgdE is the 2'-O-ribose methyltransferase RlmM specific for nucleotide C2498 in bacterial 23S rRNA

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M;


    The rRNAs of Escherichia coli contain four 2'-O-methylated nucleotides. Similar to other bacterial species and in contrast with Archaea and Eukaryota, the E. coli rRNA modifications are catalysed by specific methyltransferases that find their nucleotide targets without being guided by small...... ribosomes. Nucleotide C2498 is situated within a highly conserved and heavily modified rRNA sequence, and YgdE's activity is influenced by other modification enzymes that target this region. Phylogenetically, YgdE is placed in the cluster of orthologous groups COG2933 together with S...... complementary RNAs. We show here that the ygdE gene encodes the methyltransferase that catalyses 2'-O-methylation at nucleotide C2498 in the peptidyl transferase loop of E. coli 23S rRNA. Analyses of rRNAs using MALDI mass spectrometry showed that inactivation of the ygdE gene leads to loss of methylation at...

  4. The aminoglycoside resistance methyltransferase Sgm impedes RsmF methylation at an adjacent rRNA nucleotide in the ribosomal A site

    Cubrilo, Sonja; Babić, Fedora; Douthwaite, Stephen;


    methylated nucleotides including m(4)Cm1402 and m(5)C1407. Modification at m(5)C1407 by the methyltransferase RsmF is impeded as Sgm gains access to its adjacent G1405 target on the 30S ribosomal subunit. An Sgm mutant (G135A), which is impaired in S-adenosylmethionine binding and confers lower resistance......Ribosome-targeting antibiotics block protein synthesis by binding at functionally important regions of the bacterial rRNA. Resistance is often conferred by addition of a methyl group at the antibiotic binding site within an rRNA region that is already highly modified with several nucleotide...... methylations. In bacterial rRNA, each methylation requires its own specific methyltransferase enzyme, and this raises the question as to how an extra methyltransferase conferring antibiotic resistance can be accommodated and how it can gain access to its nucleotide target within a short and functionally...

  5. UV-induced modifications in the peptidyl transferase loop of 23S rRNA dependent on binding of the streptogramin B antibiotic, pristinamycin IA

    Porse, B T; Kirillov, S V; Awayez, M J;


    The naturally occurring streptogramin B antibiotic, pristinamycin IA, which inhibits peptide elongation, can produce two modifications in 23S rRNA when bound to the Escherichia coli 70S ribosome and irradiated at 365 nm. Both drug-induced effects map to highly conserved nucleotides within the...... functionally important peptidyl transferase loop of 23S rRNA at positions m2A2503/psi2504 and G2061/A2062. The modification yields are influenced strongly, and differentially, by P-site-bound tRNA and strongly by some of the peptidyl transferase antibiotics tested, with chloramphenicol producing a shift in the...... latter modification to A2062/C2063. Pristinamycin IA can also produce a modification on binding to deproteinized, mature 23S rRNA, at position U2500/C2501. The same modification occurs on an approximately 37-nt fragment, encompassing positions approximately 2496-2532 of the peptidyl transferase loop that...

  6. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui


    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  7. Detection of Borrelia-specific 16S rRNA sequence in total RNA extracted from Ixodes ricinus ticks

    Ž. Radulović


    Full Text Available A reverse transcriptase - polymerase chain reaction based assay for Borrelia species detection in ticks was developed. The method was based on amplification of 552 nucleotide bases long sequence of 16S rRNA, targeted by Borrelia specific primers. In the present study, total RNA extracted from Ixodes ricinus ticks was used as template. The results showed higher sensitivity for Borrelia detection as compared to standard dark-field microscopy. Method specificity was confirmed by cloning and sequencing of obtained 552 base pairs long amplicons. Phylogenetic analysis of obtained sequences showed that they belong to B. lusitaniae and B. afzelii genospecies. RT-PCR based method presented in this paper could be very useful as a screening test for detecting pathogen presence, especially when in investigations is required extraction of total RNA from ticks.

  8. The crystal structure of Mtr4 reveals a novel arch domain required for rRNA processing

    Jackson, R.N.; Robinson, H.; Klauer, A. A.; Hintze, B. J.; van Hoof, A.; Johnson, S. J.


    The essential RNA helicase, Mtr4, performs a critical role in RNA processing and degradation as an activator of the nuclear exosome. The molecular basis for this vital function is not understood and detailed analysis is significantly limited by the lack of structural data. In this study, we present the crystal structure of Mtr4. The structure reveals a new arch-like domain that is specific to Mtr4 and Ski2 (the cytosolic homologue of Mtr4). In vivo and in vitro analyses demonstrate that the Mtr4 arch domain is required for proper 5.8S rRNA processing, and suggest that the arch functions independently of canonical helicase activity. In addition, extensive conservation along the face of the putative RNA exit site highlights a potential interface with the exosome. These studies provide a molecular framework for understanding fundamental aspects of helicase function in exosome activation, and more broadly define the molecular architecture of Ski2-like helicases.

  9. Identification of 5-hydroxycytidine at position 2501 concludes characterization of modified nucleotides in E. coli 23S rRNA

    Havelund, Jesper Foged; Giessing, Anders Michael Bernth; Hansen, Trine Møller;


    modification as 5-hydroxycytidine-a novel modification in RNA. Identification of 5-hydroxycytidine was completed by liquid chromatography under nonoxidizing conditions using a graphitized carbon stationary phase in combination with ion trap tandem mass spectrometry and by comparing the fragmentation behavior...... rRNA-has previously been characterized in the bacterium Escherichia coli. Despite a first report nearly 20 years ago, the chemical nature of the modification at position 2501 has remained elusive, and attempts to isolate it have so far been unsuccessful. We unambiguously identify this last unknown...... of the natural nucleoside with that of a chemically synthesized ditto. Furthermore, we show that 5-hydroxycytidine is also present in the equivalent position of 23S rRNA from the bacterium Deinococcus radiodurans. Given the unstable nature of 5-hydroxycytidine, this modification might be found in...

  10. Phylogenetic relationship of 16 Oedipodidae species (Insecta: Orthoptera) based on the 16S rRNA gene sequences



    The sequences of the mitochondrial 16S rRNA gene of 16 Oedipodidae species were amplified and sequenced. All sequences were aligned and analyzed and the phyloge netic relationships were inferred. The properties of 16S gene in Oedipodidae showed typical patterns of many insects such as a high A+T content and variable distance-dependent transition/transversion ratios. The 0.2 weight for sites of loops may be advisable for phylogeny reconstruction using the maximum parsimony method. The phylogenetic analysis results do not support the current subfamily classification systems of Oedipodidae. Bryodemellinae and Bryodeminae are closely related and should be merged as one subfamily. The status of Oedipodinae and Locustinae is also problematic.

  11. Intrageneric relationships of Enterococci as determined by reverse transcriptase sequencing of small-subunit rRNA.

    Williams, A M; Rodrigues, U M; Collins, M D


    The 16S ribosomal ribonucleic acid (rRNA) sequences of eleven Enterococcus species were determined by reverse transcription in an attempt to clarify their intrageneric relationships. Comparative analysis of the sequence data revealed the presence of several species groups within the genus. The species E. avium, E. malodoratus, E. pseudoavium and E. raffinosus formed a distinct group as did E. durans, E. faecium, E. hirae and E. mundtii and the pair of species E. casseliflavus and E. gallinarum. Of the remaining species, E. cecorum, E. columbae, E. faecalis and E. saccharolyticus formed distinct lines of descent within the genus, whereas E. solitarius displayed a closer affinity with Tetragenococcus halophilus than with other enterococcal species. PMID:1712504

  12. Avian malaria in captive psittacine birds: detection by microscopy and 18S rRNA gene amplification.

    Belo, N O; Passos, L F; Júnior, L M C; Goulart, C E; Sherlock, T M; Braga, E M


    A cross-sectional survey was conducted to estimate the occurrence of malaria infection among captive psittacine birds (n=127) from three zoological gardens in Brazil. Malaria infection was evaluated by the association of direct examination of blood smears with amplification of the 18SSU rRNA gene of the Plasmodium genus, demonstrating an overall occurrence of 36%. Most infected bird species were Amazona aestiva (28/73), Ara ararauna (6/10), and Amazona amazonica (3/10). The low parasitemias observed among the infected birds suggest a chronic infection. The sequence analyses of 10 isolates indicate a potential occurrence of four distinct Plasmodium lineages. These findings provide new data on malarial infection in captive psittacine birds, and emphasize the need for better control of importation and exportation of these birds. PMID:18937986

  13. Erythromycin binding is reduced in ribosomes with conformational alterations in the 23 S rRNA peptidyl transferase loop

    Douthwaite, S; Aagaard, C


    induced by mutations in the peptidyl transferase loop, and to determine how these changes affect drug interaction. Mutations at positions 2057 (G-->A) and 2058 (A-->G, or -->U), all of which confer drug resistance, induce a more open conformation in the peptidyl transferase loop. Erythromycin still...... protects against chemical modification in the mutant peptidyl transferase loops, but the affinity of the drug interaction is reduced 20-fold in the 2057A mutant, 10(3)-fold in the 2058U mutant and 10(4)-fold in the 2058G mutant. Single mutations at position 2032 in the adjacent hairpin loop, which have...... previously been shown to alter drug tolerances, gave no detectable effects on the structure of the peptidyl transferase loop or on erythromycin binding. Dual mutations at positions 2032 and 2058, however, induce a marked change in the rRNA conformation with opening of the phylogenetically conserved base...

  14. Microbial community dynamics based on 16S rRNA gene profiles in a Pacific Northwest estuary and its tributaries.

    Bernhard, Anne E; Colbert, Debbie; McManus, James; Field, Katharine G


    We analyzed bacterioplankton community structure in Tillamook Bay, Oregon and its tributaries to evaluate phylogenetic variability and its relation to changes in environmental conditions along an estuarine gradient. Using eubacterial primers, we amplified 16S rRNA genes from environmental DNA and analyzed the PCR products by length heterogeneity polymerase chain reaction (LH-PCR), which discriminates products based on naturally occurring length differences. Analysis of LH-PCR profiles by multivariate ordination methods revealed differences in community composition along the estuarine gradient that were correlated with changes in environmental variables. Microbial community differences were also detected among different rivers. Using partial 16S rRNA sequences, we identified members of dominant or unique gene fragment size classes distributed along the estuarine gradient. Gammaproteobacteria and Betaproteobacteria and members of the Bacteroidetes dominated in freshwater samples, while Alphaproteobacteria, Cyanobacteria and chloroplast genes dominated in marine samples. Changes in the microbial communities correlated most strongly with salinity and dissolved silicon, but were also strongly correlated with precipitation. We also identified specific gene fragments that were correlated with inorganic nutrients. Our data suggest that there is a significant and predictable change in microbial species composition along an estuarine gradient, shifting from a more complex community structure in freshwater habitats to a community more typical of open ocean samples in the marine-influenced sites. We also demonstrate the resolution and power of LH-PCR and multivariate analyses to provide a rapid assessment of major community shifts, and show how these shifts correlate with environmental variables. PMID:16329898

  15. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report.

    Lee, Sin Hang


    Lyme disease (LD), the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA) gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. PMID:27186082

  16. Investigation of molluscan phylogeny using large-subunit and small-subunit nuclear rRNA sequences.

    Passamaneck, Yale J; Schander, Christoffer; Halanych, Kenneth M


    The Mollusca represent one of the most morphologically diverse animal phyla, prompting a variety of hypotheses on relationships between the major lineages within the phylum based upon morphological, developmental, and paleontological data. Analyses of small-ribosomal RNA (SSU rRNA) gene sequence have provided limited resolution of higher-level relationships within the Mollusca. Recent analyses suggest large-subunit (LSU) rRNA gene sequences are useful in resolving deep-level metazoan relationships, particularly when combined with SSU sequence. To this end, LSU (approximately 3.5 kb in length) and SSU (approximately 2 kb) sequences were collected for 33 taxa representing the major lineages within the Mollusca to improve resolution of intraphyletic relationships. Although the LSU and combined LSU+SSU datasets appear to hold potential for resolving branching order within the recognized molluscan classes, low bootstrap support was found for relationships between the major lineages within the Mollusca. LSU+SSU sequences also showed significant levels of rate heterogeneity between molluscan lineages. The Polyplacophora, Gastropoda, and Cephalopoda were each recovered as monophyletic clades with the LSU+SSU dataset. While the Bivalvia were not recovered as monophyletic clade in analyses of the SSU, LSU, or LSU+SSU, the Shimodaira-Hasegawa test showed that likelihood scores for these results did not differ significantly from topologies where the Bivalvia were monophyletic. Analyses of LSU sequences strongly contradict the widely accepted Diasoma hypotheses that bivalves and scaphopods are closely related to one another. The data are consistent with recent morphological and SSU analyses suggesting scaphopods are more closely related to gastropods and cephalopods than to bivalves. The dataset also presents the first published DNA sequences from a neomeniomorph aplacophoran, a group considered critical to our understanding of the origin and early radiation of the Mollusca

  17. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report

    Lee, Sin Hang


    Lyme disease (LD), the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA) gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. PMID:27186082

  18. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.

    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina


    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis. PMID:27084467

  19. Influence of DNA extraction on oral microbial profiles obtained via 16S rRNA gene sequencing

    Loreto Abusleme


    Full Text Available Background and objective: The advent of next-generation sequencing has significantly facilitated characterization of the oral microbiome. Despite great efforts in streamlining the processes of sequencing and data curation, upstream steps required for amplicon library generation could still influence 16S rRNA gene-based microbial profiles. Among upstream processes, DNA extraction is a critical step that could represent a great source of bias. Accounting for bias introduced by extraction procedures is important when comparing studies that use different methods. Identifying the method that best portrays communities is also desirable. Accordingly, the aim of this study was to evaluate bias introduced by different DNA extraction procedures on oral microbiome profiles. Design: Four DNA extraction methods were tested on mock communities consisting of seven representative oral bacteria. Additionally, supragingival plaque samples were collected from seven individuals and divided equally to test two commonly used DNA extraction procedures. Amplicon libraries of the 16S rRNA gene were generated and sequenced via 454-pyrosequencing. Results: Evaluation of mock communities revealed that DNA yield and bacterial species representation varied with DNA extraction methods. Despite producing the lowest yield of DNA, a method that included bead beating was the only protocol capable of detecting all seven species in the mock community. Comparison of the performance of two commonly used methods (crude lysis and a chemical/enzymatic lysis+column-based DNA isolation on plaque samples showed no effect of extraction protocols on taxa prevalence but global community structure and relative abundance of individual taxa were affected. At the phylum level, the latter method improved the recovery of Actinobacteria, Bacteroidetes, and Spirochaetes over crude lysis. Conclusion: DNA extraction distorts microbial profiles in simulated and clinical oral samples, reinforcing the

  20. Variability in abundance of the Bacterial and Archaeal 16S rRNA and amoA genes in water columns of northern South China Sea

    Liu, H.; Yang, C.; Chen, S.; Xie, W.; Wang, P.; Zhang, C. L.


    Recent advances in marine microbial ecology have shown that ammonia-oxidizing Archaea (AOA) are more abundant than ammonia-oxidizing bacteria (AOB), although total Bacteria are more abundant than total Archaea in marine environments. This study aimed to examine the spatial distribution and abundance of planktonic archaeal and bacterial 16S rRNA- and amoA genes in the northern South China Sea. Water samples were collected at different depths at six stations (maximum depth ranging from 1800 m to 3200 m)with four stations (B2, B3, B6, B7) located along a transect from the northeastern continental slope to the Bashi Strait and the other two (D3, D5) located southwest of this transect. Quantitative PCR of the 16S rRNA- and amoA genes was used to estimate the abundances of total Archaea, total Bacteria, and AOA and AOB, respectively. At the B series stations, the abundance of bacterial 16S rRNA gene was twofold to 36fold higher than that of the archaeal 16S rRNA gene while fivefold lower to sixfold higher at the two D stations, with both genes showing peak values slightly below sea surface (5-75 m depths) at all stations. The archaeal amoA gene had similar variations with the archaeal 16S rRNA gene, but was 1-4 orders of magnitude lower than the archaeal 16S rRNA gene at all stations. Bacterial amoA gene was below the detection at all stations. Our results also show the difference in depth profiles among these stations, which may be caused by the difference in water movement between these regions. The non-detection of bacterial amoA gene indicates that ammonia-oxidizing Archaea are the dominant group of microorganisms in nitrification of the South China Sea, which is consistent with observations in other oceans.

  1. Diversity, Dynamics and Activity of Bacterial Communities during Production of an Artisanal Sicilian Cheese as Evaluated by 16S rRNA Analysis

    Randazzo, C.L.; Torriani, S.; Akkermans, A.D.L.; Vos, de, R.; Vaughan, E E


    The diversity and dynamics of the microbial communities during the manufacturing of Ragusano cheese, an artisanal cheese produced in Sicily (Italy), were investigated by a combination of classical and culture-independent approaches. The latter included PCR, reverse transcriptase-PCR (RT-PCR), and denaturing gradient gel electrophoresis (DGGE) of 16S rRNA genes (rDNA). Bacterial and Lactobacillus group-specific primers were used to amplify the V6 to V8 and V1 to V3 regions of the 16S rRNA gene...

  2. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan

    Martínez, Allyson K.; GORDON, EMILY; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M.; Benedik, Michael J.; Yanofsky, Charles; Mankin, Alexander S.; Vazquez-Laslop, Nora; Sachs, Matthew S.; Cruz-Vera, Luis R.


    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome’s ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the con...

  3. Direct 16S rRNA Gene Sequencing from Clinical Specimens, with Special Focus on Polybacterial Samples and Interpretation of Mixed DNA Chromatograms ▿

    Kommedal, Øyvind; Kvello, Kristine; Skjåstad, Rune; Langeland, Nina; Wiker, Harald G.


    RipSeq (iSentio, Bergen, Norway) is a web-based application for the analysis of mixed DNA chromatograms. It opens the possibility to analyze chromatograms obtained by direct 16S rRNA gene sequencing from polybacterial human clinical samples. In this study, we used direct 16S rRNA gene sequencing to investigate 264 samples from a wide range of suspected human bacterial infections. The sequence-based identification was compared with the results from routine culture-based identification. A total...

  4. Translation by ribosome shunting on adenovirus and hsp70 mRNAs facilitated by complementarity to 18S rRNA

    Yueh, Andrew; Schneider, Robert J.


    Translation initiation on eukaryotic mRNAs involves 40S ribosome association with mRNA caps (m7GpppN), mediated by initiation factor eIF4F. 40S eukaryotic ribosomes and initiation factors undergo 5′ scanning to the initiation codon, with no known role for complementarity between eukaryotic 18S rRNA and the 5′ noncoding region of mRNAs. We demonstrate that the 5′ noncoding region of human adenovirus late mRNAs, known as the tripartite leader, utilizes a striking complementarity to 18S rRNA to ...

  5. Interconversion of active and inactive 30 S ribosomal subunits is accompanied by a conformational change in the decoding region of 16 S rRNA

    Moazed, D; Van Stolk, B J; Douthwaite, S;


    Zamir, Elson and their co-workers have shown that 30 S ribosomal subunits are reversibly inactivated by depletion of monovalent or divalent cations. We have re-investigated the conformation of 16 S rRNA in the active and inactive forms of the 30 S subunit, using a strategy that is designed......' regions of 16 S rRNA. The inactive form also shows significantly decreased reactivity at positions 1533 to 1538 (the Shine-Dalgarno region), in agreement with earlier findings. The principal changes in reactivity involve the universally conserved nucleotides G926, C1395, A1398 and G1401. The three purines...

  6. Composition of fecal microbiota of laboratory mice derived from Japanese commercial breeders using 16S rRNA gene clone libraries

    NOZU, Ryoko; UENO, Masami; HAYASHIMOTO, Nobuhito


    The fecal microbiota of six mice derived from three Japanese commercial breeders was analyzed by using 16S rRNA gene clone libraries to construct a database for analyzing the gut microbiota of laboratory mice. The 566 clones were obtained from the clone libraries generated from the fecal DNA samples derived from BALB/c, C57BL/6N, DBA/2 and ICR mice. Among these 566 clones, there were 446 unique 16S rRNA gene sequences. When grouped at the 98% similarity level, the 446 unique sequences consisted of 103 Clostridiales, 43 Bacteroidales, 5 Lactobacillus and 3 Erysipelotricaceae, as well as sequences from 11 other phyla. PMID:26902692

  7. Comparative Analysis of 16S rRNA and amoA Genes from Archaea Selected with Organic and Inorganic Amendments in Enrichment Culture

    Xu, Mouzhong; Schnorr, Jon; Keibler, Brandon; Holly M Simon


    We took advantage of a plant-root enrichment culture system to characterize mesophilic soil archaea selected through the use of organic and inorganic amendments. Comparative analysis of 16S rRNA and amoA genes indicated that specific archaeal clades were selected under different conditions. Three amoA sequence clades were identified, while for a fourth group, identified by 16S rRNA gene analysis alone and referred to as the “root” clade, we detected no corresponding amoA gene. The amoA-contai...

  8. Molecular analysis of the rRNA genes of Babesia spp and Ehrlichia canis detected in dogs from RibeirÃo Preto, Brazil

    de Oliveira, L. P.; Cardozo, G.P.; E.V. Santos; Mansur, M.A.B.; I.A.N. Donini; Zissou, V.G.; P.G. Roberto; M. Marins


    The partial DNA sequences of the 18S rRNA gene of Babesia canis and the 16S rRNA gene of Ehrlichia canis detected in dogs from Ribeirão Preto, Brazil, were compared to sequences from other strains deposited in GenBank. The E. canis strain circulating in Ribeirão Preto is identical to other strains previously detected in the region, whereas the subspecies Babesia canis vogeli is the main Babesia strain circulating in dogs from Ribeirão Preto.As sequências parciais dos genes RNAr 18S de Babesia...

  9. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A


    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show – using proteomic analysis and dual fluorescence reporter in vivo assays – that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requi...

  10. Phylogenetic analysis of ten species of five genera of Buccinidae from the Chinese coast based on 28S rRNA gene

    DONG Chang-Yong; Hou, Lin; Sui, Na; Zhang, Yun; WANG Ming-Chang; Li, Yan


    It has been reported that there are 31 species in 13 genera of the family Buccinidae, distributed along the Chinese coast, but their taxonomic status is still controversial. In the present paper, phylogenetic relationships among ten species in five genera of Buccinidae from the Liaoning, Shandong and Fujian coast and ten species in five genus from the Chinese coast were examined using partial large ribosome subunit 28S rRNA sequences. An approximate 1400 bp fragment of the 28 rRNA gene was o...

  11. Diversity and distribution of 16S rRNA and phenol monooxygenase genes in the rhizosphere and endophytic bacteria isolated from PAH-contaminated sites

    Anping Peng; Juan Liu; Wanting Ling; Zeyou Chen; Yanzheng Gao


    This is the first investigation of the diversity and distribution of 16S rRNA and phenol monooxygenase (PHE) genes in endophytic and rhizosphere bacteria of plants at sites contaminated with different levels of PAHs. Ten PAHs at concentrations from 34.22 to 55.29 and 45.79 to 97.81 mg·kg−1 were measured in rhizosphere soils of Alopecurus aequalis Sobol and Oxalis corniculata L., respectively. The diversity of 16S rRNA and PHE genes in rhizosphere soils or plants changed with varying PAH pollu...

  12. Prevalence of A2143G mutation of H. pylori-23S rRNA in Chinese subjects with and without clarithromycin use history

    Ma Junling; Feng Guoshuang; Gu Liankun; Zhou Jing; Zhang Baozhen; Li Qiang; Shen Lin; Zhang Lian; Shen Jing; Liu Zhuoqi; You Wei-Cheng; Deng Dajun


    Abstract Background A2143G mutation of 23S rRNA gene of H. pylori results in clarithromycin (CLR) resistance. To investigate the prevalence of the CLR resistance-related A2143G mutation of the H. pylori-specific 23S rRNA gene in Chinese subjects with and without CLR use history, 307 subjects received the treatment with amoxicillin and omeprazole (OA) and 310 subjects received a placebo in 1995, and 153 subjects received a triple therapy with OA and CLR (OAC) in 2000. DNA was extracted from fa...

  13. Estimation of Pig Fecal Contamination in a River Catchment by Real-Time PCR Using Two Pig-Specific Bacteroidales 16S rRNA Genetic Markers▿

    Mieszkin, Sophie; Furet, Jean-Pierre; Corthier, Gérard; Gourmelon, Michèle


    The microbiological quality of coastal or river water can be affected by fecal contamination from human or animal sources. To discriminate pig fecal pollution from other pollution, a library-independent microbial source tracking method targeting Bacteroidales host-specific 16S rRNA gene markers by real-time PCR was designed. Two pig-specific Bacteroidales markers (Pig-1-Bac and Pig-2-Bac) were designed using 16S rRNA gene Bacteroidales clone libraries from pig feces and slurry. For these two ...

  14. 弛豫与关联效应对NII离子2s22p3s3P1-2s22p2 1D2与2s22p3s 1P1-2s22p2 3P0,1,2自旋禁戒跃迁概率的影响%Influence of relaxation and correlation effects on probabilities of the 2s22p3s 3P1-2s22p2 1D2 and 2s22p3s 1P1-2s22p2 3P0,1,2 intercombination transitions in NII

    袁萍; 刘欣生; 张义军; 颉录有; 董晨钟


    用多组态Dirac-Fock方法,并系统考虑相对论效应、电子关联、弛豫效应等重要贡献,计算了NII离子2s22p3s 3P1-2s22p2 1D2和2s22p3s 1P1-2s22p2 3P0,1,2自旋禁戒跃迁概率和振子强度.通过比较计算证实:弛豫和关联效应对禁戒跃迁概率的影响非常大,考虑了这些效应后,计算结果有显著的改善.由跃迁概率和振子强度的计算值推断,2s22p3s 3P1-2s22p2 1D2的谱线强度应该比原有的理论预言值小.

  15. Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

    Wolff Sönksen, Ute; Christensen, Jens Jørgen; Nielsen, Lisbeth;


    Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic...

  16. True microbiota involved in chronic lung infection of cystic fibrosis patients found by culturing and 16S rRNA gene analysis

    Rudkjøbing, Vibeke Børsholt; Thomsen, Trine R; Alhede, Morten; Kragh, Kasper N; Nielsen, Per H; Johansen, Ulla; Givskov, Michael; Høiby, Niels; Bjarnsholt, Thomas


    Patients suffering from cystic fibrosis (CF) develop chronic lung infection. In this study, we investigated the microorganisms present in transplanted CF lungs (n = 5) by standard culturing and 16S rRNA gene analysis. A correspondence between culturing and the molecular methods was observed. In c...

  17. Macrolide-ketolide inhibition of MLS-resistant ribosomes is improved by alternative drug interaction with domain II of 23S rRNA

    Douthwaite, S; Hansen, L H; Mauvais, P


    The macrolide antibiotic erythromycin and its 6-O-methyl derivative (clarithromycin) bind to bacterial ribosomes primarily through interactions with nucleotides in domains II and V of 23S rRNA. The domain II interaction occurs between nucleotide A752 and the macrolide 3-cladinose moiety. Removal ...

  18. [Transport of newly synthesized rRNA from the nucleus to the cytoplasm in freely suspended cells of parsley (Petroselinum sativum)].

    Seitz, U; Seitz, U


    A rapidly labelled rRNA precursor can be detected in callus cells of Petroselinum sativum grown on a liquid synthetic medium. Its molecular weight has been calculated to be 2.3×10(6). This value agrees with that of the rRNA precursor from other plant material. In order to follow the synthesis and processing of rRNA in time and to correlate single steps in this process with cell organelles it was necessary to obtain pure fractions of nuclei and ribosomes. The isolation method for nuclei is given in detail. The nucleic acids are separated on polyacrylamide gels of low acrylamide concentration. Pulse-chase experiments show that the rRNA precursor is split into two fragments within the nucleus: an 18S and a 25S component. The 18S RNA leaves the nucleus rapidly. It is already found quantitatively in the ribosomal fraction after 30-60 min chase. At that time the 25S RNA is still within the nucleus; it appears much later in the ribosomes. Since the increase in ribosomal label occurs simultaneously with the decrease in nuclear label, it is concluded that there is no degradation of 18S RNA within the nucleus. Apparently there are two distinct transport mechanisms with different kinetics for the two RNA components. PMID:24477955

  19. Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

    Dam, M; Douthwaite, S; Tenson, T;


    Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247....... This is close to a short open reading frame in the 23 S rRNA that encodes a pentapeptide (E-peptide) whose expression in vivo renders cells resistant to erythromycin. Therefore, a possible mechanism of resistance caused by domain II mutations may be related to an increased expression of the E-peptide. To test...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore...

  20. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

    The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

  1. Simultaneous pyrosequencing of the 16S rRNA, IncP-1 trfA, and merA genes

    Holmsgaard, Peter N.; Sørensen, Søren J.; Hansen, Lars Hestbjerg


    The use of amplicon pyrosequencing makes it possible to produce thousands of sequences of the same gene at relatively low costs. Here we show that it is possible to simultaneously sequence the 16S rRNA gene, IncP-1 trfA gene and mercury reductase gene (merA) as a way for screening the diversity of...

  2. A single mutation in the 15S rRNA gene confers nonsense suppressor activity and interacts with mRF1 the release factor in yeast mitochondria

    Ali Gargouri


    Full Text Available We have determined the nucleotide sequence of the mim3-1 mitochondrial ribosomal suppressor, acting on ochre mitochondrial mutations and one frameshift mutation in Saccharomyces cerevisiae. The 15s rRNA suppressor gene contains a G633 to C transversion. Yeast mitochondrial G633 corresponds to G517 of the E.coli 15S rRNA, which is occupied by an invariant G in all known small rRNA sequences. Interestingly, this mutation has occurred at the same position as the known MSU1 mitochondrial suppressor which changes G633 to A. The suppressor mutation lies in a highly conserved region of the rRNA, known in E.coli as the 530-loop, interacting with the S4, S5 and S12 ribosomal proteins. We also show an interesting interaction between the mitochondrial mim3-1 and the nuclear nam3-1 suppressors, both of which have the same action spectrum on mitochondrial mutations: nam3-1 abolishes the suppressor effect when present with mim3-1 in the same haploid cell. We discuss these results in the light of the nature of Nam3, identified by [1] as the yeast mitochondrial translation release factor. A hypothetical mechanism of suppression by "ribosome shifting" is also discussed in view of the nature of mutations suppressed and not suppressed.

  3. Deletion analysis of the expression of rRNA genes and associated tRNA genes carried by a lambda transducing bacteriophage

    Transducing phage lambda ilv5 carries genes for rRNA's, spacer tRNA's (tRNA1/sup Ile/ and tRNA/sub 1B//sup Ala/), and two other tRNA's (tRNA1/sup Asp/ and tRNA/sup Trp/). We have isolated a mutant of lambda ilv5, lambda ilv5su7, which carries an amber suppressor mutation in the tRNA/sup Trp/ gene. A series of deletion mutants were isolated from the lambda ilv5su7 phage. Genetic and biochemical analyses of these deletion mutants have confirmed our previous conclusion that the genes for tRNA1/sup Asp/ and tRNA/sup Trp/ located at the distal end of the rRNA operon (rrnC) are cotranscribed with other rRNA genes in that operon. In addition, these deletions were used to define roughly the physical location of the promoter(s) of the rRNA operon carried by the lambda ilv5su7 transducing phage

  4. High Prevalence of Metallo-β-Lactamase and 16S rRNA Methylase Coproduction among Imipenem-Resistant Pseudomonas aeruginosa Isolates in Brazil▿

    Doi, Yohei; Ghilardi, Angela C. R.; Adams, Jennifer; de Oliveira Garcia, Doroti; Paterson, David L.


    Rates of metallo-β-lactamase and 16S rRNA methylase production were investigated in 51 imipenem-resistant Pseudomonas aeruginosa clinical isolates collected from hospitals in São Paulo, Brazil. Of them, 57% and 75% produced SPM-1 and RmtD, respectively. Of note, 51% produced both enzymes, suggesting that their coproduction is already common in this geographic area.

  5. Identification of Bacterial Species Associated with the Sheep Scab Mite (Psoroptes ovis) by Using Amplified Genes Coding for 16S rRNA

    Hogg, J.C.; Lehane, M. J.


    This was the first molecular study of the bacterial flora of the sheep scab mite (Psoroptes ovis). A sequence analysis of genes coding for 16S rRNA revealed that Serratia marcescens and bacteria closely related to Staphylococcus intermedius or Staphylococcus chromogens and Alloiococcus otitidis were present. These bacteria were associated with skin lesions, dermatitis, and otitis media caused by P. ovis.

  6. Comparison of Gull Feces-specific Assays Targeting the 16S rRNA Gene of Catellicoccus Marimammalium and Streptococcus spp.

    Two novel gull-specific qPCR assays were developed using 16S rRNA gene sequences from gull fecal clone libraries: a SYBR-green-based assay targeting Streptococcus spp. (i.e., gull3) and a TaqMan qPCR assay targeting Catellicoccus marimammalium (i.e., gull4). The main objectives ...

  7. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    Karminska, K. H.; Purta, E.; Hansen, L .H.; Bujnicki, J. M.; Vester, B.; Long, Katherine


    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...

  8. Acquired macrolide resistance in the human intestinal strain Lactobacillus rhamnosus E41 associated with a transition mutation in 23S rRNA genes

    Flórez García, Ana Belén; Ladero Losada, Víctor Manuel; Álvarez Martín, Pablo; Ammor, Mohammed Salim; Álvarez González, Miguel Ángel; Mayo Pérez, Baltasar


    Restriction fragment length polymorphism and DNA sequencing of polymerase chain reaction (PCR) products showed that a Lactobacillus rhamnosus strain of human origin resistant to macrolides, from which no resistance determinants have been detected by specific PCR and microarray screening, contained a heterozygous A → G transition mutation at position 2058 (Escherichia coli numbering) of its 23S rRNA genes.

  9. Evolutionary relationships of Spirurina (Nematoda: Chromadorea: Rhabditida) with special emphasis on dracunculoid nematodes inferred from SSU rRNA gene sequences

    Wijová, Martina; Moravec, František; Horák, Aleš; Lukeš, Julius


    Roč. 36, č. 9 (2006), s. 1067-1075. ISSN 0020-7519 R&D Projects: GA ČR(CZ) GA524/06/0170 Institutional research plan: CEZ:AV0Z60220518 Keywords : Nematoda * Spirurina * SSU rRNA gene sequences Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 3.337, year: 2006

  10. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing

    Mehetre, Gajanan T.; Paranjpe, Aditi; Dastager, Syed G.; Dharne, Mahesh S.


    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche.

  11. Profiling of 2'-O-Me in human rRNA reveals a subset of fractionally modified positions and provides evidence for ribosome heterogeneity

    Krogh, Nicolai; Jansson, Martin D; Häfner, Sophia J; Tehler, Disa; Birkedal, Ulf; Christensen-Dalsgaard, Mikkel; Lund, Anders H; Nielsen, Henrik


    the level of RNA modifications. A comparison to HCT116 cells reveals similar 2'-O-Me profiles with distinct differences at several sites. This study constitutes the first comprehensive mapping of 2'-O-Me sites in human rRNA using a high throughput sequencing approach. It establishes the existence of a...

  12. Prevalence of 16S rRNA methylase, modifying enzyme, and extended-spectrum beta-lactamase genes among Acinetobacter baumannii isolates.

    Liu, Zhenru; Ling, Baodong; Zhou, Liming


    Multidrug-resistant Acinetobacter baumannii has become a worldwide problem, and methylation of 16S rRNA has recently emerged as a new mechanism of resistance to aminoglycosides, which is mediated by a newly recognized group of 16S rRNA methylases. 16S rRNA methylase confers a high-level resistance to all 4,6-substituted deoxystreptamine aminoglycosides that are currently used in clinical practice. Some of the A. baumannii isolates have been found to coproduce extended-spectrum beta-lactamases (ESBLs), contributing to their multidrug resistance. The aim of this study was to detect the determinants of the 16S rRNA methylase genes armA, rmtA, rmtB, rmtC, rmtD, rmtE, and npmA, the modifying enzyme genes aac(6')-Ib, ant(3″)-Ia, aph(3')-I, and the extended-spectrum beta-lactamase genes bla(TEM), bla(SHV), and bla(CTX-M-3) among A. baumannii isolates in northeastern Sichuan, China. Minimum inhibitory concentrations (MICs) of 21 different antimicrobial agents against the A. baumannii isolates were determined. The clinical isolates showed a high level of resistance (MIC≧256 μg/ml) to aminoglycosides, which ranged from 50·1 to 83·8%. The resistances to meropenem and imipenem, two of the beta-lactam antibiotics and the most active antibiotics against A. baumannii, were 9·1 and 8·2%, respectively. Among 60 amikacin-resistant isolates, only the 16S rRNA methylase gene armA was found to be prevalent (66·7%), but the other 16S rRNA methylase genes rmtA, rmtB, rmtC, rmtD, rmtE, and npmA were not detected. The prevalences of the modifying enzyme genes aac (6')-Ib, ant (3″)-Ia, and aph (3')-I were 51·7, 81·7, and 58·3%, respectively, which are different from a previous study in which the occurrences of these genes were 3, 64, and 72%, respectively. Among the 40 isolates that were armA-positive, the prevalences of bla(TEM), bla(SHV), and bla(CTX-M-3) genes were detected for the first time in China, and their occurrences were 45, 65, and 52·5%, respectively. In all, A

  13. Discrimination of bacillus anthracis and closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microarray.

    Bavykin, S. G.; Mikhailovich, V. M.; Zakharyev, V. M.; Lysov, Y. P.; Kelly, J. J.; Alferov, O. S.; Jackman, J.; Stahl, D. A.; Mirzabekov, A. D.; Gavin, I. M.; Kukhtin, A. V.; Chandler, D. (Biochip Technology Center); (Engelhardt Inst. of Molecular Biology); (Northwestern Univ.); (Georgetown Univ.)


    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 min. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead reflect

  14. Methanosarcina acetivorans 16S rRNA and transcription factor nucleotide fluctuation with implications in exobiology and pathology

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Marchese, P.; Hiciano, O.; Yao, H.; Lieberman, D.; Cheung, T.


    Cultures of the methane-producing archaea Methanosarcina, have recently been isolated from Alaskan sediments. It has been proposed that methanogens are strong candidates for exobiological life in extreme conditions. The spatial environmental gradients, such as those associated with the polygons on Mars' surface, could have been produced by past methanogenesis activity. The 16S rRNA gene has been used routinely to classify phenotypes. Using the fractal dimension of nucleotide fluctuation, a comparative study of the 16S rRNA nucleotide fluctuation in Methanosarcina acetivorans C2A, Deinococcus radiodurans, and E. coli was conducted. The results suggest that Methanosarcina acetivorans has the lowest fractal dimension, consistent with its ancestral position in evolution. Variation in fluctuation complexity was also detected in the transcription factors. The transcription factor B (TFB) was found to have a higher fractal dimension as compared to transcription factor E (TFE), consistent with the fact that a single TFB in Methanosarcina acetivorans can code three different TATA box proteins. The average nucleotide pair-wise free energy of the DNA repair genes was found to be highest for Methanosarcina acetivorans, suggesting a relatively weak bonding, which is consistent with its low prevalence in pathology. Multitasking capacity comparison of type-I and type-II topoisomerases has been shown to correlate with fractal dimension using the methicillin-resistant strain MRSA 252. The analysis suggests that gene adaptation in a changing chemical environment can be measured in terms of bioinformatics. Given that the radiation resistant Deinococcus radiodurans is a strong candidate for an extraterrestrial origin and that the cold temperature Psychrobacter cryohalolentis K5 can function in Siberian permafrost, the fractal dimension comparison in this study suggests that a chemical resistant methanogen could exist in extremely cold conditions (such as that which existed on early

  15. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S


    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

  16. Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene.

    Yuan, Youhua; Wen, Yan; You, Yuangang; Xing, Yan; Li, Huanying; Weng, Xiaoman; Wu, Nan; Liu, Shuang; Zhang, Shanshan; Zhang, Wenhong; Zhang, Ying


    Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP) analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China. PMID:26196543

  17. Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene.

    Youhua Yuan

    Full Text Available Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China.

  18. Combined analyses of the ITS loci and the corresponding 16S rRNA genes reveal high micro- and macrodiversity of SAR11 populations in the Red Sea.

    David Kamanda Ngugi

    Full Text Available Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24 °C throughout the year, and a remarkable uniform temperature (~22 °C and salinity (~41 psu from the mixed layer (~200 m to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS region of SAR11 in different depths of the Red Sea's water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen on the population dynamics of this ubiquitous marine bacterium.

  19. Combined analyses of the ITS loci and the corresponding 16S rRNA genes reveal high micro- and macrodiversity of SAR11 populations in the Red Sea.

    Ngugi, David Kamanda


    Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24 °C throughout the year, and a remarkable uniform temperature (~22 °C) and salinity (~41 psu) from the mixed layer (~200 m) to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS) region of SAR11 in different depths of the Red Sea\\'s water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen) on the population dynamics of this ubiquitous marine bacterium.

  20. Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth

    Stern David B


    Full Text Available Abstract Background The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. Results AS5-overexpressing (AS5ox plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Conclusions Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

  1. Distribution of 16S rRNA methylases among different species of Gram-negative bacilli with high-level resistance to aminoglycosides.

    Zhou, Y; Yu, H; Guo, Q; Xu, X; Ye, X; Wu, S; Guo, Y; Wang, M


    16S rRNA methylases confer high-level resistance to most aminoglycosides in Gram-negative bacteria. Seven 16S rRNA methylase genes, armA, rmtA, rmtB, rmtC, rmtD, rmtE and npmA, have been identified since 2003. We studied the distribution of methylase genes in more than 200 aminoglycoside-resistant Gram-negative clinical isolates collected in 2007 at our hospital in Shanghai, China. 16S rRNA methylase genes were amplified by polymerase chain reaction (PCR) among 217 consecutive clinical isolates of Gram-negative bacilli resistant to gentamicin and amikacin by a disk diffusion method. 16S rRNA methylase genes were present in 97.5% (193/198) of clinical isolates highly resistant to amikacin (≥512 μg/ml), with armA and rmtB detected in 67.2 and 30.3% of strains, respectively, while no 16S rRNA methylase genes were detected in 19 strains with amikacin minimum inhibitory concentration (MIC) ≤256 μg/ml. armA or rmtB genes were detected in 100% of 104 strains of Enterobacteriaceae, and these two genes were equally represented (49 vs. 55 strains). Genes for armA or rmtB were detected in 94.7% (89/94) of Acinetobacter baumannii and Pseudomonas aeruginosa strains, and armA was predominant (84 vs. 5 strains with rmtB). No rmtA, rmtC, rmtD or npmA genes were found. Enterobacterial repetitive intergenic consensus sequence (ERIC-PCR) indicated that armA and rmtB genes were spread by both horizontal transfer and clonal dissemination. PMID:20614151

  2. Community analysis of chronic wound bacteria using 16S rRNA gene-based pyrosequencing: impact of diabetes and antibiotics on chronic wound microbiota.

    Lance B Price

    Full Text Available BACKGROUND: Bacterial colonization is hypothesized to play a pathogenic role in the non-healing state of chronic wounds. We characterized wound bacteria from a cohort of chronic wound patients using a 16S rRNA gene-based pyrosequencing approach and assessed the impact of diabetes and antibiotics on chronic wound microbiota. METHODOLOGY/PRINCIPAL FINDINGS: We prospectively enrolled 24 patients at a referral wound center in Baltimore, MD; sampled patients' wounds by curette; cultured samples under aerobic and anaerobic conditions; and pyrosequenced the 16S rRNA V3 hypervariable region. The 16S rRNA gene-based analyses revealed an average of 10 different bacterial families in wounds--approximately 4 times more than estimated by culture-based analyses. Fastidious anaerobic bacteria belonging to the Clostridiales family XI were among the most prevalent bacteria identified exclusively by 16S rRNA gene-based analyses. Community-scale analyses showed that wound microbiota from antibiotic treated patients were significantly different from untreated patients (p = 0.007 and were characterized by increased Pseudomonadaceae abundance. These analyses also revealed that antibiotic use was associated with decreased Streptococcaceae among diabetics and that Streptococcaceae was more abundant among diabetics as compared to non-diabetics. CONCLUSIONS/SIGNIFICANCE: The 16S rRNA gene-based analyses revealed complex bacterial communities including anaerobic bacteria that may play causative roles in the non-healing state of some chronic wounds. Our data suggest that antimicrobial therapy alters community structure--reducing some bacteria while selecting for others.

  3. Pseudomonas sp. strain CA5 (a selenite-reducing bacterium) 16S rRNA gene complete sequence. National Institute of Health, National Center for Biotechnology Information, GenBank sequence. Accession FJ422810.1.

    This study used 1321 base pair 16S rRNA gene sequence methods to confirm the phylogenetic position of a soil isolate as a bacterium belonging to the genus Pesudomonas sp. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification...

  4. Establishment of a continuous culture system for Entamoeba muris and analysis of the small subunit rRNA gene

    Kobayashi S.


    Full Text Available We established a culture system for Entamoeba muris (MG-EM-01 strain isolated from a Mongolian gerbil using a modified Balamuth’s egg yolk infusion medium supplemented with 4% adult bovine serum and Bacteroides fragilis cocultured with Escherichia coli. Further, encystation was observed in the culture medium. The morphological characteristics of E. muris are similar to those of Entamoeba coli (E. coli; moreover, the malic isoenzyme electrophoretic band, which shows species-specific electrophoretic mobility, of E. muris had almost the same mobility as that observed with the malic isoenzyme electrophorectic band of E. coli (UZG-EC-01 strain isolated from a gorilla. We determined the small subunit rRNA (SSU-rRNA gene sequence of the MG-EM-01 strain, and this sequence was observed to show 82.7% homology with that of the UZG-EC-01 strain. Further, the resultant phylogenetic tree for molecular taxonomy based on the SSU-rRNA genes of the 21 strains of the intestinal parasitic amoeba species indicated that the MG-EM-01 strain was most closely related to E. coli.

  5. First microbiota assessments of children's paddling pool waters evaluated using 16S rRNA gene-based metagenome analysis.

    Sawabe, Toko; Suda, Wataru; Ohshima, Kenshiro; Hattori, Masahira; Sawabe, Tomoo


    Insufficient chloric sterilization of children's paddling pool waters increases the risk of diarrheal illness. Therefore, we investigated the microbiota changes after children use pools. First, we applied 16S rRNA gene-based metagenome analysis to understand the dynamics of microbiota in pool water, especially with respect to the bio-contamination by potential pathogens. Proteobacteria were major taxa detected in every pool water sample after children spent time in the pool. In more detail, Gammaproteobacteria comprised the dominant class, which was followed by Betaproteobacteria. Five phyla, Bacteroidetes, Firmicutes, Actinobacteria and Deinococcus-Thermus phyla were minor groups. The pool water microbiota are likely to be a consortium of intestinal and skin microbiota from humans. Interestingly, the ratio of Gammaproteobacteria and Betaproteobacteria differed according to the age of the children who used the pool, which means the pool water was additionally contaminated by soil microbiota as a result of the children's behavior. Furthermore, potential pathogens, such as Campylobacter spp., Comamonas testosteroni and Burkholderia pseudomallei, were also found. Considering the standard plate counts, the abundances of these human pathogens are unlikely to be a sufficiently infectious dose. We suggest the importance of sanitary measures in paddling pool waters to reduce bio-contamination from both humans and the environment. PMID:26671497

  6. 116S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads

    Sima eTokajian


    Full Text Available Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 to 849 bp, while their G+C content was 42.2 mol% to 57.9 mol%. Five distinct ITS types were identified: ITSnone (without tRNA genes, ITSAla(TGC, ITSAla (TGC+Ile (GAT, ITSIle (GAT+Ala (TGC and ITS Ile (GAT+Pseudo. All of the identified tRNAAla (TGC molecules consisted of 73 bases, and all of the tRNAIle (GAT molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2.

  7. Identification of bovine Neospora parasites by PCR amplification and specific small-subunit rRNA sequence probe hybridization.

    Ho, M S; Barr, B C; Marsh, A E; Anderson, M L; Rowe, J D; Tarantal, A F; Hendrickx, A G; Sverlow, K; Dubey, J P; Conrad, P A


    Neospora is a newly recognized genus of pathogenic coccidia, closely related to Toxoplasma gondii, that can cause abortion or congenital disease in a variety of domestic animal hosts. On the basis of the small-subunit rRNA gene sequences of Neospora spp. and other apicomplexa coccidia, oligonucleotide primers COC-1 and COC-2 were used for PCR amplification of conserved sequences of approximately 300 bp in size. A Neospora-specific chemiluminescent probe hybridized to Southern blots of amplification products from Neospora DNA but not to Southern blots with amplified DNA from the other coccidian parasites tested. A Toxoplasma-specific probe whose sequence differed from that of the probe for Neospora spp. by a single base pair was used to distinguish these parasites by specific Southern blot hybridization. The PCR system detected as few as one Neospora tachyzoite in the culture medium or five tachyzoites in samples of whole blood or amniotic fluid spiked with Neospora parasites. In addition, Neospora PCR products were successfully amplified from whole blood and amniotic fluid samples of experimentally infected bovine and rhesus macaque fetuses. These results indicate that this PCR and probe hybridization system could be a valuable adjunct to serology and immunohistochemistry for the diagnosis of Neospora infections in bovine or primate fetuses. PMID:8727903

  8. Sequencing of 16S rRNA reveals a distinct salivary microbiome signature in Behçet's disease.

    Coit, Patrick; Mumcu, Gonca; Ture-Ozdemir, Filiz; Unal, Ali Ugur; Alpar, Ugur; Bostanci, Nagihan; Ergun, Tulin; Direskeneli, Haner; Sawalha, Amr H


    Behçet's disease (BD) is characterized by recurrent oro-genital ulcers, mucocutaneous lesions, and serious organ involvement. We investigated the salivary microbiome in BD using high-throughput sequencing of the 16S rRNA V4 region. Stimulated saliva samples were collected from 31 BD patients and 15 healthy controls, and in 9 BD patients, a second saliva sample was collected following dental and periodontal treatment. Sequence analysis identified a total of 908 operational taxonomic units (OTUs) present across all samples. Patients had a microbial community structure that is significantly less diverse than healthy controls. The most overabundant species in BD was Haemophilus parainfluenzae, while the most depleted included Alloprevotella rava and species in the genus Leptotrichia. Periodontal treatment improved oral health indices in BD but had no short-term effect on bacterial community structure. Neither the BD-associated genetic risk locus within the HLA-B/MICA region nor being on immunosuppressive medications explained the differences between patients and controls. PMID:27283393

  9. Comparison of Bacteroides-Prevotella 16S rRNA genetic markers for fecal samples from different animal species

    Fogarty, L.R.; Voytek, M.A.


    To effectively manage surface and ground waters it is necessary to improve our ability to detect and identify sources of fecal contamination. We evaluated the use of the anaerobic bacterial group Bacteroides-Prevotella as a potential fecal indicator. Terminal restriction length polymorphism (T-RFLP) of the 16S rRNA genes from this group was used to determine differences in populations and to identify any unique populations in chickens, cows, deer, dogs, geese, horses, humans, pigs, and seagulls. The group appears to be a good potential fecal indicator in all groups tested except for avians. Cluster analysis of Bacteroides-Prevotella community T-RFLP profiles indicates that Bacteroides-Prevotella populations from samples of the same host species are much more similar to each other than to samples from different source species. We were unable to identify unique peaks that were exclusive to any source species; however, for most host species, at least one T-RFLP peak was identified to be more commonly found in that species, and a combination of peaks could be used to identify the source. T-RFLP profiles obtained from water spiked with known-source feces contained the expected diagnostic peaks from the source. These results indicate that the approach of identifying Bacteroides-Prevotella molecular markers associated with host species might be useful in identifying sources of fecal contamination in the environment.

  10. Microbial succession in the traditional Chinese Luzhou-flavor liquor fermentation process as evaluated by SSU rRNA profiles.

    Xiang, Wenliang; Li, Ke; Liu, Seng; Xing, Yage; Li, Mingyuan; Che, Zhenming


    The community succession of microbes inhabited in the fermenting lees of Luzhou-flavor liquor was investigated based on small-subunit rRNA culture independent method. All sequences recovered from fermenting lees respectively fell into the genera of Lactobacillus, Streptococcus, Bacillus, Staphylococcus, Clostridium, Pelobacter, Actobacter, Serratia, Burkholderia, Rhodoccous, Corynebacterium, Arthrobacter, Microbacterium, Curtobacterium, Leptotrichia, Methanocuuleus, Saccharomyces, Zygosaccharomyces, Saccharomycopsis, Pichia, Talaromyces, Aspergillus, Eurotium, Fomitopsis and Trichosporon. The fungal Pichia, Saccharomycopsis and Talaromyces were most abundant in the lees fermented for 1 day, the fungal Eurotium and the bacteria Burkholderia, Streptococcus and Lactobacillus were dominant in the lees fermented for 7 days, only the bacteria Lactobacillus, Burkholderia were prevalent in the lees fermented for 60 days. Most genera almost existed in the fermenting lees, while their distributions were significantly different in 1, 7 and 60 days fermented lees. The prokaryotic community similarity coefficient was from 0.5000 to 0.5455 and followed to 0.1523, and that of eukaryotic community was from 0.5466 to 0.5259 and to 0.3750 when compared at species level. These results suggested that many microbes in lees have community successions associated with fermenting and that such successions maybe contribute the fermentation process of Luzhou-flavor liquor and is main reasons that the characteristic flavor factors are produced. PMID:23180546

  11. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes

    Mu Peng


    Full Text Available Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future.

  12. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes.

    Peng, Mu; Zi, Xiaoxue; Wang, Qiuyu


    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA) indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future. PMID:26404329

  13. Bacterial diversity assessment of pristine mangrove microbial community from Dhulibhashani, Sundarbans using 16S rRNA gene tag sequencing.

    Basak, Pijush; Pramanik, Arnab; Sengupta, Sohan; Nag, Sudip; Bhattacharyya, Anish; Roy, Debojyoti; Pattanayak, Rudradip; Ghosh, Abhrajyoti; Chattopadhyay, Dhrubajyoti; Bhattacharyya, Maitree


    The global knowledge of microbial diversity and function in Sundarbans ecosystem is still scarce, despite global advancement in understanding the microbial diversity. In the present study, we have analyzed the diversity and distribution of bacteria in the tropical mangrove sediments of Sundarbans using 16S rRNA gene amplicon sequencing. Metagenome is comprised of 1,53,926 sequences with 108.8 Mbp data and with 55 ± 2% G + C content. Metagenome sequence data are available at NCBI under the Bioproject database with accession no. PRJNA245459. Bacterial community metagenome sequences were analyzed by MG-RAST software representing the presence of 56,547 species belonging to 44 different phyla. The taxonomic analysis revealed the dominance of phyla Proteobacteria within our dataset. Further taxonomic analysis revealed abundance of Bacteroidetes, Acidobactreia, Firmicutes, Actinobacteria, Nitrospirae, Cyanobacteria, Planctomycetes and Fusobacteria group as the predominant bacterial assemblages in this largely pristine mangrove habitat. The distribution of different community datasets obtained from four sediment samples originated from one sampling station at two different depths providing better understanding of the sediment bacterial diversity and its relationship to the ecosystem dynamics of this pristine mangrove sediment of Dhulibhashani in, Sundarbans. PMID:26981367

  14. Phylogenetic relationships of Chilean leptodactylids: a molecular approach based on mitochondrial genes 12S and 16S Relaciones filogenéticas de los leptodactílidos chilenos: una aproximación molecular basada en los genes mitocondriales 12S y 16S



    Full Text Available Most Chilean amphibians belong to the subfamily Telmatobiinae (Anura, Leptodactylidae. Several phylogenetic studies of Leptodactylidae and Telmatobiinae, based principally on morphological characters, have implicitly suggested closer relationships of some species of the Telmatobiinae with members of other subfamilies of leptodactylids, including the leptodactyline genus Pleurodema which is present in Chile. Furthermore, a growing number of molecular studies suggest a non monophyletic status for Telmatobiinae, although none of these studies have investigated the phylogenetic relationships of this subfamily. We compared partial sequences of the ribosomal mitochondrial genes 12S and 16S to determine the phylogenetic relationships of Chilean leptodactylids and its position within the modern anurans (Neobatrachia. We included 22 species from nine of the 10 genera of telmatobiines present in Chile (Alsodes, Atelognathus, Batrachyla, Caudiverbera, Eupsophus, Hylorina, Insuetophrynus, Telmatobufo and Telmatobius, two species of the genus Pleurodema, and one species of Rhinodermatidae, which is considered a leptodactylid derivative family by some authors. We also included 51 species representing most of the families that compose Neobatrachia. Phylogenetic reconstructions were performed using the methods of maximum parsimony, maximum likelihood and Bayesian inference. The topologies obtained in all the analyses indicate that Telmatobiinae is a polyphyletic assemblage, composed by species belonging to Hyloidea (most of the genera and species more related to Australasian taxa (the clade Caudiverbera + Telmatobufo, defined as the tribe Calyptocephalellini. These molecular data support groups based on other kinds of evidence (Caudiverbera + Telmatobufo, Alsodes + Eupsophus and Batrachyla + Hylorina and raise new phylogenetic hypotheses for several genera of telmatobiines (Atelognathus with Batrachyla and Hylorina, Insuetophrynus + Rhinoderma. The phylogenetic

  15. Prevalence of A2143G mutation of H. pylori-23S rRNA in Chinese subjects with and without clarithromycin use history

    Ma Junling


    Full Text Available Abstract Background A2143G mutation of 23S rRNA gene of H. pylori results in clarithromycin (CLR resistance. To investigate the prevalence of the CLR resistance-related A2143G mutation of the H. pylori-specific 23S rRNA gene in Chinese subjects with and without CLR use history, 307 subjects received the treatment with amoxicillin and omeprazole (OA and 310 subjects received a placebo in 1995, and 153 subjects received a triple therapy with OA and CLR (OAC in 2000. DNA was extracted from fasting gastric juice at the end of the intervention trial in 2003. H. pylori infection was determined by H. pylori-specific 23S rRNA PCR, ELISA, and13C-urea breath test assays. Mutations of the 23S rRNA gene were detected by RFLP assays. Results The presence of 23S rRNA due to H. pylori infection in the OA group remained lower than that in the placebo group 7.3 yrs after OA-therapy [51.1% (157/307 vs. 83.9% (260/310, p = 0.0000]. In the OAC group, the 23S rRNA detection rate was 26.8% (41/153 three yrs after OAC-treatment. The A2143G mutation rate among the 23S rRNA-positive subjects in the OAC group [31.7% (13/41] was significantly higher than that in the OA group [10.2% (16/157] and the placebo group [13.8% (36/260]. The frequency of the AAGGG → CTTCA (2222–2226 and AACC → GAAG (2081–2084 sequence alterations in the OAC group was also significantly higher than those in the OA group and the placebo group. Conclusion Primary prevalence of the A2143G mutation was 10~14% among Chinese population without history of CLR therapy. Administration of CLR to eliminate H. pylori infection increased the prevalence of the A2143G mutation in Chinese subjects (32% significantly.

  16. 23S rRNA nucleotides in the peptidyl transferase center are essential for tryptophanase operon induction.

    Yang, Rui; Cruz-Vera, Luis R; Yanofsky, Charles


    Distinct features of the ribosomal peptide exit tunnel are known to be essential for recognition of specific amino acids of a nascent peptidyl-tRNA. Thus, a tryptophan residue at position 12 of the peptidyl-tRNA TnaC-tRNA(Pro) leads to the creation of a free tryptophan binding site within the ribosome at which bound tryptophan inhibits normal ribosome functions. The ribosomal processes that are inhibited are hydrolysis of TnaC-tRNA(Pro) by release factor 2 and peptidyl transfer of TnaC of TnaC-tRNA(Pro) to puromycin. These events are normally performed in the ribosomal peptidyl transferase center. In the present study, changes of 23S rRNA nucleotides in the 2585 region of the peptidyl transferase center, G2583A and U2584C, were observed to reduce maximum induction of tna operon expression by tryptophan in vivo without affecting the concentration of tryptophan necessary to obtain 50% induction. The growth rate of strains with ribosomes with either of these changes was not altered appreciably. In vitro analyses with mutant ribosomes with these changes showed that tryptophan was not as efficient in protecting TnaC-tRNA(Pro) from puromycin action as wild-type ribosomes. However, added tryptophan did prevent sparsomycin action as it normally does with wild-type ribosomes. These findings suggest that these two mutational changes act by reducing the ability of ribosome-bound tryptophan to inhibit peptidyl transferase activity rather than by reducing the ability of the ribosome to bind tryptophan. Thus, the present study identifies specific nucleotides within the ribosomal peptidyl transferase center that appear to be essential for effective tryptophan induction of tna operon expression. PMID:19329641

  17. Combining flow cytometry and 16S rRNA gene pyrosequencing: A promising approach for drinking water monitoring and characterization

    Prest, Emmanuelle I E C


    The combination of flow cytometry (FCM) and 16S rRNA gene pyrosequencing data was investigated for the purpose of monitoring and characterizing microbial changes in drinking water distribution systems. High frequency sampling (5min intervals for 1h) was performed at the outlet of a treatment plant and at one location in the full-scale distribution network. In total, 52 bulk water samples were analysed with FCM, pyrosequencing and conventional methods (adenosine-triphosphate, ATP; heterotrophic plate count, HPC). FCM and pyrosequencing results individually showed that changes in the microbial community occurred in the water distribution system, which was not detected with conventional monitoring. FCM data showed an increase in the total bacterial cell concentrations (from 345±15×103 to 425±35×103cellsmL-1) and in the percentage of intact bacterial cells (from 39±3.5% to 53±4.4%) during water distribution. This shift was also observed in the FCM fluorescence fingerprints, which are characteristic of each water sample. A similar shift was detected in the microbial community composition as characterized with pyrosequencing, showing that FCM and genetic fingerprints are congruent. FCM and pyrosequencing data were subsequently combined for the calculation of cell concentration changes for each bacterial phylum. The results revealed an increase in cell concentrations of specific bacterial phyla (e.g., Proteobacteria), along with a decrease in other phyla (e.g., Actinobacteria), which could not be concluded from the two methods individually. The combination of FCM and pyrosequencing methods is a promising approach for future drinking water quality monitoring and for advanced studies on drinking water distribution pipeline ecology. © 2014 Elsevier Ltd.

  18. What does the 5S rRNA multigene family tell us about the origin of the annual Triticeae (Poaceae)?

    Baum, B R; Edwards, T; Johnson, D A


    We have investigated the complex relationships among the annual genera within the tribe Triticeae through phylogenetic analyses of the 5S rRNA multigene family. Cloned sequences were assigned to groups of orthologous sequences, called unit classes, that were subjected to several analyses including BLAST (Basic Local Alignment Search Tool) searches to assess possible ancestral relationships with perennial genera; phylogenetic analyses using parsimony (Pars), maximum likelihood (ML), and Bayesian methods; and minimum reticulation networks from the Pars, ML, and Bayesian trees. In this study, we included genera with both annual and perennial species, such as Dasypyrum, Hordeum, and Secale. BLAST pointed to Pseudoroegneria (carrier of the St genome) and possibly Thinopyrum (carrier of the J genome) as the potential next of kin. However, Thinopyrum and Pseudoroegneria have never fallen together on the individual trees with the former generally associated with Crithopsis, Aegilops, Triticum, and Dasypyrum, while the latter is usually associated with the rest of the genera within Triticeae. The "long" unit classes placed Dasypyrum breviaristatum together with Dasypyrum villosum, whereas the "short" unit classes put them far apart on the trees. None of the gene trees alone was able to summarize the complex relationships among the genera, in line with previous results in the Triticeae. However, the application of tools designed to display phylogenetic networks was able to depict the complex links among the genera based on the short and the long gene trees, including the close link between Thinopyrum and Pseudoroegneria suggested by the phylogenetic analyses. In addition, our analyses provide support for the hypothesis that at least some annual Triticeae taxa are derived from their perennial relatives. PMID:23789993

  19. Culture dependent bacteria in commercial fishes: Qualitative assessment and molecular identification using 16S rRNA gene sequencing

    Alikunhi, Nabeel M.


    Fish contaminations have been extensively investigated in Saudi coasts, but studies pertaining to bacterial pathogens are meager. We conducted qualitative assessment and molecular identification of culture dependent bacteria in 13 fish species collected from three fishing sites and a local fish market in Jeddah, Saudi Arabia. The bacterial counts of gills, skin, gut and muscle were examined on agar plates of Macconkey’s (Mac), Eosin methylene blue (EMB) and Thiosulfate Citrate Bile Salts (TCBS) culture media. Bacterial counts exhibited interspecific, locational and behavioral differences. Mugil cephalus exhibited higher counts on TCBS (all body-parts), Mac (gills, muscle and gut) and EMB (gills and muscle). Samples of Area I were with higher counts, concurrent to seawater and sediment samples, revealing the influence of residing environment on fish contamination. Among feeding habits, detritivorous fish harbored higher bacterial counts, while carnivorous group accounted for lesser counts. Counts were higher in skin of fish obtained from market compared to field samples, revealing market as a major source of contamination. Bacterial counts of skin were positively correlated with other body-parts indicating influence of surface bacterial biota in overall quality of fish. Hence, hygienic practices and proper storage facilities in the Jeddah fish market is recommended to prevent adverse effect of food-borne illness in consumers. Rahnella aquatilis (Enterobacteriaceae) and Photobacterium damselae (Vibrionaceae) were among the dominant species identified from fish muscle samples using Sanger sequencing of 16S rRNA. This bacterial species are established human pathogens capable of causing foodborne illness with severe antibiotic resistance. Opportunistic pathogens such as Hafnia sp. (Enterobacteriaceae) and Pseudomonas stutzeri (Pseudomonadaceae) were also identified from fish muscle. These findings indicate bacterial contamination risk in commonly consumed fish of

  20. Uncultured bacterial diversity in a seawater recirculating aquaculture system revealed by 16S rRNA gene amplicon sequencing.

    Lee, Da-Eun; Lee, Jinhwan; Kim, Young-Mog; Myeong, Jeong-In; Kim, Kyoung-Ho


    Bacterial diversity in a seawater recirculating aquaculture system (RAS) was investigated using 16S rRNA amplicon sequencing to understand the roles of bacterial communities in the system. The RAS was operated at nine different combinations of temperature (15°C, 20°C, and 25°C) and salinity (20‰, 25‰, and 32.5‰). Samples were collected from five or six RAS tanks (biofilters) for each condition. Fifty samples were analyzed. Proteobacteria and Bacteroidetes were most common (sum of both phyla: 67.2% to 99.4%) and were inversely proportional to each other. Bacteria that were present at an average of ≥ 1% included Actinobacteria (2.9%) Planctomycetes (2.0%), Nitrospirae (1.5%), and Acidobacteria (1.0%); they were preferentially present in packed bed biofilters, mesh biofilters, and maturation biofilters. The three biofilters showed higher diversity than other RAS tanks (aerated biofilters, floating bed biofilters, and fish tanks) from phylum to operational taxonomic unit (OTU) level. Samples were clustered into several groups based on the bacterial communities. Major taxonomic groups related to family Rhodobacteraceae and Flavobacteriaceae were distributed widely in the samples. Several taxonomic groups like [Saprospiraceae], Cytophagaceae, Octadecabacter, and Marivita showed a cluster-oriented distribution. Phaeobacter and Sediminicola-related reads were detected frequently and abundantly at low temperature. Nitrifying bacteria were detected frequently and abundantly in the three biofilters. Phylogenetic analysis of the nitrifying bacteria showed several similar OTUs were observed widely through the biofilters. The diverse bacterial communities and the minor taxonomic groups, except for Proteobacteria and Bacteroidetes, seemed to play important roles and seemed necessary for nitrifying activity in the RAS, especially in packed bed biofilters, mesh biofilters, and maturation biofilters. PMID:27033205

  1. Bacterial community structure in High-Arctic snow and freshwater as revealed by pyrosequencing of 16S rRNA genes and cultivation

    Møller, Annette; Søborg, Ditte Andreasen; Al-Soud, Waleed Abu;


    controlled the distribution of the Cyanobacteria and algae in the snow while carbon and nitrogen fixed by these autotrophs in turn fed the heterotrophic bacteria. In the lake, a probable lower light input relative to snow resulted in low numbers of Cyanobacteria and chloroplasts and, hence, limited input......The bacterial community structures in High-Arctic snow over sea ice and an ice-covered freshwater lake were examined by pyrosequencing of 16S rRNA genes and 16S rRNA gene sequencing of cultivated isolates. Both the pyrosequence and cultivation data indicated that the phylogenetic composition...... of the microbial assemblages was different within the snow layers and between snow and freshwater. The highest diversity was seen in snow. In the middle and top snow layers, Proteobacteria, Bacteroidetes and Cyanobacteria dominated, although Actinobacteria and Firmicutes were relatively abundant also. High numbers...

  2. Application of 16S rRNA, cytochrome b and control region sequences for understanding the phylogenetic relationships in Oryx species.

    Khan, H A; Arif, I A; Al Homaidan, A A; Al Farhan, A H


    The present study reports the application of mitochondrial markers for the molecular phylogeny of Oryx species, including the Arabian oryx (AO), scimitar-horned oryx (SHO) and plains oryx (PO), using the Addax as an outgroup. Sequences of three molecular markers, 16S rRNA, cytochrome b and a control region, for the above four taxa were aligned and the topologies of respective phylogenetic trees were compared. All these markers clearly differentiated the genus Addax from Oryx. However, for species-level grouping, while 16S rRNA and cytochrome b produced similar phylogeny (SHO grouped with PO), the control region grouped SHO with AO. Further studies are warranted to generate more sequencing data, apply multiple bioinformatics tools and to include relevant nuclear markers for phylogenetic analysis of Oryx species. PMID:19224456

  3. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    Bavykin, Sergei G.; Mirzabekov, Andrei D.


    The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  4. Phylogeny and Taxonomy of Archaea: A Comparison of the Whole-Genome-Based CVTree Approach with 16S rRNA Sequence Analysis

    Guanghong Zuo


    Full Text Available A tripartite comparison of Archaea phylogeny and taxonomy at and above the rank order is reported: (1 the whole-genome-based and alignment-free CVTree using 179 genomes; (2 the 16S rRNA analysis exemplified by the All-Species Living Tree with 366 archaeal sequences; and (3 the Second Edition of Bergey’s Manual of Systematic Bacteriology complemented by some current literature. A high degree of agreement is reached at these ranks. From the newly proposed archaeal phyla, Korarchaeota, Thaumarchaeota, Nanoarchaeota and Aigarchaeota, to the recent suggestion to divide the class Halobacteria into three orders, all gain substantial support from CVTree. In addition, the CVTree helped to determine the taxonomic position of some newly sequenced genomes without proper lineage information. A few discrepancies between the CVTree and the 16S rRNA approaches call for further investigation.

  5. The mitochondrial 16 s rRNA reveals high anthropogenic influence on land snail diversity in a preliminary island survey.

    Abu-Bakar, Siti-Balkhis; Razali, Norhanis M; Naggs, Fred; Wade, Christopher; Mohd-Nor, Siti-Azizah; Aileen-Tan, Shau-Hwai


    A total of 30 specimens belonging to five species, namely; Cryptozona siamensis, Sarika resplendens and Sarika sp. from the family Ariophantidae as well as Quantula striata and Quantula sp. from the family Dyakiidae were collected from the Langkawi Island in Northern Peninsular Malaysia. All specimens were identified through comparisons of shell morphology and amplification of a 500 bp segment of the 16S rRNA mtDNA gene. To assess phylogenetic insights, the sequences were aligned using ClustalW and phylogenetic trees were constructed. The analyses showed two major lineages in both Maximum Parsimony and Neighbour Joining phylogenetic trees. Each putative taxonomic group formed a monophyletic cluster. Our study revealed low species and intraspecies genetic diversities based on the 16S rRNA gene sequences. Thus, this study has provided an insight of land snail diversity in populations of an island highly influenced by anthropogenic activities through complementary use of shell morphological and molecular data. PMID:24443224

  6. Phylogenetic relationships of some spirurine nematodes (Nematoda: Chromadorea: Rhabditida: Spirurina) parasitic in fishes inferred from SSU rRNA gene sequences

    Černotíková, Eva; Horák, Aleš; Moravec, František


    Roč. 58, č. 2 (2011), s. 135-148. ISSN 0015-5683 R&D Projects: GA ČR(CZ) GA524/06/0170; GA MŠk LC522 Institutional research plan: CEZ:AV0Z60220518 Keywords : Nematoda * Spirurina * SSU rRNA * phylogeny * taxonomy Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 1.812, year: 2011

  7. Identification of coagulase-negative staphylococci by using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and rRNA restriction patterns.

    Pennington, T H; Harker, C.; Thomson-Carter, F


    A total of 1,417 staphylococcal and micrococcal strains were collected from the beards and scalps of 10 subjects over a period of 8 months. Sixteen strains identified as Staphylococcus epidermidis with an API system had distinctive yellow colonies on nutrient agar plates and sodium dodecyl sulfate-polyacrylamide gel electrophoresis whole-cell polypeptide profiles similar to those of Staphylococcus capitis; this identification was confirmed by analysis of rRNA gene restriction patterns.

  8. Analysis of Diversity and Activity of Sulfate-Reducing Bacterial Communities in Sulfidogenic Bioreactors Using 16S rRNA and dsrB Genes as Molecular Markers▿

    Dar, Shabir A.; Yao, Li; van Dongen, Udo; Kuenen, J. Gijs; Muyzer, Gerard


    Here we describe the diversity and activity of sulfate-reducing bacteria (SRB) in sulfidogenic bioreactors by using the simultaneous analysis of PCR products obtained from DNA and RNA of the 16S rRNA and dissimilatory sulfite reductase (dsrAB) genes. We subsequently analyzed the amplified gene fragments by using denaturing gradient gel electrophoresis (DGGE). We observed fewer bands in the RNA-based DGGE profiles than in the DNA-based profiles, indicating marked differences in the populations...

  9. Sensitive PCR diagnosis of Infections by Enterocytozoon bieneusi (microsporidia) using primers based on the region coding for small-subunit rRNA.

    DA SILVA, A. J.; Schwartz, D A; Visvesvara, G S; De Moura, H; Slemenda, S B; Pieniazek, N J


    Enterocytozoon bieneusi is the most common microsporidian infecting patients with AIDS. We have developed a PCR primer pair, named EBIEF1/EBIER1, based on the small-subunit rRNA sequence of this microsporidian. Compared with other PCR-based methods, this primer pair shows a higher efficiency of detection in diagnostic applications than does another previously described primer pair, V1/EB450.

  10. 16S rRNA Gene Sequence-Based Identification of Bacteria in Automatically Incubated Blood Culture Materials from Tropical Sub-Saharan Africa.

    Hagen Frickmann

    Full Text Available The quality of microbiological diagnostic procedures depends on pre-analytic conditions. We compared the results of 16S rRNA gene PCR and sequencing from automatically incubated blood culture materials from tropical Ghana with the results of cultural growth after automated incubation.Real-time 16S rRNA gene PCR and subsequent sequencing were applied to 1500 retained blood culture samples of Ghanaian patients admitted to a hospital with an unknown febrile illness after enrichment by automated culture.Out of all 1500 samples, 191 were culture-positive and 98 isolates were considered etiologically relevant. Out of the 191 culture-positive samples, 16S rRNA gene PCR and sequencing led to concordant results in 65 cases at species level and an additional 62 cases at genus level. PCR was positive in further 360 out of 1309 culture-negative samples, sequencing results of which suggested etiologically relevant pathogen detections in 62 instances, detections of uncertain relevance in 50 instances, and DNA contamination due to sample preparation in 248 instances. In two instances, PCR failed to detect contaminants from the skin flora that were culturally detectable. Pre-analytical errors caused many Enterobacteriaceae to be missed by culture.Potentially correctable pre-analytical conditions and not the fastidious nature of the bacteria caused most of the discrepancies. Although 16S rRNA gene PCR and sequencing in addition to culture led to an increase in detections of presumably etiologically relevant blood culture pathogens, the application of this procedure to samples from the tropics was hampered by a high contamination rate. Careful interpretation of diagnostic results is required.

  11. Phylogenetic Relationships of the Marine Haplosclerida (Phylum Porifera) Employing Ribosomal (28S rRNA) and Mitochondrial (cox1, nad1) Gene Sequence Data

    Redmond, Niamh E.; Jean Raleigh; Van Soest, Rob W.M.; Michelle Kelly; Travers, Simon A A; Brian Bradshaw; Salla Vartia; Kelly M Stephens; McCormack, Grace P.


    The systematics of the poriferan Order Haplosclerida (Class Demospongiae) has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, ...

  12. Stable morphospecies within the 16S rRNA monophyletic genus .i.Microcystis./i. (KÜTZING) KÜTZING

    Komárková, Jaroslava; Mugnai, M. A.; Sili, C.; Komárek, Ondřej; Turicchia, S.

    -, č. 117 (2005), s. 279-295. ISSN 0342-1120. [Symposium of the International Association for Cyanophyte Research /16./. Luxembourg, 30.08.2004–03.09.2004] R&D Projects: GA AV ČR(CZ) IBS6017004 Grant ostatní: EU(XE) MIDI-CHIP EVK2-CT-1999-00026 Institutional research plan: CEZ:AV0Z60170517 Keywords : Microcystis * morhpospecies * 16S rRNA Subject RIV: EE - Microbiology, Virology

  13. 16S rRNA sequences of Bartonella bacilliformis and cat scratch disease bacillus reveal phylogenetic relationships with the alpha-2 subgroup of the class Proteobacteria.

    O'Connor, S P; Dorsch, M; Steigerwalt, A G; Brenner, D J; Stackebrandt, E


    The primary structures of 16S rRNAs of Bartonella bacilliformis, an isolate of the cat scratch disease (CSD) bacillus, and a strain phenotypically similar to the CSD bacillus were determined by reverse transcriptase sequencing. These microorganisms were found to be members of the alpha-2 subgroup of the class Proteobacteria. The sequence from B. bacilliformis was most closely related to the rRNA of Rochalimaea quintana (91.7% homology), the etiologic agent of trench fever. The sequence from t...

  14. 16S rRNA gene pyrosequencing of reference and clinical samples and investigation of the temperature stability of microbiome profiles

    Hang, Jun; Desai, Valmik; Zavaljevski, Nela; Yang, Yu; Lin, Xiaoxu; Satya, Ravi Vijaya; Martinez, Luis J.; Blaylock, Jason M.; Jarman, Richard G.; Thomas, Stephen J.; Kuschner, Robert A.


    Background Sample storage conditions, extraction methods, PCR primers, and parameters are major factors that affect metagenomics analysis based on microbial 16S rRNA gene sequencing. Most published studies were limited to the comparison of only one or two types of these factors. Systematic multi-factor explorations are needed to evaluate the conditions that may impact validity of a microbiome analysis. This study was aimed to improve methodological options to facilitate the best technical app...

  15. Dual Priming Oligonucleotides for Broad-Range Amplification of the Bacterial 16S rRNA Gene Directly from Human Clinical Specimens

    Kommedal, Øyvind; Simmon, Keith; Karaca, Dilek; Langeland, Nina; Wiker, Harald G.


    Broad-range amplification and sequencing of the bacterial 16S rRNA gene directly from clinical specimens are offered as a diagnostic service in many laboratories. One major pitfall is primer cross-reactivity with human DNA which will result in mixed chromatograms. Mixed chromatograms will complicate subsequent sequence analysis and impede identification. In SYBR green real-time PCR assays, it can also affect crossing threshold values and consequently the status of a specimen as positive or ne...

  16. An effect of 16S rRNA intercistronic variability on coevolutionary analysis in symbiotic bacteria: Molecular phylogeny of Arsenophonus triatominarum

    Šorfová, Pavlína; Škeříková, Andrea; Hypša, Václav


    Roč. 31, č. 2 (2008), s. 88-100. ISSN 0723-2020 R&D Projects: GA ČR GA206/04/0520; GA AV ČR IAA601410708 Institutional research plan: CEZ:AV0Z60220518 Keywords : intragenomic heterogeneity * 16S rRNA * coevolution * insect symbionts * molecular phylogeny Subject RIV: EE - Microbiology, Virology Impact factor: 2.582, year: 2008

  17. The chromatin remodeling factor CSB recruits histone acetyltransferase PCAF to rRNA gene promoters in active state for transcription initiation.

    Meili Shen

    Full Text Available The promoters of poised rRNA genes (rDNA are marked by both euchromatic and heterochromatic histone modifications and are associated with two transcription factors, UBF and SL1 that nucleate transcription complex formation. Active rRNA genes contain only euchromatic histone modifications and are loaded with all components of transcriptional initiation complex including RNA polymerase I. Coupled with histone acetylation and RNA polymerase I targeting, poised promoters can be converted to active ones by ATP-dependent chromatin remodeling factor CSB for initiation of rDNA transcription. However, it is not clear how dynamic histone modifications induce the assembly of polymerase I transcription initiation complex to active promoters during such conversion. Here we show that a complex consisting of CSB, RNA polymerase I and histone acetyltransferase PCAF is present at the rDNA promoters in active state. CSB is required for the association of PCAF with rDNA, which induces acetylation of histone H4 and histone H3K9. Overexpression of CSB promotes the association of PCAF with rDNA. Knockdown of PCAF leads to decreased levels of H4ac and H3K9ac at rDNA promoters, prevents the association of RNA polymerase I and inhibits pre-rRNA synthesis. The results demonstrate that CSB recruits PCAF to rDNA, which allows histone acetylation that is required for the assembly of polymerase I transcription initiation complex during the transition from poised to active state of rRNA genes, suggesting that CSB and PCAF play cooperative roles to establish the active state of rRNA genes by histone acetylation.

  18. Congruent Phylogenies of Most Common Small-Subunit rRNA and Dissimilatory Sulfite Reductase Gene Sequences Retrieved from Estuarine Sediments

    Joulian, Catherine; Ramsing, Niels B.; Ingvorsen, Kjeld


    The diversity of sulfate-reducing bacteria (SRB) in brackish sediment was investigated using small-subunit rRNA and dissimilatory sulfite reductase (DSR) gene clone libraries and cultivation. The phylogenetic affiliation of the most commonly retrieved clones for both genes was strikingly similar and produced Desulfosarcina variabilis-like sequences from the inoculum but Desulfomicrobium baculatum-like sequences from a high dilution in natural media. Related organisms were subsequently cultiva...

  19. Phylogenetic and genetic diversity analysis in Leptospira species based on the sequence homology pattern of 16S rRNA gene

    Pasupuleti Sreenivasa Rao


    Leptospirosis is a bacterial zoonosis, caused by pathogenic spirochete which belongs to the genus Leptospira. It exists in diverse ecological habitats and affects almost all the mammals including humans. Several online databases like NCBI etc will provide the complete genomic sequence data of various Leptospira species. However, the Phylogenetic and genetic diversity Analysis in Leptospira species based on 16S rRNA gene has not studied in detail. Therefore the present study was conducted. Seq...

  20. Characterization by 16S rRNA gene analysis and in situ hybridization of bacteria living in the hindgut of a deposit-feeding echinoid (Echinodermata)

    da Silva, S.G.; Gillan, D. C.; Dubilier, N.; De Ridder, C.


    The hindgut caecum of the deposit-feeding echinoid Echinocardium cordatum harbours a symbiotic bacterial microflora, organized into layered mats around detrital particles owing to the proliferation of filamentous bacteria. The bacterial community was analysed using 16S rRNA gene analysis and fluorescence in situ hybridization. The purpose was to characterize its biodiversity and to identify its predominant members. The majority of the 16S sequences belong to the delta -Proteobacteria (61.5%),...

  1. Identification to the species level of Lactobacillus isolated in probiotic prospecting studies of human, animal or food origin by 16S-23S rRNA restriction profiling

    Neumann Elisabeth; Teixeira Santuza MR; Horta Maria F; Mota Rodrigo M; Moreira João; Nicoli Jacques R.; Nunes Álvaro C


    Abstract Background The accurate identification of Lactobacillus and other co-isolated bacteria during microbial ecological studies of ecosystems such as the human or animal intestinal tracts and food products is a hard task by phenotypic methods requiring additional tests such as protein and/or lipids profiling. Results Bacteria isolated in different probiotic prospecting studies, using de Man, Rogosa and Sharpe medium (MRS), were typed at species level by PCR amplification of 16S-23S rRNA i...

  2. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.


    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recov...

  3. 16S rRNA gene based analysis of Enterobacter sakazakii strains from different sources and development of a PCR assay for identification

    Stephan Roger


    Full Text Available Abstract Background E. sakazakii is considered to be an opportunistic pathogen, implicated in food borne diseases causing meningitis or enteritis especially in neonates and infants. Cultural standard identification procedures for E. sakazakii include the observation of yellow pigmentation of colonies and a positive glucosidase activity. Up to now, only one PCR system based on a single available 16S rRNA gene sequence has been published for E. sakazakii identification. However, in our hands a preliminary evaluation of this system to a number of target and non-target strains showed significant specificity problems of this system. In this study full-length 16S rRNA genes of thirteen E. sakazakii strains from food, environment and human origin as well as the type strain ATCC 51329 were sequenced. Based on this sequence data a new specific PCR system for E. sakazakii was developed and evaluated. Results By phylogenetic analysis of the new full-length 16S rRNA gene sequence data obtained we could show the presence of a second phylogenetic distinct lineage within the E. sakazakii species. The newly developed 16S rRNA gene targeting PCR system allows identification of E. sakazakii strains from both lineages. The assay's ability to correctly identify different E. sakazakii isolates as well as to differentiate E. sakazakii from other closely related Enterobacteriaceae species and other microorganisms was shown on 75 target and non-target strains. Conclusion By this study we are presenting a specific and reliable PCR identification system, which is able to correctly identify E. sakazakii isolates from both phylogenetic distinct lines within the E. sakazakii species. The impact of this second newly described phylogenetic line within the E. sakazakii species in view of clinical and food safety aspects need further investigation.

  4. 16S rRNA gene based analysis of Enterobacter sakazakii strains from different sources and development of a PCR assay for identification

    Lehner, A J; Tasara, T.; Stephan, R


    BACKGROUND: E. sakazakii is considered to be an opportunistic pathogen, implicated in food borne diseases causing meningitis or enteritis especially in neonates and infants. Cultural standard identification procedures for E. sakazakii include the observation of yellow pigmentation of colonies and a positive glucosidase activity. Up to now, only one PCR system based on a single available 16S rRNA gene sequence has been published for E. sakazakii identification. However, in our hands a prelimin...

  5. Diversity and distribution of 16S rRNA and phenol monooxygenase genes in the rhizosphere and endophytic bacteria isolated from PAH-contaminated sites

    Peng, Anping; Liu, Juan; Ling, Wanting; Chen, Zeyou; Gao, Yanzheng


    This is the first investigation of the diversity and distribution of 16S rRNA and phenol monooxygenase (PHE) genes in endophytic and rhizosphere bacteria of plants at sites contaminated with different levels of PAHs. Ten PAHs at concentrations from 34.22 to 55.29 and 45.79 to 97.81 mg·kg-1 were measured in rhizosphere soils of Alopecurus aequalis Sobol and Oxalis corniculata L., respectively. The diversity of 16S rRNA and PHE genes in rhizosphere soils or plants changed with varying PAH pollution levels, as shown based on PCR-DGGE data. Generally, higher Shannon-Weiner indexes were found in mild or moderate contaminated areas. A total of 82 different bacterial 16S rRNA gene sequences belonging to five phyla; namely, Acfinobacteria, Proteobacteria, Chloroflexi, Cyanophyta, and Bacteroidetes, were obtained from rhizosphere soils. For the 57 identified PHE gene sequences, 18 were excised from rhizosphere bacteria and 39 from endophytic bacteria. The copy numbers of 16S rRNA and PHE genes in rhizosphere and endophytic bacteria varied from 3.83 × 103 to 2.28 × 106 and 4.17 × 102 to 1.99 × 105, respectively. The copy numbers of PHE genes in rhizosphere bacteria were significantly higher than in endophytic bacteria. Results increase our understanding of the diversity of rhizosphere and endophytic bacteria from plants grown in PAH-contaminated sites.

  6. 16S rRNA gene-based metagenomic analysis identifies a novel bacterial co-prevalence pattern in dental caries

    Jagathrakshakan, Sri Nisha; Sethumadhava, Raghavendra Jayesh; Mehta, Dhaval Tushar; Ramanathan, Arvind


    Objective: To identify the prevalence of acidogenic and nonacidogenic bacteria in patients with polycaries lesions, and to ascertain caries specific bacterial prevalence in relation to noncaries controls. Materials and Methods: Total genomic DNA extracted from saliva of three adults and four children from the same family were subjected to 16S rRNA gene sequencing analysis on a next generation sequencer, the PGS-Ion Torrent. Those bacterial genera with read counts > 1000 were considered as sig...

  7. Toolbox Approaches Using Molecular Markers and 16S rRNA Gene Amplicon Data Sets for Identification of Fecal Pollution in Surface Water

    Ahmed, W.; Staley, C.; Sadowsky, M J; Gyawali, P.; Sidhu, J. P. S.; Palmer, A.; Beale, D. J.; Toze, S.


    In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial...

  8. Use of 16S-23S rRNA Intergenic Spacer Region PCR and Repetitive Extragenic Palindromic PCR Analyses of Escherichia coli Isolates To Identify Nonpoint Fecal Sources

    Seurinck, Sylvie; Verstraete, Willy; Siciliano, Steven D.


    Despite efforts to minimize fecal input into waterways, this kind of pollution continues to be a problem due to an inability to reliably identify nonpoint sources. Our objective was to find candidate source-specific Escherichia coli fingerprints as potential genotypic markers for raw sewage, horses, dogs, gulls, and cows. We evaluated 16S-23S rRNA intergenic spacer region (ISR)-PCR and repetitive extragenic palindromic (rep)-PCR analyses of E. coli isolates as tools to identify nonpoint fecal...

  9. Polynucleotide Probes That Target a Hypervariable Region of 16S rRNA Genes To Identify Bacterial Isolates Corresponding to Bands of Community Fingerprints

    Heuer, Holger; Hartung, Kathrin; Wieland, Gabriele; Kramer, Ina; Smalla, Kornelia


    Temperature gradient gel electrophoresis (TGGE) is well suited for fingerprinting bacterial communities by separating PCR-amplified fragments of 16S rRNA genes (16S ribosomal DNA [rDNA]). A strategy was developed and was generally applicable for linking 16S rDNA from community fingerprints to pure culture isolates from the same habitat. For this, digoxigenin-labeled polynucleotide probes were generated by PCR, using bands excised from TGGE community fingerprints as a template, and applied in ...

  10. Pyrosequencing of 16S rRNA genes in fecal samples reveals high diversity of hindgut microflora in horses and potential links to chronic laminitis

    Steelman Samantha M; Chowdhary Bhanu P; Dowd Scot; Suchodolski Jan; Janečka Jan E


    Abstract Background The nutrition and health of horses is closely tied to their gastrointestinal microflora. Gut bacteria break down plant structural carbohydrates and produce volatile fatty acids, which are a major source of energy for horses. Bacterial communities are also essential for maintaining gut homeostasis and have been hypothesized to contribute to various diseases including laminitis. We performed pyrosequencing of 16S rRNA bacterial genes isolated from fecal material to character...

  11. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing.

    Mehetre, Gajanan T; Paranjpe, Aditi; Dastager, Syed G; Dharne, Mahesh S


    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. PMID:26950332

  12. Complementarity of the 16S rRNA penultimate stem with sequences downstream of the AUG destabilizes the plastid mRNAs

    Kuroda, Hiroshi; Maliga, Pal


    Escherichia coli mRNA translation is facilitated by sequences upstream and downstream of the initiation codon, called Shine–Dalgarno (SD) and downstream box (DB) sequences, respectively. In E.coli enhancing the complementarity between the DB sequences and the 16S rRNA penultimate stem resulted in increased protein accumulation without a significant affect on mRNA stability. The objective of this study was to test whether enhancing the complementarity of plastid mRN...

  13. Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene

    Coêlho, Mariza M.; Ferreira-Nozawa, Monica S.; Nozawa, Sérgio R.; Santos, André L.W.


    Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla), were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic...

  14. First Report of the 23S rRNA Gene A2058G Point Mutation Associated With Macrolide Resistance in Treponema pallidum From Syphilis Patients in Cuba.

    Noda, Angel A; Matos, Nelvis; Blanco, Orestes; Rodríguez, Islay; Stamm, Lola Virginia


    This study aimed to assess the presence of macrolide-resistant Treponema pallidum subtypes in Havana, Cuba. Samples from 41 syphilis patients were tested for T. pallidum 23S rRNA gene mutations. Twenty-five patients (61%) harbored T. pallidum with the A2058G mutation, which was present in all 8 subtypes that were identified. The A2059G mutation was not detected. PMID:27100771

  15. Bacterial Diversity Studies Using the 16S rRNA Gene Provide a Powerful Research-Based Curriculum for Molecular Biology Laboratory

    Sarah M. Boomer


    Full Text Available We have developed a ten-week curriculum for molecular biology that uses 16S ribosomal RNA genes to characterize and compare novel bacteria from hot spring communities in Yellowstone National Park. The 16S rRNA approach bypasses selective culture-based methods. Our molecular biology course offered the opportunity for students to learn broadly applicable methods while contributing to a long-term research project. Specifically, students isolated and characterized clones that contained novel 16S rRNA inserts using restriction enzyme, DNA sequencing, and computer-based phylogenetic methods. In both classes, students retrieved novel bacterial 16S rRNA genes, several of which were most similar to Green Nonsulfur bacterial isolates. During class, we evaluated student performance and mastery of skills and concepts using quizzes, formal lab notebooks, and a broad project assignment. For this report, we also assessed student performance alongside data quality and discussed the significance, our goal being to improve both research and teaching methods.

  16. Bacterial Diversity Studies Using the 16S rRNA Gene Provide a Powerful Research-Based Curriculum for Molecular Biology Laboratory

    Bryan E. Dutton


    Full Text Available We have developed a ten-week curriculum for molecular biology that uses 16S ribosomal RNA genes to characterize and compare novel bacteria from hot spring communities in Yellowstone National Park. The 16S rRNA approach bypasses selective culture-based methods. Our molecular biology course offered the opportunity for students to learn broadly applicable methods while contributing to a long-term research project. Specifically, students isolated and characterized clones that contained novel 16S rRNA inserts using restriction enzyme, DNA sequencing, and computer-based phylogenetic methods. In both classes, students retrieved novel bacterial 16S rRNA genes, several of which were most similar to Green Nonsulfur bacterial isolates. During class, we evaluated student performance and mastery of skills and concepts using quizzes, formal lab notebooks, and a broad project assignment. For this report, we also assessed student performance alongside data quality and discussed the significance, our goal being to improve both research and teaching methods.

  17. A local role for the small ribosomal subunit primary binder rpS5 in final 18S rRNA processing in yeast.

    Andreas Neueder

    Full Text Available In vivo depletion of the yeast small ribosomal subunit (SSU protein S5 (rpS5 leads to nuclear degradation of nascent SSUs and to a perturbed global assembly state of the SSU head domain. Here, we report that rpS5 plays an additional local role at the head/platform interface in efficient SSU maturation. We find that yeast small ribosomal subunits which incorporated an rpS5 variant lacking the seven C-terminal amino acids have a largely assembled head domain and are exported to the cytoplasm. On the other hand, 3' processing of 18S rRNA precursors is inhibited in these ribosomal particles, although they associate with the putative endonuclease Nob1p and other late acting 40S biogenesis factors. We suggest that the SSU head component rpS5 and platform components as rpS14 are crucial constituents of a highly defined spatial arrangement in the head-platform interface of nascent SSUs, which is required for efficient processing of the therein predicted SSU rRNA 3' end. Positioning of rpS5 in nascent SSUs, including its relative orientation towards platform components in the head-platform cleft, will depend on the general assembly and folding state of the head domain. Therefore, the suggested model can explain 18S precursor rRNA 3' processing phenotypes observed in many eukaryotic SSU head assembly mutants.

  18. Analysis of RAPD and mitochondrial 16S rRNA gene sequences from Trichiurus lepturus and Eupleurogrammus muticus in the Yellow Sea

    MENG Zining; ZHUANG Zhimeng; JIN Xianshi; TANG Qisheng; SU Yongquan


    Random amplified polymorphic DNA (RAPD) technique is applied to 12 individuals from each species of the hairtail fishes Trichiurus lepturus and Eupleurogrammus muticus in the Yellow Sea. The percentage of polymorphic sites, degree of genetic polymorphism and genetic distance are compared and the phylogenetic tree is constructed by Neighbor-joining method. The partial mitochondrial 16S rRNA gene is amplified by polymerase chain reaction (PCR) and the PCR products are directly sequenced after being purified. These sequences, together with the homologous sequences of another Trichiuridae species Lepidopus caudatus obtained from GenBank, are used to analyze nucleotide difference and to construct a UPGMA phylogenetic tree by means of biological informatics. Analysis shows: (1) the RAPD technique is a highly sensitive method for investigating genetic diversity in T. lepturus, and E. muticus. T. lepturus exhibits a lower polymorphism and genetic diversity than E. muticus; (2) according to the analysis of the partial mitochondrial 16S rRNA gene sequences, a very low intraspecific variation and considerably high divergence among species were found, which reveals a dual nature of conservatism and variability in mitochondrial 16S rRNA gene; (3) five primers generate the species-specific RAPD sites and these sites can be served as the molecular markers for species identification and (4) it can be proved at DNA variation level that T. lepturus and E. muticus are of two species respectively pertaining to different genera, which supports the Nelson taxonomic conclusion.

  19. Deletion analysis of the expression of rRNA genes and associated tRNA genes carried by a lambda transducing bacteriophage. [uv radiation, Escherichia coli

    Morgan, E.A.; Nomura, M.


    Transducing phage lambda ilv5 carries genes for rRNA's, spacer tRNA's (tRNA/sub 1//sup Ile/ and tRNA/sub 1B//sup Ala/), and two other tRNA's (tRNA/sub 1//sup Asp/ and tRNA/sup Trp/). We have isolated a mutant of lambda ilv5, lambda ilv5su7, which carries an amber suppressor mutation in the tRNA/sup Trp/ gene. A series of deletion mutants were isolated from the lambda ilv5su7 phage. Genetic and biochemical analyses of these deletion mutants have confirmed our previous conclusion that the genes for tRNA/sub 1//sup Asp/ and tRNA/sup Trp/ located at the distal end of the rRNA operon (rrnC) are cotranscribed with other rRNA genes in that operon. In addition, these deletions were used to define roughly the physical location of the promoter(s) of the rRNA operon carried by the lambda ilv5su7 transducing phage.

  20. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan.

    Martínez, Allyson K; Gordon, Emily; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M; Benedik, Michael J; Yanofsky, Charles; Mankin, Alexander S; Vazquez-Laslop, Nora; Sachs, Matthew S; Cruz-Vera, Luis R


    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome's ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the concentration dependence of L-Trp-mediated tna operon induction, whereas the TnaC I19L change suppresses this phenotype, restoring the sensitivity of the translating A2058U mutant ribosome to free L-Trp. These findings suggest that interactions between TnaC residue I19 and 23S rRNA nucleotide A2058 contribute to the creation of a regulatory L-Trp binding site within the translating ribosome. PMID:24137004

  1. Genetic variation and identification of cultivated Fallopia multiflora and its wild relatives by using chloroplast matK and 18S rRNA gene sequences.

    Yan, Ping; Pang, Qi-Hua; Jiao, Xu-Wen; Zhao, Xuan; Shen, Yan-Jing; Zhao, Shu-Jin


    FALLOPIA MULTIFLORA (Thunb.) Harald . has been widely and discriminatingly used in China for the study and treatment of anemia, swirl, deobstruent, pyrosis, insomnia, amnesia, atheroma and also for regulating immune functions. However, there is still confusion about the herbal drug's botanical origins and the phylogenetic relationship between the cultivars and the wild relatives. In order to develop an efficient method for identification, a molecular analysis was performed based on 18 S rRNA gene and partial MATK gene sequences. The 18 S rRNA gene sequences of F. MULTIFLORA were 1809 bp in length and were highly conserved, indicating that the cultivars and the wild F. MULTIFLORA have the same botanical origin. Based on our 18 S rRNA gene sequences analysis, F. MULTIFLORA could be easily distinguished at the DNA level from adulterants and some herbs with similar components. The MATK gene partial sequences were found to span 1271 bp. The phylogenetic relation of F. MULTIFLORA based on the MATK gene showed that all samples in this paper were divided into four clades. The sequences of the partial MATK gene had many permutations, which were related to the geographical distributions of the samples. MATK gene sequences provided valuable information for the identification of F. MULTIFLORA. New taxonomic information could be obtained to authenticate the botanical origin of the F. MULTIFLORA, the species and the medicines made of it. PMID:18759218

  2. 30S Subunit-Dependent Activation of the Sorangium cellulosum So ce56 Aminoglycoside Resistance-Conferring 16S rRNA Methyltransferase Kmr

    Savic, Miloje; Sunita, S.; Zelinskaya, Natalia; Desai, Pooja M.; Macmaster, Rachel; Vinal, Kellie


    Methylation of bacterial 16S rRNA within the ribosomal decoding center confers exceptionally high resistance to aminoglycoside antibiotics. This resistance mechanism is exploited by aminoglycoside producers for self-protection while functionally equivalent methyltransferases have been acquired by human and animal pathogenic bacteria. Here, we report structural and functional analyses of the Sorangium cellulosum So ce56 aminoglycoside resistance-conferring methyltransferase Kmr. Our results demonstrate that Kmr is a 16S rRNA methyltransferase acting at residue A1408 to confer a canonical aminoglycoside resistance spectrum in Escherichia coli. Kmr possesses a class I methyltransferase core fold but with dramatic differences in the regions which augment this structure to confer substrate specificity in functionally related enzymes. Most strikingly, the region linking core β-strands 6 and 7, which forms part of the S-adenosyl-l-methionine (SAM) binding pocket and contributes to base flipping by the m1A1408 methyltransferase NpmA, is disordered in Kmr, correlating with an exceptionally weak affinity for SAM. Kmr is unexpectedly insensitive to substitutions of residues critical for activity of other 16S rRNA (A1408) methyltransferases and also to the effects of by-product inhibition by S-adenosylhomocysteine (SAH). Collectively, our results indicate that adoption of a catalytically competent Kmr conformation and binding of the obligatory cosubstrate SAM must be induced by interaction with the 30S subunit substrate. PMID:25733511

  3. Comparative analyses of phenotypic methods and 16S rRNA, khe, rpoB genes sequencing for identification of clinical isolates of Klebsiella pneumoniae.

    He, Yanxia; Guo, Xianguang; Xiang, Shifei; Li, Jiao; Li, Xiaoqin; Xiang, Hui; He, Jinlei; Chen, Dali; Chen, Jianping


    The present work aimed to evaluate 16S rRNA, khe and rpoB gene sequencing for the identification of Klebsiella pneumoniae in comparison with phenotypic methods. Fifteen clinical isolates were examined, which were initially identified as K. pneumoniae subsp. pneumoniae using the automated VITEK 32 system in two hospitals in Enshi City, China. Their identity was further supported by conventional phenotypic methods on the basis of morphological and biochemical characteristics. Using Bayesian phylogenetic analyses and haplotypes network reconstruction, 13 isolates were identified as K. pneumoniae, whereas the other two isolates (K19, K24) were classified as Shigella sp. and Enterobacter sp., respectively. Of the three genes, 16S rRNA and khe gene could discriminate the clinical isolates at the genus level, whereas rpoB could discriminate Klebsiella at the species and even subspecies level. Overall, the gene tree based on rpoB is more compatible with the currently accepted classification of Klebsiella than those based on 16S rRNA and khe genes, showing that rpoB can be a powerful tool for identification of K. pneumoniae isolates. Above all, our study challenges the utility of khe as a species-specific marker for identification of K. pneumoniae. PMID:27147066

  4. In silico analysis of the 16S rRNA gene of endophytic bacteria, isolated from the aerial parts and seeds of important agricultural crops.

    Bredow, C; Azevedo, J L; Pamphile, J A; Mangolin, C A; Rhoden, S A


    Because of human population growth, increased food production and alternatives to conventional methods of biocontrol and development of plants such as the use of endophytic bacteria and fungi are required. One of the methods used to study microorganism diversity is sequencing of the 16S rRNA gene, which has several advantages, including universality, size, and availability of databases for comparison. The objective of this study was to analyze endophytic bacterial diversity in agricultural crops using published papers, sequence databases, and phylogenetic analysis. Fourteen papers were selected in which the ribosomal 16S rRNA gene was used to identify endophytic bacteria, in important agricultural crops, such as coffee, sugar cane, beans, corn, soybean, tomatoes, and grapes, located in different geographical regions (America, Europe, and Asia). The corresponding 16S rRNA gene sequences were selected from the NCBI database, aligned using the Mega 5.2 program, and phylogenetic analysis was undertaken. The most common orders present in the analyzed cultures were Bacillales, Enterobacteriales, and Actinomycetales and the most frequently observed genera were Bacillus, Pseudomonas, and Microbacterium. Phylogenetic analysis showed that only approximately 1.56% of the total sequences were not properly grouped, demonstrating reliability in the identification of microorganisms. This study identified the main genera found in endophytic bacterial cultures from plants, providing data for future studies on improving plant agriculture, biotechnology, endophytic bacterium prospecting, and to help understand relationships between endophytic bacteria and their interactions with plants. PMID:26345903

  5. Targeting single-nucleotide polymorphisms in the 16S rRNA gene to detect and differentiate Legionella pneumophila and non-Legionella pneumophila species.

    Zhan, Xiao-Yong; Hu, Chao-Hui; Zhu, Qing-Yi


    A PCR-based method targeting single-nucleotide polymorphisms (SNPs) in the 16S rRNA gene was developed for differential identification of Legionella pneumophila and non-Legionella pneumophila. Based on the bioinformatics analysis for 176 Legionella 16S rRNA gene fragments of 56 different Legionella species, a set of SNPs, A(628)C(629) was found to be highly specific to L. pneumophila strains. A multiplex assay was designed that was able to distinguish sites with limited sequence heterogeneity between L. pneumophila and non-L. pneumophila in the targeted 16S rRNA gene. The assay amplified a 261-bp amplicon for Legionella spp. and a set of 203- and 97-bp amplicons only specific to L. pneumophila species. Among 49 ATCC strains and 284 Legionella isolates from environmental water and clinical samples, 100 % of L. pneumophila and non-L. pneumophila strains were correctly identified and differentiated by this assay. The assay presents a more rapid, sensitive and alternative method to the currently available PCR-sequencing detection and differentiation method. PMID:27112927

  6. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    Rosendahl, G; Douthwaite, S


    23 S rRNA. Within the ribosome, L11 also interacts with this rRNA region, although the protection effects are subtly different and extend to nucleotide 1098. The pentameric r-protein complex L10.(L12)4 binds to an adjacent site on the rRNA, protecting riboses at positions 1043, 1046 to 1049, 1053 to...... by L10.(L12)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  7. Hydrogen bonding and packing density are factors most strongly connected to limiting sites of high flexibility in the 16S rRNA in the 30S ribosome

    Ghosh Sujit K


    Full Text Available Abstract Background Conformational flexibility in structured RNA frequently is critical to function. The 30S ribosomal subunit exists in different conformations in different functional states due to changes in the central part of the 16S rRNA. We are interested in evaluating the factors that might be responsible for restricting flexibility to specific parts of the 16S rRNA using biochemical data obtained from the 30S subunit in solution. This problem was approached taking advantage of the observation that there must be a high degree of conformational flexibility at sites where UV photocrosslinking occurs and a lack of flexibility inhibits photoreactivity at many other sites that are otherwise suitable for reaction. Results We used 30S x-ray structures to quantify the properties of the nucleotide pairs at UV- and UVA-s4U-induced photocrosslinking sites in 16S rRNA and compared these to the properties of many hundreds of additional sites that have suitable geometry but do not undergo photocrosslinking. Five factors that might affect RNA flexibility were investigated – RNA interactions with ribosomal proteins, interactions with Mg2+ ions, the presence of long-range A minor motif interactions, hydrogen bonding and the count of neighboring heavy atoms around the center of each nucleobase to estimate the neighbor packing density. The two factors that are very different in the unreactive inflexible pairs compared to the reactive ones are the average number of hydrogen bonds and the average value for the number of neighboring atoms. In both cases, these factors are greater for the unreactive nucleotide pairs at a statistically very significant level. Conclusion The greater extent of hydrogen bonding and neighbor atom density in the unreactive nucleotide pairs is consistent with reduced flexibility at a majority of the unreactive sites. The reactive photocrosslinking sites are clustered in the 30S subunit and this indicates nonuniform patterns of

  8. Effect of secondary compounds in forages on rumen micro-organisms quantified by 16S and 18S rRNA

    A gas syringe method was used to evaluate the effect of secondary compounds from plant materials on in vitro fermentation products and microbial biomass. The experiment used Pennisetum purpureum, Morinda citrifolia fruit, Nothopanax scutellarium leaves, Sesbania sesban LS (low saponins type), Sesbania sesban HS (high saponins type) and Sapindus rarak fruit as substrates. The incubation was conducted with and without polyethylene glycol 6000 (PEG) addition for 24 hours. Gas production and short-chain fatty acids (SCFA) were analysed. Prokaryotic and eukaryotic concentrations were measured by quantifying 16S and 18S rRNA. The percentage increase in gas production due to PEG was very small (<5%) for all plant materials, which indicated that the biological effect of tannin in these plant materials is limited. TLC analysis revealed that all materials contained saponin, but only S. rarak, followed by S. sesban, contained a high diversity of saponins. S. sesban gave the highest (234 ml/g) while S. rarak gave the lowest gas production (115 ml/g). S. rarak gave the lowest SCFA production (3.57 mmole/g) and also the lowest ratio of acetate to propionate (1.76), indicating a change in pattern of SCFA production. Total elimination of eukaryotic concentration was evident from the absence of the 18S rRNA band when S. rarak and S. sesban were used as sole substrates. S. rarak also reduced the prokaryotic concentration. To use S. rarak as a defaunating agent without affecting prokaryotes, a crude saponin extract was prepared from S. rarak for further experiment. Different concentrations of crude saponins in a methanol extract of S. rarak fruit dissolved in rumen buffer were added to a substrate consisting of elephant grass and wheat bran (7:3 w/w). Microbial biomass yield was quantified by gravimetry and using rRNA as a marker. Addition of crude saponin extract from S. rarak to a high-roughage diet increased microbial biomass (MB) yield to 1.07 and 1.14 times MB yield of the

  9. Polyethylene glycol and polyvinylpirrolidone effect on bacterial rRNA extraction and hybridization from cells exposed to tannins Efeito de polietilenoglicol e polivinilpirrolidona na extração e hibridização de rRNA bacteriano de células expostas a taninos

    Pedro Braga Arcuri


    Full Text Available In order to detect fluctuations in ruminal microbial populations due to forage tannins using 16S ribosomal RNA (rRNA probes, recovery of intact rRNA is required. The objective of this work was to evaluate the effect of polyethylene glycol (PEG and polyvinylpirrolidone (PVP on extraction of bacterial rRNA, in the presence of tannins from tropical legume forages and other sources, that hybridize with oligonucleotide probes. Ruminococcus albus 8 cells were exposed to 8 g/L tannic acid or 1 g/L condensed tannins extracted from Acacia angustissima, banana (Musa sp. skin, Desmodium ovalifolium, red grape (Vitis vinifera skin and Inga edulis, or no tannins. Cells were rinsed with Tris buffer pH 7 containing either 8% PEG or 6% PVP prior to cell lysis. Total RNA samples rinsed with either PEG or PVP migrated through denaturing agarose gels. The 16S rRNA bands successfully hybridized with a R. albus species-specific oligonucleotide probe, regardless of tannin source. The effect of rinsing buffers on the density of 16S rRNA bands, as well as on the hybridization signals was compared. There were significant effects (PA recuperação de RNA ribossômico (rRNA intacto é necessária para a detecção de flutuações na população microbiana ruminal decorrentes dos taninos de forrageiras, utilizando-se sondas para 16S rRNA. O objetivo deste trabalho foi avaliar o efeito de polietilenoglicol (PEG e polivinilpirrolidona (PVP na extração de rRNA bacteriano, em presença de taninos de leguminosas forrageiras tropicais e de outras fontes, que possa ser hibridizado com sondas de oligonucleotídeos. Culturas de Ruminococcus albus 8 foram expostas ou não a 8 g/L de ácido tânico ou a 1 g/L de taninos condensados, extraídos de Acacia angustissima, casca de banana (Musa sp., Desmodium ovalifolium, cascas de uvas vermelhas (Vitis vinifera e Inga edulis. As culturas foram lavadas com tampão Tris pH 7 contendo 8% PEG ou 6% PVP antes do rompimento das c

  10. Paternity testing with VNTR DNA systems. II. Evaluation of 271 cases of disputed paternity with the VNTR systems D2S44, D5S43, D7S21, D7S22, and D12S11

    Hansen, Hanna Elsebeth; Morling, N


    Paternity testing was carried out in 271 cases of disputed paternity using the 5 VNTR systems D2S44 (YNH24), D5S43 (MS8), D7S21 (MS31), D7S22 (g3), and D12S11 (MS43a), and 10-15 conventional marker systems including the HLA-A,B system. By means of the matching criteria for the VNTR systems...... established elsewhere (Morling & Hansen 1992), all 70 unrelated men who had been excluded by conventional typing were also excluded with 2 or more VNTR systems. Based on the observed exclusion frequencies for the 5 VNTR systems, a theoretical exclusion rate exceeding 0.999 could be obtained. A total of 350...

  11. Phylogenetic Diversity and Spatial Distribution of the Microbial Community Associated with the Caribbean Deep-water Sponge Polymastia cf. corticata by 16S rRNA, aprA, and amoA Gene Analysis

    Meyer, Birte; Kuever, Jan


    Denaturing gradient gel electrophoresis (DGGE)-based analyses of 16S rRNA, aprA, and amoA genes demonstrated that a phylogenetically diverse and complex microbial community was associated with the Caribbean deep-water sponge Polymastia cf. corticata Ridley and Dendy, 1887. From the 38 archaeal and bacterial 16S rRNA phylotypes identified, 53% branched into the sponge-specific, monophyletic sequence clusters determined by previous studies (considering predominantly shallow-water sponge species...

  12. Development of polymerase chain reaction primer sets for diagnosis of Lyme disease and for species-specific identification of Lyme disease isolates by 16S rRNA signature nucleotide analysis.


    We have determined and compared partial 16S rRNA sequences from 23 Lyme disease spirochete isolates and aligned these with 8 sequences previously presented. The 16S rRNA signature nucleotide compositions were defined for each isolate and compared with the genomic species signature nucleotide sets previously established. To identify positions truly indicative of species classification which could serve as targets for polymerase chain reaction species-specific identification primers, 16S rRNA-b...

  13. Quantitative identification of fecal water pollution sources by TaqMan real-time PCR assays using Bacteroidales 16S rRNA genetic markers.

    Lee, Dae-Young; Weir, Susan C; Lee, Hung; Trevors, Jack T


    PCR-based analysis of Bacteroidales 16S rRNA genes has emerged as a promising tool to identify sources of fecal water pollution. In this study, three TaqMan real-time PCR assays (BacGeneral, BacHuman, and BacBovine) were developed and evaluated for their ability to quantitatively detect general (total), human-specific, and bovine-specific Bacteroidales 16S rRNA genetic markers. The detection sensitivity was determined to be 6.5 copies of 16S rRNA gene for the BacGeneral and BacHuman assays and 10 copies for the BacBovine assay. The assays were capable of detecting approximately one to two cells per PCR. When tested with 70 fecal samples from various sources (human, cattle, pig, deer, dog, cat, goose, gull, horse, and raccoon), the three assays positively identified the target markers in all samples without any false-negative results. The BacHuman and BacBovine assays exhibited false-positive reactions with non-target samples in a few cases. However, the level of the false-positive reactions was about 50 times smaller than that of the true-positive ones, and therefore, these cross-reactions were unlikely to cause misidentifications of the fecal pollution sources. Microbial source-tracking capability was tested at two freshwater streams of which water quality was influenced by human and cattle feces, respectively. The assays accurately detected the presence of the corresponding host-specific markers upon fecal pollution and the persistence of the markers in downstream areas. The assays are expected to reliably determine human and bovine fecal pollution sources in environmental water samples. PMID:20871990

  14. Persistent spread of the rmtB 16S rRNA methyltransferase gene among Escherichia coli isolates from diseased food-producing animals in China.

    Xia, Jing; Sun, Jian; Cheng, Ke; Li, Liang; Fang, Liang-Xing; Zou, Meng-Ting; Liao, Xiao-Ping; Liu, Ya-Hong


    A total of 963 non-duplicate Escherichia coli strains isolated from food-producing animals between 2002 and 2012 were screened for the presence of the 16S rRNA methyltransferase genes. Among the positive isolates, resistance determinants to extended spectrum β-lactamases, plasmid-mediated quinolone resistance genes as well as floR and fosA/A3/C2 were detected using PCR analysis. These isolates were further subjected to antimicrobial susceptibility testing, molecular typing, PCR-based plasmid replicon typing and plasmid analysis. Of the 963 E. coli isolates, 173 (18.0%), 3 (0.3%) and 2 (0.2%) were rmtB-, armA- and rmtE-positive strains, respectively. All the 16S rRNA methyltransferase gene-positive isolates were multidrug resistant and over 90% of them carried one or more type of resistance gene. IncF (especially IncFII) and non-typeable plasmids played the main role in the dissemination of rmtB, followed by the IncN plasmids. Plasmids that harbored rmtB ranged in size from 20kb to 340kb EcoRI-RFLP testing of the 109 rmtB-positive plasmids from different years and different origins suggested that horizontal (among diverse animals) and vertical transfer of IncF, non-typeable and IncN-type plasmids were responsible for the spread of rmtB gene. In summary, our findings highlight that rmtB was the most prevalent 16S rRNA methyltransferase gene, which present persistent spread in food-producing animals in China and a diverse group of plasmids was responsible for rmtB dissemination. PMID:27139028

  15. Bacterial communities in haloalkaliphilic sulfate-reducing bioreactors under different electron donors revealed by 16S rRNA MiSeq sequencing

    Zhou, Jiemin [National Key Laboratory of Biochemical Engineering, Institute of Process Engineering, Chinese Academy of Sciences, P.O. Box 353, Beijing 100190 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Zhou, Xuemei; Li, Yuguang [101 Institute, Ministry of Civil Affairs, Beijing 100070 (China); Xing, Jianmin, E-mail: [National Key Laboratory of Biochemical Engineering, Institute of Process Engineering, Chinese Academy of Sciences, P.O. Box 353, Beijing 100190 (China)


    Highlights: • Bacterial communities of haloalkaliphilic bioreactors were investigated. • MiSeq was first used in analysis of communities of haloalkaliphilic bioreactors. • Electron donors had significant effect on bacterial communities. - Abstract: Biological technology used to treat flue gas is useful to replace conventional treatment, but there is sulfide inhibition. However, no sulfide toxicity effect was observed in haloalkaliphilic bioreactors. The performance of the ethanol-fed bioreactor was better than that of lactate-, glucose-, and formate-fed bioreactor, respectively. To support this result strongly, Illumina MiSeq paired-end sequencing of 16S rRNA gene was applied to investigate the bacterial communities. A total of 389,971 effective sequences were obtained and all of them were assigned to 10,220 operational taxonomic units (OTUs) at a 97% similarity. Bacterial communities in the glucose-fed bioreactor showed the greatest richness and evenness. The highest relative abundance of sulfate-reducing bacteria (SRB) was found in the ethanol-fed bioreactor, which can explain why the performance of the ethanol-fed bioreactor was the best. Different types of SRB, sulfur-oxidizing bacteria, and sulfur-reducing bacteria were detected, indicating that sulfur may be cycled among these microorganisms. Because high-throughput 16S rRNA gene paired-end sequencing has improved resolution of bacterial community analysis, many rare microorganisms were detected, such as Halanaerobium, Halothiobacillus, Desulfonatronum, Syntrophobacter, and Fusibacter. 16S rRNA gene sequencing of these bacteria would provide more functional and phylogenetic information about the bacterial communities.

  16. Bacterial communities in haloalkaliphilic sulfate-reducing bioreactors under different electron donors revealed by 16S rRNA MiSeq sequencing

    Highlights: • Bacterial communities of haloalkaliphilic bioreactors were investigated. • MiSeq was first used in analysis of communities of haloalkaliphilic bioreactors. • Electron donors had significant effect on bacterial communities. - Abstract: Biological technology used to treat flue gas is useful to replace conventional treatment, but there is sulfide inhibition. However, no sulfide toxicity effect was observed in haloalkaliphilic bioreactors. The performance of the ethanol-fed bioreactor was better than that of lactate-, glucose-, and formate-fed bioreactor, respectively. To support this result strongly, Illumina MiSeq paired-end sequencing of 16S rRNA gene was applied to investigate the bacterial communities. A total of 389,971 effective sequences were obtained and all of them were assigned to 10,220 operational taxonomic units (OTUs) at a 97% similarity. Bacterial communities in the glucose-fed bioreactor showed the greatest richness and evenness. The highest relative abundance of sulfate-reducing bacteria (SRB) was found in the ethanol-fed bioreactor, which can explain why the performance of the ethanol-fed bioreactor was the best. Different types of SRB, sulfur-oxidizing bacteria, and sulfur-reducing bacteria were detected, indicating that sulfur may be cycled among these microorganisms. Because high-throughput 16S rRNA gene paired-end sequencing has improved resolution of bacterial community analysis, many rare microorganisms were detected, such as Halanaerobium, Halothiobacillus, Desulfonatronum, Syntrophobacter, and Fusibacter. 16S rRNA gene sequencing of these bacteria would provide more functional and phylogenetic information about the bacterial communities

  17. Multiplex RT-PCR detection of Cucumber mosaic virus subgroups and Tobamoviruses infecting Tomato using 18S rRNA as an internal control

    Shaoning Chen; Hao Gu; Xiaoming Wang; Jishuang Chen; Weimin Zhu


    A multiplex reverse-transcription polymerase chain reaction (RT-PCR) protocol was developed for simultaneous detection and discrimination of subgroups of Cucumber mosaic virus (CMV), including its satellite RNA, Tomato mosaic virus (ToMV) and Tobacco mosaic virus (TMV),using 18S rRNA as an internal control.Species- and subgroups-specific primers designed to differentiate CMV subgroups Ⅰ and Ⅱ, ToMV and TMV, were assessed using the cDNA clones of viral genomes, CMV satellite RNA and 18S rRNA gene from tomato (Solanum lycopersicum L.) or tobacco (Nicotiana tobacum).Using total RNA extracted from artificial mixture of tomato leaf tissues infected by each virus, the reaction components and cycling parmeters were optimized and a multiplex RT-PCR procedure was established.Six fragments of 704, 593, 512, 421,385, 255 bp, specific to CMV subgroup ll, CMV subgroup I, ToMV, TMV, satellite RNA and 18S rRNA, respectively, were sinultaneously amplified.The sensitivity of the multiplex RT-PCR method for detecting CMV was 100 times higher than that of double-antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA).This method was successfully used for field detection.Among 141 samples collected from East China through tomato growth seasons, 106 single infections with one of the above isolates were detected and 13 mixed infections were found.The results showed the potential use of this method for investigating the epidemiology of viral diseases infecting tomato.

  18. Metagenomic of Actinomycetes Based on 16S rRNA and nifH Genes in Soil and Roots of Four Indonesian Rice Cultivars Using PCR-DGGE



    Full Text Available The research was conducted to study the metagenomic of actinomycetes based on 16S ribosomal RNA (rRNA and bacterial nifH genes in soil and roots of four rice cultivars. The denaturing gradient gel electrophoresis profile based on 16S rRNA gene showed that the diversity of actinomycetes in roots was higher than soil samples. The profile also showed that the diversity of actinomycetes was similar in four varieties of rice plant and three types of agroecosystem. The profile was partially sequenced and compared to GenBank database indicating their identity with closely related microbes. The blast results showed that 17 bands were closely related ranging from 93% to 100% of maximum identity with five genera of actinomycetes, which is Geodermatophilus, Actinokineospora, Actinoplanes, Streptomyces and Kocuria. Our study found that Streptomyces species in soil and roots of rice plants were more varied than other genera, with a dominance of Streptomyces alboniger and Streptomyces acidiscabies in almost all the samples. Bacterial community analyses based on nifH gene denaturing gradient gel electrophoresis showed that diversity of bacteria in soils which have nifH gene was higher than that in rice plant roots. The profile also showed that the diversity of those bacteria was similar in four varieties of rice plant and three types of agroecosystem. Five bands were closely related with nifH gene from uncultured bacterium clone J50, uncultured bacterium clone clod-38, and uncultured bacterium clone BG2.37 with maximum identity 99%, 98%, and 92%, respectively. The diversity analysis based on 16S rRNA gene differed from nifH gene and may not correlate with each other. The findings indicated the diversity of actinomycetes and several bacterial genomes analyzed here have an ability to fix nitrogen in soil and roots of rice plant.

  19. Direct relationship between the level of p53 stabilization induced by rRNA synthesis-inhibiting drugs and the cell ribosome biogenesis rate.

    Scala, F; Brighenti, E; Govoni, M; Imbrogno, E; Fornari, F; Treré, D; Montanaro, L; Derenzini, M


    Many drugs currently used in chemotherapy work by hindering the process of ribosome biogenesis. In tumors with functional p53, the inhibition of ribosome biogenesis may contribute to the efficacy of this treatment by inducing p53 stabilization. As the level of stabilized p53 is critical for the induction of cytotoxic effects, it seems useful to highlight those cancer cell characteristics that can predict the degree of p53 stabilization following the treatment with inhibitors of ribosome biogenesis. In the present study we exposed a series of p53 wild-type human cancer cell lines to drugs such as actinomycin D (ActD), doxorubicin, 5-fluorouracil and CX-5461, which hinder ribosomal RNA (rRNA) synthesis. We found that the amount of stabilized p53 was directly related to the level of ribosome biogenesis in cells before the drug treatment. This was due to different levels of inactivation of the ribosomal proteins-MDM2 pathway of p53 digestion. Inhibition of rRNA synthesis always caused cell cycle arrest, independent of the ribosome biogenesis rate of the cells, whereas apoptosis occurred only in cells with a high rDNA transcription rate. The level of p53 stabilization induced by drugs acting in different ways from the inhibition of ribosome biogenesis, such as hydroxyurea (HU) and nutlin-3, was independent of the level of ribosome biogenesis in cells and always lower than that occurring after the inhibition of rRNA synthesis. Interestingly, in cells with a low ribosome biogenesis rate, the combined treatment with ActD and HU exerted an additive effect on p53 stabilization. These results indicated that (i) drugs inhibiting ribosome biogenesis may be highly effective in p53 wild-type cancers with a high ribosome biogenesis rate, as they induce apoptotic cell death, and (ii) the combination of drugs capable of stabilizing p53 through different mechanisms may be useful for treating cancers with a low ribosome biogenesis rate. PMID:25961931

  20. The genetic diversity of genus Bacillus and the related genera revealed by 16S rRNA gene sequences and ardra analyses isolated from geothermal regions of turkey

    Arzu Coleri Cihan


    Full Text Available Previously isolated 115 endospore-forming bacilli were basically grouped according to their temperature requirements for growth: the thermophiles (74%, the facultative thermophiles (14% and the mesophiles (12%. These isolates were taken into 16S rRNA gene sequence analyses, and they were clustered among the 7 genera: Anoxybacillus, Aeribacillus, Bacillus, Brevibacillus, Geobacillus, Paenibacillus, and Thermoactinomycetes. Of these bacilli, only the thirty two isolates belonging to genera Bacillus (16, Brevibacillus (13, Paenibacillus (1 and Thermoactinomycetes (2 were selected and presented in this paper. The comparative sequence analyses revealed that the similarity values were ranged as 91.4-100 %, 91.8- 99.2 %, 92.6- 99.8 % and 90.7 - 99.8 % between the isolates and the related type strains from these four genera, respectively. Twenty nine of them were found to be related with the validly published type strains. The most abundant species was B. thermoruber with 9 isolates followed by B. pumilus (6, B. lichenformis (3, B. subtilis (3, B. agri (3, B. smithii (2, T. vulgaris (2 and finally P. barengoltzii (1. In addition, isolates of A391a, B51a and D295 were proposed as novel species as their 16S rRNA gene sequences displayed similarities ≤ 97% to their closely related type strains. The AluI-, HaeIII- and TaqI-ARDRA results were in congruence with the 16S rRNA gene sequence analyses. The ARDRA results allowed us to differentiate these isolates, and their discriminative restriction fragments were able to be determined. Some of their phenotypic characters and their amylase, chitinase and protease production were also studied and biotechnologically valuable enzyme producing isolates were introduced in order to use in further studies.

  1. Phylogenetic and genetic diversity analysis in Leptospira species based on the sequence homology pattern of 16S rRNA gene

    Pasupuleti Sreenivasa Rao


    Full Text Available Leptospirosis is a bacterial zoonosis, caused by pathogenic spirochete which belongs to the genus Leptospira. It exists in diverse ecological habitats and affects almost all the mammals including humans. Several online databases like NCBI etc will provide the complete genomic sequence data of various Leptospira species. However, the Phylogenetic and genetic diversity Analysis in Leptospira species based on 16S rRNA gene has not studied in detail. Therefore the present study was conducted. Sequences of various species related to genus Leptospira obtained from the NCBI database etc and aligned (CLUSTAL_X. Two Phylogenetic trees were constructed (MEGA-5 in which the first one is related to various serovars of L. interrogans and the other is related to various species of Leptospira. The Phylogenetic trees revealed the relationship and genetic diversity of various serovars of L. interrogans and the other Leptospira species, with their nearest phylogenetic relatives. In the first tree, two major clades were observed which were named as A and B, whereas in the second tree, three major clades were observed and named as A, B and C respectively. Aquifex pyrophilus strain has been used for out grouping in both the trees. The genetic distance between the species in the phylogenetic tree is presented by a bar which represents 0.5 nucleotide substitutions per alignment position in the 16S rRNA gene sequence among the various serovars of L. interrogans while 0.05 nucleotide substitutions in case of various species related to the genus Leptospira. Thus, the findings from the above study confirm that the genus Leptospira exhibits genetic diversity in the 16S rRNA gene. [Int J Res Med Sci 2013; 1(4.000: 369-377

  2. 16S rRNA gene pyrosequencing reveals shift in patient faecal microbiota during high-dose chemotherapy as conditioning regimen for bone marrow transplantation.

    Montassier, Emmanuel; Batard, Eric; Massart, Sébastien; Gastinne, Thomas; Carton, Thomas; Caillon, Jocelyne; Le Fresne, Sophie; Caroff, Nathalie; Hardouin, Jean Benoit; Moreau, Philippe; Potel, Gilles; Le Vacon, Françoise; de La Cochetière, Marie France


    Gastrointestinal disturbances are a side-effect frequently associated with haematological malignancies due to the intensive cytotoxic treatment given in connection with bone marrow transplantation (BMT). However, intestinal microbiota changes during chemotherapy remain poorly described, probably due to the use of culture-based and low-resolution molecular methods in previous studies. The objective of our study was to apply a next generation DNA sequencing technology to analyse chemotherapy-induced changes in faecal microbiota. We included eight patients with non-Hodgkin's lymphoma undergoing one course of BMT conditioning chemotherapy. We collected a prechemotherapy faecal sample, the day before chemotherapy was initiated, and a postchemotherapy sample, collected 1 week after the initiation of chemotherapy. Total DNA was extracted from faecal samples, denaturing high-performance liquid chromatography based on amplification of the V6 to V8 region of the 16S ribosomal RNA (rRNA) gene, and 454-pyrosequencing of the 16 S rRNA gene, using PCR primers targeting the V5 and V6 hypervariable 16S rRNA gene regions were performed. Raw sequence data were screened, trimmed, and filtered using the QIIME pipeline. We observed a steep reduction in alpha diversity and significant differences in the composition of the intestinal microbiota in response to chemotherapy. Chemotherapy was associated with a drastic drop in Faecalibacterium and accompanied by an increase of Escherichia. The chemotherapy-induced shift in the intestinal microbiota could induce severe side effects in immunocompromised cancer patients. Our study is a first step in identifying patients at risk for gastrointestinal disturbances and to promote strategies to prevent this drastic shift in intestinal microbiota. PMID:24402367

  3. The Structure of Aquifex aeolicus Ribosomal Protein S8 Reveals a Unique Subdomain That Contributes to Extremely-Tight Association With 16S rRNA

    Menichelli, Elena; Edgcomb, Stephen P.; Recht, Michael I.; Williamson, James R.


    The assembly of ribonucleoprotein complexes occurs in a broad range of conditions, but the principles that promote assembly and allow function at high temperature are poorly understood. The ribosomal protein S8 from the hyperthemophilic bacterium Aquifex aeolicus (AS8) is unique in that there is a 41 residue insertion in the consensus S8 sequence. In addition, AS8 exhibits an unusually-high affinity for the 16S ribosomal RNA (rRNA), characterized by a picomolar dissociation constant that is a...

  4. Bacterial Community Composition in the Gut Content and Ambient Sediment of Sea Cucumber Apostichopus japonicus Revealed by 16S rRNA Gene Pyrosequencing

    Fei Gao; Fenghui Li; Jie Tan; Jingping Yan; Huiling Sun


    The composition of the bacterial communities in the contents of the foregut and hindgut of the sea cucumber Apostichopus japonicus and in the ambient surface sediment was surveyed by 16S rRNA gene 454-pyrosequencing. A total of 188,623 optimized reads and 15,527 operational taxonomic units (OTUs) were obtained from the ten gut contents samples and four surface sediment samples. The sequences in the sediments, foregut contents, and hindgut contents were assigned to 38.0±4.7, 31.2±6.2 and 27.8±...

  5. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.

    Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo


    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA

  6. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.

    Jeongsu Oh

    Full Text Available High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs. The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM

  7. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    Kaminska, Katarzyna H; Purta, Elzbieta; Hansen, Lykke H; Bujnicki, Janusz M; Vester, Birte; Long, Katherine S


    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...... a 4Fe-4S cluster, a SAM molecule coordinated to the iron-sulfur cluster (SAM1) and a SAM molecule that is the putative methyl group donor (SAM2). All mutations at predicted functional sites affect Cfr activity significantly as assayed by antibiotic susceptibility testing and primer extension...

  8. Cultivation-independent analysis reveals a shift in ciliate 18S rRNA gene diversity in a polycyclic aromatic hydrocarbon-polluted soil

    Lara, Enrique; Berney, Cédric; Harms, Hauke; Chatzinotas, Antonis


    Using cultivation-independent methods the ciliate communities of a clay-rich soil with a 90-year record of pollution by polycyclic aromatic hydrocarbons (PAH) (4.5 g kg−1 PAH) were compared with that of a nonpolluted soil collected in its vicinity and with similar properties. A ciliate-specific set of 18S rRNA gene targeting primers was designed and used to amplify DNA extracted from both soils (surface and 20 cm depth). Four clone libraries were generated with PCR products that covered an 18...

  9. hRRN3 is essential in the SL1-mediated recruitment of RNA Polymerase I to rRNA gene promoters

    Miller, Gail; Panov, Kostya I.; Friedrich, J. Karsten; TRINKLE-MULCAHY, LAURA; Lamond, Angus I; Zomerdijk, Joost C. B. M.


    A crucial step in transcription is the recruitment of RNA polymerase to promoters. In the transcription of human rRNA genes by RNA Polymerase I (Pol I), transcription factor SL1 has a role as the essential core promoter binding factor. Little is known about the mechanism by which Pol I is recruited. We provide evidence for an essential role for hRRN3, the human homologue of a yeast Pol I transcription factor, in this process. We find that whereas the bulk of human Pol I complexes (Iα) are tra...

  10. High-density universal 16S rRNA microarray analysis reveals broader diversity than typical clone library when sampling the environment.

    DeSantis, Todd Z; Brodie, Eoin L; Moberg, Jordan P; Zubieta, Ingrid X; Piceno, Yvette M; Andersen, Gary L


    Molecular approaches aimed at detection of a broad-range of prokaryotes in the environment routinely rely on classifying heterogeneous 16S rRNA genes amplified by polymerase chain reaction (PCR) using primers with broad specificity. The general method of sampling and categorizing DNA has been to clone then sequence the PCR products. However, the number of clones required to adequately catalog the majority of taxa in a sample is unwieldy. Alternatively, hybridizing target sequences to a universal 16S rRNA gene microarray may provide a more rapid and comprehensive view of prokaryotic community composition. This study investigated the breadth and accuracy of a microarray in detecting diverse 16S rRNA gene sequence types compared to clone-and-sequencing using three environmental samples: urban aerosol, subsurface soil, and subsurface water. PCR products generated from universal 16S rRNA gene-targeted primers were classified by using either the clone-and-sequence method or by hybridization to a novel high-density microarray of 297,851 probes complementary to 842 prokaryotic subfamilies. The three clone libraries comprised 1391 high-quality sequences. Approximately 8% of the clones could not be placed into a known subfamily and were considered novel. The microarray results confirmed the majority of clone-detected subfamilies and additionally demonstrated greater amplicon diversity extending into phyla not observed by the cloning method. Sequences matching operational taxonomic units within the phyla Nitrospira, Planctomycetes, and TM7, which were uniquely detected by the array, were verified with specific primers and subsequent amplicon sequencing. Subfamily richness detected by the array corresponded well with nonparametric richness predictions extrapolated from clone libraries except in the water community where clone-based richness predictions were greatly exceeded. It was concluded that although the microarray is unreliable in identifying novel prokaryotic taxa, it

  11. Cleavage of the sarcin–ricin loop of 23S rRNA differentially affects EF-G and EF-Tu binding

    García-Ortega, Lucía; Álvarez-García, Elisa; Gavilanes, José G.; Martínez-del-Pozo, Álvaro; Joseph, Simpson


    Ribotoxins are potent inhibitors of protein biosynthesis and inactivate ribosomes from a variety of organisms. The ribotoxin α-sarcin cleaves the large 23S ribosomal RNA (rRNA) at the universally conserved sarcin–ricin loop (SRL) leading to complete inactivation of the ribosome and cellular death. The SRL interacts with translation factors that hydrolyze GTP, and it is important for their binding to the ribosome, but its precise role is not yet understood. We studied the effect of α-sarcin on...

  12. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment

    Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo


    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology–a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in

  13. Genetic Diversity of Pasteurella dagmatis as Assessed by Analysis of the 16S rRNA and rpoB Gene Sequences

    Król, Jarosław; Bania, Jacek; Florek, Magdalena; Podkowik, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzisław


    A total of 16 Pasteurella dagmatis strains, including 11 feline and 4 canine isolates as well as one strain isolated from a tiger, were analyzed using partial 16S rRNA and rpoB gene sequence comparison. Phylogenetic studies based on both genes revealed that the population of P. dagmatis recovered from cats in Poland differs markedly from canine strains, constituting a well-separated cluster within Pasteurella sensu stricto species group. The isolate from a tiger seems to represent yet another...

  14. Phylogenetic positions of two marine ciliates, Metanophrys similis and Pseudocohnilembus hargisi (Protozoa, Ciliophora, Scuticociliatia), inferred from complete small subunit rRNA gene sequences


    The small subunit rRNA (SSrRNA) gene was sequenced for two marine scuticociliates Metanophrys similis and Pseudocohnilembus hargisi. The results show that this gene comprises 1763 and 1753 nucleotides in the two marine ciliates respectively.Metanophrys similis is phylogenetically closely related to the clade containing Mesanophrys carcini and Anophyroides haemophila, which branches basally to other species within the order Philasterida. Pseudocohnilembus hargisi groups with its congener, P. marinus, with strong bootstrap support. Paranophrys magna groups with the clade including Cohnilembus and Uronema, representing a sister clade to that containing the two Pseudocohnilembus species.

  15. Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene

    Mariza M. Coêlho


    Full Text Available Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla, were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species.

  16. Molecular identification of bacteria by fluorescence-based PCR-single-strand conformation polymorphism analysis of the 16S rRNA gene.

    Widjojoatmodjo, M N; Fluit, A.C.; Verhoef, J


    PCR-single-strand conformation polymorphism (PCR-SSCP) analysis is a rapid and convenient technique for the detection of mutations and allelic variants. We have adapted this technique for the identification of bacteria by PCR with fluorescein-labeled primers chosen from the conserved regions of the 16S rRNA gene flanking a variable region. The PCR product was denatured, separated on a nondenaturing gel, and detected by an automated DNA sequencer. The mobility of the single-stranded DNA is seq...

  17. Isolation and identification by 16S rRNA sequence analysis of plant growth-promoting azospirilla from the rhizosphere of wheat

    Ayyaz, Khadija; Zaheer, Ahmad; Rasul, Ghulam; Mirza, Muhammad Sajjad


    The main objective of the present study was to isolate phytohormone-producing, phosphate-solubilizing strains of Azospirillum from wheat to be used as inoculants for plant growth promotion. Five Azospirillum strains were isolated from the rhizosphere of field-grown wheat (Triticum aestivum L.), and it was confirmed by BOX-polymerase chain reaction (PCR) that the isolates were different and not re-isolates of the same strain. Sequence analysis of the PCR-amplified 16S rRNA gene indicated that ...

  18. Genetic Analysis of the Invariant Residue G791 in Escherichia coli 16S rRNA Implicates RelA in Ribosome Function▿

    Kim, Hong-Man; Ryou, Sang-Mi; Song, Woo-Seok; Sim, Se-Hoon; Cha, Chang-Jun; Han, Seung Hyun; Ha, Nam-Chul; Kim, Jae-Hong; BAE, Jeehyeon; Cunningham, Philip R.; Lee, Kangseok


    Previous studies identified G791 in Escherichia coli 16S rRNA as an invariant residue for ribosome function. In order to establish the functional role of this residue in protein synthesis, we searched for multicopy suppressors of the mutant ribosomes that bear a G-to-U substitution at position 791. We identified relA, a gene whose product has been known to interact with ribosomes and trigger a stringent response. Overexpression of RelA resulted in the synthesis of approximately 1.5 times more...

  19. Renibacterium salmoninarum, the causative agent of bacterial kidney disease in salmonid fish, detected by nested reverse transcription-PCR of 16S rRNA sequences.

    Magnússon, H B; Fridjónsson, O H; Andrésson, O S; Benediktsdóttir, E; Gudmundsdóttir, S; Andrésdóttir, V


    An assay based on reverse transcription and nested PCR amplification of hypervariable regions within the 16S rRNA sequence was used to specifically detect Renibacterium salmoninarum, the slowly growing causative agent of bacterial kidney disease in salmonid fish. This assay detected 1 to 10 bacteria per sample and took 1 to 2 days to perform. The assay was used to detect R. salmoninarum in ovarian fluid obtained from naturally infected fish. The assay was unreliable when it was used to examine kidney tissue. PMID:7529017

  20. A phylogenetic comparison of the 16S rRNA sequence of the fish pathogen, Renibacterium salmoninarum, to gram-positive bacteria.

    Gutenberger, S K; Giovannoni, S J; Field, K G; Fryer, J L; Rohovec, J S


    The 16S rRNA of Renibacterium salmoninarum, the causative agent of bacterial kidney disease in salmonids, was sequenced by reverse transcriptase to produce a nearly complete sequence (97%) of 1475 nucleotides. Phylogenetic comparisons to seventeen genera and signature sequence analysis indicated that R. salmoninarum was a member of the high G + C Gram-positive eubacterial subdivision although the reported G + C value is only 53%. A phylogenetic tree details the relationship of R. salmoninarum to ten actinomycetes from diverse environments. PMID:1709893

  1. Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene.

    Coêlho, Mariza M; Ferreira-Nozawa, Monica S; Nozawa, Sérgio R; Santos, André L W


    Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla), were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species. PMID:22215973

  2. Bacterial community structure in High-Arctic snow and freshwater as revealed by pyrosequencing of 16S rRNA genes and cultivation

    Annette K. Møller


    Full Text Available The bacterial community structures in High-Arctic snow over sea ice and an ice-covered freshwater lake were examined by pyrosequencing of 16S rRNA genes and 16S rRNA gene sequencing of cultivated isolates. Both the pyrosequence and cultivation data indicated that the phylogenetic composition of the microbial assemblages was different within the snow layers and between snow and freshwater. The highest diversity was seen in snow. In the middle and top snow layers, Proteobacteria, Bacteroidetes and Cyanobacteria dominated, although Actinobacteria and Firmicutes were relatively abundant also. High numbers of chloroplasts were also observed. In the deepest snow layer, large percentages of Firmicutes and Fusobacteria were seen. In freshwater, Bacteroidetes, Actinobacteria and Verrucomicrobia were the most abundant phyla while relatively few Proteobacteria and Cyanobacteria were present. Possibly, light intensity controlled the distribution of the Cyanobacteria and algae in the snow while carbon and nitrogen fixed by these autotrophs in turn fed the heterotrophic bacteria. In the lake, a probable lower light input relative to snow resulted in low numbers of Cyanobacteria and chloroplasts and, hence, limited input of organic carbon and nitrogen to the heterotrophic bacteria. Thus, differences in the physicochemical conditions may play an important role in the processes leading to distinctive bacterial community structures in High-Arctic snow and freshwater.

  3. Footprints of a trypanosomatid RNA world: pre-small subunit rRNA processing by spliced leader addition trans-splicing

    Mario Gustavo Mayer


    Full Text Available The addition of a capped mini-exon [spliced leader (SL] through trans-splicing is essential for the maturation of RNA polymerase (pol II-transcribed polycistronic pre-mRNAs in all members of the Trypanosomatidae family. This process is an inter-molecular splicing reaction that follows the same basic rules of cis-splicing reactions. In this study, we demonstrated that mini-exons were added to precursor ribosomal RNA (pre-rRNA are transcribed by RNA pol I, including the 5' external transcribed spacer (ETS region. Additionally, we detected the SL-5'ETS molecule using three distinct methods and located the acceptor site between two known 5'ETS rRNA processing sites (A' and A1 in four different trypanosomatids. Moreover, we detected a polyadenylated 5'ETS upstream of the trans-splicing acceptor site, which also occurs in pre-mRNA trans-splicing. After treatment with an indirect trans-splicing inhibitor (sinefungin, we observed SL-5'ETS decay. However, treatment with 5-fluorouracil (a precursor of RNA synthesis that inhibits the degradation of pre-rRNA led to the accumulation of SL-5'ETS, suggesting that the molecule may play a role in rRNA degradation. The detection of trans-splicing in these molecules may indicate broad RNA-joining properties, regardless of the polymerase used for transcription.

  4. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A


    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA. PMID:26853884

  5. Purification, crystallization and preliminary X-ray diffraction analysis of the 23S rRNA methyltransferase RlmJ from Escherichia coli

    The 23S rRNA methyltransferase RlmJ from E. coli has been cloned, expressed, purified and crystallized. X-ray diffraction data to 1.85 Å resolution have been collected from the apo RlmJ crystals. Methyltransferase RlmJ uses the cofactor S-adenosylmethionine to methylate the exocyclic nitrogen N6 of nucleotide A2030 in 23S rRNA during ribosome assembly in Escherichia coli. RlmJ with a C-terminal hexahistidine tag was overexpressed in E. coli and purified as a monomer using Ni2+-affinity and size-exclusion chromatography. The recombinant RlmJ was crystallized using the sitting-drop vapour-diffusion method and a full data set was collected to 1.85 Å resolution from a single apo crystal. The crystals belonged to space group P21, with unit-cell parameters a = 46.9, b = 77.8, c = 82.5 Å, β = 104°. Data analysis suggested two molecules per asymmetric unit and a Matthews coefficient of 2.20 Å3 Da−1

  6. Design and evaluation of universal 16S rRNA gene primers for high-throughput sequencing to simultaneously detect DAMO microbes and anammox bacteria.

    Lu, Yong-Ze; Ding, Zhao-Wei; Ding, Jing; Fu, Liang; Zeng, Raymond J


    To develop universal 16S rRNA gene primers for high-throughput sequencing for the simultaneous detection of denitrifying anaerobic methane oxidation (DAMO) archaea, DAMO bacteria, and anaerobic ammonium oxidation (anammox) bacteria, four published primer sets (PS2-PS5) were modified. The overall coverage of the four primer pairs was evaluated in silico with the Silva SSU r119 dataset. Based on the virtual evaluation, the two best primer pairs (PS4 and PS5) were selected for further verification. Illumina MiSeq sequencing of a freshwater sediment and a culture from a DAMO-anammox reactor using these two primer pairs revealed that PS5 (341b4F-806R) was the most promising universal primer pair. This pair of primers detected both archaea and bacteria with less bias than PS4. Furthermore, an anaerobic fermentation culture and a wastewater treatment plant culture were used to verify the accuracy of PS5. More importantly, it detected DAMO archaea, DAMO bacteria, and anammox bacteria simultaneously with no false positives appeared. This universal 16S rRNA gene primer pair extends the existing molecular tools for studying the community structures and distributions of DAMO microbes and their potential interactions with anammox bacteria in different environments. PMID:26454634

  7. Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers.

    Myer, Phillip R; Kim, MinSeok; Freetly, Harvey C; Smith, Timothy P L


    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplification primer selection, and read length, which can affect the apparent microbial community. In this study, we compared short read 16S rRNA variable regions, V1-V3, with that of near-full length 16S regions, V1-V8, using highly diverse steer rumen microbial communities, in order to examine the impact of technology selection on phylogenetic profiles. Short paired-end reads from the Illumina MiSeq platform were used to generate V1-V3 sequence, while long "circular consensus" reads from the Pacific Biosciences RSII instrument were used to generate V1-V8 data. The two platforms revealed similar microbial operational taxonomic units (OTUs), as well as similar species richness, Good's coverage, and Shannon diversity metrics. However, the V1-V8 amplified ruminal community resulted in significant increases in several orders of taxa, such as phyla Proteobacteria and Verrucomicrobia (P niche-specific database to use in analyzing data from shorter read technologies when budgetary constraints preclude use of near-full length 16S sequencing. PMID:27282101

  8. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.


    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  9. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H


    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  10. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    Walters , William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada , Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, Greg; Fuhrman, Jed A.; Apprill, Amy; Knight, Rob


    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of datasets amplified with varied primers requires attention. Here we examine the performance of modified 16S rRNA gene and ITS primers for archaea/bacteria and fungi, respectively, with non-aquatic samples. We moved primer barcodes to the 5’-end, allowing for a range of different 3’ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4-5 of the 16S rRNA gene. We additionally demonstrate that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection of Thaumarchaeota and SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies.

  11. Vertical Distribution of Bacterial Communities in the Indian Ocean as Revealed by Analyses of 16S rRNA and nasA Genes.

    Jiang, Xuexia; Jiao, Nianzhi


    Bacteria play an important role in the marine biogeochemical cycles. However, research on the bacterial community structure of the Indian Ocean is scarce, particularly within the vertical dimension. In this study, we investigated the bacterial diversity of the pelagic, mesopelagic and bathypelagic zones of the southwestern Indian Ocean (50.46°E, 37.71°S). The clone libraries constructed by 16S rRNA gene sequence revealed that most phylotypes retrieved from the Indian Ocean were highly divergent from those retrieved from other oceans. Vertical differences were observed based on the analysis of natural bacterial community populations derived from the 16S rRNA gene sequences. Based on the analysis of the nasA gene sequences from GenBank database, a pair of general primers was developed and used to amplify the bacterial nitrate-assimilating populations. Environmental factors play an important role in mediating the bacterial communities in the Indian Ocean revealed by canonical correlation analysis. PMID:27407295

  12. Mineral Type and Solution Chemistry Affect the Structure and Composition of Actively Growing Bacterial Communities as Revealed by Bromodeoxyuridine Immunocapture and 16S rRNA Pyrosequencing.

    Kelly, L C; Colin, Y; Turpault, M-P; Uroz, S


    Understanding how minerals affect bacterial communities and their in situ activities in relation to environmental conditions are central issues in soil microbial ecology, as minerals represent essential reservoirs of inorganic nutrients for the biosphere. To determine the impact of mineral type and solution chemistry on soil bacterial communities, we compared the diversity, composition, and functional abilities of a soil bacterial community incubated in presence/absence of different mineral types (apatite, biotite, obsidian). Microcosms were prepared containing different liquid culture media devoid of particular essential nutrients, the nutrients provided only in the introduced minerals and therefore only available to the microbial community through mineral dissolution by biotic and/or abiotic processes. By combining functional screening of bacterial isolates and community analysis by bromodeoxyuridine DNA immunocapture and 16S rRNA gene pyrosequencing, we demonstrated that bacterial communities were mainly impacted by the solution chemistry at the taxonomic level and by the mineral type at the functional level. Metabolically active bacterial communities varied with solution chemistry and mineral type. Burkholderia were significantly enriched in the obsidian treatment compared to the biotite treatment and were the most effective isolates at solubilizing phosphorous or mobilizing iron, in all the treatments. A detailed analysis revealed that the 16S rRNA gene sequences of the OTUs or isolated strains assigned as Burkholderia in our study showed high homology with effective mineral-weathering bacteria previously recovered from the same experimental site. PMID:27138048

  13. Analysis of 16S rRNA and mxaF genes reveling insights into Methylobacterium niche-specific plant association

    Manuella Nóbrega Dourado


    Full Text Available The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant.

  14. The phylogeny of Aerococcus and Pediococcus as determined by 16S rRNA sequence analysis: description of Tetragenococcus gen. nov.

    Collins, M D; Williams, A M; Wallbanks, S


    The phylogenetic interrelationships of the genera Pediococcus and Aerococcus were investigated using reverse transcriptase sequencing of 16S rRNA. The genus Pediococcus was found to be phylogenetically heterogeneous. The four species P. acidilactici, P. damnosus, P. parvulus and P. pentosaceus formed a phylogenetically distinct group. Within this pediococcal cluster, P. acidilactici was closely related to P. pentosaceus whereas P. damnosus showed a specific relationship with P. parvulus. The species P. dextrinicus, although showing significant sequence relatedness with these pediococcal species, was peripheral to the genus. Pediococcus halophilus exhibited low sequence homology with all of the species examined and formed a distinct line of descent. Pediococcus halophilus exhibited a closer affinity with enterococci and carnobacteria than with the other lactic acid bacteria. Pediococcus urinae-equi was phylogenetically very closely related to Aerococcus viridans. The 16S rRNA sequences of the type strains of these species differed by only two nucleotides (99.9% sequence homology) and clearly demonstrate that P. urinae-equi is a member of the genus Aerococcus. PMID:2227360

  15. Comparative analysis of 16S rRNA and amoA genes from archaea selected with organic and inorganic amendments in enrichment culture.

    Xu, Mouzhong; Schnorr, Jon; Keibler, Brandon; Simon, Holly M


    We took advantage of a plant-root enrichment culture system to characterize mesophilic soil archaea selected through the use of organic and inorganic amendments. Comparative analysis of 16S rRNA and amoA genes indicated that specific archaeal clades were selected under different conditions. Three amoA sequence clades were identified, while for a fourth group, identified by 16S rRNA gene analysis alone and referred to as the "root" clade, we detected no corresponding amoA gene. The amoA-containing archaea were present in media with either organic or inorganic amendments, whereas archaea representing the root clade were present only when organic amendment was used. Analysis of amoA gene abundance and expression, together with nitrification-coupled growth assays, indicated potential growth by autotrophic ammonia oxidation for members of two group 1.1b clades. Increased abundance of one of these clades, however, also occurred upon the addition of organic amendment. Finally, although amoA-containing group 1.1a archaea were present in enrichments, we detected neither expression of amoA genes nor evidence for nitrification-coupled growth of these organisms. These data support a model of a diverse metabolic community in mesophilic soil archaea that is just beginning to be characterized. PMID:22267662

  16. Morphology, ontogenetic features and SSU rRNA gene-based phylogeny of a soil ciliate, Bistichella cystiformans spec. nov. (Protista, Ciliophora, Stichotrichia).

    Fan, Yangbo; Hu, Xiaozhong; Gao, Feng; Al-Farraj, Saleh A; Al-Rasheid, Khaled A S


    The morphology, ontogeny and SSU rRNA gene-based phylogeny of Bistichella cystiformans spec. nov., isolated from the slightly saline soil of a mangrove wetland in Zhanjiang, southern China, were investigated. The novel species was characterized by having five to eight buccal cirri arranged in a row, three to five transverse cirri, four macronuclear nodules aligned, and 17-32 and 20-34 cirri in frontoventral rows V and VI, respectively, both extending to the transverse cirri. The main ontogenetic features of the novel species were as follows: (1) the parental adoral zone of the membranelles is completely inherited by the proter; (2) the frontoventral and transverse cirri are formed in a six-anlagen mode; (3) basically, the frontal-ventral-transverse cirral anlagen II-V generate one transverse cirrus each at their posterior ends, while anlage VI provides no transverse cirrus; (4) both marginal rows and dorsal kineties develop intrakinetally, no dorsal kinety fragment is formed; and (5) the macronuclear nodules fuse into a single mass at the middle stage. Phylogenetic analyses based on the SSU rRNA gene showed that the novel species groups with the clade containing Bistichella variabilis, Parabistichella variabilis, Uroleptoides magnigranulosus and two species of the genus Orthoamphisiella. Given present knowledge, it was considered to be still too early to come to a final conclusion regarding the familial classification of the genus Bistichella; further investigations of key taxa with additional molecular markers are required. PMID:25242538

  17. Phylogenetic positions of four hypotrichous ciliates (Protista, Ciliophora) based on SSU rRNA gene, with notes on their morphological characters.

    Yang, Caiting; Liu, An; Xu, Yusen; Xu, Yuan; Fan, Xinpeng; Al-Farraj, Saleh A; Ni, Bing; Gu, Fukang


     The morphology and infraciliature of the four hypotrichous ciliates; Rigidohymena inquieta (Stokes, 1887) Berger, 2011, Pattersoniella vitiphila Foissner, 1987, Notohymena australis Foissner & O' Donoghue, 1990, and Cyrtohymena (Cyrtohymenides) australis (Foissner, 1995) Foissner, 2004, collected from east China, were investigated by using live observation and protargol impregnation method. An improved diagnosis for R. inquieta was supplied based on descriptions of present and previous populations. New morphology and morphogenesis information based on Chinese populations of another three hypotrichids were also supplemented. The Small-subunit rRNA (SSU rRNA) gene sequences of the four species were characterized and their phylogenetic positions were revealed by means of Bayesian inference and Maximum-likelihood analysis. The analyses shows that R. inquieta clusters with other members of the subfamily Stylonychinae, which confirms the monophyly of the subfamily and verified R. inquieta as a separated species from R. candens though it differs from others mainly by body size. C. (C.) australis occupying the basal position of the clade which contains cyrtohymenids and some other groups, declines the idea of separating Cyrtohymena into two subgenus. Notohymena australis and China population of Pattersoniella vitiphila respectively clustering with their congeners correspond well with the systematics revealed by morphological similarities. PMID:26623736

  18. Modified nucleotides m(2)G966/m(5)C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon.

    Prokhorova, Irina V; Osterman, Ilya A; Burakovsky, Dmitry E; Serebryakova, Marina V; Galyamina, Maria A; Pobeguts, Olga V; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G; Govorun, Vadim M; Bogdanov, Alexey A; Sergiev, Petr V; Dontsova, Olga A


    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show--using proteomic analysis and dual fluorescence reporter in vivo assays--that m(2)G966 and m(5)C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m(2)G966 and m(5)C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon. PMID:24241179

  19. Molecular characterisation of Mycoplasma hyorhinis isolated from pigs using pulsed-field gel electrophoresis and 16S rRNA sequencing.

    Yamaguti, Maurício; Oliveira, Rosângela C; Marques, Lucas M; Buzinhani, Melissa; Buim, Marcos R; Neto, Renata L; Guimarães, Ana Márcia S; Timenetsky, Jorge


    Economic loss in pig breeding is common due to respiratory disorders, and Mycoplasma hyopneumoniae and Mycoplasma hyorhinis, namely, are the most common infectious agents. The aim of this study is to recover these mollicutes and detect their genotypic variations by pulsed-field gel electrophoresis (PFGE) and sequencing the 16 s rRNA gene. One hundred and twenty-six swabs from tonsil and nasal mucus of pigs with respiratory disorders were analysed. A total of 78 lungs were sampled, as well as two trachea and two tonsils obtained from animals with respiratory disorder. A total of 59 isolates were obtained: 1 (1.70 per cent) of M hyopneumoniae, 2 (3.40 per cent) of Mycoplasma flocculare and 56 (94.90 per cent) of M hyorhinis. The PFGE for M hyorhinis showed 10 profiles with enzyme AvaI and 9 profiles with XhoI. A low polymorphism of the 16sRNS gene was detected in M hyorhinis isolates compared with the type strain in the GenBank. M hyorhinis isolates of different herds showed a large heterogenicity with enzymes AvaI and XhoI. The sequencing of the 16S rRNA gene allowed for analysing the interspecific and intraspecific variations of isolated mycoplasmas. PMID:26688737

  20. YbeA is the m3Psi methyltransferase RlmH that targets nucleotide 1915 in 23S rRNA

    Purta, Elzbieta; Kaminska, Katarzyna H; Kasprzak, Joanna M;


    Pseudouridines in the stable RNAs of Bacteria are seldom subjected to further modification. There are 11 pseudouridine (Psi) sites in Escherichia coli rRNA, and further modification is found only at Psi1915 in 23S rRNA, where the N-3 position of the base becomes methylated. Here, we report the...... identity of the E. coli methyltransferase that specifically catalyzes methyl group addition to form m(3)Psi1915. Analyses of E. coli rRNAs using MALDI mass spectrometry showed that inactivation of the ybeA gene leads to loss of methylation at nucleotide Psi1915. Methylation is restored by complementing the...... knockout strain with a plasmid-encoded copy of ybeA. Homologs of the ybeA gene, and thus presumably the ensuing methylation at nucleotide m(3)Psi1915, are present in most bacterial lineages but are essentially absent in the Archaea and Eukaryota. Loss of ybeA function in E. coli causes a slight slowing of...

  1. Nematode 18S rRNA gene is a reliable tool for environmental biosafety assessment of transgenic banana in confined field trials.

    Nakacwa, R; Kiggundu, A; Talwana, H; Namaganda, J; Lilley, C; Tushemereirwe, W; Atkinson, H


    Information on relatedness in nematodes is commonly obtained by DNA sequencing of the ribosomal internal transcribed spacer region. However, the level of diversity at this locus is often insufficient for reliable species differentiation. Recent findings suggest that the sequences of a fragment of the small subunit nuclear ribosomal DNA (18S rRNA or SSU), identify genera of soil nematodes and can also distinguish between species in some cases. A database of soil nematode genera in a Ugandan soil was developed using 18S rRNA sequences of individual nematodes from a GM banana confined field trial site at the National Agricultural Research Laboratories, Kawanda in Uganda. The trial was planted to evaluate transgenic bananas for resistance to black Sigatoka disease. Search for relatedness of the sequences gained with entries in a public genomic database identified a range of 20 different genera and sometimes distinguished species. Molecular markers were designed from the sequence information to underpin nematode faunal analysis. This approach provides bio-indicators for disturbance of the soil environment and the condition of the soil food web. It is being developed to support environmental biosafety analysis by detecting any perturbance by transgenic banana or other GM crops on the soil environment. PMID:23661261

  2. The utility of diversity profiling using Illumina 18S rRNA gene amplicon deep sequencing to detect and discriminate Toxoplasma gondii among the cyst-forming coccidia.

    Cooper, Madalyn K; Phalen, David N; Donahoe, Shannon L; Rose, Karrie; Šlapeta, Jan


    Next-generation sequencing (NGS) has the capacity to screen a single DNA sample and detect pathogen DNA from thousands of host DNA sequence reads, making it a versatile and informative tool for investigation of pathogens in diseased animals. The technique is effective and labor saving in the initial identification of pathogens, and will complement conventional diagnostic tests to associate the candidate pathogen with a disease process. In this report, we investigated the utility of the diversity profiling NGS approach using Illumina small subunit ribosomal RNA (18S rRNA) gene amplicon deep sequencing to detect Toxoplasma gondii in previously confirmed cases of toxoplasmosis. We then tested the diagnostic approach with species-specific PCR genotyping, histopathology and immunohistochemistry of toxoplasmosis in a Risso's dolphin (Grampus griseus) to systematically characterise the disease and associate causality. We show that the Euk7A/Euk570R primer set targeting the V1-V3 hypervariable region of the 18S rRNA gene can be used as a species-specific assay for cyst-forming coccidia and discriminate T. gondii. Overall, the approach is cost-effective and improves diagnostic decision support by narrowing the differential diagnosis list with more certainty than was previously possible. Furthermore, it supplements the limitations of cryptic protozoan morphology and surpasses the need for species-specific PCR primer combinations. PMID:26801593

  3. Molecular analysis of 18S rRNA gene of Cryptosporidium parasites from patients living in Iran, Malawi, Nigeria and Vietnam.

    Ghaffari, Salman; Kalantari, Narges


    Cryptosporidium species are one of the most common causes of gastrointestinal infection in humans around the world. This study has aimed to investigate the hyper variable region of the 18S rRNA gene in Cryptosporidium for exact parasite identification. DNA was extracted from 26 fecal samples from which initially Cryptosporidium oocysts were identified by Ziehl-Neelsen acid-fast , Auramine phenol and ELISA techniques. Nested PCR, targeting the most polymorphic region of the 18S rRNA gene and genotyping was performed by restriction endonuclease digestion of the PCR product followed by nucleotide sequencing and phylogenic analysis. Among 26 isolates analyzed, three species of Cryptosporidium were identified; 38.5% of the isolates were C. hominis while 53.8% of the isolates were C. parvum and 7.7% of the isolates were C. meleagridis, which the last two species have the potentially zoonotic transmission. The only 11T subtype of C. hominis was demonstrated. These strains clustered distinctly into either human or animal origin regardless of the geographical origin, age, or immunity status of the patients. In summary, this work is the first report of C. meleagridis infecting human in Iran. Moreover, it suggested that multi-locus study of Cryptosporidium species in developing countries would be necessary to determine the extent of transmission of cryptosporidiosis in the populations. PMID:24551771

  4. Assessment of fecal pollution sources in a small northern-plains watershed using PCR and phylogenetic analyses of Bacteroidetes 16S rRNA gene

    Lamendella, R.; Domingo, J.W.S.; Oerther, D.B.; Vogel, J.R.; Stoeckel, D.M.


    We evaluated the efficacy, sensitivity, host-specificity, and spatial/temporal dynamics of human- and ruminant-specific 16S rRNA gene Bacteroidetes markers used to assess the sources of fecal pollution in a fecally impacted watershed. Phylogenetic analyses of 1271 fecal and environmental 16S rRNA gene clones were also performed to study the diversity of Bacteroidetes in this watershed. The host-specific assays indicated that ruminant feces were present in 28-54% of the water samples and in all sampling seasons, with increasing frequency in downstream sites. The human-targeted assays indicated that only 3-5% of the water samples were positive for human fecal signals, although a higher percentage of human-associated signals (19-24%) were detected in sediment samples. Phylogenetic analysis indicated that 57% of all water clones clustered with yet-to-be-cultured Bacteroidetes species associated with sequences obtained from ruminant feces, further supporting the prevalence of ruminant contamination in this watershed. However, since several clusters contained sequences from multiple sources, future studies need to consider the potential cosmopolitan nature of these bacterial populations when assessing fecal pollution sources using Bacteroidetes markers. Moreover, additional data is needed in order to understand the distribution of Bacteroidetes host-specific markers and their relationship to water quality regulatory standards. ?? 2006 Federation of European Microbiological Societies.

  5. From learning taxonomies to phylogenetic learning: Integration of 16S rRNA gene data into FAME-based bacterial classification


    Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for

  6. From learning taxonomies to phylogenetic learning: Integration of 16S rRNA gene data into FAME-based bacterial classification

    Dawyndt Peter


    Full Text Available Abstract Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the

  7. A molecular biological study on identification of common septicemia bacteria using 16s-23s rRNA gene spacer regions

    傅君芬; 虞和永; 尚世强; 洪文澜; 陆淼泉; 李建平


    In the search for a rapid and reliable method for identification of bacteria in blood and cerebrospinal fluid , we developed a unified set of primers and used them under polymerase chain reaction(PCR) to amplify the spacer regions between the 16s and 23s genes in the prokaryotic rRNA genetic loci . Spacer regions within these loci showed a significant level of length and sequence polymorphism across most of the species lines. A generic pair of priming sequences was selected from highly conserved sequences in the 16s and 23s genes occurring adjacent to these polymorphic regions. This single set of primers and reaction conditions were used for the amplification of the 16s-23s spacer regions for 61 strains of standard bacteria and corresponding clinical isolates belonging to 20 genera and 27 species, including Listeria, Staphylococcus and Salmonella species, et al. When the spacer amplification products were resolved by electrophoresis, the resulting patterns could be used to distinguish most of the bacteria species within the test group, and the amplification products of the clinical isolates clustered at the standard species level. Some species presenting similar pattern were further analyzed by HinfI or AluI digestion or DNA clone and sequences analysis in order to establish the specific 16s-23s rRNA gene spacer regions map. Analysis of 42 blood specimens from septicemic neonates and 6 CSF specimens from suspected purulent meningitis patients by bacterial culture and PCR-RFLP(Restriction Fregament Length Polymorphism) showed that 15 specimens of blood culture were positive(35.7%) in the 42 septicemic neonates; 27 specimens were positive(64.2%) by PCR, and that the positive rate by PCR was significantly higher than that by blood culture(P<0.01). Among the 6 CSF specimens, one specimen found positive by blood culture was also positive by PCR, two found negative by blood culture showed positive by PCR; all three were S.epidermidis according to the DNA map. One C

  8. Prevalence of 16S rRNA Methylase Gene rmtB Among Escherichia coli Isolated from Bovine Mastitis in Ningxia, China.

    Yu, Ting; He, Tao; Yao, Hong; Zhang, Jin-Bao; Li, Xiao-Na; Zhang, Rong-Ming; Wang, Gui-Qin


    The aim of this study is to understand the prevalence and molecular characterization of 16S rRNA methylase gene, rmtB, among Escherichia coli strains isolated from bovine mastitis in China. A total of 245 E. coli isolates were collected from bovine mastitis in China between 2013 and 2014 and were screened for 16S rRNA methylase genes (armA, rmtA, rmtB, rmtC, rmtD, rmtE, and npmA) by polymerase chain reaction. About 5.3% (13/245) of the isolates carried the rmtB gene; the isolates were highly resistant to amikacin. Thirteen rmtB-positive strains were analyzed for the presence of extended-spectrum β-lactamase genes (bla(TEM), bla(CTX-M), bla(OXA), and bla(SHV)). All the isolates harbored both bla(TEM-1) and bla(CTX-M-15) genes and two of the isolates were also positive for bla(OXA-1). Pulsed-field gel electrophoresis (PFGE) analysis indicated that the nine rmtB-positive strains belonging to ST10 from one farm showed the similar PFGE pattern, indicating a clonal expansion in this farm. S1-PFGE and Southern blotting showed that 12 isolates harbored the rmtB gene in plasmids of two different sizes (≈45 kb [n=10] and ≈48 kb [n=2]), while only 1 strain harbored the rmtB gene in the chromosome. These plasmids were transferable by conjugation studies, and two isolates from two respective farms carried the same size of plasmid, suggesting that the horizontal transmission of plasmids also contributed to the spread of rmtB gene. This is the first report of prevalence of the 16S rRNA methylase gene rmtB among E. coli isolated from bovine mastitis in China, and rmtB-carrying E. coli may pose a threat to the treatment of bovine mastitis. PMID:26203763

  9. Identification of Raoultella terrigena as a Rare Causative Agent of Subungual Abscess Based on 16S rRNA and Housekeeping Gene Sequencing

    Yu Wang


    Full Text Available A 63-year-old-man was admitted to our hospital with severe subungual abscess. Bacteria were isolated from pus samples, and an inconsistent identification was shown by VITEK 2 system and MALDI-TOF mass spectrometry as Raoultella planticola and Raoultella terrigena, respectively. Molecular identification by 16S rRNA sequencing suggested that the isolate is R. terrigena, and this was further demonstrated by sequencing three housekeeping genes (rpoB, gyrA, and parC with phylogenetic analysis. To our knowledge, this is the first report of subungual abscess caused by R. terrigena, a rare case of human infection due to soil bacterium. Our study highlights the technique importance on this pathogen identification.

  10. Update on Pneumocystis carinii f. sp. hominis typing based on nucleotide sequence variations in internal transcribed spacer regions of rRNA genes

    Lee, C H; Helweg-Larsen, J; Tang, X; Jin, S; Li, B; Bartlett, M S; Lu, Jingquan; Lundgren, B; Lundgren, J D; Olsson, M; Lucas, Sandra; Roux, P; Cargnel, A; Atzori, C; Matos, O; Smith, J W


    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the...... previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are...... named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study....

  11. Investigating the etiology of bovine digital dermatitis by a combination of 16S rRNA gene analysis and fluorescence in situ hybridization

    Schou, Kirstine Klitgaard; Rasmussen, Marianne; Capion, Nynne; Boye, Mette; Jensen, Tim Kåre

    Bovine digital dermatitis, the cause of lameness and wasting in cattle, was first reported in 1974. Today, this disease has considerable negative effects on animal welfare and production economy in many parts of the world. A bacterial etiology of digital dermatitis is now well documented, and the...... etiology of the disease. Here, a PCR-based approach targeting the 16S rRNA gene along with fluorescence in situ hybridization was used to determine the prevalence and diversity of 17 Treponema phylotypes in 85 digital dermatitis lesions from six Danish dairy herds as well as additional biopsies of healthy...... skin and previously examined digital dermatitis lesions. All skin samples were evaluated histopathologically for possible predisposing abnormalities. Furthermore, fluorescence in situ hybridization tests for Fusobacterium. necrophorum and D. nodosus was applied. All lesions revealed intermingled...

  12. Specific detection of Pasteurella multocida in chickens with fowl cholera and in pig lung tissues using fluorescent rRNA in situ hybridization

    Mbuthia, P.G.; Christensen, H.; Boye, Mette;


    further detected in formalin-fixed paraffin-embedded lung tissues from experimental fowl cholera in chickens and infections in pigs. In chicken lung tissues P. multocida cells were detected singly, in pairs, as microcolonies, and as massive colonies within air capillaries (septa and lumen), parabronchial...... a suitable and fast method for specific detection of P. multocida in histological formalin-fixed tissues. The test was replicable and reproducible and is recommended as a supplementary test for diagnosis and as a tool in pathogenesis studies of fowl cholera and respiratory tract infections in pigs......A Pasteurella multocida species-specific oligonucleotide probe, pmhyb449, targeting 16S rRNA was designed and evaluated by whole-cell hybridization against 22 selected reference strains in animal tissues. it differentiated P. multocida from other bacterial species of the families Pasteurellaceae...

  13. Phylogenetic relationships of the marine Haplosclerida (Phylum Porifera) employing ribosomal (28S rRNA) and mitochondrial (cox1, nad1) gene sequence data.

    Redmond, Niamh E; Raleigh, Jean; van Soest, Rob W M; Kelly, Michelle; Travers, Simon A A; Bradshaw, Brian; Vartia, Salla; Stephens, Kelly M; McCormack, Grace P


    The systematics of the poriferan Order Haplosclerida (Class Demospongiae) has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, are highly congruent and suggest the presence of four clades. Clade A is comprised primarily of species of Haliclona and Callyspongia, and clade B is comprised of H. simulans and H. vansoesti (Family Chalinidae), Amphimedon queenslandica (Family Niphatidae) and Tabulocalyx (Family Phloeodictyidae), Clade C is comprised primarily of members of the Families Petrosiidae and Niphatidae, while Clade D is comprised of Aka species. The polyphletic nature of the suborders, families and genera described in other studies is also found here. PMID:21931685

  14. Specific detection of the genus Serpulina, S-hyodysenteriae and S-pilosicoli in porcine intestines by fluorescent rRNA in situ hybridization

    Boye, Mette; Jensen, Tim Kåre; Møller, Kristian;


    detection of Serpulina isolates at genus level as well as for specific detection of S. hyodysenteriae and S. pilosicoli in formalin-fixed colon tissue sections from pigs suffering from swine dysentery and porcine colonic spirochaetosis, respectively. Tissue sections were also used from pigs without any...... intestinal disorders as controls for estimating the specificity of the probes. The probes developed in this study thus had the potential of specific identification and histological recognition obtained in the formalin-fixed tissue samples.......A fluorescent-labelled in situ hybridization method targeting rRNA was devised to facilitate specific identification and diagnosis of diarrhoea and colitis in pigs caused by the genus Serpulina, as well as to distinguish the species Serpulina hyodysenteriae and Serpulina pilosicoli in formalin-fixed...

  15. Cyanobacterial ecotypes in different optical microenvironments of a 68 C hot spring mat community revealed by 16S-23S rRNA internal transcribed spacer region variation

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea;


    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynth......We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic...... distinct populations over the vertical interval. We were unable to identify patterns in genetic variation in Synechococcus 16S rRNA sequences that correlate with different vertically distributed populations. However, patterns of variation at the internal transcribed spacer locus separating 16S and 23S r...

  16. Protist 18S rRNA gene Sequence Analysis Reveals Multiple Sources of Organic Matter Contributing to Turbidity Maxima of the Columbia River Estuary

    Herfort, Lydie; Peterson, Tawnya D.; McCue, Lee Ann; Zuber, Peter A.


    The Columbia River estuary is traditionally considered a detritus-based ecosystem fueled in summer by organic matter (OM) from expired freshwater diatoms. Since Estuarine Turbidity Maxima (ETM) are sites of accumulation and transformation of this phytoplankton-derived OM, to further characterize the ETM protist assemblage, we collected in August 2007 bottom waters throughout an ETM event, as well as surface water during the peak of bottom turbidity, and performed biogeochemical, microscopic and molecular (18S rRNA gene clone libraries) analyses. These data confirmed that the majority of the particulate OM in ETMs is derived from chlorophyll a-poor particulate organic carbon tagged by DNA too damaged to be detected by molecular analysis.

  17. Assessment of a 16S rRNA amplicon Illumina sequencing procedure for studying the microbiome of a symbiont-rich aphid genus.

    Jousselin, E; Clamens, A-L; Galan, M; Bernard, M; Maman, S; Gschloessl, B; Duport, G; Meseguer, A S; Calevro, F; Coeur d'acier, A


    The bacterial communities inhabiting arthropods are generally dominated by a few endosymbionts that play an important role in the ecology of their hosts. Rather than comparing bacterial species richness across samples, ecological studies on arthropod endosymbionts often seek to identify the main bacterial strains associated with each specimen studied. The filtering out of contaminants from the results and the accurate taxonomic assignment of sequences are therefore crucial in arthropod microbiome studies. We aimed here to validate an Illumina 16S rRNA gene sequencing protocol and analytical pipeline for investigating endosymbiotic bacteria associated with aphids. Using replicate DNA samples from 12 species (Aphididae: Lachninae, Cinara) and several controls, we removed individual sequences not meeting a minimum threshold number of reads in each sample and carried out taxonomic assignment for the remaining sequences. With this approach, we show that (i) contaminants accounted for a negligible proportion of the bacteria identified in our samples; (ii) the taxonomic composition of our samples and the relative abundance of reads assigned to a taxon were very similar across PCR and DNA replicates for each aphid sample; in particular, bacterial DNA concentration had no impact on the results. Furthermore, by analysing the distribution of unique sequences across samples rather than aggregating them into operational taxonomic units (OTUs), we gained insight into the specificity of endosymbionts for their hosts. Our results confirm that Serratia symbiotica is often present in Cinara species, in addition to the primary symbiont, Buchnera aphidicola. Furthermore, our findings reveal new symbiotic associations with Erwinia- and Sodalis-related bacteria. We conclude with suggestions for generating and analysing 16S rRNA gene sequences for arthropod-endosymbiont studies. PMID:26458227

  18. Cloning of 16S rRNA genes amplified from normal and disturbed vaginal microflora suggests a strong association between Atopobium vaginae, Gardnerella vaginalis and bacterial vaginosis

    De Ganck Catharine


    Full Text Available Abstract Background The pathogenesis of bacterial vaginosis remains largely elusive, although some microorganisms, including Gardnerella vaginalis, are suspected of playing a role in the etiology of this disorder. Recently culture-independent analysis of microbial ecosystems has proven its efficacy in characterizing the diversity of bacterial populations. Here, we report on the results obtained by combining culture and PCR-based methods to characterize the normal and disturbed vaginal microflora. Results A total of 150 vaginal swab samples from healthy women (115 pregnant and 35 non-pregnant were categorized on the basis of Gram stain of direct smear as grade I (n = 112, grade II (n = 26, grade III (n = 9 or grade IV (n = 3. The composition of the vaginal microbial community of eight of these vaginal swabs (three grade I, two grade II and three grade III, all from non-pregnant women, were studied by culture and by cloning of the 16S rRNA genes obtained after direct amplification. Forty-six cultured isolates were identified by tDNA-PCR, 854 cloned 16S rRNA gene fragments were analysed of which 156 by sequencing, yielding a total of 38 species, including 9 presumptively novel species with at least five species that have not been isolated previously from vaginal samples. Interestingly, cloning revealed that Atopobium vaginae was abundant in four out of the five non-grade I specimens. Finally, species specific PCR for A. vaginae and Gardnerella vaginalis pointed to a statistically significant co-occurrence of both species in the bacterial vaginosis samples. Conclusions Although historically the literature regarding bacterial vaginosis has largely focused on G. vaginalis in particular, several findings of this study – like the abundance of A. vaginae in disturbed vaginal microflora and the presence of several novel species – indicate that much is to be learned about the composition of the vaginal microflora and its relation to the etiology of BV.

  19. Bacterial communities of traditional salted and fermented seafoods from Jeju Island of Korea using 16S rRNA gene clone library analysis.

    Kim, Min-Soo; Park, Eun-Jin


    Jeotgal, which is widely consumed as a nutritional supplement in Korea, is traditional type of preserved seafood that is prepared by salting and fermenting. Here, we report on the bacterial community structure and diversity of jeotgal obtained from the Korean island of Jeju, which has a subtropical climate. Two samples of Jeotgal were collected from Jeju, made from either damselfish (Chromis notata; jari-dom-jeot, J1 and J2) or silver-stripe round herring (Spratelloides gracilis; ggot-myulchi-jeot, K1 and K2). The physical characteristics (pH and salinity) were assessed and the bacterial communities characterized using 16S rRNA gene-clone library analysis and cultural isolation. No difference was found in the community composition between the J and K fermented seafoods. Both fermented seafoods had relatively high salinity (26% to 33%) and high pH values (pH 6.08 to 6.72). Based on the 16S rRNA gene sequences, the halophilic lactic-acid bacteria Tetragenococcus halophilus and T. muriaticus were observed to be dominant in the J and K fermented seafoods, accompanied by halophilic bacteria including Halanaerobium spp., Halomonas spp., and Chromohalobacter spp. When compared with 7 other types of fermented seafood from a previous study, the communities of the J and K fermented seafoods were separated by the most influential group, the genus Tetragenococcus. The results suggest that these 2 types of traditional salted fermented seafood from Jeju have distinct communities dominated by Tetragenococcus spp., which are derived from the raw ingredients and are dependent on the physical conditions. This may explain how the seafoods that are made in Jeju may differ from other jeotgals. PMID:24689962

  20. Methylation pattern of the intergenic spacer of rRNA genes in excised cotyledons of Cucurbita pepo L. (Zucchini) after hormone treatment

    High molecular mass genomic DNA was isolated from excised marrow cotyledons (Cucurbita pepo L. zucchini) treated with 6-benzyladenine (BA) of methyl ester of jasmonic acid (MeJA) for 24 h in darkness. DNA purified from contaminating polysaccharides with Celite column was completely digested with the restriction enzyme Eco RI and the changes in the methylation pattern of the intergenic spacer (IGS) of r RNA genes were studied after subsequent digestion with the couple of restriction enzymes-isoschizomers MSP I and Hpa II by the method of 'indirect end labelling'. As rDNA units probe a cloned 32P-labelled Eco RI 2.1 kb fragment spanning in the most part of 18S r RNA gene from flax rDNA was used. Results showed heavy methylation of the rRNA genes. As judged from the almost total lack of digestion with HPA II, there were no methylation free regions in repeated rDNA units or little if any were observed. A hypo methylated Hps II site was detected near the promoter region in some of the repeats. Digestion with Msp I affected nearly 50% of the repeating units. The Msp digestion fragments of the 6.2 kb Eco RI fragment of r DNA were few in number and large in size (0.5 - 2.5 kb). This suggested that in addition with -CpG- sequences, methylation in -CpNpG- might not be random. Methylation pattern in IGS was not changed upon treatment of the cotyledons in vivo with BA and MeJA. Thus, previously observed hormone-mediated effects on the eactivity of rRNA gene expression were not accompanied by any significant changes of the methylation pattern in IGS. (authors)

  1. PCR assay based on DNA coding for 16S rRNA for detection and identification of mycobacteria in clinical samples.

    Kox, L F; van Leeuwen, J; Knijper, S; Jansen, H M; Kolk, A H


    A PCR and a reverse cross blot hybridization assay were developed for the detection and identification of mycobacteria in clinical samples. The PCR amplifies a part of the DNA coding for 16S rRNA with a set of primers that is specific for the genus Mycobacterium and that flanks species-specific sequences within the genes coding for 16S rRNA. The PCR product is analyzed in a reverse cross blot hybridization assay with probes specific for M. tuberculosis complex (pTub1), M. avium (pAvi3), M. intracellulare (pInt5 and pInt7), M. kansasii complex-M. scrofulaceum complex (pKan1), M. xenopi (pXen1), M. fortuitum (pFor1), M. smegmatis (pSme1), and Mycobacterium spp. (pMyc5a). The PCR assay can detect 10 fg of DNA, the equivalent of two mycobacteria. The specificities of the probes were tested with 108 mycobacterial strains (33 species) and 31 nonmycobacterial strains (of 17 genera). The probes pAvi3, pInt5, pInt7, pKan1, pXen1, and pMyc5a were specific. With probes pTub1, pFor1, and pSme1, slight cross hybridization occurred. However, the mycobacterial strains from which the cross-hybridizing PCR products were derived belonged to nonpathogenic or nonopportunistic species which do not occur in clinical samples. The test was used on 31 different clinical specimens obtained from patients suspected of having mycobacterial disease, including a patient with a double mycobacterial infection. The samples included sputum, bronchoalveolar lavage, tissue biopsy samples, cerebrospinal fluid, pus, peritoneal fluid, pleural fluid, and blood. The results of the PCR assay agreed with those of conventional identification methods or with clinical data, showing that the test can be used for the direct and rapid detection and identification of mycobacteria in clinical samples. PMID:8586707

  2. The effects of alignment quality, distance calculation method, sequence filtering, and region on the analysis of 16S rRNA gene-based studies.

    Patrick D Schloss

    Full Text Available Pyrosequencing of PCR-amplified fragments that target variable regions within the 16S rRNA gene has quickly become a powerful method for analyzing the membership and structure of microbial communities. This approach has revealed and introduced questions that were not fully appreciated by those carrying out traditional Sanger sequencing-based methods. These include the effects of alignment quality, the best method of calculating pairwise genetic distances for 16S rRNA genes, whether it is appropriate to filter variable regions, and how the choice of variable region relates to the genetic diversity observed in full-length sequences. I used a diverse collection of 13,501 high-quality full-length sequences to assess each of these questions. First, alignment quality had a significant impact on distance values and downstream analyses. Specifically, the greengenes alignment, which does a poor job of aligning variable regions, predicted higher genetic diversity, richness, and phylogenetic diversity than the SILVA and RDP-based alignments. Second, the effect of different gap treatments in determining pairwise genetic distances was strongly affected by the variation in sequence length for a region; however, the effect of different calculation methods was subtle when determining the sample's richness or phylogenetic diversity for a region. Third, applying a sequence mask to remove variable positions had a profound impact on genetic distances by muting the observed richness and phylogenetic diversity. Finally, the genetic distances calculated for each of the variable regions did a poor job of correlating with the full-length gene. Thus, while it is tempting to apply traditional cutoff levels derived for full-length sequences to these shorter sequences, it is not advisable. Analysis of beta-diversity metrics showed that each of these factors can have a significant impact on the comparison of community membership and structure. Taken together, these results

  3. Caracterização de rizóbios indicados para produção de inoculantes por meio de sequenciamento parcial do 16S rRNA Characterization of rhizobia indicated for inoculant production using 16S rRNA partial sequencing

    Bethânia Figueiredo Barbosa de Toledo


    Full Text Available O objetivo deste trabalho foi confrontar as sequências parciais do gene 16S rRNA de estirpes padrão de rizóbios com as de estirpes recomendadas para a produção de inoculantes no Brasil, com vistas à verificação da confiabilidade do sequenciamento parcial desse gene para a identificação rápida de estirpes. Foram realizados sequenciamentos através de reação em cadeia da polimerase (PCR com iniciadores relativos à região codificadora do gene 16S rRNA entre as bactérias estudadas. Os resultados foram analisados pela consulta de similaridade de nucleotídeos aos do "Basic Local Alignment Search Tool" (Blastn e por meio da interpretação de árvores filogenéticas geradas usando ferramentas de bioinformática. A classificação taxonômica das estirpes Semia recomendadas para inoculação de leguminosas com base em propriedades morfológicas e especificidade hospedeira não foi confirmada em todas as estirpes. A maioria das estirpes estudadas, consultadas no Blastn, é consistente com a classificação proposta pela construção de árvores filogenéticas das sequências destas estirpes, com base na similaridade pelo sequenciamento parcial do gene considerado.The aim of this work was to compare the partial sequences of 16S rRNA gene of rhizobia strain patterns already classified with strains recommended for the production of inoculants in Brazil, in order to verify the reliability of partial sequencing of the gene for the purpose of rapid identification of strains. Polymerase Chain Reaction (PCR sequencing using primers on the coding region of the 16S rRNA gene among the bacteria studied was conducted. The results were analyzed by consulting the nucleotides' similarity based on Basic Local Alignment Search Tool (Blastn and by interpreting the phylogenetic trees generated by bioinformatic tools. The taxonomic classification of Semia strains recommended for legume inoculation based on morphological properties and host specificity was

  4. Molecular analysis of the rRNA genes of Babesia spp and Ehrlichia canis detected in dogs from Ribeirão Preto, Brazil Análise dos genes rRNA de Babesia spp e Ehrlichia canis detectados em cães de Ribeirão Preto, Brasil

    L.P. Oliveira


    Full Text Available The partial DNA sequences of the 18S rRNA gene of Babesia canis and the 16S rRNA gene of Ehrlichia canis detected in dogs from Ribeirão Preto, Brazil, were compared to sequences from other strains deposited in GenBank. The E. canis strain circulating in Ribeirão Preto is identical to other strains previously detected in the region, whereas the subspecies Babesia canis vogeli is the main Babesia strain circulating in dogs from Ribeirão Preto.As sequências parciais dos genes RNAr 18S de Babesia canis e RNAr 16S e Ehrlichiacanis detectados em cães de Ribeirão Preto, Brasil, foram comparadas à sequências de outras linhagens depositadas no GeneBank. A linhagem de E. canis circulando em Ribeirão Preto é idêntica a outras detectadas previamente na região, enquanto a sub-espécie B. canis vogeli é a principal linhagem de Babesia circulando em cães de Ribeirão Preto.

  5. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong


    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. PMID:26800847

  6. A single methyltransferase YefA (RlmCD) catalyses both m5U747 and m5U1939 modifications in Bacillus subtilis 23S rRNA

    Desmolaize, Benoit; Fabret, Céline; Brégeon, Damien;


    , YefA that is a COG2265 member. A recombinant version of YefA functions in an E. coli m(5)U-null mutant adding the same two rRNA methylations. The findings suggest that during evolution, COG2265 enzymes have undergone a series of changes in target specificity and that YefA is closer to an archetypical...

  7. Effects of Cr(III) and CR(VI) on nitrification inhibition as determined by SOUR, function-specific gene expression and 16S rRNA sequence analysis of wastewater nitrifying enrichments

    The effect of Cr(III) and Cr(VI) on ammonia oxidation, the transcriptional responses of functional genes involved in nitrification and changes in 16S rRNA level sequences were examined in nitrifying enrichment cultures. The nitrifying bioreactor was operated as a continuous react...

  8. Characterization of copy numbers of 16S rDNA and 16S rRNA of Candidatus Liberibacter asiaticus and the implication in detection in planta using quantitative PCR

    Wang Nian


    Full Text Available Abstract Background Citrus Huanglongbing (HLB is one of the most devastating diseases on citrus and is associated with Candidatus Liberibacter spp.. The pathogens are phloem limited and have not been cultured in vitro. The current management strategy of HLB is to remove infected citrus trees and reduce psyllid populations with insecticides to prevent the spreading. This strategy requires sensitive and reliable diagnostic methods for early detection. Results We investigated the copy numbers of the 16S rDNA and 16S rRNA of the HLB pathogen and the implication of improving the diagnosis of HLB for early detection using Quantitative PCR. We compared the detection of HLB with different Quantitative PCR based methods with primers/probe targeting either 16S rDNA, beta-operon DNA, 16S rRNA, or beta-operon RNA. The 16S rDNA copy number of Ca. Liberibacter asiaticus was estimated to be three times of that of the beta-operon region, thus allowing detection of lower titer of Ca. L. asiaticus. Quantitative reverse transcriptional PCR (QRT-PCR indicated that the 16S rRNA averaged 7.83 times more than that of 16S rDNA for the same samples. Dilution analysis also indicates that QRT-PCR targeting 16S rRNA is 10 time more sensitive than QPCR targeting 16S rDNA. Thus QRT-PCR was able to increase the sensitivity of detection by targeting 16S rRNA. Conclusion Our result indicates that Candidatus Liberibacter asiaticus contains three copies of 16S rDNA. The copy number of 16S rRNA of Ca. L. asiaticus in planta averaged about 7.8 times of 16S rDNA for the same set of samples tested in this study. Detection sensitivity of HLB could be improved through the following approaches: using 16S rDNA based primers/probe in the QPCR assays; and using QRT-PCR assays targeting 16S rRNA.

  9. Detection of Clostridium sp. and its Relation to Different Ages and Gastrointestinal Segments as Measured by Molecular Analysis of 16S rRNA Genes

    Seyed Ziaeddin Mirhosseini


    Full Text Available The objective of this study was to establish a specific, sensitive and rapid PCR approach for the detection of Clostridium sp. at the genus level. Clostridium sp. in the duodenum, jejunum, ileum and cecum of broiler chickens were analyzed by 16S rRNA genes. The PCR detected the presence of Clostridium spp. in naturally contaminated intestinal samples. For the total gastrointestinal segments, 53.125, 65.625 and 59.375% samples were positive for naturally occurring Clostridium spp. at the ages 4, 14 and 30d, respectively. Analysis of the microbial contents indicated that Clostridium sp. was not consistently detected in all intestinal segments. These results can put in evidence the hypothesis that Clostridium spp. may be interfering in health and performance of chickens.Clostridium spp. são organismos patogénicos com distribuição mundial, podendo estar presente nos seres humanos, em animais domésticos e em animais selvagens. Estas bactérias habitam geralmente o trato gastrintestinal. Os métodos bacteriológicos convencionais como a microscopia e a cultura têm limitações. O objetivo deste estudo foi de estabelecer uma metodologia específica, sensível e rápida como a ténica de PCR para a deteção de Clostridium spp. A presença de Clostridium spp. Foi pesquisada no duodeno, o jejunum, o íleo e o cecum de galinhas usando análise molecular de genes do rRNA 16S. A técnica de PCR usada neste trabalho detectou Clostridium spp. em amostras intestinais naturalmente contaminadas. Considerando o trato gastrintestinal total, 53.125, 65.625 e 59.375% das amostras foram positivas para Clostridium nas idades 4, 14 e 30d respectivamente. A análise microbiana indicou que Clostridium spp. não foi detectado consistentemente em todos os segmentos intestinais. Os dados observados alertam para possíveis implicações significativas para a saúde e o desempenho das galinhas.

  10. Pyrosequencing of 16S rRNA genes in fecal samples reveals high diversity of hindgut microflora in horses and potential links to chronic laminitis

    Steelman Samantha M


    Full Text Available Abstract Background The nutrition and health of horses is closely tied to their gastrointestinal microflora. Gut bacteria break down plant structural carbohydrates and produce volatile fatty acids, which are a major source of energy for horses. Bacterial communities are also essential for maintaining gut homeostasis and have been hypothesized to contribute to various diseases including laminitis. We performed pyrosequencing of 16S rRNA bacterial genes isolated from fecal material to characterize hindgut bacterial communities in healthy horses and those with chronic laminitis. Results Fecal samples were collected from 10 normal horses and 8 horses with chronic laminitis. Genomic DNA was extracted and the V4-V5 segment of the 16S rRNA gene was PCR amplified and sequenced on the 454 platform generating a mean of 2,425 reads per sample after quality trimming. The bacterial communities were dominated by Firmicutes (69.21% control, 56.72% laminitis and Verrucomicrobia (18.13% control, 27.63% laminitis, followed by Bacteroidetes, Proteobacteria, and Spirochaetes. We observed more OTUs per individual in the laminitis group than the control group (419.6 and 355.2, respectively, P = 0.019 along with a difference in the abundance of two unassigned Clostridiales genera (P = 0.03 and P = 0.01. The most abundant bacteria were Streptococcus spp., Clostridium spp., and Treponema spp.; along with unassigned genera from Subdivision 5 of Verrucomicrobia, Ruminococcaceae, and Clostridiaceae, which together constituted ~ 80% of all OTUs. There was a high level of individual variation across all taxonomic ranks. Conclusions Our exploration of the equine fecal microflora revealed higher bacterial diversity in horses with chronic laminitis and identification of two Clostridiales genera that differed in abundance from control horses. There was large individual variation in bacterial communities that was not explained in our study. The core hindgut microflora was

  11. Phylogeny of 54 representative strains of species in the family Pasteurellaceae as determined by comparison of 16S rRNA sequences.

    Dewhirst, F E; Paster, B J; Olsen, I; Fraser, G J


    Virtually complete 16S rRNA sequences were determined for 54 representative strains of species in the family Pasteurellaceae. Of these strains, 15 were Pasteurella, 16 were Actinobacillus, and 23 were Haemophilus. A phylogenetic tree was constructed based on sequence similarity, using the Neighbor-Joining method. Fifty-three of the strains fell within four large clusters. The first cluster included the type strains of Haemophilus influenzae, H. aegyptius, H. aphrophilus, H. haemolyticus, H. paraphrophilus, H. segnis, and Actinobacillus actinomycetemcomitans. This cluster also contained A. actinomycetemcomitans FDC Y4, ATCC 29522, ATCC 29523, and ATCC 29524 and H. aphrophilus NCTC 7901. The second cluster included the type strains of A. seminis and Pasteurella aerogenes and H. somnus OVCG 43826. The third cluster was composed of the type strains of Pasteurella multocida, P. anatis, P. avium, P. canis, P. dagmatis, P. gallinarum, P. langaa, P. stomatis, P. volantium, H. haemoglobinophilus, H. parasuis, H. paracuniculus, H. paragallinarum, and A. capsulatus. This cluster also contained Pasteurella species A CCUG 18782, Pasteurella species B CCUG 19974, Haemophilus taxon C CAPM 5111, H. parasuis type 5 Nagasaki, P. volantium (H. parainfluenzae) NCTC 4101, and P. trehalosi NCTC 10624. The fourth cluster included the type strains of Actinobacillus lignieresii, A. equuli, A. pleuropneumoniae, A. suis, A. ureae, H. parahaemolyticus, H. parainfluenzae, H. paraphrohaemolyticus, H. ducreyi, and P. haemolytica. This cluster also contained Actinobacillus species strain CCUG 19799 (Bisgaard taxon 11), A. suis ATCC 15557, H. ducreyi ATCC 27722 and HD 35000, Haemophilus minor group strain 202, and H. parainfluenzae ATCC 29242. The type strain of P. pneumotropica branched alone to form a fifth group. The branching of the Pasteurellaceae family tree was quite complex. The four major clusters contained multiple subclusters. The clusters contained both rapidly and slowly evolving

  12. Shifts of microbial community structure in soils of a photovoltaic plant observed using tag-encoded pyrosequencing of 16S rRNA.

    Wu, Shijin; Li, Yuan; Wang, Penghua; Zhong, Li; Qiu, Lequan; Chen, Jianmeng


    The environmental risk of fluoride and chloride pollution is pronounced in soils adjacent to solar photovoltaic sites. The elevated levels of fluoride and chloride in these soils have had significant impacts on the population size and overall biological activity of the soil microbial communities. The microbial community also plays an essential role in remediation of these soils. Questions remain as to how the fluoride and chloride contamination and subsequent remediation at these sites have impacted the population structure of the soil microbial communities. We analyzed the microbial communities in soils collected from close to a solar photovoltaic enterprise by pyrosequencing of the 16S rRNA tag. In addition, we used multivariate statistics to identity the relationships shared between sequence diversity and heterogeneity in the soil environment. The overall microbial communities were surprisingly diverse, harboring a wide variety of taxa and sharing significant correlations with different degrees of fluoride and chloride contamination. The contaminated soils harbored abundant bacteria that were probably resistant to the high acidity, high fluoride and chloride concentration, and high osmotic pressure environment. The dominant genera were Sphingomonas, Subgroup_6_norank, Clostridium sensu stricto, Nitrospira, Rhizomicrobium, and Acidithiobacillus. The results of this study provide new information regarding a previously uncharacterized ecosystem and show the value of high-throughput sequencing in the study of complex ecosystems. PMID:26695154

  13. Bacterial community composition in the gut content and ambient sediment of sea cucumber Apostichopus japonicus revealed by 16S rRNA gene pyrosequencing.

    Fei Gao

    Full Text Available The composition of the bacterial communities in the contents of the foregut and hindgut of the sea cucumber Apostichopus japonicus and in the ambient surface sediment was surveyed by 16S rRNA gene 454-pyrosequencing. A total of 188,623 optimized reads and 15,527 operational taxonomic units (OTUs were obtained from the ten gut contents samples and four surface sediment samples. The sequences in the sediments, foregut contents, and hindgut contents were assigned to 38.0±4.7, 31.2±6.2 and 27.8±6.5 phyla, respectively. The bacterial richness and Shannon diversity index were both higher in the ambient sediments than in the gut contents. Proteobacteria was the predominant phylum in both the gut contents and sediment samples. The predominant classes in the foregut, hindgut, and ambient sediment were Holophagae and Gammaproteobacteria, Deltaproteobacteria and Gammaproteobacteria, and Gammaproteobacteria and Deltaproteobacteria, respectively. The potential probiotics, including sequences related to Bacillus, lactic acid bacteria (Lactobacillus, Lactococcus, and Streptococcus and Pseudomonas were detected in the gut of A. japonicus. Principle component analysis and heatmap figure showed that the foregut, hindgut, and ambient sediment respectively harbored different characteristic bacterial communities. Selective feeding of A. japonicus may be the primary source of the different bacterial communities between the foregut contents and ambient sediments.

  14. Bacterial Community Composition in the Gut Content and Ambient Sediment of Sea Cucumber Apostichopus japonicus Revealed by 16S rRNA Gene Pyrosequencing

    Gao, Fei; Li, Fenghui; Tan, Jie; Yan, Jingping; Sun, Huiling


    The composition of the bacterial communities in the contents of the foregut and hindgut of the sea cucumber Apostichopus japonicus and in the ambient surface sediment was surveyed by 16S rRNA gene 454-pyrosequencing. A total of 188,623 optimized reads and 15,527 operational taxonomic units (OTUs) were obtained from the ten gut contents samples and four surface sediment samples. The sequences in the sediments, foregut contents, and hindgut contents were assigned to 38.0±4.7, 31.2±6.2 and 27.8±6.5 phyla, respectively. The bacterial richness and Shannon diversity index were both higher in the ambient sediments than in the gut contents. Proteobacteria was the predominant phylum in both the gut contents and sediment samples. The predominant classes in the foregut, hindgut, and ambient sediment were Holophagae and Gammaproteobacteria, Deltaproteobacteria and Gammaproteobacteria, and Gammaproteobacteria and Deltaproteobacteria, respectively. The potential probiotics, including sequences related to Bacillus, lactic acid bacteria (Lactobacillus, Lactococcus, and Streptococcus) and Pseudomonas were detected in the gut of A. japonicus. Principle component analysis and heatmap figure showed that the foregut, hindgut, and ambient sediment respectively harbored different characteristic bacterial communities. Selective feeding of A. japonicus may be the primary source of the different bacterial communities between the foregut contents and ambient sediments. PMID:24967593

  15. bioOTU: An Improved Method for Simultaneous Taxonomic Assignments and Operational Taxonomic Units Clustering of 16s rRNA Gene Sequences.

    Chen, Shi-Yi; Deng, Feilong; Huang, Ying; Jia, Xianbo; Liu, Yi-Ping; Lai, Song-Jia


    Clustering of 16s rRNA amplicon sequences into operational taxonomic units (OTUs) is the most common bioinformatics pipeline for investigating microbial community by high-throughput sequencing technologies. However, the existing algorithms of OTUs clustering still remain to be improved at reliability. Here we propose an improved method (bioOTU) that first assigns taxonomy to unique tags at genus level for separating the error-free sequences of known species in reference database from artifacts, and then cluster them into OTUs by different strategies. The remaining tags, which fail to be clustered in the previous step, are further subjected to independent OTUs clustering by the optimized algorithm of heuristic clustering. The performance tests on both mock and real communities revealed that bioOTU is powerful for recovering the underlying profiles at both microbial composition and abundance, and it also produces comparable or less number of OTUs in comparison with the prevailing tools of Mothur and UPARSE. The bioOTU is implemented in C and Python languages with source codes freely available on the GitHub repository. PMID:26950196

  16. Bacterial taxa associated with the hematophagous mite Dermanyssus gallinae detected by 16S rRNA PCR amplification and TTGE fingerprinting.

    Valiente Moro, Claire; Thioulouse, Jean; Chauve, Claude; Normand, Philippe; Zenner, Lionel


    Dermanyssus gallinae (Arthropoda, Mesostigmata) is suspected to be involved in the transmission of a wide variety of pathogens, but nothing is known about its associated non-pathogenic bacterial community. To address this question, we examined the composition of bacterial communities in D. gallinae collected from standard poultry farms in Brittany, France. Genetic fingerprints of bacterial communities were generated by temporal temperature gradient gel electrophoresis (TTGE) separation of individual polymerase chain reaction (PCR)-amplified 16S rRNA gene fragments, followed by DNA sequence analysis. Most of the sequences belonged to the Proteobacteria and Firmicute phyla, with a majority of sequences corresponding to the Enterobacteriales order and the Staphylococcus genus. By using statistical analysis, we showed differences in biodiversity between poultry farms. We also determined the major phylotypes that compose the characteristic microbiota associated with D. gallinae. Saprophytes, opportunistic pathogens and pathogenic agents such as Pasteurella multocida, Erysipelothrix rhusiopathiae and sequences close to the genus Aerococcus were identified. Endosymbionts such as Schineria sp., Spiroplasma sp. Anistosticta, "Candidatus Cardinium hertigii" and Rickettsiella sp. were also present in the subdominant bacterial community. Identification of potential targets within the symbiont community may be considered in the future as a means of ectoparasite control. PMID:19027065

  17. Use of 16S rRNA sequencing and quantitative PCR to correlate venous leg ulcer bacterial bioburden dynamics with wound expansion, antibiotic therapy, and healing.

    Sprockett, Daniel D; Ammons, Christine G; Tuttle, Marie S


    Clinical diagnosis of infection in chronic wounds is currently limited to subjective clinical signs and culture-based methods that underestimate the complexity of wound microbial bioburden as revealed by DNA-based microbial identification methods. Here, we use 16S rRNA next generation sequencing and quantitative polymerase chain reaction to characterize weekly changes in bacterial load, community structure, and diversity associated with a chronic venous leg ulcer over the 15-week course of treatment and healing. Our DNA-based methods and detailed sampling scheme reveal that the bacterial bioburden of the wound is unexpectedly dynamic, including changes in the bacterial load and community structure that correlate with wound expansion, antibiotic therapy, and healing. We demonstrate that these multidimensional changes in bacterial bioburden can be summarized using swabs taken prior to debridement, and therefore, can be more easily collected serially than debridement or biopsy samples. Overall, this case illustrates the importance of detailed clinical indicators and longitudinal sampling to determine the pathogenic significance of chronic wound microbial dynamics and guide best use of antimicrobials for improvement of healing outcomes. PMID:25902876

  18. Characterization and potential of three temperature ranges for hydrogen fermentation of cellulose by means of activity test and 16s rRNA sequence analysis.

    Gadow, Samir I; Jiang, Hongyu; Li, Yu-You


    A series of standardized activity experiments were performed to characterize three different temperature ranges of hydrogen fermentation from different carbon sources. 16S rRNA sequences analysis showed that the bacteria were close to Enterobacter genus in the mesophilic mixed culture (MMC) and Thermoanaerobacterium genus in the thermophilic and hyper-thermophilic mixed cultures (TMC and HMC). The MMC was able to utilize the glucose and cellulose to produce methane gas within a temperature range between 25 and 45 °C and hydrogen gas from 35 to 60°C. While, the TMC and HMC produced only hydrogen gas at all temperature ranges and the highest activity of 521.4mlH2/gVSSd was obtained by TMC. The thermodynamic analysis showed that more energy is consumed by hydrogen production from cellulose than from glucose. The experimental results could help to improve the economic feasibility of cellulosic biomass energy using three-phase technology to produce hythane. PMID:26954308

  19. Effects of DNA extraction and universal primers on 16S rRNA gene-based DGGE analysis of a bacterial community from fish farming water


    Among many reports investigating microbial diversity from environmental samples with denaturing gradient gel electrophoresis (DGGE), limited attention has been given to the effects of universal primers and DNA extraction on the outcome of DGGE analysis. In this study, these effects were tested with 16S rRNA gene-based DGGE on a bacterial community from farming water samples. The results indicate that the number of discernable bands in the DGGE fingerprint differed with the primer pairs used; the bands produced by 63f/518r, 341f/926r and 933f/1387r primer pairs were obviously fewer than those by 968f/1401r. Also, we found that each DNA extraction method resulted in different community profiles, reflected by the number and intensity of bands in the DGGE fingerprint. Furthermore,the main bands (theoretically representing dominant bacteria) differed with the extraction methods applied.It is therefore believed that the effects of universal primers and DNA extraction should be given more attention and carefully chosen before performing an investigation into a new environment with DGGE.

  20. Comparative 16S rRNA signatures and multilocus sequence analysis for the genus Salinicola and description of Salinicola acroporae sp. nov., isolated from coral Acropora digitifera.

    Lepcha, Rinchen T; Poddar, Abhijit; Schumann, Peter; Das, Subrata K


    A novel Gram-negative, aerobic, motile marine bacterium, strain S4-41(T), was isolated from mucus of the coral Acropora digitifera from the Andaman Sea. Heterotrophic growth was observed in 0-25 % NaCl, at 15-45 °C and pH 4.5-9. In phylogenetic trees, strain S4-41(T) was grouped within the genus Salinicola but formed a separate branch distant from a cluster composed of Salinicola salarius M27(T) and Salinicola socius SMB35(T). DNA-DNA relatedness between strain S4-41(T) and these reference strains were well below 70 %. Q-9 was the sole respiratory quinone. The DNA G+C content was determined to be 63.6 mol%. Based on a polyphasic analysis, strain S4-41(T) is concluded to represent a novel species in the genus Salinicola for which the name Salinicola acroporae sp. nov. is proposed. The type strain is S4-41(T) (=JCM 30412(T) = LMG 28587(T)). Comparative 16S rRNA analysis of the genera Salinicola, Kushneria, Chromohalobacter and Cobetia revealed the presence of genus specific sequence signatures. Multilocus sequence analysis based on concatenated sequences of rRNAs (16S and 23S) and four protein coding housekeeping genes (atpA, gyrB, secA, rpoD) was found to be unnecessary for phylogenetic studies of the genus Salinicola. PMID:25944083