WorldWideScience

Sample records for 12cgamma 3alpha ehnergeticheskoe

  1. Activating STAT3 Alpha for Promoting Healing of Neurons

    Conway, Greg

    2008-01-01

    A method of promoting healing of injured or diseased neurons involves pharmacological activation of the STAT3 alpha protein. Usually, injured or diseased neurons heal incompletely or not at all for two reasons: (1) they are susceptible to apoptosis (cell death); and (2) they fail to engage in axogenesis that is, they fail to re-extend their axons to their original targets (e.g., muscles or other neurons) because of insufficiency of compounds, denoted neurotrophic factors, needed to stimulate such extension. The present method (see figure) of treatment takes advantage of prior research findings to the effect that the STAT3 alpha protein has anti-apoptotic and pro-axogenic properties.

  2. 3$\\alpha$-cluster structure and monopole transition in $^{12}$C and $^{14}$C

    Yoshida, Yuta

    2016-01-01

    3$\\alpha$-cluster structures and monopole transitions of $0^+$ states in $^{12}$C and $^{14}$C were investigated with $3\\alpha$- and $^{10}$Be+$\\alpha$-cluster models. A gas-like $3\\alpha$ state and a bending-chain $3\\alpha$ state were obtained in the $0^+_2$ and $0^+_3$ states of $^{12}$C, respectively. In $^{14}$C, a linear-chain 3$\\alpha$ structure is found in the $0^+_4$ state near the $^{10}$Be+$\\alpha$ threshold, but a cluster gas-like state does not appear because valence neutrons attract $\\alpha$ clusters and suppress spatial development of 3$\\alpha$ clustering. It was found that the linear-chain state in $^{14}$C is stabilized against the bending and $\\alpha$ escaping modes by valence neutrons. The monopole transition strengths in $^{12}$C are enhanced by $3\\alpha$-cluster developing, whereas, those in $^{14}$C are not enhanced so much because of the tight binding of $\\alpha$ clusters by valence neutrons.

  3. The derivation of a novel mitomycin skeleton: 3 alpha-alkoxymitomycin.

    Kasai, M; Kono, M; Shirahata, K

    1991-03-01

    The first example of C-3 alkoxylation in mitomycins has been achieved. 3 alpha-iso-Propoxy-10-O-decarbamoylmitomycin D (4) and 3 alpha-iso-propoxymitomycin D (5) were derived from mitomycin D (3) under decarbamoylation conditions with iso-propoxide. Under similar conditions 3 alpha-iso-propoxy-10-O-decarbamoylporfiromycin (8) and 3 alpha-methoxy-10-O-decarbamoylmitomycin B (11) were also derived from porfiromycin (6) and mitomycin B (9), respectively. The mechanism of generation of these novel analogs was based on the premise that the key intermediate of hydroquinone iminium salt (14) was led through the iminium salt (13), followed by alkoxide addition and oxidation. PMID:2026556

  4. Local versus nonlocal $\\alpha\\alpha$ interactions in $3\\alpha$ description of $^{12}$C

    Suzuki, Y; Descouvemont, P; Fujiwara, Y; Matsumura, H; Orabi, M; Theeten, M

    2008-01-01

    Local $\\alpha \\alpha$ potentials fail to describe $^{12}$C as a $3\\alpha$ system. Nonlocal $\\alpha \\alpha$ potentials that renormalize the energy-dependent kernel of the resonating group method allow interpreting simultaneously the ground state and $0^+_2$ resonance of $^{12}$C as $3\\alpha$ states. A comparison with fully microscopic calculations provides a measure of the importance of three-cluster exchanges in those states.

  5. Structure-function of human 3 alpha-hydroxysteroid dehydrogenases: genes and proteins.

    Penning, T M; Jin, Y; Steckelbroeck, S; Lanisnik Rizner, T; Lewis, M

    2004-02-27

    Four soluble human 3 alpha-hydroxysteroid dehydrogenase (HSD) isoforms exist which are aldo-keto reductase (AKR) superfamily members. They share 86% sequence identity and correspond to: AKR1C1 (20 alpha(3 alpha)-HSD); AKR1C2 (type 3 3 alpha-HSD and bile-acid binding protein); AKR1C3 (type 2 3 alpha-HSD and type 5 17 beta-HSD); and AKR1C4 (type 1 3 alpha-HSD). Each of the homogeneous recombinant enzymes are plastic and display 3-, 17- and 20-ketosteroid reductase and 3 alpha- 17 beta- and 20 alpha-hydroxysteroid oxidase activities with different k(cat)/K(m) ratios in vitro. The crystal structure of the AKR1C2.NADP(+).ursodeoxycholate complex provides an explanation for this functional plasticity. Ursodeoxycholate is bound backwards (D-ring in the A-ring position) and upside down (beta-face of steroid inverted) relative to the position of 3-ketosteroids in the related rat liver 3 alpha-HSD (AKR1C9) structure. Transient transfection indicates that in COS-1 cells, AKR1C enzymes function as ketosteroid reductases due to potent inhibition of their oxidase activity by NADPH. By acting as ketosteroid reductases they may regulate the occupancy of the androgen, estrogen and progesterone receptors. RT-PCR showed that AKRs are discretely localized. AKR1C4 is virtually liver specific, while AKR1C2 and AKR1C3 are dominantly expressed in prostate and mammary gland. AKR1C genes are highly conserved in structure and may be transcriptionally regulated by steroid hormones and stress. PMID:15026176

  6. Almost Redundant Components in the 3 alpha Faddeev Equation for the Buck, Friedlich and Wheatly alpha alpha Potential

    Fujiwara, Y; Kohno, M

    2004-01-01

    The 3 alpha orthogonality condition model using the Pauli-forbidden bound states of the Buck, Friedlich and Wheatly alpha alpha potential can yield a compact 3 alpha ground state with a large binding energy, in which a small admixture of the redundant components can never be eliminated.

  7. Emergence of new alleles of the MSP-3alpha gene in Plasmodium vivax isolates from Korea.

    Nam, Deok Hwa; Oh, Jun Seo; Nam, Myoung Hyun; Park, Hae Chul; Lim, Chae Seung; Lee, Won Ja; Sattabongkot, Jetsumon; Klein, Terry A; Ayala, Francisco J

    2010-04-01

    Nucleotide sequence analysis of the Plasmodium vivax PvMSP-3alpha gene was conducted on blood from 143 malaria patients admitted to Korea University Medical Center from 1996 to 2007 in the Republic of Korea (ROK). From 1996 to 2002, the PvMSP-3alpha alleles were of two types, SKOR-67 (2.53 kb) and SKOR-69 (1.78 kb), which differed in length and amino acid sequence. Two new variants with similar size to SKOR-67 were first observed in 2002 and in 2006-2007 accounted for nearly 50% (25/51) of the sampled isolates. The new variants had the same amino acid sequence as SKOR-69 in the N-terminal region, but in Blocks I and II and in the C-terminal region, they were similar to previously reported isolates from Thailand, Papua New Guinea, India, Brazil, and Ecuador strains. PMID:20348492

  8. Effects of $\\alpha$-cluster breaking on 3$\\alpha$ cluster structures in $^{12}$C

    Suhara, Tadahiro; Kanada-En'yo, Yoshiko

    2014-01-01

    To clarify the effects of $\\alpha$-cluster breaking on 3$\\alpha$ cluster structures in $^{12}$C, we investigate $^{12}$C using a hybrid model that combines the Brink-Bloch cluster model with the $p_{3/2}$ subshell closure wave function. We have found that $\\alpha$-cluster breaking caused by spin-orbit force significantly changes cluster structures of excited $0^{+}$ states through orthogonality to lower states. Spatially developed cluster components of the $0^{+}_{2}$ state are reduced. The $...

  9. MIP-3alpha/CCL20 in renal transplantation and its possible involvement as dendritic cell chemoattractant in allograft rejection.

    Woltman, Andrea M; de Fijter, Johan W; van der Kooij, Sandra W; Jie, Kim E; Massacrier, Catherine; Caux, Christophe; Daha, Mohamed R; van Kooten, Cees

    2005-09-01

    Graft-infiltrating dendritic cells (DC) and alloreactive T lymphocytes play a critical role in renal allograft rejection. Renal proximal tubular epithelial cells (TEC) are considered as active players in the attraction of leukocytes during renal inflammatory responses. Macrophage inflammatory protein (MIP)-3alpha/CCL20 is a major chemokine expressed by epithelial cells that attracts immature DC. In the present study, we present evidence that also the transplanted kidney can be a major source of MIP-3alpha/CCL20. Renal transplant recipients with rejection showed significantly increased excretion of urinary MIP-3alpha/CCL20 that correlated with transplant function. The tubular staining for MIP-3alpha/CCL20 in renal biopsies of patients with rejection as well as in vitro studies with primary human TEC indicated that TEC might be responsible for the increased urinary MIP-3alpha/CCL20. Furthermore, MIP-3alpha/CCL20 produced by activated TEC was highly potent in the attraction of CD1a+CD34+-derived DC precursors. These data suggest a role for MIP-3alpha/CCL20 in amplification of the immune response during renal allograft rejection by attraction of CCR6+ inflammatory cells, which may include DC, to the site of inflammation. PMID:16095490

  10. Kinetics of allopregnanolone formation catalyzed by human 3 alpha-hydroxysteroid dehydrogenase type III (AKR1C2).

    Trauger, John W; Jiang, Alice; Stearns, Brian A; LoGrasso, Philip V

    2002-11-12

    Allopregnanolone is a neurosteroid which exhibits anxiolytic and anticonvulsant activities through potentiation of the GABA(A) receptor. The reduction of 5alpha-dihydroprogesterone (5alpha-DHP), the last step in allopregnanolone biosynthesis, is catalyzed by 3alpha-hydroxysteroid dehydrogenases (3alpha-HSDs). While the mechanism of action of allopregnanolone and the physiological and pharmacological modulation of allopregnanolone concentrations in vivo have been extensively studied, there has been little characterization of the kinetics of human 3alpha-HSD catalyzed allopregnanolone formation. We report here determination of the kinetic mechanism for 5alpha-DHP reduction catalyzed by human 3alpha-HSD type III by using steady-state kinetics studies and assessment of the ability of fluoxetine and various other small molecules to activate 3alpha-HSD type III catalyzed allopregnanolone formation. Enzyme-catalyzed 5alpha-DHP reduction yielded two products, allopregnanolone and 5alpha,20alpha-tetrahydroprogesterone, as measured by using a radiometric thin-layer chromatography assay, while 5beta-DHP reduction yielded the neurosteroid pregnanolone as the only product. 5Beta-DHP reduction proceeded with a catalytic efficiency 10 times higher than that of 5alpha-DHP reduction. Two-substrate kinetic analysis and dead-end inhibition studies for 5alpha-DHP reduction and allopregnanolone oxidation indicated that 3alpha-HSD type III utilized a ternary complex (sequential) kinetic mechanism, with nicotinamide adenine dinucleotide cofactor binding before steroid substrate and leaving after steroid product. Since previous reports suggested that fluoxetine and certain other small molecules increased allopregnanolone concentrations in vivo by activating 3alpha-HSD type III, we investigated whether these small molecules were able to activate human 3alpha-HSD type III. Our results showed that, at concentrations up to 50 microM, fluoxetine, paroxetine, sertraline, norfluoxetine

  11. Aqueous chemical growth of alpha-Fe2O3-alpha-Cr203 nanocompositethin films

    Vayssieres, Lionel; Guo, Jinghua; Nordgren, Joseph

    2001-06-30

    We are reporting here on the inexpensive fabrication and optical properties of an iron(III) oxide chromium(III) oxide nanocomposite thin film of corundum crystal structure. Its novel and unique-designed architecture consists of uniformed, well-defined and oriented nanorods of Hematite (alpha-Fe2O3) of 50 nm in diameter and 500nm in length and homogeneously distributed nonaggregated monodisperse spherical nanoparticles of Eskolaite (alpha-Cr2O3) of 250 nm in diameter. This alpha-Fe2O3 alpha-Cr2O3 nanocomposite thin film is obtained by growing, directly onto transparent polycrystalline conducting substrate, an oriented layer of hematite nanorods and growing subsequently, the eskolaite layer. The synthesis is carried out by a template-free, low-temperature, multilayer thin film coating process using aqueous solution of metal salts as precursors. Almost 100 percent of the light is absorbed by the composite film between 300 and 525 nm and 40 percent at 800 nm which yields great expectations as photoanode materials for photovoltaic cells and photocatalytic devices.

  12. Research on the reactions {sup 9}Be ({sup 3}He, 3 {alpha}) and {sup 10}B (d, 3 {alpha}); Contribution a l'etude experimentale des reactions {sup 9}Be ({sup 3}He, 3 {alpha}) et {sup 10}B (d, 3 {alpha})

    Thouvenin, P. [Commissariat a l' Energie Atomique, Bruyeres-le-Chatel (France). Centre d' Etudes

    1967-06-15

    For studying these reactions, the detection of the final particles emitted in coincidence in the directions {theta}{sub 1} and {theta}{sub 2}, together with the bi-parametric analysis of the corresponding pulses are used. This method enables us to obtain the orthogonal Dalitz diagrams (E{sub 1}, E{sub 2}). An examination of the spectra obtained shows that the sequential mechanism appears to predominate. The contribution of the purely statistical process is less than 15 per cent of the total spectrum. In the case of {sup 10}B (d, 3 {alpha}), for E{sub d} = 1.5 MeV, 2,66 MeV and 3 MeV, the width of the peak of the first particles emitted, with respect to {sup 8}Be excitations close to 11 MeV, is found to be equal to 2.6 {+-} 0.6 MeV, much less than the width of the 2. excited state observed by {alpha} - {alpha} scattering. The coincidence spectra and the free spectra give an excitation energy of E{sub x} = 2.68 {+-} 0.07 MeV for the first excited state of {sup 8}Be. Some remarks are made concerning the anomalies observed for E{sub d} = 5 MeV and 9 MeV. The excited levels of {sup 8}Be at 13.91 MeV and 7.56 MeV which have been described in the past are not observed. (author) [French] La detection de deux des particules finales emises en cofncidence dans les directions {theta}{sub 1} et {theta}{sub 2}, et l'analyse biparametrique des impulsions correspondantes sont utilisees pour etudier ces reactions. Cette methode nous permet d'obtenir des diagrammes de Dalitz orthogonaux (E{sub 1}, E{sub 2}). L'examen des spectres obtenus montre que le mecanisme sequentiel semble predominant. La contribution du processus purement statistique est inferieure a 15 pour cent du spectre total. Dans le cas de {sup 10}B (d, 3 {alpha}), pour E{sub d} = 1,5 MeV, 2,66 MeV et 3 MeV, la largeur du pic des premieres particules emises relatives a des excitations de {sup 8}Be voisines de 11 MeV, est trouvee egale a 2,6 {+-} 0,6 MeV, tres inferieure a la largeur du 2. etat excite

  13. Topoisomerase 3alpha and RMI1 suppress somatic crossovers and are essential for resolution of meiotic recombination intermediates in Arabidopsis thaliana.

    Frank Hartung

    2008-12-01

    Full Text Available Topoisomerases are enzymes with crucial functions in DNA metabolism. They are ubiquitously present in prokaryotes and eukaryotes and modify the steady-state level of DNA supercoiling. Biochemical analyses indicate that Topoisomerase 3alpha (TOP3alpha functions together with a RecQ DNA helicase and a third partner, RMI1/BLAP75, in the resolution step of homologous recombination in a process called Holliday Junction dissolution in eukaryotes. Apart from that, little is known about the role of TOP3alpha in higher eukaryotes, as knockout mutants show early lethality or strong developmental defects. Using a hypomorphic insertion mutant of Arabidopsis thaliana (top3alpha-2, which is viable but completely sterile, we were able to define three different functions of the protein in mitosis and meiosis. The top3alpha-2 line exhibits fragmented chromosomes during mitosis and sensitivity to camptothecin, suggesting an important role in chromosome segregation partly overlapping with that of type IB topoisomerases. Furthermore, AtTOP3alpha, together with AtRECQ4A and AtRMI1, is involved in the suppression of crossover recombination in somatic cells as well as DNA repair in both mammals and A. thaliana. Surprisingly, AtTOP3alpha is also essential for meiosis. The phenotype of chromosome fragmentation, bridges, and telophase I arrest can be suppressed by AtSPO11 and AtRAD51 mutations, indicating that the protein is required for the resolution of recombination intermediates. As Atrmi1 mutants have a similar meiotic phenotype to Attop3alpha mutants, both proteins seem to be involved in a mechanism safeguarding the entangling of homologous chromosomes during meiosis. The requirement of AtTOP3alpha and AtRMI1 in a late step of meiotic recombination strongly hints at the possibility that the dissolution of double Holliday Junctions via a hemicatenane intermediate is indeed an indispensable step of meiotic recombination.

  14. Synthesis of a precursor for the preparation of 9 alpha,11 alpha-tritiated 5 alpha-androstane-3 alpha,17 beta-diol 17-glucuronide

    Starting from 11 beta-hydroxytestosterone, the synthesis of a strategic precursor, C-9 (11) unsaturated 5 alpha-androstane-3 alpha, 17 beta-diol 17-glucuronide (9a), for the preparation of 9 alpha,11 alpha-tritiated 5 alpha-androstane-3 alpha, 17 beta-diol 17-glucuronide has been achieved. The authors optimized the reaction conditions for catalytic reduction employing hydrogen and subsequent base hydrolysis followed by purification on Amberlite XAD-2 resin to obtain the saturated 5 alpha-androstane-3 alpha, 17 beta-diol 17-glucuronide

  15. Immobilization of lipase on epoxy activated (1-->3)-alpha-D-glucan isolated from Penicillium chrysongenum.

    Wang, Tianqi; Li, Hanxiang; Nie, Kaili; Tan, Tianwei

    2006-12-01

    A water-insoluble linear (1-->3)-alpha-D-glucan was isolated from Penicillium mycelia. Three kinds of epoxy-activated microspheres of this glucan were prepared as supports for Candida sp. lipase (EC3.1.1.3) immobilization. The highest immobilization yield was 36.4%. The specific activity was 26.85 U/mg, and only 4.1% of activity was lost in comparison with the free enzyme used for immobilization. The higher thermal stability, storage stability, and reusability of the immobilized lipase make it a potential candidate for wide application. PMID:17151459

  16. Human podocytes adhere to the KRGDS motif of the alpha3alpha4alpha5 collagen IV network.

    Borza, Corina M; Borza, Dorin-Bogdan; Pedchenko, Vadim; Saleem, Moin A; Mathieson, Peter W; Sado, Yoshikazu; Hudson, Heather M; Pozzi, Ambra; Saus, Juan; Abrahamson, Dale R; Zent, Roy; Hudson, Billy G

    2008-04-01

    Podocyte adhesion to the glomerular basement membrane is required for proper function of the glomerular filtration barrier. However, the mechanism whereby podocytes adhere to collagen IV networks, a major component of the glomerular basement membrane, is poorly understood. The predominant collagen IV network is composed of triple helical protomers containing the alpha3alpha4alpha5 chains. The protomers connect via the trimeric noncollagenous (NC1) domains to form hexamers at the interface. Because the NC1 domains of this network can potentially support integrin-dependent cell adhesion, it was determined whether individual NC1 monomers or alpha3alpha4alpha5 hexamers support podocyte adhesion. It was found that, although human podocytes did not adhere to NC1 domains proper, they did adhere via integrin alphavbeta3 to a KRGDS motif located adjacent to alpha3NC1 domains. Because the KRGDS motif is a site of phosphorylation, its interactions with integrin alphavbeta3 may play a critical role in cell signaling in physiologic and pathologic states. PMID:18235087

  17. Faddeev calculation of 3 alpha and alpha alpha Lambda systems using alpha alpha resonating-group method kernel

    Fujiwara, Y; Kohno, M; Suzuki, Y; Baye, D; Sparenberg, J M

    2004-01-01

    We carry out Faddeev calculations of three-alpha (3 alpha) and two-alpha plus Lambda (alpha alpha Lambda) systems, using two-cluster resonating-group method kernels. The input includes an effective two-nucleon force for the alpha alpha resonating-group method and a new effective Lambda N force for the Lambda alpha interaction. The latter force is a simple two-range Gaussian potential for each spin-singlet and triplet state, generated from the phase-shift behavior of the quark-model hyperon-nucleon interaction, fss2, by using an inversion method based on supersymmetric quantum mechanics. Owing to the exact treatment of the Pauli-forbidden states between the clusters, the present three-cluster Faddeev formalism can describe the mutually related, alpha alpha, 3 alpha and alpha alpha Lambda systems, in terms of a unique set of the baryon-baryon interactions. For the three-range Minnesota force which describes the alpha alpha phase shifts quite accurately, the ground-state and excitation energies of 9Be Lambda are...

  18. Conditional overexpression of Stat3alpha in differentiating myeloid cells results in neutrophil expansion and induces a distinct, antiapoptotic and pro-oncogenic gene expression pattern.

    Redell, Michele S; Tsimelzon, Anna; Hilsenbeck, Susan G; Tweardy, David J

    2007-10-01

    Normal neutrophil development requires G-CSF signaling, which includes activation of Stat3. Studies of G-CSF-mediated Stat3 signaling in cell culture and transgenic mice have yielded conflicting data regarding the role of Stat3 in myelopoiesis. The specific functions of Stat3 remain unclear, in part, because two isoforms, Stat3alpha and Stat3beta, are expressed in myeloid cells. To understand the contribution of each Stat3 isoform to myelopoiesis, we conditionally overexpressed Stat3alpha or Stat3beta in the murine myeloid cell line 32Dcl3 (32D) and examined the consequences of overexpression on cell survival and differentiation. 32D cells induced to overexpress Stat3alpha, but not Stat3beta, generated a markedly higher number of neutrophils in response to G-CSF. This effect was a result of decreased apoptosis but not of increased proliferation. Comparison of gene expression profiles of G-CSF-stimulated, Stat3alpha-overexpressing 32D cells with those of cells with normal Stat3alpha expression revealed novel Stat3 gene targets, which may contribute to neutrophil expansion and improved survival, most notably Slc28a2, a purine nucleoside transporter, which is critical for maintenance of intracellular nucleotide levels and prevention of apoptosis, and Gpr65, an acid-sensing, G protein-coupled receptor with pro-oncogenic and antiapoptotic functions. PMID:17634277

  19. Neuromuscular blocking N,N'-polymethylene bistropanium, bis 3alpha-hydroxytropanium and bis 3-oxotropanium compounds.

    Gyermek, L; Lee, C; Nguyen, N; Cho, Y M

    1998-01-01

    To explore the role of ester groups in the neuromuscular blocking (NMB) property of various quaternary ammonium tropinesters, we have synthesized and pharmacologically evaluated twenty bisquaternary ammonium derivatives where two tropane (I), 3alpha-hydroxytropane (II), or 3-oxotropane (III) moieties were connected on their nitrogen atoms with a polymethylene chain of C3-C12 length. The rank order of potency of these agents in the rat (evoked EMG responses of the ant. tibial muscle) was: I, II, and III. Most potent were the longer chain (e.g. C10-C12) compounds of series I, yet they were inferior to bisquaternary ammonium tropinester derivatives (e.g. N,N'-polymethylene bisquaternary tropinesters, or bisquaternary derivatives of dicarboxylic acid tropinesters). Although some of the agents (series I and II) showed a rapid onset and short duration of action-profile, they also exhibited cardiovascular side effects (e.g. cardiac vagal block and blood pressure changes). In the design of new NMB agents of rapid onset and short duration of action the presence of different ester groups in addition to an azabicyclo ring system (e.g. tropane), seems to be essential. PMID:9820129

  20. Identification of noncollagenous sites encoding specific interactions and quaternary assembly of alpha 3 alpha 4 alpha 5(IV) collagen: implications for Alport gene therapy.

    Kang, Jeong Suk; Colon, Selene; Hellmark, Thomas; Sado, Yoshikazu; Hudson, Billy G; Borza, Dorin-Bogdan

    2008-12-12

    Defective assembly of alpha 3 alpha 4 alpha 5(IV) collagen in the glomerular basement membrane causes Alport syndrome, a hereditary glomerulonephritis progressing to end-stage kidney failure. Assembly of collagen IV chains into heterotrimeric molecules and networks is driven by their noncollagenous (NC1) domains, but the sites encoding the specificity of these interactions are not known. To identify the sites directing quaternary assembly of alpha 3 alpha 4 alpha 5(IV) collagen, correctly folded NC1 chimeras were produced, and their interactions with other NC1 monomers were evaluated. All alpha1/alpha 5 chimeras containing alpha 5 NC1 residues 188-227 replicated the ability of alpha 5 NC1 to bind to alpha3NC1 and co-assemble into NC1 hexamers. Conversely, substitution of alpha 5 NC1 residues 188-227 by alpha1NC1 abolished these quaternary interactions. The amino-terminal 58 residues of alpha3NC1 encoded binding to alpha 5 NC1, but this interaction was not sufficient for hexamer co-assembly. Because alpha 5 NC1 residues 188-227 are necessary and sufficient for assembly into alpha 3 alpha 4 alpha 5 NC1 hexamers, whereas the immunodominant alloantigenic sites of alpha 5 NC1 do not encode specific quaternary interactions, the findings provide a basis for the rational design of less immunogenic alpha 5(IV) collagen constructs for the gene therapy of X-linked Alport patients. PMID:18930919

  1. Neuroprotective effect of the 3 alpha 5 beta-pregnanolone glutamate treatment in the model of focal cerebral ischemia in immature rats

    Kletečková, Lenka; Tsenov, Grygoriy; Kubová, Hana; Stuchlík, Aleš; Valeš, Karel

    2014-01-01

    Roč. 564, APR 3 (2014), s. 11-15. ISSN 0304-3940 R&D Projects: GA ČR(CZ) GPP304/11/P386; GA ČR(CZ) GBP304/12/G069; GA TA ČR(CZ) TE01020028; GA ČR(CZ) GAP303/12/1464; GA ČR(CZ) GA14-03627S Grant ostatní: Univerzita Karlova(CZ) 604412 Institutional support: RVO:67985823 Keywords : 3 alpha 5 beta-Pregnanolone glutamate * NMDA receptor * immature rats * focal cerebral * ischemia * endothelin-1 Subject RIV: FH - Neurology Impact factor: 2.030, year: 2014

  2. Arabidopsis thaliana RGXT1 and RGXT2 encode Golgi-localized (1,3)-alpha-D-xylosyltransferases involved in the synthesis of pectic rhamnogalacturonan-II

    Madsen, Jack Egelund; Petersen, Bent Larsen; Motawia, Mohammed Saddik;

    2006-01-01

    in rhamnogalacturonan-II, a complex polysaccharide essential to vascular plants, and is conserved across higher plant families. Rhamnogalacturonan-II isolated from both RGXT1 and RGXT2 T-DNA insertional mutants functioned as specific acceptor molecules in the xylosyltransferase assay. Expression of......Two homologous plant-specific Arabidopsis thaliana genes, RGXT1 and RGXT2, belong to a new family of glycosyltransferases (CAZy GT-family-77) and encode cell wall (1,3)-alpha-d-xylosyltransferases. The deduced amino acid sequences contain single transmembrane domains near the N terminus, indicative...

  3. Antimicrobial activity of basic cholane derivatives. X. Synthesis of 3 alpha- and 3 beta-amino-5 beta-cholan-24-oic acids.

    Bellini, A M; Mencini, E; Quaglio, M P; Guarneri, M; Fini, A

    1991-07-01

    A simple and convenient route to 3 alpha- and 3 beta-amino-5 beta-cholan-24-oic acids was developed via Leuckart-Wallach amination reduction and subsequent acid hydrolysis. Two epimeric formylamino derivatives were produced (alpha and beta), approximately in a 1:1 ratio, as determined by 13C nuclear magnetic resonance spectroscopy. The two isomers were separated by making use of their different solubilities in ethyl ether. The absolute configuration of the two amino acids was assigned by comparison with authentic reference samples. PMID:1780957

  4. The selenium-75-homocholic acid taurine test reevaluated: combined measurement of fecal selenium-75 activity and 3 alpha-hydroxy bile acids in 211 patients

    The recommended reference values for the selenium-75-homocholic acid taurine (75SeHCAT) test, used in the analysis of chronic diarrhea, were evaluated in 211 patients by comparing simultaneous measurements of 3 alpha-hydroxy bile acids and 75Se activity in daily collected stools. An initial evaluation in 11 patients showed that the fecal collection method, which allows inspection and additional analysis of stools, was equivalent to the abdominal retention method. Selenium-75-HCAT whole-body retention half-life (WBR50) was greater than 2.8 days in less than 10% of the patients with bile acid malabsorption and less than 1.7 days in less than 10% of the normals. We recommend that a 75SeHCAT WBR50 less than 1.7 days is abnormal, a WBR50 greater than 2.8 days is normal, and a WBR50 in the range 1.7-2.8 days is equivocal, which was the case in 48% (94/195) of the patients in this study

  5. The Expression of Interleukin-17, Interferon-gamma, and Macrophage Inflammatory Protein-3 Alpha mRNA in Patients with Psoriasis Vulgaris

    李家文; 李东升; 谭志建

    2004-01-01

    Summary: To investigate the role of Interleukin-17 (IL-17), Interferon-gamma (IFN-γ), and macrophage inflammatory protein-3 alpha (MIP-3α) in the pathogenesis of psoriasis, reverse transcriptase-polymerase chain reaction (RT-PCR) was used to semi-quantitatively analyze the mRNA expression of IL 17, IFN-γ, and MIP-3α in 31 psoriatic lesions and 16 normal skin tissues. The results showed that the mRNA of the three cytokines was present in all specimens. And the expression level of IL-17 mRNA in skin lesions was 1. 1416±0. 0591, which was significantly higher than that in normal controls (0. 8788±0. 0344, P<0. 001). The expression levels of IFN-γ mRNA were 1.1142±0. 0561 and 0. 9050±0. 0263, respectively, with significant difference(P<0. 001). And the expression levels of MIP-3α mRNA in psoriatic lesions was 1. 1397 ± 0. 0521, which was markedly higher than that in normal controls (0. 8681±0. 0308, P<0. 001). These findings indicate that up regulated expression of IL-17, IFN-γ, and MIP-3α might be involved in the pathogenesis of psoriasis.

  6. The alloantigenic sites of alpha3alpha4alpha5(IV) collagen: pathogenic X-linked alport alloantibodies target two accessible conformational epitopes in the alpha5NC1 domain.

    Kang, Jeong Suk; Kashtan, Clifford E; Turner, A Neil; Heidet, Laurence; Hudson, Billy G; Borza, Dorin-Bogdan

    2007-04-01

    Anti-glomerular basement membrane (GBM) antibody nephritis is caused by an autoimmune or alloimmune reaction to the NC1 domains of alpha3alpha4alpha5(IV) collagen. Some patients with X-linked Alport syndrome (XLAS) develop post-transplant nephritis mediated by pathogenic anti-GBM alloantibodies to collagen IV chains present in the renal allograft but absent from the tissues of the patient. In this work, the epitopes targeted by alloantibodies from these patients were identified and characterized. All XLAS alloantibodies recognized conformational epitopes in the NC1 domain of alpha5(IV) collagen, which were mapped using chimeric alpha1/alpha5 NC1 domains expressed in mammalian cells. Allograft-eluted alloantibodies mainly targeted two conformational alloepitopes mapping to alpha5NC1 residues 1-45 and 114-168. These regions also encompassed the major epitopes of circulating XLAS alloantibodies, which in some patients additionally targeted alpha5NC1 residues 169-229. Both kidney-eluted and circulating alloantibodies to alpha5NC1 distinctively targeted epitopes accessible in the alpha3alpha4alpha5NC1 hexamers of human GBM, unlike anti-GBM autoantibodies, which targeted sequestered alpha3NC1 epitopes. The results identify two immunodominant alpha5NC1 epitopes as major alloantigenic sites of alpha3alpha4alpha5(IV) collagen specifically implicated in the pathogenesis of post-transplant nephritis in XLAS patients. The contrast between the accessibility of these alloepitopes and the crypticity of autoepitopes indicates that distinct molecular forms of antigen may initiate the immunopathogenic processes in the two forms of anti-GBM disease. PMID:17293596

  7. Affinity labeling of two nucleotide sites on Na,K-ATPase using 2'(3')-O-(2,4,6-trinitrophenyl)8-azidoadenosine 5'-[alpha-32P]diphosphate (TNP-8N3-[alpha-32P]ADP) as a photoactivatable probe. Label incorporation before and after blocking the high affinity ATP site with fluorescein isothiocyanate.

    Ward, D G; Cavieres, J D

    1998-12-11

    ATP and its analogues act on the minimal functional unit of Na, K-ATPase, the alpha beta protomer, with high and low affinity effects. Fluorescein isothiocyanate (FITC) irreversibly blocks the high affinity, or catalytic, ATP site, and yet the surviving K+-phosphatase activity of soluble FITC-modified alphabeta protomers can be photoinactivated by 2'(3')-O-trinitrophenyl (TNP)-8N3-ADP (Ward, D. G., and Cavieres, J. D. (1998) J. Biol. Chem. 273, 14277-14284). We have now used TNP-8N3-[alpha-32P]ADP as a photoaffinity label for Na,K-ATPase. The native enzyme can be photolabeled at 5 microM TNP-8N3-[alpha-32P]ADP, and ATP or FITC treatment prevents labeling of the alpha chain. At 25 microM, however, TNP-8N3-[alpha-32P]ADP can be incorporated in the FITC-modified alpha chain, concurrently with the inactivation of the K+-phosphatase activity, to an extrapolated level of 0.5-1.2 mol of 32P-probe per mol of alpha chain. Photoinactivation and labeling are prevented by TNP-ADP, vanadate, or strophanthidin and are promoted by Na+ or Mg2+, but not K+. The cation effects suggest that the fluorescein-modified enzyme incorporates the TNP-8N3-[alpha-32P]ADP. Mg complex preferentially, and the free probe when in the E1 enzyme form and after occupation of a low-affinity Na+ site. Partial trypsinolysis reveals that the point of TNP-8N3-[alpha-32P]ADP attachment is on the C-terminal 58-kDa fragment of the FITC-modified alpha chain. The affinity labeling of the fluorescein enzyme by TNP-8N3-[alpha-32P]ADP endorses the view that two nucleotide sites can be occupied simultaneously in each alpha subunit of Na,K-ATPase. PMID:9837964

  8. 3alpha clustering in the excited states of 16C

    Baba, T; Kimura, M

    2014-01-01

    The alpha cluster states of 16C are investigated by using the antisymmetrized molecular dynamics. It is shown that two different types of alpha cluster states exist: triangular and linear-chain states. The former has an approximate isosceles triangular configuration of alpha particles surrounded by four valence neutrons occupying sd-shell, while the latter has the linearly aligned alpha particles with two sd-shell neutrons and two pf-shell neutrons. It is found that the structure of the linear-chain state is qualitatively understood in terms of the 3/2 pi- and 1/2 sigma- molecular orbit as predicted by molecular-orbital model, but there exists non-negligible Be+alpha+2n correlation. The band-head energies of the triangular and linear-chain rotational bands are 8.0 and 15.5 MeV, and the latter is close to the He+Be threshold energy. It is also shown that the linear-chain state becomes the yrast sstate at J=10 with excitation energy 27.8 MeV owing to its very large moment-of-inertia comparable with hyperdeforma...

  9. Genetic diversity of plasmodium vivax merozoite surface protein-3alpha (Pvmsp-3alpha) gene in Jhapa District of Nepal

    Adhikari, Madhav; Ranjitkar, Samir; Schousboe, Mette Leth;

    2012-01-01

    into 13 allelic patterns: A1-A9, B1, B2, C1 and C2. These results indicated a high genetic diversity within the studied P. vivax population. As the transmission rate of malaria is low in Nepal, the diversity is most likely due to migration of people between the malaria endemic regions, either within...

  10. Neurosteroids: Can a 2alpha,3alpha-epoxy ring make up for the 3alpha-hydroxyl group?

    Kasal, Alexander; Buděšínský, Miloš; Mareš, Pavel; Krištofíková, Z.; Leitao, A. J.; Sá e Melo, M. L.; Silva, M. M. C.

    2016-01-01

    Roč. 105, Jan (2016), s. 12-18. ISSN 0039-128X R&D Projects: GA ČR(CZ) GA305/09/0846; GA ČR(CZ) GBP304/12/G069 Institutional support: RVO:61388963 ; RVO:67985823 Keywords : neurosteroids * NMR spectrometry * GABA(A) receptor * TBPS-test Subject RIV: ED - Physiology Impact factor: 2.639, year: 2014

  11. Brassinolide activities of 2alpha,3alpha-diols versus 3alpha,4alpha-diols in the bean second internode bioassay: Explanation by molecular modeling methods

    Šíša, Miroslav; Vilaplana-Polo, M.; Ballesteros, C. B.; Kohout, Ladislav

    2007-01-01

    Roč. 72, 11/12 (2007), s. 740-750. ISSN 0039-128X R&D Projects: GA AV ČR 1QS510680561; GA MŠk 1M06030 Institutional research plan: CEZ:AV0Z40550506 Keywords : 3D-SAR * 3D-QSAR * biologically active steroids * brassinosteroids Subject RIV: CC - Organic Chemistry Impact factor: 2.143, year: 2007

  12. Brassinolide activities 2alpha, 3alpha - diols versus 3alpha, 4alpha - diols in the bean second internode bioassay: explanation by molecular modeling methods

    Šíša, Miroslav; Vilaplana-Polo, M.; Ballesteros, C. B.; Kohout, Ladislav

    Brno : Mendelova zemědělská a lesnická univerzita v Brně, 2007. s. 7. ISBN 978-80-7375-090-9. [Funkční genomika a proteomika ve šlechtění rostlin. 24.09.2007-25.09.2007, Křtiny] Institutional research plan: CEZ:AV0Z40550506 Keywords : brassinolid * plant stress * molecular modeling Subject RIV: CC - Organic Chemistry

  13. Macrophage Inflammatory Protein-3 Alpha (MIP-3α)/CCL20 in HIV-1-Infected Individuals

    Aziz, Najib; Detels, Roger; Chang, L Cindy; Butch, Anthony W

    2016-01-01

    Objective Uncontrolled HIV infection progresses to the depletion of systemic and mucosal CD4 and AIDS. Early HIV infection may be associated with increases in the concentration of MIP-3α in the blood and gut fluids. MIP-3α/CCL20 is the only chemokine known to interact with CCR6 receptors which are expressed on immature dendritic cells and both effector and memory CD8+ and CD4+ T cells. The role and prognostic value of blood levels of MIP-3α in HIV-infected individuals has yet to be described. Methods We determined the serum levels of MIP-3α, and IFN-γ, in 167 HIV-1-infected and 27 HIV-1-uninfected men participating in the Multicenter AIDS Cohort Study (MACS). The blood biomarkers were measured using enzyme-linked immunosorbent assays (ELISA) and the cell phenotypes using flow cytometry. Results Median serum levels of MIP-3α in HIV-1-infected and uninfected men was significantly different (pabsolute number of CD4+ T cell (p=0.01) and were positively correlated with CD38 molecules on CD8+ T cells (p=0.0002) and with serum levels of IFN-γ (0.006). Conclusion Serum levels of MIP-3α concomitantly increase with plasma levels of IFN-γ, CD38 expression on CD8+ T cells, and decreased of absolute CD4+ T cells in HIV-1-infected men. A higher blood level of MIP-3α may be representation of locally high level of MIP-3α and more recruitment of immature dendritic cell at site of infection. Involvement of CCR6/CCL20 axis and epithelial cells at the recto-colonel level may enhance sexual transmission of HIV-1 in MSM and may be useful as a prognostic marker in HIV-1-infection and AIDS.

  14. Pregnanolone 3alpha-Hemiesters - Novel Anionic Steroid Inhibitors of Activated NMDA Receptors

    Slavíková, Barbora; Chodounská, Hana; Vyklický, Vojtěch; Borovská, Jiřina; Krausová, Barbora; Vyklický ml., Ladislav; Kudová, Eva

    Kanazawa : -, 2012. [International Congress on Hormonal Steroids and Hormones and Cancer /15./. 15.11.2012-17.11.2012, Kanazawa] R&D Projects: GA ČR(CZ) GAP303/12/1464; GA TA ČR(CZ) TE01020028 Institutional support: RVO:61388963 ; RVO:67985823 Keywords : NMDA receptors * neurosteroids Subject RIV: CC - Organic Chemistry

  15. Decreased expression of hepatocyte nuclear factor 3 alpha during the acute-phase response influences transthyretin gene transcription.

    Qian, X; Samadani, U; Porcella, A; Costa, R H

    1995-01-01

    Three distinct hepatocyte nuclear factor 3 (HNF-3) proteins (alpha, beta, and gamma) are known to regulate the transcription of numerous liver-specific genes. The HNF-3 proteins bind to DNA as monomers through a winged-helix motif, which is also utilized by a number of developmental regulators, including the Drosophila homeotic fork head (fkh) protein. We have previously characterized a strong-affinity HNF-3S site in the transthyretin (TTR) promoter region which is essential for expression in...

  16. On increasing the level of engineering and economical substatiation for wind power plants

    Basic arguments for developing wind power plants contained in the article by L.G.Ovis published in the journal Ehnergeticheskoe Mashinostroenie, N6, 1992 are analyzed. Incorrectness of the author's conclusion on advisability of using wind power plants in The Khabarovsk Region is proved. The conclusion on the necessity of fundamental technical-economical studies for substantiation of the wind power plant applicability in each individual case is made

  17. Relaxation Dynamics of Pseudomonas aeruginosa ReI(CO)3(.alpha.-diimine)(HisX)+ (X = 83, 107, 109, 124, 126)CuII Azurins

    Blanco-Rodríguez, A. M.; Busby, M.; Ronayne, K. L.; Towrie, M.; Grädinaru, C.; Sudhamsu, J.; Sýkora, Jan; Hof, Martin; Záliš, Stanislav; Di Billio, A. J.; Crane, B. R.; Gray, H. B.; Vlček Jr., Antonín

    2009-01-01

    Roč. 131, č. 33 (2009), s. 11788-11800. ISSN 0002-7863 R&D Projects: GA MŠk OC09043; GA MŠk(CZ) LC06063 Institutional research plan: CEZ:AV0Z40400503 Keywords : resolved infrared spectroscopy * excited-state dynamics * electron transfer Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 8.580, year: 2009

  18. 3 alpha 5 beta-Pregnanolone glutamate, a use-dependent NMDA antagonist, reversed spatial learning deficit in an animal model of schizophrenia

    Valeš, Karel; Rambousek, Lukáš; Holubová, Kristina; Svoboda, Jan; Bubeníková-Valešová, V.; Chodounská, Hana; Vyklický ml., Ladislav; Stuchlík, Aleš

    2012-01-01

    Roč. 235, č. 1 (2012), s. 82-88. ISSN 0166-4328 R&D Projects: GA MZd(CZ) NS10365 Institutional research plan: CEZ:AV0Z50110509 Institutional support: RVO:67985823 ; RVO:61388963 Keywords : schizophrenia-like behavior * MK-801 * use-dependent * NMDA antagonist * anxiety * pregnanolone glutamate * Carousel maze Subject RIV: FH - Neurology Impact factor: 3.327, year: 2012

  19. {Coherent Dissociation $^{12}$C~$\\rightarrow$~3$\\alpha$ in Lead-Enriched Emulsion at 4.5 GeV/$c$~per Nucleon

    Belaga, V V; Rusakova, V V; Salamov, J A; Chernov, G M; 10.1063/7788-1905(95)5811-5

    2011-01-01

    The transverse-momentum distributions and correlation characteristics of relativistic $\\alpha$ particles from the coherent dissociation of a carbon nucleus into three $\\alpha$ particles at 4.5 GeV/$c$ are studied in lead-enriched emulsion. Comparative analysis of data obtained in ordinary and lead-enriched emulsion stacks is performed. It is shown that the statistical model of rapid fragmentation does not describe the momentum and correlation characteristics of a $\\alpha$ particles in the rest frame of the carbon nucleus. The estimated decay temperature of $^{12}$C is weakly dependent on the target atomic mass. It is shown that the carbon nucleus undergoing fragmentation acquires angular momentum in the collision.

  20. Chromosomal mapping and mutational analysis of the coding region of the glycogen synthase kinase-3alpha and beta isoforms in patients with NIDDM

    Hansen, L; Arden, K C; Rasmussen, S B;

    1997-01-01

    Activation of glycogen synthesis in skeletal muscle in response to insulin results from the combined inactivation of glycogen synthase kinase-3 (GSK-3) and activation of the protein phosphatase-1, changing the ratio between the inactive phosphorylated state of the glycogen synthase to the active ...

  1. Synthesis of deuterium labeled NMDA receptor inhibitor-20-Oxo-5 beta-[9,12,12-H-2(3)]pregnan-3 alpha-yl-L-glutamyl 1-ester

    Kapras, Vojtěch; Slavíčková, Alena; Šťastná, Eva; Vyklický ml., Ladislav; Valeš, Karel; Chodounská, Hana

    2012-01-01

    Roč. 77, č. 3 (2012), s. 282-287. ISSN 0039-128X R&D Projects: GA MŠk(CZ) LC554; GA MŠk(CZ) LC06077; GA MZd(CZ) NS10365; GA MŠk(CZ) 1M0517 Grant ostatní: GA MŠk(CZ) ED0007/01/01 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50110509 Keywords : NMDA receptor * neuroprotection * deuterium labeling Subject RIV: CC - Organic Chemistry Impact factor: 2.803, year: 2012

  2. Highly efficient photocatalysis by BiFeO{sub 3}/{alpha}({gamma})-Fe{sub 2}O{sub 3} ferromagnetic nano p/n junctions formed by dopant-induced phase separation

    Ramadan, Wegdan, E-mail: wegdan.ramadan@gmail.com [Alexandria University, Physics Department, Faculty of Science (Egypt); Shaikh, Parvez A. [National Chemical Laboratory (CSIR-NCL), Council of Scientific and Industrial Research (India); Ebrahim, Sh. [Alexandria University, Materials Science Department, Institute of Graduate Studies and Research (Egypt); Ramadan, Abdallah [Alexandria University, Physics Department, Faculty of Science (Egypt); Hannoyer, Beatrice; Jouen, Samuel; Sauvage, Xavier [Universite de Rouen, GPM, UMR 6634 CNRS (France); Ogale, Satishchandra, E-mail: sb.ogale@ncl.res.in [National Chemical Laboratory (CSIR-NCL), Council of Scientific and Industrial Research (India)

    2013-08-15

    A series of Bi{sub 1-x}Ca{sub x}FeO{sub 3} (BCFO) nanoparticles (with x = 0.0, 0.03, 0.07, 0.10, 0.15, and 0.20) have been synthesized by sol-gel reaction. X-ray diffraction patterns establish the formation of hexagonal bismuth ferrite as the prominent phase, with a small contribution of the Bi{sub 2}Fe{sub 4}O{sub 9} phase (as reported by others as well) which diminishes rapidly with the increase in Ca concentration. Interestingly, above a calcium dopant concentration of about 10 % peaks of Fe{sub 2}O{sub 3} (both {alpha} and {gamma} components) are observed with a concomitant enhancement of ferromagnetism. Small contribution of the Bi{sub 6}Ca{sub 4}O{sub 13} phase is also noted in these samples. This phase evolution is driven by dopant-induced strain energy and increasing oxygen vacancy concentration for local charge balance. Transmission electron microscopy (with elemental scanning) and Moessbauer spectroscopy techniques bring out the evolution of nanoparticle morphology (and elemental distribution) and phase configuration, respectively. Measurements of photocatalytic activity (and photo-Fenton activity with H{sub 2}O{sub 2}) reveal that Ca doping at the Bi site in BFO enhances the activity significantly in the concentration regime where BFO/{alpha}({gamma})-Fe{sub 2}O{sub 3} phases coexist in the form of a nanocomposite. The enhancement can thus be attributed to the carrier transfer between BFO and {alpha}({gamma})-Fe{sub 2}O{sub 3} across nano p/n junctions leading to enhanced carrier lifetime. Importantly, the magnetization of the nanocomposite (about 16 emu gm{sup -1} at x = 0.20) provides a convenient way to collect the photocatalyst with the help of an external magnet for reuse.

  3. Anharmonicity Effects in IR Spectra of [Re(X)(CO)(3)(alpha-diimine)] (alpha-diimine=2,2 '-bipyridine or pyridylimidazo[1,5-a]pyridine; X = Cl or NCS) Complexes in Ground and Excited Electronic States

    Kvapilová, Hana; Vlček Jr., Antonín; Barone, V.; Biczysko, M.; Záliš, Stanislav

    2015-01-01

    Roč. 119, č. 40 (2015), s. 10137-10146. ISSN 1089-5639 R&D Projects: GA MŠk LD14129 Institutional support: RVO:61388955 Keywords : RESOLVED INFRARED-SPECTROSCOPY * TRANSITION-METAL-COMPLEXES * LARGE MOLECULAR- SYSTEMS Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.693, year: 2014

  4. Comparing Prothrombin induced by vitamin K absence-II (PIVKA-II) with the oncofetal proteins Glypican-3, Alpha feto protein and Carcinoembryonic antigen in diagnosing hepatocellular carcinoma among Egyptian patients

    Iman A. Abd El Gawad; Mossallam, Ghada I.; Noha H. Radwan; Elzawahry, Heba M; Niveen M. Elhifnawy

    2014-01-01

    Background: Hepatocellular carcinoma (HCC) is usually asymptomatic in the early stage and does not show elevated alpha-feto protein (AFP). AFP shows 60–80% sensitivity in diagnosing HCC. Glypican3 (GPC-3) is an oncofetal protein that is only detected in HCC cells but not in benign liver tissues, while Carcinoembryonic antigen (CEA) is expressed in various neoplasms including HCC. Although, it is not specific for HCC. Prothrombin induced by vitamin K absence-II (PIVKA-II) is an abnormal ...

  5. Comparing Prothrombin induced by vitamin K absence-II (PIVKA-II) with the oncofetal proteins Glypican-3, Alpha feto protein and Carcinoembryonic antigen in diagnosing hepatocellular carcinoma among Egyptian patients

    Background: Hepatocellular carcinoma (HCC) is usually asymptomatic in the early stage and does not show elevated alpha-feto protein (AFP). AFP shows 60-80% sensitivity in diagnosing HCC. Glypican3 (GPC-3) is an oncofetal protein that is only detected in HCC cells but not in benign liver tissues, while Carcinoembryonic antigen (CEA) is expressed in various neoplasms including HCC. Although, it is not specific for HCC. Prothrombin induced by vitamin K absence-II (PIVKA-II) is an abnormal prothrombin protein that is increased in the serum of HCC patients. It has higher sensitivity and specificity compared to AFP. The aim of this study is to compare the clinical utility of PIVKA-II with GPC-3, AFP and CEA in diagnosing HCC. Prothrombin induced by vitamin K absence-II Patients and methods: This study included 40 patients with HCC, 10 patients with cirrhosis as a benign control group, and 10 apparently healthy volunteers as normal controls. Serum samples were subjected to routine laboratory investigations, measurement of CEA, AFP using MEIA technique (Axsym), glypican3, and PIVKA-II using ELISA technique in the sera of all patients and controls. Results: All markers showed the highest results in the HCC group. Higher concentrations of PIVKA- II were detected in patients with splenomegaly, and in tumors with size (>3 cm). Combination of Glypican-3 and PIVKA-II showed the highest sensitivity, while GPC-3 alone and combination of GPC-3 and AFP showed the highest specificity to differentiate HCC from liver cirrhosis and normal controls. GPC-3, PIVKAII, and combination of both showed the highest sensitivity, while GPC-3 alone showed the highest specificity to differentiate HCC from liver cirrhosis. Conclusion: Glypican-3 is the only oncofetal antigen that showed comparable high diagnostic accuracy as PIVKA-II in diagnosing HCC among Egyptian patients.

  6. The Value of Combined Serum Alpha-fetoprotein Heteroplasmon-L3 Concentration and AFP-L3/Alpha-fetoprotein Ratio Detection in the Early Diagnosis of Primary Liver Cancer%联合检测血清甲胎蛋白异质体浓度与甲胎蛋白异质体百分含量在原发性肝癌诊断中的价值

    黄彩云; 韩素桂; 贾红莲

    2013-01-01

    Objective To explore the value of combined serum alpha-fetoprotein inform (AFP-L3) and AFP-L3/AFP as biomarkers in the early diagnosis of hepatocellular carcinoma (HCC).Methods A total of 137 patients from the People's Hospital of Tangshan of Hebei Union University were included in our study.They were treated in hospital from March to November 201 1.All the patients were at the age of 28 to 77 years old,and 98 of them were men,and 39 were women.According to the pathological diagnosis,patients were divided into two groups.HCC group had 92 patients,and benign liver disease group had 45 patients including 37 with liver cirrhosis and 8 with chronic hepatitis.ELISA method was used to test the serum AFP-L3 level.At the same time,microcentrifugal column method was adopted to separate AFP-L3 from the patients' serum,and electrochemical luminescence method was used to detect the separated AFP-L3 and total AFP levels.Then,we calculated the ratio of AFP-L3/AFP.We also calculated the statistical indexes of AFP-L3 level and AFP-L3/AFP ratio in the diagnosis of HCC,such as sensitivity,specificity and Youden index.The above indexes of combined AFP-L3 level and AFP-L3/AFP ratio were also detected to evaluated its diagnostic value.Results HCC group AFP-L3 level (109.04 ± 62.51) ng/mL was significantly higher than that of the benign liver disease group [(25.96 ± 49.43) ng/mL; t=8.28,P < 0.001].HCC group serum AFP-L3/AFP ratio (17.35% ± 14.48%) was significantly higher than that of the benign liver disease group (5.62% ± 6.38%,t=6.545,P < 0.000 1).With serum AFP-L3 level > 38.0 ng/mL as a critical value of primary liver cancer diagnosis,the sensitivity was 83.69%,and the specificity was 88.88%.For AFP-L3/AFP ratio > 10% as a critical value in primary liver cancer diagnosis,the sensitivity was 83.69%,and the specificity was 95.55%.When serum AFP-L3 level > 38.0 ng/mL and AFP-L3/AFP ratio > 7.5% were combined in primary liver cancer diagnosis,the sensitivity was 97.83%,and the specificity was 84.44%.Conclusion Compared with application of single indicators,combined use of AFP-L3 level and the ratio of AFP-L3/AFP in the diagnosis of HCC significantly improves the diagnostic sensitivity,and is more conducive to the early diagnosis of HCC,although its diagnostic specificity is slightly lower.%目的 通过检测肝病患者血清甲胎蛋白异质体(AFP-L3)浓度和AFP-L3/血清甲胎蛋白(AFP)比值,分析探讨并联运用两指标在肝细胞癌(HCC)诊断中的价值.方法 选取2011年3月-11月137例的住院患者血清标本,AFP检测均为阳性.依据病理学诊断,将137例患者分为两组,HCC组92例,良性肝病组45例,后者包括肝硬化结节37例、慢性活动性肝炎8例.采用酶联免疫吸附试验(ELISA)检测所有患者血清AFP-L3浓度;同时运用微量吸附柱法分离血清中的AFP-L3,采用电化学发光法检测分离后的AFP-L3和血清中总AFP浓度,计算AFP-L3/AFP比值.计算采用AFP-L3浓度与AFP-L3/AFP比值以及AFP-L3浓度与AFP-L3/AFP比值两指标并联诊断HCC的灵敏度、特异度、Youden指数等统计学指标,探讨其在原发性肝癌诊断中的价值.结果 ①HCC 组AFP-L3浓度(109.04±62.51)ng/mL,明显高于良性肝病组(25.96±49.43)ng/mL,差异有统计学意义(t=8.28,P< 0.001).HCC组血清AFP-L3/AFP比值(17.35±14.48%)高于良性肝病组(5.617±6.38%),差异有统计学意义(t=6.545,P<0.0001).②以血清AFP-L3浓度>38.0 ng/mL作为临界值诊断原发性肝癌的灵敏度为83.69%,特异度为88.88%,以AFP-L3/AFP比值>10%作为临界值诊断原发性肝癌的灵敏度为83.69%,特异度为95.55%.③并联应用血清AFP-L3浓度>38.0 ng/mL、AFP-L3/AFP>比值7.5%诊断HCC的灵敏度为97.83%,特异度为84.44%.结论 并联应运AFP-L3浓度与AFP-L3/AFP比值诊断HCC较应用单一指标诊断特异度稍有下降,但明显提高了诊断的灵敏度,更有利于HCC的早期诊断.

  7. Involvement of mirror neuron system in prodromal Alzheimer's disease

    Moretti, D. V.

    2016-01-01

    Background Mirror neurons have been localized in several locations, including the inferior parietal lobule (IPL). Increase of EEG alpha3/alpha2 frequency power ratio has been detected in mild cognitive impairment (MCI) subjects who will convert in Alzheimer's disease (AD). We investigated the association of alpha3/alpha2 frequency power ratio with cortical thickness in IPL in MCI subjects. Methods 74 adult subjects with MCI underwent EEG recording and high resolution MRI. Alpha3/alpha2 freque...

  8. INCREASE OF THETA FREQUENCY IS ASSOCIATED WITH REDUCTION IN REGIONAL CEREBRAL BLOOD FLOW ONLY IN SUBJECTS WITH MILD COGNITIVE IMPAIRMENT WITH HIGHER UPPER ALPHA/LOW ALPHA EEG FREQUENCY POWER RATIO

    Davide v Moretti

    2013-12-01

    Full Text Available Background: several biomarkers have been proposed for detecting Alzheimer's disease (AD in its earliest stages, that is, in the predementia stage. In an attempt to find noninvasive biomarkers, researchers have investigated the feasibility of neuroimaging tools, such as MRI, SPECT as well as neurophysiological measurements using EEG. Moreover, the increase of EEG alpha3/alpha2 frequency power ratio has been associated with AD-converters subjects with mild cognitive impairment (MCI.Objective: to study the association of alpha3/alpha2 frequency power ratio with regional cerebral blood flow (rCBF changes in subjects with MCI .Methods: 27 adult subjects with MCI underwent EEG recording and perfusion single-photon emission computed tomography (SPECT evaluation. The alpha3/alpha2 frequency power ratio was computed for each subject. Two groups were obtained according to the median values of alpha3/alpha2, at a cut-off of 1.17. Correlation between brain perfusion and EEG markers were detected.Results: subjects with higher alpha3/alpha2 frequency power ratio showed a constant trend to a lower perfusion than low alpha3/alpha2 group. The two groups were significantly different as about the hippocampal volume and correlation with the theta frequency activity.Conclusion: there is a complex interplay between cerebral blood flow, theta frequency activity and hippocampal volume in MCI patients with prodromal Alzheimer's disease, characterized by higher EEG alpha3 /alpha2 frequency power ratio.

  9. Triterpenes from Protium hebetatum resin.

    Marques, Delcio Dias; Graebner, Ilmar Bernardo; de Lemos, Telma Leda Gomes; Machado, Luciana Lucas; Assunção, Jõao Carlos Costa; Monte, Francisco José Queiroz

    2010-08-01

    Three olean (beta-amyrenone, beta-amyrin and maniladiol), three ursane (alpha-amyrinone, alpha-amyrin and breine) and four tirucallane (3-oxotirucalla-8,24-dien-21-6ic acid, 3alpha-hydroxytirucalla-8,24-dien-21-oic acid, 3alpha-acetoxytirucalla-8,24-dien-21-oic acid and 3alpha-hydroxytirucalla-7,24-dien-21-oic acid) triterpenes were isolated from the oleoresin of Protium hebetatum Daly. The structures were established mainly by 13C, 1D and 2D NMR spectroscopic analysis. The isolation of 3alpha-hydroxytirucalla-8,24-dien-21-oic acid permitted correction of the chemical shift assignments of some of its carbon atoms. PMID:20839613

  10. Neuroactive steroids in depression and anxiety disorders: Clinical studies

    Eser, Daniela; Schuele, Cornelius; Baghai, Thomas C.; Romeo, Elena; Rupprecht, Rainer

    2006-01-01

    Certain neuroactive steroids modulate ligand-gated ion channels via non-genomic mechanisms. Especially 3 alpha-reduced pregnane steroids are potent positive allosteric modulators of the gamma-aminobutyric acid type A (GABA(A)) receptor. During major depression, there is a disequilibrium of 3 alpha-reduced neuroactive steroids, which is corrected by clinically effective pharmacological treatment. To investigate whether these alterations are a general principle of successful antidepressant trea...

  11. Two new ent-kaurane diterpenoids from Albizia mollis (Wall.) Boiv

    Cheng, Zhong-Quan; Yang, Dan; Liu, Yu-Qing; Hu, Jiang-Miao; Jiang, He-Zhong; Wang, Peng-Cheng; Zhoua, Jun; Zhao, You-Xing, E-mail: yxzhao@mail.kib.ac.c [Chinese Academy of Sciences, Kunming (China). Kunming Institute of Botany. State Key Lab. of Phytochemistry and Plant Resources in West China; Li, Ning [Anhui University, Hefei (China). School of Life Sciences

    2010-07-01

    Two new kaurane diterpenoid, 3{alpha}, 16{beta}, 17-trihydroxy-ent-kaurane 3-O-{beta}-D-glucopyranoside and 2{beta},3{alpha}-dihydroxy-ent-kaur-15-en-17-oic acid 3-O-{beta}-D-glucopyranoside, were isolated from the bark of Albizia mollis (Wall.) Boiv. The structures of two new compounds were elucidated by extensive 1D- and 2D-NMR spectroscopic methods in combination with MS experiments. (author)

  12. Hepatocyte nuclear factor 3 activates transcription of thyroid transcription factor 1 in respiratory epithelial cells.

    Ikeda, K.; Shaw-White, J R; Wert, S E; Whitsett, J A

    1996-01-01

    Thyroid transcription factor 1 (TTF-1), hepatocyte nuclear factor 3alpha (HNF-3alpha), and HNF-3beta regulate the transcription of genes expressed in the respiratory epithelium. To test whether members of the HNF-3/forkhead family influence TTF-1 gene expression, deletion constructs containing the 5' region of the human TTF-1 gene were transfected into immortalized mouse lung epithelial (MLE) cells. DNase I protection and electrophoretic mobility shift assays identified elements in the 5' reg...

  13. Isolation of lignans glycosides from Alibertia sessilis (Vell.) K. Schum. (Rubiaceae) by preparative high-performance liquid chromatography

    Silva, V.C. da; Bolzani, V. da S.; Lopes, M.N. [UNESP, Araraquara, SP (Brazil). Inst. de Quimica. Dept. de Quimica Organica; Silva, G.H. [Universidade Federal de Sergipe, Aracaju, SE (Brazil). Dept. de Quimica]. E-mail: mnlopes@iq.unesp.br

    2006-10-15

    Enantiomeric aglycone lignans contained in a mixture were separated from a fraction of the extract of the stems of Alibertia sessilis (Vell.) K. Schum. (Rubiaceae) by preparative high-performance liquid chromatography. An efficient and fast separation can be achieved with methanol-water (30:70, v/v). Their structures were identified as (+)-lyoniresinol 3{alpha}-O-{beta}-glucopyranoside and (-)-lyoniresinol 3{alpha}-O-{beta}-glucopyranoside, being reported for the first time in Rubiaceae. (author)

  14. Acylated triterpene saponins from the roots of Securidaca longepedunculata.

    Mitaine-Offer, Anne-Claire; Pénez, Nicolas; Miyamoto, Tomofumi; Delaude, Clément; Mirjolet, Jean-François; Duchamp, Olivier; Lacaille-Dubois, Marie-Aleth

    2010-01-01

    Four triterpene saponins, 3-O-beta-D-glucopyranosylpresenegenin 28-O-beta-D-apiofuranosyl-(1-->3)-beta-d-xylopyranosyl-(1-->4)-[beta-D-apiofuranosyl-(1-->3)]-alpha-L-rhamnopyranosyl-(1-->2)-{4-O-[(E)-3,4,5-trimethoxycinnamoyl]}-beta-D-fucopyranosyl ester, 3-O-beta-D-glucopyranosylpresenegenin 28-O-beta-D-apiofuranosyl-(1-->3)-beta-D-xylopyranosyl-(1-->4)-[beta-D-apiofuranosyl-(1-->3)]-alpha-L-rhamnopyranosyl-(1-->2)-[(6-O-acetyl)-beta-D-glucopyranosyl-(1-->3)]-{4-O-[(E)-3,4,5-trimethoxycinnamoyl]}-beta-D-fucopyranosyl ester, 3-O-beta-D-glucopyranosylpresenegenin 28-O-beta-D-apiofuranosyl-(1-->3)-beta-D-xylopyranosyl-(1-->4)-[beta-D-apiofuranosyl-(1-->3)]-alpha-L-rhamnopyranosyl-(1-->2)-[beta-D-galactopyranosyl-(1-->3)]-{4-O-[(E)-3,4,5-trimethoxycinnamoyl]}-beta-D-fucopyranosyl ester, and 3-O-beta-D-glucopyranosylpresenegenin 28-O-beta-D-apiofuranosyl-(1-->3)-[alpha-L-arabinopyranosyl-(1-->4)]-beta-D-xylopyranosyl-(1-->4)-[beta-D-apiofuranosyl-(1-->3)]-alpha-L-rhamnopyranosyl-(1-->2)-{4-O-[(E)-3,4,5-trimethoxycinnamoyl]}-beta-D-fucopyranosyl ester, were isolated from the roots of Securidaca longepedunculata, together with three known compounds. Their structures were established mainly by 2D NMR techniques and mass spectrometry. PMID:19863977

  15. Steroid metabolism in the hormone dependent MCF-7 human breast carcinoma cell line and its two hormone resistant subpopulations MCF-7/LCC1 and MCF-7/LCC2

    Jørgensen, L; Brünner, N; Spang-Thomsen, M;

    1998-01-01

    and 17beta-hydroxysteroid oxidoreductase were investigated isolating the following steroids: estriol (E3), estradiol (E2), estrone (E1), 3alpha/beta-androstanediol (A-diol), testosterone (T), dihydrotestosterone (DHT), androsterone (AND), androstenedion (4-AD) and androstanedione (A-dion). For all......Androgen and estrogen metabolism was investigated in the hormone-dependent human breast cancer cell line MCF-7 and its two hormone-resistant sublines MCF-7/LCC1 and MCF-7/LCC2. Using the product isolation method, the activity of aromatase, 5alpha-reductase, 3alpha/beta-hydroxysteroid oxidoreductase...

  16. Comparison of the effect of cortisol on aromatase activity and androgen metabolism in two human fibroblast cell lines derived from the same individual

    Svenstrup, B; Brünner, N; Dombernowsky, P;

    1990-01-01

    The effect of preincubation with cortisol on estrogen and androgen metabolism was investigated in human fibroblast monolayers grown from biopsies of genital and non-genital skin of the same person. The activity in the cells of aromatase, 5 alpha-reductase, 17 beta-hydroxysteroid oxidoreductase and...... 3 alpha-hydroxysteroid oxidoreductase was investigated by isolating estrone, estradiol, estriol, dihydrotestosterone, androstanedione, androsterone, 3 alpha-androstanediol, testosterone and androstenedione after incubation of the cells with [14C]testosterone or [14C]androstenedione. For experiments...

  17. Triterpenos da resina de Protium heptaphyllum March (B0urseraceae: caracterização em misturas binárias

    Maia Robinson Magalhães

    2000-01-01

    Full Text Available Eight triterpenes, maniladiol, breine, ursa-9(11:12-dien-3beta-ol, oleana-9(11:12-dien-3beta-ol, 3alpha-hydroxy-tirucalla-8,24-dien-21-oic acid, 3alpha-hydroxy-tirucalla-7,24-dien-21-oic, alpha and beta amyrines were isolated as binary mixtures obtained from the chloroform extract of the oil-resin of Protium heptaphyllum March. The identification of the compounds was based mainly in 13C NMR data and mass spectra. The diene and the tetracyclic acid triterpenes were not reported before in the literature as constituents of the studied resin.

  18. Gclust Server: 124012 [Gclust Server

    Full Text Available 124012 DME_CG8953_24647550 Cluster Sequences Related Sequences(14) 553 Actn3: alpha act...nce length 553 Representative annotation Actn3: alpha actinin 3 CG8953-PA Number ...hromalveolata, Excavata) (9species) (%) 0.0 Cyanobacteria (25species) (%) 0.0 Photosynthetic bacteria (15spe...cies) (%) 0.0 Non-photosynthetic bacteria (31species) (%) 0.0 Opisthokonts (Anima...ls and fungi) (8species) (%) 12.5 Number of Sequences for each species DME: 1 Species not appearing in this

  19. AcEST: DK960434 [AcEST

    Full Text Available TST39A01NGRL0007_G14 362 Adiantum capillus-veneris mRNA. clone: TST39A01NGRL0007_G14. 5' end seq ... amiliaris GN=CLN8 PE... 30 4.8 sp|Q9JHS2|HIF3A_RAT Hypoxia -inducible factor 3 alpha OS=Rattus n... 30 4.8 sp| ... jct: 213 WVCFWHWDGLVSSLYL 228 >sp|Q9JHS2|HIF3A_RAT Hypoxia -inducible factor 3 alpha OS=Rattus norvegicus GN=H ...

  20. Triterpenos isolados de Eschweilera longipes miers (Lecythidaceae

    Carvalho Mario Geraldo de

    1998-01-01

    Full Text Available The phytochemical studies of Eschweilera longipes have led to the identification of ten triterpenoids: fridelin, fridelinol, alpha-amirin, beta-amirin, 3beta-O-cinamoyl-alpha-amirin, 3beta-O-cinamoyl-beta-amirin, alpha-amirenone, beta-amirenone, 3-alpha-hidroxi-lupeol, 3-alpha-hidroxi-taraxasterol, along with b-sitosterol, stigmasterol, alpha -tocopherol and tocotrienol. The structures of these compounds were identified by analysis of IR, ¹H and 13C NMR data and comparison with values of literature.

  1. Modification of behavioral effects of drugs in mice by neuroactive steroids

    Ungard, JT; Beekman, M; Gasior, M; Carter, RB; Dijkstra, D; Witkin, JM

    2000-01-01

    Rationale: Neuroactive steroids represent a novel class of potential therapeutic agents (epilepsy, anxiety, migraine, drug dependence) thought to act through positive allosteric modulation of the GABA(A) receptor A synthetically derived neuroactive steroid, ganaxolone (3 alpha-hydroxy-3 beta-methyl-

  2. Yeast Interacting Proteins Database: YKR026C, YBR270C [Yeast Interacting Proteins Database

    Full Text Available YKR026C GCN3 Alpha subunit of the translation initiation factor eIF2B, the guanine-nucleotide ex ... sociated complex that regulates actin cytoskeletal dynamics ... during polarized growth and cell wall integrity; i ... sociated complex that regulates actin cytoskeletal dynamics ... during polarized growth and cell wall integrity; i ...

  3. Polymorphism of exon 3 of the HLA-G gene

    Hviid, T V; Meldgaard, M; Sørensen, Steen; Morling, N

    1997-01-01

    rate of embryos. HLA-G seems to play an important role in the feto-maternal relationship. The polymorphism of the HLA-G locus is not fully clarified. One study has shown extensive nucleotide sequence variation in the exon 3 (alpha-2 domain) in healthy African Americans. A few studies in other...

  4. Alpha scintillation cell for direct measurement of indoor radon

    A large volume (1500 cm3) alpha scintillation cell to measure indoor radon is described. Air is sampled directly into the cell and gross alpha activity is measured after three hours. The cells are suitable for concentrations higher than 10-20 Bq/m3. They were successfully used for randon measurements in kindergartens in Nova Gorica. 7 refs., 2 figs., 1 tab

  5. Lipid constituents of the red alga Acantophora spicifera

    Wahidullah, S.; DeSouza, L.; Govenkar, M.B.

    A new steroid cholest-4-ene-3 alpha, 6 beta-diol together with the known cholest-4-ene-3-one, lauric acid and O-phathalic acid bis-(2-ethyl nonly)-ester were isolated from the red alga Acantophora spicifera. The structures of these compounds were...

  6. Correlations of $\\alpha$-particles in splitting of $^{12}$C nuclei by neutrons of energy of 14.1 MeV

    Kattabekov, R R; Artemenkov, D A; Bradnova, V; Zarubin, P I; Zarubina, I G; Majling, L; Rusakova, V V; Sadovsky, A B

    2014-01-01

    Correlations of $\\alpha$-particles are studied on statistics of 400 events of splitting $^{12}$C $\\rightarrow$ 3$\\alpha$ in nuclear track emulsion exposed to $14.1 MeV$ neutrons. The ranges and emission angles of the $\\alpha$-particles are measured. Distributions over energy of $\\alpha$-particle pairs and triples are obtained.

  7. Dynamics of solitons and quasisolitons of the cubic third-order nonlinear Schrödinger equation

    Karpman, V.I.; Juul Rasmussen, J.; Shagalov, A.G.

    2001-01-01

    The dynamics of soliton and quasisoliton solutions of the cubic third-order nonlinear Schrodinger equation is studied. Regular solitons exist due to a balance between the nonlinear terms and (linear) third-order dispersion; they are not important at small alpha (3) (alpha (3) is the coefficient in...

  8. New hopane triterpene from Eleocharis sellowiana (Cyperaceae)

    Ruiz, Ana Lucia T.G. [Universidade Estadual de Campinas, SP (Brazil). Centro Pluridisciplinar de Pesquisas Quimicas, Biologicas e Agrarias]. E-mail: aa_ruiz@hotmail.com.br; Magalhaes, Aderbal F.; Magalhaes, Eva G. [Universidade Estadual de Campinas, SP (Brazil). Inst. de Quimica; Faria, Aparecida D.; Amaral, Maria do Carmo E. [Universidade Estadual de Campinas, SP (Brazil). Inst. de Biologia

    2006-08-15

    A new triterpene named 3{alpha}-hydroxy-13{alpha},17{alpha},21{beta}-hopan-15,19-dione and E-phytylhexadecanoate were isolated from the hexanic extract of Eleocharis sellowiana. NMR and MS experiments determined the molecular structures. (author)

  9. A simple relation for the concentration dependence of osmotic pressure and depletion thickness in polymer solutions

    Fleer, G.J.; Skvortsov, A.M.; Tuinier, R.

    2007-01-01

    We propose simple expressions II/IIo = 1 + and (omega/omega(ex))(3 alpha-1) and (delta(0)/delta)(2) = 1 + (omega/omega(ex))(2 alpha) for the osmotic pressure II and the depletion thickness 6 as a function of the polymer concentration omega. Here, IIo and delta 0 correspond to the dilute limit, and o

  10. Functional characterisation of a putative rhamnogalacturonan II specific xylosyltransferase

    Madsen, Jack Egelund; Damager, Iben; Faber, Kirsten; Olsen, C Erik; Ulvskov, Peter; Petersen, Bent Larsen

    An Arabidopsis thaliana gene, At1g56550, was expressed in Pichia pastoris and the recombinant protein was shown to catalyse transfer of d-xylose from UDP-alpha-d-xylose onto methyl alpha-l-fucoside. The product formed was shown by 1D and 2D (1)H NMR spectroscopy to be Me alpha-d-Xyl-(1,3)-alpha...

  11. Autoepitopes and alloepitopes of type IV collagen: role in the molecular pathogenesis of anti-GBM antibody glomerulonephritis.

    Borza, Dorin-Bogdan

    2007-01-01

    Anti-glomerular basement membrane (anti-GBM) antibodies elicited by autoimmune or alloimmune mechanisms are associated with aggressive forms of rapid progressive glomerulonephritis. Pathogenic anti-GBM autoantibodies and alloantibodies target the noncollagenous (NC1) domains of the alpha3alpha4alpha5(IV) collagen, a major GBM component. In autoimmune anti-GBM glomerulonephritis, a breakdown of immune self-tolerance leads to the activation of autoreactive B and T cells recognizing epitopes within the alpha3NC1 subunit. In the GBM, the conformational epitopes targeted by anti-GBM autoantibodies are structurally sequestered within the alpha3alpha4alpha5NC1 hexamer complex formed upon assembly of collagen IV chains into trimeric molecules and networks. Autoantibodies selectively bind to and dissociate a subset of alpha3alpha4alpha5NC1 hexamers composed of monomer subunits, whereas hexamers containing NC1 dimer subunits are resistant to dissociation by autoantibodies. The crypticity of alpha3NC1 autoepitopes suggests that self-tolerance to alpha3(IV) collagen is broken by structural alterations of the native alpha3alpha4alpha5NC1 hexamer that unmask normally sequestered epitopes, triggering an autoimmune reaction. Post-transplant anti-GBM nephritis in the renal allograft of transplanted Alport patients is mediated by an alloimmune reaction to the NC1 domains of alpha3alpha4alpha5(IV) collagen, present in the allograft GBM but absent from Alport basement membranes. Alloantibodies from patients with autosomal-recessive Alport syndrome predominantly bind to the alpha3NC1 domain, whereas alloantibodies from X-linked Alport patients target preferentially, though not exclusively, epitopes within the alpha5NC1 subunit. The accessibility of the alloantigenic sites within the alpha3alpha4alpha5NC1 hexamers, contrasting with the crypticity of autoantigenic sites, suggest that different molecular forms of alpha3alpha4alpha5(IV) collagen initiate the immunopathogenic responses in

  12. Bile salts of the West Indian manatee, Trichechus manatus latirostris: novel bile alcohol sulfates and absence of bile acids.

    Kuroki, S; Schteingart, C D; Hagey, L R; Cohen, B I; Mosbach, E H; Rossi, S S; Hofmann, A F; Matoba, N; Une, M; Hoshita, T

    1988-04-01

    The bile salts present in gallbladder bile of the West Indian manatee, Trichechus manatus latirostris, an herbivorous marine mammal of the tropical and subtropical margins of the Atlantic Ocean, were found to consist of a mixture of bile alcohol sulfates. Bile acids, previously believed to be present in all mammals, were not detected. Using chromatography, mass spectrometry, and 1H- and 13C-nuclear magnetic resonance spectroscopy, the major bile alcohol was identified as 5 beta-cholestane-3 alpha,6 beta,7 alpha-25,26-pentol; that is, it had the nuclear structure of alpha-muricholic acid and the side chain structure of bufol. This compound has not been described previously and the trivial name "alpha-trichechol" is proposed. The second most abundant compound was 5 beta-cholestane-3 alpha,7 alpha,25,26-tetrol. Other bile alcohols were tentatively identified as 5 beta-cholestane-3 alpha,6 beta,7 beta,25,26-pentol (named beta-trichechol), 3 alpha,6 alpha,7 beta, 25-26-pentol (named omega-trichechol) and 5 beta-cholestane-3 alpha,6 beta,7 alpha,26-tetrol. The 1H and 13C NMR spectra of the four 6,7 epimers of 3,6,7 trihydroxy bile acids are described and discussed. All bile alcohols were present as ester sulfates, the sulfate group being tentatively assigned to the 26-hydroxy group. 12-Hydroxy compounds were not detected. The manatee is the first mammal found to lack bile acids, presumably because it lacks the enzymes required for oxidation of the 26-hydroxy group to a carboxylic acid. Trichechols, like other bile salts, are water-soluble end products of cholesterol metabolism; whether they also function as biological surfactants in promoting biliary cholesterol secretion or lipid digestion is unknown. PMID:3392467

  13. Alport alloantibodies but not Goodpasture autoantibodies induce murine glomerulonephritis: protection by quinary crosslinks locking cryptic α3(IV) collagen autoepitopes in vivo.

    Luo, Wentian; Wang, Xu-Ping; Kashtan, Clifford E; Borza, Dorin-Bogdan

    2010-09-15

    The noncollagenous (NC1) domains of alpha3alpha4alpha5(IV) collagen in the glomerular basement membrane (GBM) are targets of Goodpasture autoantibodies or Alport posttransplant nephritis alloantibodies mediating rapidly progressive glomerulonephritis. Because the autoepitopes but not the alloepitopes become cryptic upon assembly of alpha3alpha4alpha5NC1 hexamers, we investigated how the accessibility of B cell epitopes in vivo influences the development of glomerulonephritis in mice passively immunized with human anti-GBM Abs. Alport alloantibodies, which bound to native murine alpha3alpha4alpha5NC1 hexamers in vitro, deposited linearly along the mouse GBM in vivo, eliciting crescentic glomerulonephritis in Fcgr2b(-/-) mice susceptible to Ab-mediated inflammation. Goodpasture autoantibodies, which bound to murine alpha3NC1 monomer and dimer subunits but not to native alpha3alpha4alpha5NC1 hexamers in vitro, neither bound to the mouse GBM in vivo nor induced experimental glomerulonephritis. This was due to quinary NC1 crosslinks, recently identified as sulfilimine bonds, which comprehensively locked the cryptic Goodpasture autoepitopes in the mouse GBM. In contrast, non-crosslinked alpha3NC1 subunits were identified as a native target of Goodpasture autoantibodies in the GBM of squirrel monkeys, a species susceptible to Goodpasture autoantibody-mediated nephritis. Thus, crypticity of B cell autoepitopes in tissues uncouples potentially pathogenic autoantibodies from autoimmune disease. Crosslinking of alpha3alpha4alpha5NC1 hexamers represents a novel mechanism averting autoantibody binding and subsequent tissue injury by posttranslational modifications of an autoantigen. PMID:20709951

  14. Ubiquitin conjugation by the N-end rule pathway and mRNAs for its components increase in muscles of diabetic rats

    Lecker, S. H.; Solomon, V.; Price, S. R.; Kwon, Y. T.; Mitch, W. E.; Goldberg, A. L.

    1999-01-01

    Insulin deficiency (e.g., in acute diabetes or fasting) is associated with enhanced protein breakdown in skeletal muscle leading to muscle wasting. Because recent studies have suggested that this increased proteolysis is due to activation of the ubiquitin-proteasome (Ub-proteasome) pathway, we investigated whether diabetes is associated with an increased rate of Ub conjugation to muscle protein. Muscle extracts from streptozotocin-induced insulin-deficient rats contained greater amounts of Ub-conjugated proteins than extracts from control animals and also 40-50% greater rates of conjugation of (125)I-Ub to endogenous muscle proteins. This enhanced Ub-conjugation occurred mainly through the N-end rule pathway that involves E2(14k) and E3alpha. A specific substrate of this pathway, alpha-lactalbumin, was ubiquitinated faster in the diabetic extracts, and a dominant negative form of E2(14k) inhibited this increase in ubiquitination rates. Both E2(14k) and E3alpha were shown to be rate-limiting for Ub conjugation because adding small amounts of either to extracts stimulated Ub conjugation. Furthermore, mRNA for E2(14k) and E3alpha (but not E1) were elevated 2-fold in muscles from diabetic rats, although no significant increase in E2(14k) and E3alpha content could be detected by immunoblot or activity assays. The simplest interpretation of these results is that small increases in both E2(14k) and E3alpha in muscles of insulin-deficient animals together accelerate Ub conjugation and protein degradation by the N-end rule pathway, the same pathway activated in cancer cachexia, sepsis, and hyperthyroidism.

  15. Tibolone and its metabolites acutely relax rabbit coronary arteries in vitro

    Lund, Claus Otto; Nilas, Lisbeth; Pedersen, Susan Helene;

    2004-01-01

    -response curves to tibolone, 3 alpha-OH-tibolone, 3 beta-OH-tibolone, Delta 4-isomer and 17 beta-estradiol were obtained after precontraction with potassium 30 mmol/l and after addition of N omega-nitro-l-arginine methyl ester 10(-4) mol/l (l-NAME, an inhibitor of endothelial nitric oxide (NO) synthase) or...... under curve (AUC). RESULTS: Tibolone and its metabolites induced a concentration-dependent vasodilatation comparable to that of 17 beta-estradiol with the rank of potency: 3 beta-OH-tibolone approximately = to tibolone>3 alpha-OH-tibolone>Delta 4-isomer (ANOVA). l-NAME partly inhibited the relaxation to...... tibolone is comparable to that of 17 beta-estradiol in this set-up....

  16. Triterpenes and new saponins from Ilex chamaedryfolia: chemotaxonomic tool to Ilex species differentiation

    Three saponins were isolated from leaves of Ilex chamaedryfolia. Their structures were established by spectroscopic and mass spectrometry data as the new saponin 3beta-O-beta-D-glucopyranosyl-(1-3)-alpha-L-arabinopyranosyl-20(S)-19alpha- hydroxyurs-12-en-28-oic acid 28-O-beta-D-glucopyranosyl-(1-3)-beta-D-glucopyranosyl ester, the new saponin 3beta-O-beta-D-glucopyranosyl-(1-3)-alpha-L-arabinopyranosyl-20(S)-19alpha- hydroxyurs-12-en-28-oic acid 28-O-beta-D-glucopyranosyl ester and the known saponin 3beta-O-beta-D-glucuronopyranosyl-20(R)-19alpha-hydroxyurs-12-en-28-oic acid 28-O-beta-D-glucopyranosyl ester. Ursolic acid and α-amyrin were also isolated. (author)

  17. Triterpenes and new saponins from Ilex chamaedryfolia: chemotaxonomic tool to Ilex species differentiation

    Lencina, Claiton L.; Cardoso, Mariana C. de; Zancanaro, Ivomar; Gosmann, Grace, E-mail: grace.gosmann@ufrgs.b [Universidade Federal do Rio Grande do Sul (FF/UFRGS), Porto Alegre, RS (Brazil). Faculdade de Farmacia; Pires, Viviane S.; Sonnet, Pascal; Guillaume, Dominique [UMR-CNRS, Universite de Picardie Jules Verne, Amiens (France). Faculte de Pharmacie. Lab. des Glucides; Schenkel, Eloir P. [Universidade Federal de Santa Catarina (CCS/UFSC), Florianopolis, SC (Brazil). Centro de Ciencias da Saude

    2010-07-01

    Three saponins were isolated from leaves of Ilex chamaedryfolia. Their structures were established by spectroscopic and mass spectrometry data as the new saponin 3beta-O-beta-D-glucopyranosyl-(1-3)-alpha-L-arabinopyranosyl-20(S)-19alpha- hydroxyurs-12-en-28-oic acid 28-O-beta-D-glucopyranosyl-(1-3)-beta-D-glucopyranosyl ester, the new saponin 3beta-O-beta-D-glucopyranosyl-(1-3)-alpha-L-arabinopyranosyl-20(S)-19alpha- hydroxyurs-12-en-28-oic acid 28-O-beta-D-glucopyranosyl ester and the known saponin 3beta-O-beta-D-glucuronopyranosyl-20(R)-19alpha-hydroxyurs-12-en-28-oic acid 28-O-beta-D-glucopyranosyl ester. Ursolic acid and {alpha}-amyrin were also isolated. (author)

  18. Chemical constituents of Gustavia Augusta L. (Lecythidaceae); Constituintes quimicos de Gustavia Augusta L. (Lecythidaceae)

    Souza, Afonso Duarte Leao de; Rocha, Arnaldo F. Imbiriba da; Pinheiro, Maria Lucia Belem; Andrade, Carlos Humberto de S.; Galotta, Ana Lucia de A. Queiroz; Santos, Maria do Perpetuo Socorro S. dos [Amazonas Univ., Manaus, AM (Brazil). Dept. de Quimica]. E-mail: afonsodlsouza@yahoo.com.br

    2001-08-01

    The Gustavia augusta is used in the folk medicine against leishmaniasis and showed anti-inflammatory action. The phyto chemical studies of the plant stem bark have led to the isolation of (22E)-stigmasta-7,22-dien-3{beta}-ol, 24{alpha}(S)-ethyl-5{alpha}-colesta-7, trans-22-dien-3-one, D-friedoolean-14-en-3{beta}-ol, D-friedoolean-14-en-3-one and D-friedoolean-14-en-3{alpha}-ol along with stigmasterol, {alpha}-amyrin, {beta}-amyrin, lupeol, 3{alpha}-hydroxy-lupeol and betulinic acid. The structures of these compounds were identified by IR, GC/M S, {sup 1} H and {sup 1} {sup 3} C NMR spectral analysis and comparison with literature data. (author)

  19. Microbial transformation of curcumol by Aspergillus niger.

    Chen, Li-Xia; Zhang, Hui; Zhao, Qian; Yin, Shi-Yu; Zhang, Zhong; Li, Tian-Xian; Qiu, Feng

    2013-02-01

    Curcumol is a representative index component for the quality control of the essential oil of Curcuma wenyujin Y.H. Chen et C. Ling, an antivirus and anticancer drug in China. Microbial transformation of curcumol (1) by Aspergillus niger AS 3.739 yielded two products. Their structures were elucidated as 3alpha-hydroxycurcumol (2) and 3alpha-(4'-methoxy-succinyloxy)-curcumol (3) by extensive spectroscopic methods including 2D-NMR and HRESI-MS. Among them, 3 is a new compound. Esterification of the substrate with succinic acid is a novel reaction in the field of microbial transformation of natural products. Compound 2, the major transformation product of 1, was a high regio- and stereo-specific hydroxylation product and showed significant antiviral effects. PMID:23513713

  20. Madhucosides A and B, protobassic acid glycosides from Madhuca indica with inhibitory activity on free radical release from phagocytes.

    Pawar, Rahul S; Bhutani, K K

    2004-04-01

    The structures of madhucosides A (1) and B (2), isolated from the bark of Madhuca indica, were established as 3-O-beta-D-apiofuranosyl(1-->2)-beta-D-glucopyranosyl-28-O-[beta-D-xylopyranosyl(1-->2)-[alpha-L-rhamnopyranosyl(1-->4)]-beta-D-glucopyranosyl(1--> 3)-alpha-L-rhamnopyranosyl(1-->2)-alpha-L-arabinopyranosyl]protobassic acid and 3-O-beta-D-apiofuranosyl(1-->2)-beta-D-glucopyranosyl-28-O-[beta-D-xylopyranosyl(1-->2)-[alpha-L-rhamnopyranosyl(1-->4)]-beta-D-glucopyranosyl(1-->3)-alpha-L-rhamnopyranosyl(1-->2)-alpha-L-arabinopyranosyl]protobassic acid, respectively. These two compounds showed significant inhibitory effects on both superoxide release from polymorphonuclear cells in a NBT reduction assay and hypochlorous acid generation from neutrophils assessed in a luminol-enhanced chemiluminescence assay. PMID:15104500

  1. Chemical constituents of Solanum buddleifolium Sendtn; Constituintes quimicos de Solanum buddleifolium Sendtn

    Pinto, Francisco das Chagas L.; Torres, Maria da conceicao M.; Silveira, Edilberto R.; Pessoa, Otilia Deusdenia L., E-mail: opessoa@ufc.br [Universidade Federal do Ceara (UFC), Fortaleza, CE (Brazil). Centro de Ciencias. Dept. de Quimica Organica e Inorganica; Braz-Filho, Raimundo [Universidade Estadual do Norte Fluminense, Campos, RJ (Brazil). Dept. de Quimica; Guedes, Maria Lenise da Silva [Universidade Federal da Bahia (UFBA), Ondina, BA (Brazil). Inst. de Biologia. Dept. de Botanica

    2013-10-01

    The chemical investigation of the stem EtOH extract of S. buddleifolium resulted in the isolation of terpenoids, amides, lignans and a steroidal alkaloid. Based on HRMS, IR and {sup 1}H and {sup 13}C NMR data analysis, the structures of the isolated compounds were identified as: 13-hydroxysolavetivone, betulinic acid, N-trans-caffeoyltyramine, N-trans-feruloyldopamine, N-trans-p-cumaroyltyramine, N-trans-feruloyltyramine, N-trans-feruloyl- 3'-O-methoxydopamine, alangilignoside C, isolariciresinol, polistachiol, (+)-(8R,7'S,8'S)-3{alpha}-O-({beta}-D-glucopiranosyl)-lioniresinol, (-)-(8S,7'R,8'R)-3{alpha}-O-({beta}-D-glucopiranosyl)-lioniresinol and solamargine. The occurrence of terpenoids and amides is common in Solanum, unlike lignans which are rare. The isolated lignans described in this work are reported for the first time in the genus Solanum. (author)

  2. A new antifungal phenolic glycoside derivative, iridoids and lignans from Alibertia sessilis (vell.) K. Schum. (Rubiaceae)

    Silva, Viviane C. da; Bolzani, Vanderlan da S.; Lopes, Marcia N. [UNESP, Araraquara, SP (Brazil). Inst. de Quimica. Dept. de Quimica Organica]. E-mail: mnlopes@iq.unesp.br; Young, Maria C.M. [Instituto de Botanica, Sao Paulo, SP (Brazil). Secao de Fisiologia e Bioquimica de Plantas

    2007-07-01

    A new antifungal phenolic glycoside, 3,4,5-trimethoxyphenyl-1-O-{beta}-D-(5-O-syringoyl)apiofuranosyl-(1 {yields} 6)-{beta}-D-glucopyranoside (1), together with four known iridoids, geniposidic acid (2), geniposide (3), 6{alpha}-hydroxygeniposide (4) and 6{beta}-hydroxygeniposide (5); two lignans, (+)-lyoniresinol-3{alpha}-O-{beta}-D-glucopyranoside (6), (-)-lyoniresinol-3{alpha}-O-{beta}-D-glucopyranoside (7); and two phenolic acids, chlorogenic (8) and salicylic acids (9) and D-manitol (10), were isolated from the ethanolic extract of the stems of Alibertia sessilis. Structures of 1 and of the known compounds were determined by spectroscopic analysis. All compounds isolated were evaluated for their antifungal activities against two phytopathogenic fungi strains Cladosporium cladosporioides and C. sphaerospermum by direct bioautography. (author)

  3. Hot accretion flow with radiative cooling: state transitions in black hole X-ray binaries

    Wu, Mao-Chun; Xie, Fu-Guo; Yuan, Ye-Fei; Gan, Zhao-Ming

    2016-01-01

    We investigate state transitions in black hole X-ray binaries through different parameters by using two-dimensional axisymmetric hydrodynamical simulation method. For radiative cooling in hot accretion flow, we take into account the bremsstrahlung, synchrotron and synchrotron-self Comptonization self-consistently in the dynamics. Our main result is that the state transitions occur when the accretion rate reaches a critical value $\\dot M \\sim 3\\alpha\\ \\dot M_{\\rm Edd}$, above which cold and de...

  4. The inner ear of dogs with X-linked nephritis provides clues to the pathogenesis of hearing loss in X-linked Alport syndrome.

    Harvey, S J; Mount, R; Sado, Y; Naito, I; Ninomiya, Y; Harrison, R; Jefferson, B; Jacobs, R; Thorner, P S

    2001-09-01

    Alport syndrome is an inherited disorder of type IV collagen with progressive nephropathy, ocular abnormalities, and high-tone sensorineural deafness. In X-linked Alport syndrome, mutations in the COL4A5 gene encoding the alpha5 chain of type IV collagen lead to loss of the alpha3/alpha4/alpha5 network and increased susceptibility of the glomerular basement membrane to long-term damage. The molecular defects that underlie the otopathology in this disease remain poorly understood. We used a canine model of X-linked Alport syndrome to determine the expression of type IV collagen alpha-chains in the inner ear. By 1 month in normal adult dogs, the alpha3, alpha4, and alpha5 chains were co-expressed in a thin continuous line extending along the basilar membrane and the internal and external sulci, with the strongest expression along the lateral aspect of the spiral ligament in the basal turn of the cochlea. Affected dogs showed complete absence of the alpha3/alpha4/alpha5 network. The lateral aspect of the spiral ligament is populated by tension fibroblasts that express alpha-smooth muscle actin and nonmuscle myosin and are postulated to generate radial tension on the basilar membrane via the extracellular matrix for reception of high frequency sound. We propose that in Alport syndrome, the loss of the alpha3/alpha4/alpha5 network eventually weakens the interaction of these cells with their extracellular matrix, resulting in reduced tension on the basilar membrane and the inability to respond to high frequency sounds. PMID:11549602

  5. Activity of quinones from teak (Tectona grandis) on fungal cell wall stress.

    Sumthong, Pattarawadee; Damveld, Robbert A; Choi, Young H; Arentshorst, Mark; Ram, Arthur F; van den Hondel, Cees A; Verpoorte, Rob

    2006-08-01

    Teak ( Tectona grandis L.f., Verbenaceae) sawdust extract inhibited the growth of Aspergillus niger. Centrifugal partition chromatography was used to isolate the active compounds. By (1)H-NMR the active compounds were identified as deoxylapachol and tectoquinone. Two A. niger transgenic strains which show induction of 1,3 -alpha-D-glucan synthase were used as a cell wall damage model. The result showed that deoxylapachol from T. grandis extract induced fungal cell wall stress. PMID:16972200

  6. Quality experimental and calculated powder x-ray diffraction

    Sullenger, D.B.; Cantrell, J.S.; Beiter, T.A.; Tomlin, D.W.

    1996-08-01

    For several years, we have submitted quality powder XRD patterns to the International Centre for Diffraction Data for inclusion as reference standards in their Powder Diffraction File. The procedure followed is described; examples used are {beta}-UH{sub 3}, {alpha}- BaT{sub 2}, alpha-lithium disilicate ({alpha}-Li{sub 2}Si{sub 2}O{sub 5}), and 2,2`,4,4`,6,6`hexanitroazobenzene-III (HNAB-III).

  7. Characterization of the seed oils from kiwi (Actinidia chinensis), passion fruit (Passiflora edulis) and guava (Psidium guajava)

    Piombo Georges; Barouh Nathalie; Barea Bruno; Boulanger Renaud; Brat Pierre; Pina Michel; Villeneuve Pierre

    2006-01-01

    Oils extracted from three exotic fruits, guava, kiwi and passion fruit were analyzed to evaluate the possible commercial interest for these waste materials from fruit juices industry. Results showed interesting fatty acids compositions with high amounts of essential fatty acids such as 62.3% alpha linolenic acid for kiwi seed oil, and respectively 73.4% and 77.0% for omega 6 linoleic acid in passion fruit and guava seed oils. Fatty acids regiodistribution, sterols and tocopherols contents wer...

  8. Analysis of delocalization of clusters in linear-chain $\\alpha$-cluster states with entanglement entropy

    Kanada-En'yo, Yoshiko

    2015-01-01

    I investigate entanglement entropy of one dimension (1D) cluster states to discuss the delocalization of clusters in linear-chain $3\\alpha$- and $4\\alpha$-cluster states. In analysis of entanglement entropy of 1D Tohsaki-Horiuchi-Schuck-R\\"opke (THSR) and Brink-Bloch cluster wave functions, I show clear differences in the entanglement entropy between localized cluster wave functions and delocalized cluster wave functions. In order to clarify spatial regions where the entanglement entropy is g...

  9. Alkaloids and other constituents from Xylopia langsdorffiana (Annonaceae); Alcaloides e outros constituintes de Xylopia langsdorffiana (Annonaceae)

    Silva, Marcelo Sobral da; Tavares, Josean Fechine; Queiroga, Karine Formiga; Agra, Maria de Fatima; Barbosa Filho, Jose Maria [Universidade Federal da Paraiba (UFPB), Joao Pessoa, PB (Brazil). Dept. de Ciencias Farmaceuticas], e-mail: marcelosobral@ltf.ufpb.br; Almeida, Jackson Roberto Guedes da Silva [Universidade Federal do Vale do Sao Francisco, Petrolina, PE (Brazil). Colegiado de Medicina; Silva, Samia Andricia Souza da [Universidade Federal de Alagoas (UFAL), Maceio, AL (Brazil). Escola de Enfermagem e Farmacia

    2009-07-01

    The phytochemical investigation of Xylopia langsdorffiana led to the isolation of corytenchine, xylopinine, discretamine, xylopine, ent-atisan-16{alpha}-hydroxy-18-oic acid, 13{sup 2} (S) hydroxy-17{sup 3}-ethoxyphaephorbide and quercetin-3-{alpha}-rhamnoside. Their structures were assigned based on spectroscopic analyses, including two-dimensional NMR techniques. Antioxidant activities of discretamine were measured using the 1,2-diphenyl- 2-picryl-hydrazyl (DPPH) free radical scavenging assay. (author)

  10. A role for collagen IV cross-links in conferring immune privilege to the Goodpasture autoantigen: structural basis for the crypticity of B cell epitopes.

    Vanacore, Roberto M; Ham, Amy-Joan L; Cartailler, Jean-Philippe; Sundaramoorthy, Munirathinam; Todd, Parvin; Pedchenko, Vadim; Sado, Yoshikazu; Borza, Dorin-Bogdan; Hudson, Billy G

    2008-08-15

    The detailed structural basis for the cryptic nature (crypticity) of a B cell epitope harbored by an autoantigen is unknown. Because the immune system may be ignorant of the existence of such "cryptic" epitopes, their exposure could be an important feature in autoimmunity. Here we investigated the structural basis for the crypticity of the epitopes of the Goodpasture autoantigen, the alpha3alpha4alpha5 noncollagenous-1 (NC1) hexamer, a globular domain that connects two triple-helical molecules of the alpha3alpha4alpha5 collagen IV network. The NC1 hexamer occurs in two isoforms as follows: the M-isoform composed of monomer subunits in which the epitopes are accessible to autoantibodies, and the D-isoform composed of both monomer and dimer subunits in which the epitopes are cryptic. The D-isoform was characterized with respect to quaternary structure, as revealed by mass spectrometry of dimer subunits, homology modeling, and molecular dynamics simulation. The results revealed that the D-isoform contains two kinds of cross-links as follows: S-hydroxylysyl-methionine and S-lysyl-methionine cross-links, which stabilize the alpha3alpha5-heterodimers and alpha4alpha4-homodimers, respectively. Construction and analysis of a three-dimensional model of the D-isoform of the alpha3alpha4alpha5 NC1 hexamer revealed that crypticity is a consequence of the following: (a) sequestration of key residues between neighboring subunits that are stabilized by domain-swapping interactions, and (b) by cross-linking of subunits at the trimer-trimer interface, which stabilizes the structural integrity of the NC1 hexamer and protects against binding of autoantibodies. The sequestrated epitopes and cross-linked subunits represent a novel structural mechanism for conferring immune privilege at the level of quaternary structure. Perturbation of the quaternary structure may be a key factor in the etiology of Goodpasture disease. PMID:18499662

  11. Gab1 Acts as an Adapter Molecule Linking the Cytokine Receptor gp130 to ERK Mitogen-Activated Protein Kinase

    Takahashi-Tezuka, Mariko; Yoshida, Yuichi; Fukada, Toshiyuki; Ohtani, Takuya; Yamanaka, Yojiro; Nishida, Keigo; NAKAJIMA, Koichi; Hibi, Masahiko; Hirano, Toshio

    1998-01-01

    Gab1 has structural similarities with Drosophila DOS (daughter of sevenless), which is a substrate of the protein tyrosine phosphatase Corkscrew. Both Gab1 and DOS have a pleckstrin homology domain and tyrosine residues, potential binding sites for various SH2 domain-containing adapter molecules when they are phosphorylated. We found that Gab1 was tyrosine phosphorylated in response to various cytokines, such as interleukin-6 (IL-6), IL-3, alpha interferon (IFN-α), and IFN-γ. Upon the stimula...

  12. Characterization & Modification of Copper and Iron Oxide Nanoparticles for Application as Absorber Material in Silicon based Thin Film Solar Cells

    Nuys, Maurice

    2015-01-01

    The present thesis deals with the characterization and modification of semiconducting copper oxide (CuO, Cu2O) and iron oxide (gamma-Fe2O3, alpha-Fe2O3) nanoparticles, which provide a basis for an innovative solar cell concept involving nanoparticles composed of almost unlimitedly available elements as absorber material in thin film solar cells. This approach is promising to meet the requirements of increasing the production capacity and lowering the production costs if the nanoparticles exhi...

  13. The Phase Diagram GdF3-LuF3

    Ranieri, I. M.; Baldochi, S. L.; Klimm, D.

    2007-01-01

    The phase diagram gadolinium fluoride - lutetium fluoride was determined by differential scanning calorimetry (DSC) and X-ray powder diffraction analysis. Both pure components undergo a reversible first order transformation to a high temperature phase. The mutual solubility of both components is unlimited in the orthorhombic room temperature phase. The maximum solubility of Lu in the high temperature phase of GdF3 (tysonite type) is about 20% and the maximum solubility of Gd in LuF3 ($\\alpha$...

  14. Chemical trapping of labile aldehyde intermediates in the metabolism of propranolol and oxprenolol.

    Goldszer, F; Tindell, G L; Walle, U K; Walle, T

    1981-11-01

    Propranolol is N-dealkylated to N-desisopropylpropranolol (DIP) by microsomal enzymes. DIP was shown in this study to be rapidly deaminated by monoamine oxidase (MAO). Thus, incubation of DIP (10(-4) M) with rat liver mitochondria for 90 min demonstrated 74.8 +/- 4.1% metabolism which was almost completely blocked by the MAO inhibitor pargyline (10(-5) M). The end products of this deamination were 3-(alpha-naphthoxy)-1,2-propylene glycol (Glycol) and 3-(alpha-naphthoxy)lactic acid (NLA). In the presence of excess NADH the Glycol was the major product whereas NLA was the major product in the presence of excess NAD+. The intermediate aldehyde in this deamination reaction, 3-(alpha-naphthoxy)-2-hydroxypropanal (Ald), was extremely labile and decomposed quantitatively to alpha-naphthol when removed from the incubates. However, the addition of methoxyamine hydrochloride directly to the incubates made it possible to chemically trap the intact Ald as an O-methyloxime and prove its structure by gas chromatography-mass spectrometry. The deamination of the primary amine of oxprenolol also gave rise to a labile aldehyde which could be trapped and identified as its O-methyloxime. PMID:7335950

  15. Analysis of delocalization of clusters in linear-chain $\\alpha$-cluster states with entanglement entropy

    Kanada-En'yo, Yoshiko

    2015-01-01

    I investigate entanglement entropy of one dimension (1D) cluster states to discuss the delocalization of clusters in linear-chain $3\\alpha$- and $4\\alpha$-cluster states. In analysis of entanglement entropy of 1D Tohsaki-Horiuchi-Schuck-R\\"opke (THSR) and Brink-Bloch cluster wave functions, I show clear differences in the entanglement entropy between localized cluster wave functions and delocalized cluster wave functions. In order to clarify spatial regions where the entanglement entropy is generated by the delocalization of clusters, I analyze the spatial distribution of entanglement entropy. In the linear-chain $3\\alpha$ cluster state, the delocalization occurs dominantly in a low-density tail region while it is relatively suppressed in an inner region because of Pauli blocking effect between clusters. In the linear-chain 4$\\alpha$ state having a larger system size than the linear-chain $3\\alpha$ state, the delocalization occurs in the whole system. The entanglement entropy is found to be a measure of the d...

  16. Absorption and transport of deuterium-substituted 2R,4'R,8'R-alpha-tocopherol in human lipoproteins

    Oral administration of a single dose of tri- or hexadeuterium substituted 2R,4'R,8'R-alpha-tocopheryl acetate (d3- or d6-alpha-T-Ac) to humans was used to follow the absorption and transport of vitamin E in plasma lipoproteins. Three hr after oral administration of d3-alpha-T-Ac (15 mg) to 2 subjects, plasma levels of d3-alpha-T were detectable; these increased up to 10 hr, reached a plateau at 24 hr, then decreased. Following administration of d6-alpha-T-Ac (15-16 mg) to 2 subjects, the percentage of deuterated tocopherol relative to the total tocopherol in chylomicrons increased more rapidly than the corresponding percentage in whole plasma. Chylomicrons and plasma lipoproteins were isolated from 2 additional subjects following administration of d3-alpha-T-Ac (140 or 60 mg). The percentage of deuterated tocopherol relative to the total tocopherol increased most rapidly in chylomicrons, then in very low density lipoproteins (VLDL), followed by essentially identical increases in low and high density lipoproteins (LDL and HDL, respectively) and lastly, in the red blood cells. This pattern of appearance of deuterated tocopherol is consistent with the concept that newly absorbed vitamin E is secreted by the intestine into chylomicrons; subsequently, chylomicron remnants are taken up by the liver from which the vitamin E is secreted in VLDL. The metabolism of VLDL in the circulation results in the simultaneous delivery of vitamin E into LDL and HDL

  17. Absorption and transport of deuterium-substituted 2R,4'R,8'R-alpha-tocopherol in human lipoproteins

    Traber, M.G.; Ingold, K.U.; Burton, G.W.; Kayden, H.J.

    1988-08-01

    Oral administration of a single dose of tri- or hexadeuterium substituted 2R,4'R,8'R-alpha-tocopheryl acetate (d3- or d6-alpha-T-Ac) to humans was used to follow the absorption and transport of vitamin E in plasma lipoproteins. Three hr after oral administration of d3-alpha-T-Ac (15 mg) to 2 subjects, plasma levels of d3-alpha-T were detectable; these increased up to 10 hr, reached a plateau at 24 hr, then decreased. Following administration of d6-alpha-T-Ac (15-16 mg) to 2 subjects, the percentage of deuterated tocopherol relative to the total tocopherol in chylomicrons increased more rapidly than the corresponding percentage in whole plasma. Chylomicrons and plasma lipoproteins were isolated from 2 additional subjects following administration of d3-alpha-T-Ac (140 or 60 mg). The percentage of deuterated tocopherol relative to the total tocopherol increased most rapidly in chylomicrons, then in very low density lipoproteins (VLDL), followed by essentially identical increases in low and high density lipoproteins (LDL and HDL, respectively) and lastly, in the red blood cells. This pattern of appearance of deuterated tocopherol is consistent with the concept that newly absorbed vitamin E is secreted by the intestine into chylomicrons; subsequently, chylomicron remnants are taken up by the liver from which the vitamin E is secreted in VLDL. The metabolism of VLDL in the circulation results in the simultaneous delivery of vitamin E into LDL and HDL.

  18. Cellular origins of type IV collagen networks in developing glomeruli.

    Abrahamson, Dale R; Hudson, Billy G; Stroganova, Larysa; Borza, Dorin-Bogdan; St John, Patricia L

    2009-07-01

    Laminin and type IV collagen composition of the glomerular basement membrane changes during glomerular development and maturation. Although it is known that both glomerular endothelial cells and podocytes produce different laminin isoforms at the appropriate stages of development, the cellular origins for the different type IV collagen heterotrimers that appear during development are unknown. Here, immunoelectron microscopy demonstrated that endothelial cells, mesangial cells, and podocytes of immature glomeruli synthesize collagen alpha 1 alpha 2 alpha1(IV). However, intracellular labeling revealed that podocytes, but not endothelial or mesangial cells, contain collagen alpha 3 alpha 4 alpha 5(IV). To evaluate the origins of collagen IV further, we transplanted embryonic kidneys from Col4a3-null mutants (Alport mice) into kidneys of newborn, wildtype mice. Hybrid glomeruli within grafts containing numerous host-derived, wildtype endothelial cells never expressed collagen alpha 3 alpha 4 alpha 5(IV). Finally, confocal microscopy of glomeruli from infant Alport mice that had been dually labeled with anti-collagen alpha 5(IV) and the podocyte marker anti-GLEPP1 showed immunolabeling exclusively within podocytes. Together, these results indicate that collagen alpha 3 alpha 4 alpha 5(IV) originates solely from podocytes; therefore, glomerular Alport disease is a genetic defect that manifests specifically within this cell type. PMID:19423686

  19. Monocyte chemoattractant protein-1 (MCP-1) inhibits the intestinal-like differentiation of monocytes.

    Spoettl, T; Hausmann, M; Herlyn, M; Gunckel, M; Dirmeier, A; Falk, W; Herfarth, H; Schoelmerich, J; Rogler, G

    2006-07-01

    Monocytes (MO) migrating into normal, non-inflamed intestinal mucosa undergo a specific differentiation resulting in a non-reactive, tolerogenic intestinal macrophage (IMAC). Recently we demonstrated the differentiation of MO into an intestinal-like macrophage (MAC) phenotype in vitro in a three-dimensional cell culture model (multi-cellular spheroid or MCS model). In the mucosa of patients with inflammatory bowel disease (IBD) in addition to normal IMAC, a reactive MAC population as well as increased levels of monocyte chemoattractant protein 1 (MCP-1) is found. The aim of this study was to investigate the influence of MCP-1 on the differentiation of MO into IMAC. MCS were generated from adenovirally transfected HT-29 cells overexpressing MCP-1, macrophage inflammatory protein 3 alpha (MIP-3alpha) or non-transfected controls and co-cultured with freshly elutriated blood MO. After 7 days of co-culture MCS were harvested, and expression of the surface antigens CD33 and CD14 as well as the intracellular MAC marker CD68 was determined by flow-cytometry or immunohistochemistry. MCP-1 and MIP-3alpha expression by HT-29 cells in the MCS was increased by transfection at the time of MCS formation. In contrast to MIP-3alpha, MCP-1 overexpression induced a massive migration of MO into the three-dimensional aggregates. Differentiation of IMAC was disturbed in MCP-1-transfected MCS compared to experiments with non-transfected control aggregates, or the MIP-3alpha-transfected MCS, as indicated by high CD14 expression of MO/IMAC cultured inside the MCP-1-transfected MCS, as shown by immunohistochemistry and FACS analysis. Neutralization of MCP-1 was followed by an almost complete absence of monocyte migration into the MCS. MCP-1 induced migration of MO into three-dimensional spheroids generated from HT-29 cells and inhibited intestinal-like differentiation of blood MO into IMAC. It may be speculated that MCP-1 could play a role in the disturbed IMAC differentiation in IBD mucosa

  20. AKT/SGK-sensitive phosphorylation of GSK3 in the regulation of L-selectin and perforin expression as well as activation induced cell death of T-lymphocytes

    Bhavsar, Shefalee K.; Merches, Katja; Bobbala, Diwakar [Department of Physiology, University of Tuebingen (Germany); Lang, Florian, E-mail: florian.lang@uni-tuebingen.de [Department of Physiology, University of Tuebingen (Germany)

    2012-08-17

    Highlights: Black-Right-Pointing-Pointer Akt/SGK dependent phosphorylation of GSK3{alpha},{beta} regulates T lymphocytes. Black-Right-Pointing-Pointer T cells from mice expressing Akt/SGK insensitive GSK3{alpha},{beta} (gsk3{sup KI}) release less IL-2. Black-Right-Pointing-Pointer CD4{sup +} cells from gsk3{sup KI} mice express less CD62L. Black-Right-Pointing-Pointer CD8{sup +} cells from gsk3{sup KI} mice are relatively resistant to activation induced cell death. Black-Right-Pointing-Pointer Perforin expression is enhanced in gsk3{sup KI} T cells. -- Abstract: Survival and function of T-lymphocytes critically depends on phosphoinositide (PI) 3 kinase. PI3 kinase signaling includes the PKB/Akt and SGK dependent phosphorylation and thus inhibition of glycogen synthase kinase GSK3{alpha},{beta}. Lithium, a known unspecific GSK3 inhibitor protects against experimental autoimmune encephalomyelitis. The present study explored, whether Akt/SGK-dependent regulation of GSK3 activity is a determinant of T cell survival and function. Experiments were performed in mutant mice in which Akt/SGK-dependent GSK3{alpha},{beta} inhibition was disrupted by replacement of the serine residue in the respective SGK/Akt-phosphorylation consensus sequence by alanine (gsk3{sup KI}). T cells from gsk3{sup KI} mice were compared to T cells from corresponding wild type mice (gsk3{sup WT}). As a result, in gsk3{sup KI} CD4{sup +} cells surface CD62L (L-selectin) was significantly less abundant than in gsk3{sup WT} CD4{sup +} cells. Upon activation in vitro T cells from gsk3{sup KI} mice reacted with enhanced perforin production and reduced activation induced cell death. Cytokine production was rather reduced in gsk3{sup KI} T cells, suggesting that GSK3 induces effector function in CD8{sup +} T cells. In conclusion, PKB/Akt and SGK sensitive phosphorylation of GSK3{alpha},{beta} is a potent regulator of perforin expression and activation induced cell death in T lymphocytes.

  1. Progesterone metabolism by the hypothalamus, pituitary, and uterus of the rat during pregnancy

    Metabolites of [3H]progesterone were quantitated from incubations of hypothalamus, pituitary, and uterus of rats during different stages of pregnancy. The hypothalamus, anterior pituitary, and a section of uterus from five rats on Days 1, 8, 15, and 21 of pregnancy were incubated individually with [3H]progesterone and analyzed for metabolite formation by reverse isotopic dilution analysis. The radioactive metabolites present were 5 alpha-pregnane-3,20-dione (5 alpha-DHP), 3 alpha-hydroxy-5 alpha-pregnan-20-one, 20 alpha-hydroxy-4-pregnen-3-one, 20 alpha-hydroxy-5 alpha-pregnan-3-one, and 5 alpha-pregnane-3 alpha, 20 alpha-diol. The major metabolite formed by the hypothalamus and pituitary was 5 alpha-DHP. In the pituitary samples, formation of 5 alpha-DHP was decreased on Days 15 and 21 of pregnancy compared to Day 1, and formation of 20 alpha-hydroxy-5 alpha-pregnan-3-one was decreased on Day 21 compared to Day 1. In the uterine samples, 3 alpha-hydroxy-5 alpha-pregnan-20-one was the major metabolite formed at all stages of pregnancy. The formation of all metabolic products of progesterone by the uterus was increased on Day 21 compared to Days 1, 8, and 15 of pregnancy. No changes in the formation of progesterone metabolites were observed in the hypothalamic samples during pregnancy. It is concluded that there are different profiles in the in vitro metabolism of [3H]progesterone by the hypothalamus, pituitary, and uterus of the rat during the course of pregnancy

  2. Skin of the male African catfish, Clarias gariepinus: a source of steroid glucuronides

    Steroid metabolism in the skin of mature male African catfish, Clarias gariepinus, reared in the laboratory, was studied in vitro by tissue incubations with [3H]pregnenolone, [3H]dehydroepiandrosterone, [3H]17 alpha-hydroxyprogesterone, [3H]androstenedione, [14C]11 beta-hydroxyandrostenedione, and [3H]testosterone as precursors. While pregnenolone was not converted to any other steroid, dehydroepiandrosterone was transformed mainly to 5-androstene-3 beta, 17 beta-diol. The products of 17 alpha-hydroxyprogesterone incubations were 5 beta-pregnane-3 alpha,17 alpha-diol-20-one, 5 beta-pregnane-3 alpha,17 alpha, 20 beta-triol, and 5 beta-pregnan-17 alpha-o1-3,20-dione. The major steroids of androstenedione incubations were etiocholanolone, testosterone, and androsterone. Testosterone was converted mainly to etiocholanolone and androstenedione, and only small quantities of 11 beta-hydroxytestosterone, 11-ketotestosterone, and 11-ketoandrostenedione were the metabolites found in 11 beta-hydroxyandrostenedione incubation. These results demonstrated the presence of the enzymes 5 alpha- and 5 beta-reductases and 3 alpha-, 11 beta-, 17 beta-, and 20 beta-hydroxysteroid dehydrogenases in the skin. From enzymehistochemical results it appeared that the steroid conversions take place in the epithelial cells. Moreover, the presence of UDP-glucose dehydrogenase, an enzyme involved in the synthesis of glucuronic acid, in these cells indicates the possibility of steroid glucuronide formation. Indeed significant amounts of water-soluble steroid conjugates, particularly 5 beta-dihydrotestosterone- and testosterone-glucuronide, were found in the incubations with androstenedione and testosterone, indicating the presence of the UDP-glucuronosyl transferase in the catfish skin

  3. Isolation and characterization of new collagens from chick cartilage.

    von der Mark, K; van Menxel, M; Wiedemann, H

    1982-05-01

    Three unique collagen chains were isolated from chick sternal cartilage following pepsin solubilization of total cartilage collagens and removal of the predominant type II collagen by fractional salt precipitation. Native molecules containing 1 alpha, 2 alpha and 3 alpha chains precipitated between 0.7 M and 1.2 M NaCl at acidic pH and could be purified by chromatography on carboxymethyl-cellulose and agarose columns. Although similar to mammalian 1 alpha, 2 alpha and 3 alpha chains, differences in the mobilities on sodium dodecylsulfate gel electrophoresis, CNBr peptide profiles and amino acid composition were found. The 1 alpha and 2 alpha chains resemble, but are structurally distinct from, the chick alpha 1(V) and alpha 2(V) chains. The 3 alpha chain appears to be closely related to the alpha 1(II) chain, although some differences in the cyanogen bromide peptides suggest that they might be different gene products. In addition, two collagenous fragments of Mr 140 000 (M1) and 35 000 (M2) were found which precipitated at 2.0 m NaCl at acidic pH. Both fragments contain interchain disulfide bonds. The larger fragment was reducible to subunits of approximate Mr 120 000, 48 000, 28 000 and 11 000. The smaller fragment gave rise to peptides of Mr about 12 000 and 10 000 after reduction. By the technique of rotary shadowing the native, unreduced larger fragment M1 appeared as a slender rod-like molecule with a distinct bend approximately 40 nm from one end. We interpret this finding as indicative of a focal amino acid sequence irregularity, disrupting the triple-helical conformation. PMID:7084229

  4. Estranediols profiling in calves' urine after 17beta-nandrolone laureate ester administration.

    Pinel, Gaud; Rambaud, Lauriane; Monteau, Fabrice; Elliot, Christopher; Le Bizec, Bruno

    2010-08-01

    17beta-Nandrolone (17beta-NT) is one of the most recurrent forbidden anabolic steroid used in meat producing animals breeding. Because efficient control must both take into account metabolic patterns and associated kinetics of elimination, the metabolism of 17beta-NT in bovines has already been investigated and is well documented, but only focussing on its main metabolites (i.e. 17alpha-nandrolone, 19-noretiocholanolone and 19-norandrostenedione). The goal of the present study was to enlarge this panel of 17beta-NT metabolites, especially through the urinary estranediols fraction in order to perform a more global steroid profiling upon 17beta-nortestosterone laureate ester administration in calves. A GC-MS/MS method has been developed to monitor and quantify 5 estranediols isomers including 5alpha-estrane-3beta,17beta-diol (abb), 5beta-estrane-3alpha,17beta-diol (bab), 5alpha-estrane-3beta,17alpha-diol (aba), 5alpha-estrane-3alpha,17beta-diol (aab) and 5beta-estrane-3alpha,17alpha-diol (baa). Their urinary elimination kinetics have been established allowing detection of 4 estranediols up to several days after administration. All animals demonstrated homogeneous patterns of elimination both from a qualitative (metabolite profile) and quantitative point of view (elimination kinetics in urine). 5alpha-Estrane-3beta,17alpha-diol (aba) was found as the major metabolite with concentrations up to 100microgL(-1). PMID:20132885

  5. (n, {alpha}) cross section measurement of light nuclei using gridded ionization chamber and gaseous sample

    Sanami, Toshiya; Baba, Mamoru; Saito, Keiichiro; Ibara, Yasutaka; Yamazaki, Tetsuro; Sato, Jun; Hirakawa, Naohiro [Tohoku Univ., Sendai (Japan)

    1998-03-01

    We have developed a measuring method of (n, {alpha}) cross section by using gaseous sample in a gridded ionization chamber. In this study, we measured the {sup 12}C(n, {alpha}{sub 0}) and the {sup 16}O(n, {alpha}{sub 0}), (n, {alpha}{sub 123}) cross sections for En=11.5 and 12.8 MeV neutrons. We also deduced the {sup 12}C(n, x{alpha}) spectrum and analyzed the data by a kinematic calculation combined with the reaction data of the {sup 12}C(n, n`3{alpha}). (author)

  6. Antifungal iridoids, triterpenes and phenol compounds from Alibertia myrciifolia Sprunge Ex. Schum

    Luciano, Joao Henrique S.; Lima, Mary Anne S.; Silveira, Edilberto Rocha [Universidade Federal do Ceara (UFC), Fortaleza, CE (Brazil). Centro de Ciencias. Dept. de Quimica Organica e Inorganica; Vasconcelos, Ilka Maria; Fernandes, Georgia Sampaio [Universidade Federal do Ceara (UFC), Fortaleza, CE (Brazil). Dept. de Bioquimica e Biologia Molecular; Souza, Elnatan Bezerra de [Universidade do Vale do Acarau, Sobral, CE (Brazil). Coord. de Biologia

    2010-07-01

    The new iridoid glucoside 10-O-vanilloyl-geniposidic acid has been isolated from the aerial parts of Alibertia myrciifolia along with hydroxyhopanone, 3{alpha},22-dihydroxyhopane, ursolic acid, luteolin-3',4'-dimethyl ether, caffeic acid and geniposidic acid. The structures of the isolated compounds were determined by means of mass spectrometry and nuclear magnetic resonance spectral analyses. The antifungal activities of the iridoids 10-O-vanilloyl-geniposidic acid and geniposidic acid were evaluated against the phytopathogenic fungi strains Colletotrichum gloeosporioides, Fusarium solani and Aspergillus niger. (author)

  7. Optical transitions in hybrid perovskite solar cells: Ellipsometry, density functional theory, and quantum efficiency analyses for CH3NH3PbI3

    Shirayama, Masaki; Kadowaki, Hideyuki; Miyadera, Tetsuhiko; Sugita, Takeshi; Tamakoshi, Masato; Kato, Masato; Fujiseki, Takemasa; Murata, Daisuke; Hara, Shota; Murakami, Takurou N.; Fujimoto, Shohei; Chikamatsu, Masayuki; Fujiwara, Hiroyuki

    2015-01-01

    We report artifact-free CH3NH3PbI3 optical constants extracted from ultra-smooth perovskite layers without air exposure and assign all the optical transitions in the visible/ultraviolet region unambiguously based on density functional theory (DFT) analysis that assumes a simple pseudo-cubic crystal structure. From the self-consistent spectroscopic ellipsometry analysis of the ultra-smooth CH3NH3PbI3 layers, we find that the absorption coefficients of CH3NH3PbI3 (alpha = 3.8 x 10^4 cm-1 at 2.0...

  8. Up-regulation of REG3A in colorectal cancer cells confers proliferation and correlates with colorectal cancer risk

    Ye, Ying; Xiao, Ling; Wang, Su-Juan; Yue, Wei; Yin, Qiao-Shan; Sun, Meng-Yao; Xia, Wei; Shao, Zhi-Yi; Zhang, Hong

    2015-01-01

    Colorectal cancer (CRC) is one of the most common malignancies in the world. Previous studies have investigated the altered expression of regenerating islet-derived 3 alpha (REG3A) in various cancers. We aimed at exploring the biological function and the underlying molecular mechanism of REG3A in CRC. In this study, REG3A was found elevated in CRC compared with normal tissues. Further, high REG3A expression level was correlated with bigger tumor size, poorer differentiation, higher tumor stag...

  9. Triterpenos de Styrax camporum (styracaceae) Triterpenes from Styrax camporum (styracaceae)

    Patrícia Mendonça Pauletti; Angela Regina Araújo; Vanderlan da Silva Bolzani; Maria Claudia Marx Young

    2002-01-01

    Chemical investigation of the leaves of Styrax camporum (Styracaceae) resulted in the isolation of the lignan lariciresinol and six triterpenes: ursolic acid, 2alpha,3alpha-dihydroxy-urs-12-en-28-oic acid and mixtures of uvaol and erythrodiol, as well as 3beta-O-trans-p-coumaroyl-2alpha-hydroxy-urs-12-en-28-oic acid and 3b-O-trans-p-coumaroylmaslinic acid. The structures of these compounds were established by spectroscopic analysis. This paper deals with the first report of these compounds in...

  10. Triterpenos de Styrax camporum (styracaceae)

    Pauletti Patrícia Mendonça; Araújo Angela Regina; Bolzani Vanderlan da Silva; Young Maria Claudia Marx

    2002-01-01

    Chemical investigation of the leaves of Styrax camporum (Styracaceae) resulted in the isolation of the lignan lariciresinol and six triterpenes: ursolic acid, 2alpha,3alpha-dihydroxy-urs-12-en-28-oic acid and mixtures of uvaol and erythrodiol, as well as 3beta-O-trans-p-coumaroyl-2alpha-hydroxy-urs-12-en-28-oic acid and 3b-O-trans-p-coumaroylmaslinic acid. The structures of these compounds were established by spectroscopic analysis. This paper deals with the first report of these compounds in...

  11. Investigation of the Reduction of Nitric Oxides by CO and H2 on Pt-Mo Catalysts under Oxidizing Conditions

    Frank, B.; Lübke, R.; Emig, G.; Renken, A.

    1998-01-01

    The reduction of NO by CO on Pt has been extensively investigated in the past since it helps to eliminate NO of the exhaust gas of cars. However, the dissociation of NO in this reaction and the deactivation of the NO/CO reaction on Pt-supported catalysts still need to be discussed. In this work, the reduction of NO with CO is examined on a 0.5 % Pt-3.4 % MoO3/alpha-Al2O3 catalyst. The results of a kinetic modeling are presented and a new proposition concerning the mechanism of the observed de...

  12. Structural investigation of resin glycosides from Ipomoea lonchophylla.

    MacLeod, J K; Ward, A; Oelrichs, P B

    1997-05-01

    A fraction from Ipomoea lonchophylla, which was toxic to mice, contained an inseparable mixture of resin glycosides with differing numbers of C5 ester groups on the hexasaccharide chain. After alkaline hydrolysis of the esters, the structure of the major component (1) was elucidated using high-field NMR spectroscopy, mass spectrometry, chemical studies, and comparison with known resin glycosides. Compound 1 was identified as 3,11-dihydroxytetradecanoic acid 11-O-beta-quinovopyranosyl-(1-->2)-beta-glucopyranosyl-(1-->3)- [alpha-rhamnopyranosyl- (1-->4)]-quinovopyranosyl-(1-->2)-beta-glucopyranosyl-(1-->2)-beta -fucopyranoside. PMID:9170289

  13. Observation of isolated high-E_T photons in deep inelastic scattering

    Chekanov, S; Krakauer, D A; Loizides, J H; Magill, S; Miglioranzi, S; Musgrave, B; Repond, J; Yoshida, R; Mattingly, M C K; Antonioli, P; Bari, G; Basile, M; Bellagamba, L; Boscherini, D; Bruni, A; Bruni, G; Cara Romeo, G; Cifarelli, Luisa; Cindolo, F; Contin, A; Corradi, M; De Pasquale, S; Giusti, P; Iacobucci, G; Margotti, A; Montanari, A; Nania, R; Palmonari, F; Pesci, A; Sartorelli, G; Zichichi, A; Aghuzumtsyan, G; Bartsch, D; Brock, I; Goers, S; Hartmann, H; Hilger, E; Irrgang, P; Jakob, H P; Kind, O; Meyer, U; Paul, E; Rautenberg, J; Renner, R; Stifutkin, A; Tandler, J; Voss, K C; Wang, M; Bailey, D S; Brook, N H; Cole, J E; Heath, G P; Namsoo, T; Robins, S; Wing, M; Capua, M; Mastroberardino, A; Schioppa, M; Susinno, G; Kim, J Y; Kim, Y K; Lee, J H; Lim, I T; Pac, M Y; Caldwell, A; Helbich, M; Liu, X; Mellado, B; Ning, Y; Paganis, S; Ren, Z; Schmidke, W B; Sciulli, F; Chwastowski, J; Eskreys, Andrzej; Figiel, J; Galas, A; Olkiewicz, K; Stopa, P; Zawiejski, L; Adamczyk, L; Bold, T; Grabowska-Bold, I; Kisielewska, D; Kowal, A M; Kowal, M; Kowalski, T; Przybycien, M B; Suszycki, L; Szuba, D; Szuba, J; Kotanski, A; Slominski, W; Adler, V; Behrens, U; Bloch, I; Borras, K; Chiochia, V; Dannheim, D; Drews, G; Fourletova, J; Fricke, U; Geiser, A; Göttlicher, P; Gutsche, O; Haas, T; Hain, W; Hillert, S; Kahle, B; Kötz, U; Kowalski, H; Kramberger, G; Labes, H; Lelas, D; Lim, H; Löhr, B; Mankel, R; Melzer-Pellmann, I A; Nguyen, C N; Notz, D; Nuncio-Quiroz, A E; Polini, A; Raval, A; Rurua, L; Schneekloth, U; Stösslein, U; Wolf, G; Youngman, C; Zeuner, W; Schlenstedt, S; Barbagli, G; Gallo, E; Genta, C; Pelfer, P G; Bamberger, A; Benen, A; Karstens, F; Dobur, D; Vlasov, N N; Bell, M; Bussey, P J; Doyle, A T; Ferrando, J; Hamilton, J; Hanlon, S; Saxon, D H; Skillicorn, I O; Gialas, I; Carli, T; Gosau, T; Holm, U; Krumnack, N; Lohrmann, E; Milite, M; Salehi, H; Schleper, P; Schörner-Sadenius, T; Stonjek, S; Wichmann, K; Wick, K; Ziegler, A; Collins-Tooth, C; Foudas, C; Goncalo, R; Long, K R; Tapper, A D; Cloth, P; Filges, D; Kataoka, M; Nagano, K; Tokushuku, K; Yamada, S; Yamazaki, Y; Barakbaev, A N; Boos, E G; Pokrovskiy, N S; Zhautykov, B O; Son, D; Piotrzkowski, K; Barreiro, F; Glasman, C; González, O; Labarga, L; Del Peso, J; Tassi, E; Terron, J; Vázquez, M; Zambrana, M; Barbi, M; Corriveau, F; Gliga, S; Lainesse, J; Padhi, S; Stairs, D G; Walsh, R; Tsurugai, T; Antonov, A; Danilov, P; Dolgoshein, B A; Gladkov, D; Sosnovtsev, V V; Suchkov, S; Dementiev, R K; Ermolov, P F; Katkov, I I; Khein, L A; Korzhavina, I A; Kuzmin, V A; Levchenko, B B; Lukina, O Yu; Proskuryakov, A S; Shcheglova, L M; Zotkin, S A; Coppola, N; Grijpink, S; Koffeman, E; Kooijman, P; Maddox, E; Pellegrino, A; Schagen, S; Tiecke, H G; Velthuis, J J; Wiggers, L; De Wolf, E; Brümmer, N; Bylsma, B; Durkin, L S; Ling, T Y; Cooper-Sarkar, A M; Cottrell, A; Devenish, R C E; Foster, B; Grzelak, G; Gwenlan, C; Patel, S; Straub, P B; Walczak, R; Bertolin, A; Brugnera, R; Carlin, R; Dal Corso, F; Dusini, S; Garfagnini, A; Limentani, S; Longhin, A; Parenti, A; Posocco, M; Stanco, L; Turcato, M; Heaphy, E A; Metlica, F; Oh, B Y; Whitmore, J J; Iga, Y; D'Agostini, Giulio; Marini, G; Nigro, A; Cormack, C; Hart, J C; McCubbin, N A; Heusch, C A; Park, I H; Pavel, N; Abramowicz, H; Gabareen, A; Kananov, S; Kreisel, A; Levy, A; Kuze, M; Fusayasu, T; Kagawa, S; Kohno, T; Tawara, T; Yamashita, T; Hamatsu, R; Hirose, T; Inuzuka, M; Kaji, H; Kitamura, S; Matsuzawa, K; Ferrero, M I; Monaco, V; Sacchi, R; Solano, A; Arneodo, M; Ruspa, M; Koop, T; Martin, J F; Mirea, A; Butterworth, J M; Hall-Wilton, R; Jones, T W; Lightwood, M S; Sutton, M R; Targett-Adams, C; Ciborowski, J; Ciesielski, R; Luzniak, P; Nowak, R J; Pawlak, J M; Sztuk, J; Tymieniecka, T; Ukleja, A; Ukleja, J; Zarnecki, A F; Adamus, M; Plucinsky, P P; Eisenberg, Y; Hochman, D; Riveline, U; Karshon, M; Gladilin, L K; Kcira, D; Lammers, S; Li, L; Reeder, D D; Rosin, M; Savin, A A; Smith, W H; Deshpande, Abhay A; Dhawan, S; Bhadra, S; Catterall, C D; Fourletov, S; Hartner, G; Menary, S R; Soares, M; Standage, J

    2004-01-01

    First measurements of cross sections for isolated prompt photon production in deep inelastic ep scattering have been made using the ZEUS detector at the HERA electron-proton collider using an integrated luminosity of 121 pb^-1. A signal for isolated photons in the transverse energy and rapidity ranges 5 35 GeV^2. Cross sections are presented for inclusive prompt photons and for those accompanied by a single jet in the range E_T^jet \\geq 6 GeV and -1.5 \\leq eta^jet < 1.8. Calculations at order alpha^3alpha_s describe the data reasonably well.

  14. NAD- and NADP-dependent 7alpha-hydroxysteroid dehydrogenases from bacteroides fragilis.

    Macdonald, I A; Williams, C N; Mahony, D E; Christie, W M

    1975-03-28

    Twenty strains of Bacteroides fragilis were screened for hydroxysteroid oxidoreductase activity in cell-free preparations. Eighteen strains were shown to contain NAD-dependent 7alpha-hydroxysteroid dehydrogenase. Sixteen of the strains containing the NAD-dependent enzyme also contained NADP-depedent 7alpha-hydroxysteroid dehydrogenase, but invariably in lesser amounts. A strain particulary rich in both 7alpha-hydroxysteroid dehydrogenase activities was selected for further study. Measurement of activity as a function of pH revealed a fairly sharp optimal activity range of 9.5--10.0 for the NAD-dependent enzyme and a broad flat optimal range of 7.0--9.0 for the NADP-dependent enzyme. Michaelis constants for trihydroxy-bile acids for the NAD-dependent enzyme were in the range of 0.32--0.34 mM, whereas dihydroxy-bile acids gave a Km of 0.1 mM. Thin-layer chromatography studies on the oxidation product of 3alpha, 7alpha-dihydroxy-5beta-cholanoic acid (chenodeoxycholic acid) by the dehydrogenase revealed a band corresponding to that of synthetic 3alpha-hydroxy, 7-keto-5beta-cholanoic acid. Similarly the oxidation product of chenodeoxycholic acid by both 7alpha-hydroxysteroid dehydrogenase and commercially available 3alpha-hy-droxysteroid dehydrogenase revealed a band corresponding to that of synthetic 3,7-diketo-5beta-cholanoic acid. Neither of these two oxidation products could be distinguished from those by the Escherichia coli dehydrogenase oxidation previously reported. Disc-gel electrophoresis of a cell-free lyophilized preparation indicated one active band for NAD-dependent activity of mobility similar to that for the NADP-dependent E. coli enzyme. The NADP-dependent dehydrogenase was unstable and rapidly lost activity after polyacylamide disc-gel electrophoresis, ultracentrifugation, freezing on refrigeration at 4 degrees C. No 3 alpha- or 12alpha-oriented oxidoreductase activity was demonstrated in any of the strains examined. PMID:236764

  15. The structure of an alternate form of complement C3 that displays costimulatory growth factor activity for B lymphocytes

    1994-01-01

    In this study, the structure of a novel 1.9-kb transcript coding for complement component 3 (C3) is described. This alternate C3 is identical to the 3' end of the C3 message beginning at position 3300 of the C3 cDNA. Its transcription appears to be driven by an alternate promoter located within intron 8 of the C3 gene. This alternate C3 message contains an open reading frame that may encode a 536-amino acid- long protein identical to the 3' part of the C3 alpha chain. The resulting protein co...

  16. Functional capacity of XRCC1 protein variants identified in DNA repair-deficient Chinese hamster ovary cell lines and the human population

    Berquist, Brian R; Singh, Dharmendra Kumar; Fan, Jinshui;

    2010-01-01

    XRCC1 operates as a scaffold protein in base excision repair, a pathway that copes with base and sugar damage in DNA. Studies using recombinant XRCC1 proteins revealed that: a C389Y substitution, responsible for the repair defects of the EM-C11 CHO cell line, caused protein instability; a V86R...... mutation abolished the interaction with POLbeta, but did not disrupt the interactions with PARP-1, LIG3alpha and PCNA; and an E98K substitution, identified in EM-C12, reduced protein integrity, marginally destabilized the POLbeta interaction, and slightly enhanced DNA binding. Two rare (P161L and Y576S...

  17. Modulation of the firing activity of female dorsal raphe nucleus serotonergic neurons by neuroactive steroids.

    Robichaud, M; Debonnel, G

    2004-07-01

    Important gender differences in mood disorders result in a greater susceptibility for women. Accumulating evidence suggests a reciprocal modulation between the 5-hydroxytryptamine (5-HT) system and neuroactive steroids. Previous data from our laboratory have shown that during pregnancy, the firing activity of 5-HT neurons increases in parallel with progesterone levels. This study was undertaken to evaluate the putative modulation of the 5-HT neuronal firing activity by different neurosteroids. Female rats received i.c.v. for 7 days a dose of 50 micro g/kg per day of one of the following steroids: progesterone, pregnenolone, 5beta-pregnane-3,20-dione (5beta-DHP), 5beta-pregnan-3alpha-ol,20-one, 5beta-pregnan-3beta-ol,20-one, 5alpha-pregnane-3,20-dione, 5alpha-pregnan-3alpha-ol,20-one (allopregnanolone, 3alpha,5alpha-THP), 5alpha-pregnane-3beta-ol,20-one and dehydroepiandrosterone (DHEA). 5beta-DHP and DHEA were also administered for 14 and 21 days (50 micro g/kg per day, i.c.v.) as well as concomitantly with the selective sigma 1 (sigma1) receptor antagonist NE-100. In vivo, extracellular unitary recording of 5-HT neurons performed in the dorsal raphe nucleus of these rats revealed that DHEA, 5beta-DHP and 3alpha,5alpha-THP significantly increased the firing activity of the 5-HT neurons. Interestingly, 5beta-DHP and DHEA showed different time-frames for their effects with 5beta-DHP having its greatest effect after 7 days to return to control values after 21 days, whereas DHEA demonstrated a sustained effect over the 21 day period. NE-100 prevented the effect of DHEA but not of 5beta-DHP, thus indicating that its sigma1 receptors mediate the effect of DHEA but not that of 5beta-DHP. In conclusion, our results offer a cellular basis for potential antidepressant effects of neurosteroids, which may prove important particularly for women with affective disorders. PMID:15225127

  18. Síntese de análogo de brassinoesteróide a partir de vespertilina

    Gárate José L. M.

    1998-01-01

    Full Text Available In the last years, several research groups have been working on the synthesis of new steroidal plant hormones called brassinosteroids (BS, which promote plant growth and better crops. Many synthetic targets and applications of these compounds and their analogues have been described in the literature. From Solanum species of the Distrito Federal, we isolated the steroidal alkaloid solasodine, which was then converted into our starting material, vespertiline. By functionalization of rings A and B, we have synthesized a new analogue of BS, with a 2alpha,3alpha-dihydroxy-6-one structure, typical of the naturally occurring BS castasterone, the immediate biosynthetic precursor of brassinolide.

  19. Triterpenos de Styrax camporum (styracaceae

    Pauletti Patrícia Mendonça

    2002-01-01

    Full Text Available Chemical investigation of the leaves of Styrax camporum (Styracaceae resulted in the isolation of the lignan lariciresinol and six triterpenes: ursolic acid, 2alpha,3alpha-dihydroxy-urs-12-en-28-oic acid and mixtures of uvaol and erythrodiol, as well as 3beta-O-trans-p-coumaroyl-2alpha-hydroxy-urs-12-en-28-oic acid and 3b-O-trans-p-coumaroylmaslinic acid. The structures of these compounds were established by spectroscopic analysis. This paper deals with the first report of these compounds in S. camporum.

  20. Flavonoid Glycosides and Other Hydrophilic Compounds from Flowers of Heterotheca inuloides.

    Jerga, C; Merfort, I; Willuhn, G

    1990-08-01

    Ten flavonoid glycosides were identified in flowers of HETEROTHECA INULOIDES ("Mexican Arnica"). Their structures were established by spectral data (UV, (1)H-NMR, (13)C-NMR, mass) and total acid hydrolysis as kaempferol 3-beta-glucoside, 3-beta-galactoside, 3-beta-rutinoside, 3-beta-robinobioside, quercetin 3-beta-glucoside, 3-beta-galactoside, 3-beta-glucuronide, 3-beta-glucuronide-6''-methylester, 3-alpha- L-arabinoside, and 3-beta-rutinoside. Additionally, caffeic, protocatechuic, and chlorogenic acid as well as umbelliferone were found. PMID:17221440

  1. Synthesis and nicotinic receptor activity of a hydroxylated tropane

    Bremner, John B; Godfrey, Colette A; Jensen, Anders A.; Smith, Reginald J

    2004-01-01

    (+/-)-3alpha-hydroxy homoepibatidine 4 has been synthesized from the alkaloid scopolamine 5 and its properties as a nicotinic agonist assessed. While still binding strongly, the compound showed reduced agonist potency for the alpha(4)beta(2) nAChR compared with the parent compound epibatidine 1....... Compound 4 also displayed generally similar binding and selectivity profiles at alpha(4)beta(2), alpha(2)beta(4), alpha(3)beta(4), and alpha(4)beta(4) nAChR subtypes to those for nicotine....

  2. Calculating few-body resonances using an oscillator trap

    Fedorov, D V; Thogersen, M

    2009-01-01

    We investigate the possibility of calculating the parameters of few-body resonances using the oscillator trap boundary conditions. We place the few-body system in an oscillator trap and calculate the energy spectrum and the strength function of a suitably chosen transition. Broader resonances are identified as Lorentzian peaks in the strength function. Narrower resonances are identified through the pattern of avoided crossings in the spectrum of the system as function of the trap size. As an example we calculate 0+ resonances in 12C within the 3-alpha model.

  3. Anyonic Partition Functions and Windings of Planar Brownian Motion

    Desbois, Jean; Heinemann, Christine; Ouvry, Stéphane

    1994-01-01

    The computation of the $N$-cycle brownian paths contribution $F_N(\\alpha)$ to the $N$-anyon partition function is adressed. A detailed numerical analysis based on random walk on a lattice indicates that $F_N^{(0)}(\\alpha)= \\prod_{k=1}^{N-1}(1-{N\\over k}\\alpha)$. In the paramount $3$-anyon case, one can show that $F_3(\\alpha)$ is built by linear states belonging to the bosonic, fermionic, and mixed representations of $S_3$.

  4. Characterization of the seed oils from kiwi (Actinidia chinensis, passion fruit (Passiflora edulis and guava (Psidium guajava

    Piombo Georges

    2006-03-01

    Full Text Available Oils extracted from three exotic fruits, guava, kiwi and passion fruit were analyzed to evaluate the possible commercial interest for these waste materials from fruit juices industry. Results showed interesting fatty acids compositions with high amounts of essential fatty acids such as 62.3% alpha linolenic acid for kiwi seed oil, and respectively 73.4% and 77.0% for omega 6 linoleic acid in passion fruit and guava seed oils. Fatty acids regiodistribution, sterols and tocopherols contents were also analyzed to try to establish the potential nutritional interest of such oils.

  5. Synthesis and biological activities of aminopyrimidyl-indoles structurally related to meridianins.

    Akue-Gedu, Rufine; Debiton, Eric; Ferandin, Yoan; Meijer, Laurent; Prudhomme, Michelle; Anizon, Fabrice; Moreau, Pascale

    2009-07-01

    The synthesis of new meridianin derivatives substituted at the C-5 position of the 2-aminopyrimidine ring by various aryl groups and substituted or not by a methyl group on the indole nitrogen is described. These compounds were tested for their kinase inhibitory potencies toward five kinases (CDK5/p25, CK1delta/epsilon, GSK-3alpha/beta, Dyrk1A and Erk2) as well as their in vitro antiproliferative activities toward a human fibroblast primary culture and two human solid cancer cell lines (MCF-7 and PA 1). PMID:19477650

  6. Differential induction of the toll-like receptor 4-MyD88-dependent and -independent signaling pathways by endotoxins.

    Zughaier, Susu M; Zimmer, Shanta M; Datta, Anup; Carlson, Russell W; Stephens, David S

    2005-05-01

    The biological response to endotoxin mediated through the Toll-like receptor 4 (TLR4)-MD-2 receptor complex is directly related to lipid A structure or configuration. Endotoxin structure may also influence activation of the MyD88-dependent and -independent signaling pathways of TLR4. To address this possibility, human macrophage-like cell lines (THP-1, U937, and MM6) or murine macrophage RAW 264.7 cells were stimulated with picomolar concentrations of highly purified endotoxins. Harvested supernatants from previously stimulated cells were also used to stimulate RAW 264.7 or 23ScCr (TLR4-deficient) macrophages (i.e., indirect induction). Neisseria meningitidis lipooligosaccharide (LOS) was a potent direct inducer of the MyD88-dependent pathway molecules tumor necrosis factor alpha (TNF-alpha), interleukin-1beta (IL-1beta), monocyte chemoattractant protein 1 (MCP-1), macrophage inflammatory protein 3alpha (MIP-3alpha), and the MyD88-independent molecules beta interferon (IFN-beta), nitric oxide, and IFN-gamma-inducible protein 10 (IP-10). Escherichia coli 55:B5 and Vibrio cholerae lipopolysaccharides (LPSs) at the same pmole/ml lipid A concentrations induced comparable levels of TNF-alpha, IL-1beta, and MIP-3alpha, but significantly less IFN-beta, nitric oxide, and IP-10. In contrast, LPS from Salmonella enterica serovars Minnesota and Typhimurium induced amounts of IFN-beta, nitric oxide, and IP-10 similar to meningococcal LOS but much less TNF-alpha and MIP-3alpha in time course and dose-response experiments. No MyD88-dependent or -independent response to endotoxin was seen in TLR4-deficient cell lines (C3H/HeJ and 23ScCr) and response was restored in TLR4-MD-2-transfected human embryonic kidney 293 cells. Blocking the MyD88-dependent pathway by DNMyD88 resulted in significant reduction of TNF-alpha release but did not influence nitric oxide release. IFN-beta polyclonal antibody and IFN-alpha/beta receptor 1 antibody significantly reduced nitric oxide release. N

  7. Biotransformation of sclareolide by filamentous fungi: cytotoxic evaluations of the derivatives

    Cano, Arturo [Universidad Nacional Autonoma de Mexico, D.F. (Mexico). Facultad de Estudios Superiores Zaragoza; Ramirez-Apan, Maria Teresa; Delgado, Guillermo, E-mail: delgado@unam.m [Universidad Nacional Autonoma de Mexico, D.F. (Mexico)

    2011-07-01

    Sclareolide (1) was incubated with eight different species of filamentous fungi conventionally used for bio-oxidations. Compound 1 was metabolized with Aspergillus niger in medium A to yield 3-ketosclareolide (2) and 3b-hydroxysclareolide (4), while in medium B (containing major number of nutrients with respect to medium A), compounds 2, 4, 3{alpha},6{beta}-dihydroxysclareolide (16), 1-ketosclareolide (17), 3-keto-15-hydroxysclareolide (18) and 3{beta},15-dihydroxysclareolide (19) were obtained. The biotransformation products 16-19 were found to be new substances. Fermentation of 1 with Cunninghamella blackesleeana using medium A afforded 2 and 4, while using medium B yielded 2, 4, 16 and 17. Compounds 2, 4 and 17 were also obtained with Curvularia lunata. Biotransformation of 1 with Beauveria bassiana yielded 4 in satisfactory yield, with Rhizopus oligosporus and Mucor miehei afforded 2 and 4, while with R. nigricans and Fusarium moliniforme yielded 2, 4 and 16. Cytotoxic evaluation of 1 and the obtained products against selected human cancer cell lines (U251, PC-3, K562, HCT-15, MCF-7 and SKUL-1) indicated that 16 (3{alpha},6{beta}-dihydroxysclareolide) displayed moderate cytotoxic (IC{sub 50} < 100 {mu}M) against U251, PC-3, HCT-15 and MCF-7. (author)

  8. Relationship between omega-3 fatty acids and plasma neuroactive steroids in alcoholism, depression and controls.

    Nieminen, L R G; Makino, K K; Mehta, N; Virkkunen, M; Kim, H Y; Hibbeln, J R

    2006-01-01

    Deficiency in the long-chain omega-3 fatty acid, docosahexaenoic acid (DHA) has been associated with increased corticotropin releasing hormone and may contribute to hypothalamic pituitary axis (HPA) hyperactivity. Elevated levels of the neuroactive steroids, allopregnanolone (3alpha,5alpha-THP) and 3alpha,5alpha-tetrahydrodeoxycorticosterone (THDOC) appear to counter-regulate HPA hyperactivity. Plasma essential fatty acids and neurosteroids were assessed among 18 male healthy controls and among 34 male psychiatric patients with DSM-III alcoholism, depression, or both. Among all subjects, lower plasma DHA was correlated with higher plasma THDOC (r = -0.3, P < 0.05) and dihydroprogesterone (DHP) (r = -0.52, P < 0.05). Among psychiatric patients lower DHA was correlated with higher DHP (r = -0.60, P < 0.01), and among healthy controls lower plasma DHA was correlated with higher THDOC (r = -0.83, P < 0.01) and higher isopregnanolone (3beta,5alpha-THP) (r = -0.55, P < 0.05). In this pilot observational study, lower long-chain omega-3 essential fatty acid status was associated with higher neuroactive steroid concentrations, possibly indicating increased feedback inhibition of the HPA axis. PMID:16959481

  9. Chemical constituents from the leaves of Boehmeria rugulosa with antidiabetic and antimicrobial activities.

    Semwal, Deepak Kumar; Rawat, Usha; Semwal, Ravindra; Singh, Randhir; Krishan, Pawan; Singh, Manjeet; Singh, Gur Jas Preet

    2009-12-01

    Three new flavonoid glycosides, named chalcone-6'-hydroxy-2',3,4-trimethoxy-4'-O-beta-D-glucopyranoside (1), isoflavone-3',4',5,6-tetrahydroxy-7-O-[beta-D-glucopyranosyl-(1-->3)-alpha-L-rhamnopyranoside] (2), and isoflavone-3',4',5,6-tetrahydroxy-7-O-[beta-D-glucopyranosyl-(1-->6)-beta-D-glucopyranosyl-(1-->6)-beta-D-glucopyranosyl-(1-->3)-alpha-L-rhamnopyranoside] (3), were isolated from the leaves of Boehmeria rugulosa, together with five known compounds, beta-sitosterol, quercetin, 3,4-dimethoxy-omega-(2'-piperidyl)-acetophenone (4), boehmeriasin A (5), and quercetin-7-O-beta-D-glucopyranoside. The structures of the isolated compounds were determined by means of chemical and spectral data including 2D NMR experiments. The ethanolic extract of leaves showed significant hypoglycemic activity on alloxan-induced diabetic mice. Glibenclamide, an oral hypoglycemic agent (5 mg/kg, p.o.), was used as a positive control. The ethanolic extract of the plant as well as the isolated compounds 1-3 (25 microg/ml) showed potent antimicrobial activity against two bacterial species (Staphylococcus aureus and Streptococcus mutans) and three fungus pathogens (Microsporum gypseum, Microsporum canis, and Trichophyton rubrum). The activities of the isolated compounds 1-3 have been compared with positive controls, novobiocin, and erythromycin (15 microg/ml). PMID:20183275

  10. Bisdesmosidic saponins from Securidaca longepedunculata roots: evaluation of deterrency and toxicity to Coleopteran storage pests.

    Stevenson, Philip C; Dayarathna, Thamara K; Belmain, Steven R; Veitch, Nigel C

    2009-10-14

    Powdered dry root bark of Securidaca longepedunculata was mixed with maize and cowpea and effectively reduced the numbers of Sitophilus zeamais and Callosobruchus maculatus emerging from these commodities, respectively, more than 9 months after treatment. This effect was reciprocated in grain treated with a methanol extract of the root bark, indicating that compounds were present that were oviposition deterrents or directly toxic to the adults or larvae. Two new bisdesmosidic saponins, 3-O-beta-D-glucopyranosyl-28-O-(alpha-L-arabinopyranosyl-(1 --> 3)-beta-D-xylopyranosyl-(1 --> 4)[beta-D-apiofuranosyl-(1 --> 3)]-alpha-L-rhamnopyranosyl-(1 --> 2)-[4-O-(4-methoxycinnamoyl-beta-D-fucopyranosyl)])-medicagenic acid (securidacaside A) and 3-O-beta-D-glucopyranosyl-28-O-(alpha-L-arabinopyranosyl-(1 --> 3)-beta-D-xylopyranosyl-(1 --> 4)[beta-D-apiofuranosyl-(1 --> 3)]-alpha-L-rhamnopyranosyl-(1 --> 2)-[4-O-(3,4,5-trimethoxy-(E)-cinnamoyl-beta-D-fucopyranosyl)])-medicagenic acid (securidacaside B), were isolated from the methanol extract of the roots of S. longepedunculata and characterized by spectroscopic methods. Securidacaside A, which occurred as (E)- and (Z)-regioisomers, showed deterrency and toxicity toward C. maculatus and S. zeamais and could contribute to the biological activity of the methanol extract. The potential to optimize the use of this plant for stored product protection using water extracts, which would be appropriate technology for target farmers, is discussed. PMID:19769365

  11. Development of an in vitro dual-chamber model of the female genital tract as a screening tool for epithelial toxicity.

    Gali, Youssef; Ariën, Kevin K; Praet, Marleen; Van den Bergh, Rafael; Temmerman, Marleen; Delezay, Olivier; Vanham, Guido

    2010-05-01

    Heterosexual transmission of human immunodeficiency virus (HIV-1) is the predominant mode of infection worldwide. However, the early steps of transepithelial infection still need to be clarified. Using epithelial cells, originating from the female genital tract, and peripheral blood mononuclear cells as subepithelial target cells, an in vitro dual-chamber model of the female genital tract was developed. Remarkably, an intact layer of some cell types (HEC-1A, CaSki and Ect1) served as a protective barrier against cell-free but not against cell-associated HIV-1 that crossed the epithelial barrier through transmigration. Furthermore, dysfunctions of the epithelial layers were assessed by monitoring transepithelial electric resistance and transepithelial passage of FluoSpheres and HIV-1 after treatment with nonoxynol-9 (N-9). Most of the functional assays showed dysfunction of the epithelial barrier at lower concentrations compared to a widely used colorimetric toxicity assay (WST-1). Finally, N-9 treatment caused a significant increase in the production of interleukin-8 (IL-8) and macrophage inflammatory protein-3alpha (MIP-3alpha) and a decrease of Secretory Leukocyte Protease Inhibitor (SLPI) and Monocyte Chemotactic Protein-1 (MCP-1) in this model. In conclusion, this model is a useful tool to (1) study HIV-1 transmission mechanisms and (2) evaluate epithelial toxicity of candidate microbicides. PMID:20138087

  12. In situ deuteron NMR investigations of sheared liquid crystalline polymers.

    Siebert, Hartmut; Becker, Patrick; Quijada-Garrido, Isabel; Grabowski, David A; Schmidt, Claudia

    2002-01-01

    The flow behavior of nematic liquid crystalline polysiloxanes of the side-chain type is studied by in situ 2H NMR spectroscopy on samples under shear in a cone-and-plate cell. The director orientation as a function of applied shear rate is determined from the quadrupole splitting of the spectra. The data analysis yields the two Leslie viscosity coefficients alpha2 and alpha3 and the flow-alignment parameter lambda = -(alpha3 + alpha2)/(alpha3 - alpha2). The values of lambda were determined for several homopolymers with only one type of side chain and random copolymers containing two different side chains. The results show that the flow behavior is related to the phase structure of the polymers, which varies with their composition. Only polymers with large amounts of smectic clusters in the nematic state show the tumbling instability (absolute value(lambda) polymers are flow aligning (absolute value(lambda) > or = 1). For some polymers, a transition from tumbling at low temperature to flow aligning at high temperatures was observed. PMID:12469817

  13. Isoscalar monopole and dipole excitations of cluster states and giant resonances in $^{12}$C

    Kanada-En'yo, Yoshiko

    2015-01-01

    The isoscalar monopole(ISM) and dipole(ISD) excitations in $^{12}$C are theoretically investigated with the shifted antisymmetrized molecular dynamics(AMD) plus $3\\alpha$-cluster generator coordinate method(GCM). The small amplitude vibration modes are described by coherent one-particle one-hole excitations expressed by small shift of single-nucleon Gaussian wave functions within the AMD framework, whereas the large amplitude cluster modes are incorporated by superposing $3\\alpha$-cluster wave functions in the GCM. The coupling of the excitations in the intrinsic frame with the rotation and parity transformation is taken into account microscopically by the angular-momentum and parity projections. The present calculation describes the ISM and ISD excitations in a wide energy region covering cluster modes in the low-energy region and the giant resonances in the high-energy region, though the quantitative description of the high-energy part is not satisfactory. The low-energy ISM and ISD strengths of the cluster...

  14. cDNA sequence coding for the alpha'-chain of the third complement component in the African lungfish.

    Sato, A; Sültmann, H; Mayer, W E; Figueroa, F; Tichy, H; Klein, J

    1999-04-01

    cDNA clones coding for almost the entire C3 alpha-chain of the African lungfish (Protopterus aethiopicus), a representative of the Sarcopterygii (lobe-finned fishes), were sequenced and characterized. From the sequence it is deduced that the lungfish C3 molecule is probably a disulphide-bonded alpha:beta dimer similar to that of the C3 components of other jawed vertebrates. The deduced sequence contains conserved sites presumably recognized by proteolytic enzymes (e.g. factor I) involved in the activation and inactivation of the component. It also contains the conserved thioester region and the putative site for binding properdin. However, the site for the interaction with complement receptor 2 and factor H are poorly conserved. Either complement receptor 2 and factor H are not present in the lungfish or they bind to different residues at the same or a different site than mammalian complement receptor 2 and factor H. The C3 alpha-chain sequences faithfully reflect the phylogenetic relationships among vertebrate classes and can therefore be used to help to resolve the long-standing controversy concerning the origin of the tetrapods. PMID:10219761

  15. Synovial tissue hypoxia and inflammation in vivo.

    Ng, C T

    2012-02-01

    INTRODUCTION: Hypoxia is a microenvironmental feature in the inflamed joint, which promotes survival advantage for cells. The aim of this study was to examine the relationship of partial oxygen pressure in the synovial tissue (tPO(2)) in patients with inflammatory arthritis with macroscopic\\/microscopic inflammation and local levels of proinflammatory mediators. METHODS: Patients with inflammatory arthritis underwent full clinical assessment and video arthroscopy to quantify macroscopic synovitis and measure synovial tPO(2) under direct visualisation. Cell specific markers (CD3 (T cells), CD68 (macrophages), Ki67 (cell proliferation) and terminal deoxynucleotidyl transferase dUTP nick end labelling (cell apoptosis)) were quantified by immunohistology. In vitro migration was assessed in primary and normal synoviocytes (synovial fibroblast cells (SFCs)) using a wound repair scratch assay. Levels of tumour necrosis factor alpha (TNFalpha), interleukin 1beta (IL1beta), interferon gamma (IFNgamma), IL6, macrophage inflammatory protein 3alpha (MIP3alpha) and IL8 were quantified, in matched serum and synovial fluid, by multiplex cytokine assay and ELISA. RESULTS: The tPO(2) was 22.5 (range 3.2-54.1) mm Hg and correlated inversely with macroscopic synovitis (r=-0.421, p=0.02), sublining CD3 cells (-0.611, p<0.01) and sublining CD68 cells (r=-0.615, p<0.001). No relationship with cell proliferation or apoptosis was found. Primary and normal SFCs exposed to 1% and 3% oxygen (reflecting the median tPO(2) in vivo) induced cell migration. This was coupled with significantly higher levels of synovial fluid tumour necrosis factor alpha (TNFalpha), IL1beta, IFNgamma and MIP3alpha in patients with tPO(2) <20 mm Hg (all p values <0.05). CONCLUSIONS: This is the first study to show a direct in vivo correlation between synovial tPO(2), inflammation and cell migration, thus it is proposed that hypoxia is a possible primary driver of inflammatory processes in the arthritic joint.

  16. Structural studies of the major polysaccharide in the cell wall of Renibacterium salmoninarum.

    Sørum, U; Robertsen, B; Kenne, L

    1998-01-01

    The galactose-rich polysaccharide (GPS) in the cell wall of the Gram-positive bacterium Renibacterium salmoninarum, the causative agent in of bacterial kidney disease (BKD) of salmonids, has been studied by sugar and methylation analysis, partial acid hydrolysis, Smith degradation, FABMS, and 1H and 13C NMR spectroscopy. The data show that the GPS has a heptasaccharide repeating unit with the following structure: alpha-D-Rhap-(1-->3)-alpha-L-FucpNAc-(1-->)-beta-D-GlcpNAc 1 decreases 2 -->3)-beta-D-Galf-(1-->6)-beta-D-Galf-(1-->3)-beta-D-Galf -(1-->6) -beta-D-Galf-(1-->. PMID:9691455

  17. Polymorphism of exon 3 of the HLA-G gene

    Hviid, T V; Meldgaard, Michael; Sørensen, S;

    1997-01-01

    HLA-G is a non-classical MHC class I gene with a limited tissue distribution. The most pronounced expression is detected in the cytotrophoblast of first trimester placenta. It is possible to detect mRNA for HLA-G in preimplantation blastocysts where expression is correlated with a high cleavage...... rate of embryos. HLA-G seems to play an important role in the feto-maternal relationship. The polymorphism of the HLA-G locus is not fully clarified. One study has shown extensive nucleotide sequence variation in the exon 3 (alpha-2 domain) in healthy African Americans. A few studies in other...... populations have only revealed a limited polymorphism. We investigated the polymorphism of the exon 3 of HLA-G by means of Polymerase Chain Reaction (PCR)-Single Strand Conformation Polymorphism (SSCP)- and DNA sequencing analysis in a Danish population. We detected four single-base substitutions in exon 3...

  18. O carater de Chern-Connes para C$^*$-sistemas dinamicos calculado em algumas algebras de operadores pseudodiferenciais

    Dias, David P

    2008-01-01

    Given a C$^*$-dynamical system $(A, G, \\alpha)$ one defines a homomorphism, called the Chern-Connes character, that take an element in $K_0(A) \\oplus K_1(A)$, the K-theory groups of the C$^*$-algebra $A$, and maps it into $H_{\\mathbb{R}}^*(G)$, the real deRham cohomology ring of $G$. We explictly compute this homomorphism for the examples $(\\overline{\\Psi_{cl}^0(S^1)}, S^1, \\alpha)$ and $(\\overline{\\Psi_{cl}^0(S^2)}, SO(3), \\alpha)$, where $\\overline{\\Psi_{cl}^0(M)}$ denotes the C$^*$-algebra generated by the classical pseudodifferential operators of zero order in the manifold $M$ and $\\alpha$ the action of conjugation by the regular representation (translations).

  19. Triterpenoid saponins from Lippia alba (Mill.) N. E. Brown

    Farias, Mareni R.; Pertile, Roberto; Correa, Melissa M.; Schenkel, Eloir P., E-mail: marenif@yahoo.com.b [Universidade Federal de Santa Catarina (UFSC), Florianopolis, SC (Brazil). Dept. de Ciencias Farmaceuticas. Programa de Pos-graduacao em Farmacia; Almeida, Maria Tereza R. de; Palermo, Jorge A. [Universidad de Buenos Aires (Argentina). Facultad de Ciencias Exactas y Naturales. Dept. de Quimica Organica

    2010-07-01

    Two saponins were isolated from the leaves of Lippia alba. Their structures were established using one- and two-dimensional NMR spectroscopy and mass spectrometry. These new compounds were elucidated as 3-O-beta-D-glucopyranosyl-28-O-(alpha-L-rhamnopyranosyl-(1->3)-beta-D-xylopyranosyl -(1->4)-alpha-L-rhamnopyranosyl-(1->2)-alpha-L-arabinopyranosyl)-16alpha, 23-dihydroxy-olean -12-en-28-oic acid, named as Lippiasaponin I (2) and as 3-O-beta-D-glucopyranosyl-28-O-(alpha-L-rhamnopyranosyl-(1->3)-beta-D-xylopyranosyl- (1->4)-alpha-L-rhamnopyranosyl-(1->3)-alpha-Larabinopyranosyl)-16alpha,23-dihydroxy-olean -12-en-28-oic acid, named Lippiasaponin II (3). (author)

  20. Hydroxylation of a hederagenin derived saponin by a Xylareaceous fungus found in fruits of Sapindus saponaria

    Murgu, Michael; Santos, Luiz F. Arruda; Souza, Gezimar D. de; Daolio, Cristina; Ferreira, Antonio Gilberto; Rodrigues-Filho, Edson [Universidade Federal de Sao Carlos (UFSCAR), SP (Brazil). Dept. de Quimica; Schneider, Bernd [Max Planck Institute for Chemical Ecology, Beutenberg Campus, Jena (Germany)

    2008-07-01

    During our screening of tropical plants for endophyte microorganisms, a Xylareaceous fungus was found living on the internal part of Sapindus saponaria fruits. The fruits of S. saponaria accumulate great amounts of triterpenoidal and sesquiterpenoidal saponins. The saponin 3-O-({beta}-D-xylopyranosyl)-(1{yields}3)-{alpha}-L -rhamnopyranosyl-(1{yields}2)-{alpha}-L-arabinopyranosyl-hederagenin was isolated using chromatographic methods, after alkaline hydrolysis of the crude extract obtained from S. saponaria fruits and added to the culture medium used to grows the fungus. A new saponin was isolated from this experiment by preparative scale HPLC and characterized as a 22{alpha}-hydroxy derivative. The structure of this hydroxylated saponin was elucidated based on interpretation of MS/MS data and NMR spectra. (author)

  1. The synthesis and characterization of analogs of the antimicrobial compound squalamine: 6 beta-hydroxy-3-aminosterols synthesized from hyodeoxycholic acid.

    Jones, S R; Kinney, W A; Zhang, X; Jones, L M; Selinsky, B S

    1996-10-01

    Analogs of the aminosterol antimicrobial agent squalamine have been synthesized beginning from hyodeoxycholic acid. After carboxylic acid esterification and oxidation of both alcohol functions to ketones, the A/B ring junction was converted from cis to trans by acid-catalyzed isomerization. Different polyamines were added to the 3-keto group by reductive amination, yielding both the 3 alpha and 3 beta addition products. The synthetic products exhibited potent, broad-spectrum antimicrobial activity similar to that of the parent compound. Changing the identity of the polyamine or the stereochemistry of addition has little effect upon antimicrobial activity but appears to change the selectivity of the agents. The analogs are synthesized with high yield from inexpensive starting materials and are promising alternatives to squalamine as potential antibiotics. PMID:8910969

  2. Layered cathode materials for lithium ion rechargeable batteries

    Kang, Sun-Ho; Amine, Khalil

    2007-04-17

    A number of materials with the composition Li.sub.1+xNi.sub..alpha.Mn.sub..beta.Co.sub..gamma.M'.sub..delta.O.sub.2-- zF.sub.z (M'=Mg,Zn,Al,Ga,B,Zr,Ti) for use with rechargeable batteries, wherein x is between about 0 and 0.3, .alpha. is between about 0.2 and 0.6, .beta. is between about 0.2 and 0.6, .gamma. is between about 0 and 0.3, .delta. is between about 0 and 0.15, and z is between about 0 and 0.2. Adding the above metal and fluorine dopants affects capacity, impedance, and stability of the layered oxide structure during electrochemical cycling.

  3. Anacardic acid derivatives from Brazilian propolis and their antibacterial activity

    Silva, M.S.S.; Lima, S.G. de; Lopes, J.A.D.; Chaves, M.H.; Cito, A.M.G.L. [Universidade Federal do Piaui (UFPI), Teresina, PI (Brazil). Dept. de Quimica]. E-mail: gracito@ufpi.br; Oliveira, E.H. [Universidade Federal do Piaui (UFPI), Teresina, PI (Brazil). Dept. de Microbiologia e Parasitologia; Reis, F.A.M. [Universidade Estadual de Campinas (UNICAMP), Campinas, SP (Brazil). Inst. de Quimica

    2008-07-01

    Propolis is a sticky, gummy, resinous substance collected by honeybees (Apis mellifera L.) from various plant sources, which has excellent medicinal properties. This paper describes the isolation and identification of triterpenoids and anacardic acid derivatives from Brazilian propolis and their antibacterial activity. Their structures were elucidated by {sup 1}H and {sup 13}C NMR, including uni- and bidimensional techniques; in addition, comparisons were made with data from academic literature. These compounds were identified as: cardanols (1a + 1b), cardols (2a + 2b), mono ene anacardic acid (3), alpha-amirine (4), beta-amirine (5), cycloartenol (6), 24-methylene-cycloartenol (7) and lupeol (8). The determination of the position of the double bond after a reaction with Dimethyl disulfide (DMDS) is described for the phenol derivatives. The ethanolic extract was tested in vitro for antimicrobial activity by using the disc diffusion method and it showed significant results against Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa and Shigella spp. (author)

  4. Anacardic acid derivatives from Brazilian propolis and their antibacterial activity

    Propolis is a sticky, gummy, resinous substance collected by honeybees (Apis mellifera L.) from various plant sources, which has excellent medicinal properties. This paper describes the isolation and identification of triterpenoids and anacardic acid derivatives from Brazilian propolis and their antibacterial activity. Their structures were elucidated by 1H and 13C NMR, including uni- and bidimensional techniques; in addition, comparisons were made with data from academic literature. These compounds were identified as: cardanols (1a + 1b), cardols (2a + 2b), mono ene anacardic acid (3), alpha-amirine (4), beta-amirine (5), cycloartenol (6), 24-methylene-cycloartenol (7) and lupeol (8). The determination of the position of the double bond after a reaction with Dimethyl disulfide (DMDS) is described for the phenol derivatives. The ethanolic extract was tested in vitro for antimicrobial activity by using the disc diffusion method and it showed significant results against Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa and Shigella spp. (author)

  5. Nonlinear optics of astaxanthin thin films

    Esser, A.; Fisch, Herbert; Haas, Karl-Heinz; Haedicke, E.; Paust, J.; Schrof, Wolfgang; Ticktin, Anton

    1993-02-01

    Carotinoids exhibit large nonlinear optical properties due to their extended (pi) -electron system. Compared to other polyenes which show a broad distribution of conjugation lengths, carotinoids exhibit a well defined molecular structure, i.e. a well defined conjugation length. Therefore the carotinoid molecules can serve as model compounds to study the relationship between structure and nonlinear optical properties. In this paper the synthesis of four astaxanthins with C-numbers ranging from 30 to 60, their preparation into thin films, wavelength dispersive Third Harmonic Generation (THG) measurements and some molecular modelling calculations will be presented. Resonant (chi) (3) values reach 1.2(DOT)10-10 esu for C60 astaxanthin. In the nonresonant regime a figure of merit (chi) (3)/(alpha) of several 10-13 esu-cm is demonstrated.

  6. Dynamic sea level changes following changes in the thermohaline circulation

    Levermann, Anders; Griesel, Alexa; Hofmann, Matthias; Rahmstorf, Stefan [Potsdam Institute for Climate Impact Research, Potsdam (Germany); Montoya, Marisa [Universidad Complutense de Madrid, Facultad de Ciencias Fisicas, Madrid (Spain)

    2005-03-01

    Using the coupled climate model CLIMBER-3{alpha}, we investigate changes in sea surface elevation due to a weakening of the thermohaline circulation (THC). In addition to a global sea level rise due to a warming of the deep sea, this leads to a regional dynamic sea level change which follows quasi-instantaneously any change in the ocean circulation. We show that the magnitude of this dynamic effect can locally reach up to {proportional_to}1 m, depending on the initial THC strength. In some regions the rate of change can be up to 20-25 mm/yr. The emerging patterns are discussed with respect to the oceanic circulation changes. Most prominent is a south-north gradient reflecting the changes in geostrophic surface currents. Our results suggest that an analysis of observed sea level change patterns could be useful for monitoring the THC strength. (orig.)

  7. Increased phosphorylation of skeletal muscle glycogen synthase at NH2-terminal sites during physiological hyperinsulinemia in type 2 diabetes

    Højlund, Kurt; Staehr, Peter; Hansen, Bo Falck;

    2003-01-01

    mechanism involved in human muscle and the defect in type 2 diabetes remain unclear. We studied the effect of insulin at physiological concentrations on glucose metabolism, insulin signaling and phosphorylation of GS in skeletal muscle from type 2 diabetic and well-matched control subjects during euglycemic......-hyperinsulinemic clamps. Analysis using phospho-specific antibodies revealed that insulin decreases phosphorylation of sites 3a + 3b in human muscle, and this was accompanied by activation of Akt and inhibition of glycogen synthase kinase-3alpha. In type 2 diabetic subjects these effects of insulin were fully intact....... Despite that, insulin-mediated glucose disposal and storage were reduced and activation of GS was virtually absent in type 2 diabetic subjects. Insulin did not decrease phosphorylation of sites 2 + 2a in healthy human muscle, whereas in diabetic muscle insulin infusion in fact caused a marked increase in...

  8. On the existence of non-abelian monopoles: the algebro-geometric approach

    Braden, H W

    2010-01-01

    We develop the Atiyah-Drinfeld-Manin-Hitchin-Nahm construction to study SU(2) non-abelian charge 3 monopoles within the algebro-geometric method. The method starts with finding an algebraic curve, the monopole spectral curve, subject to Hitchin's constraints. We take as the monopole curve the genus four curve that admits a $C_3$ symmetry, $\\eta^3+\\alpha\\eta\\zeta^2+\\beta\\zeta^6+\\gamma\\zeta^3-\\beta=0$, with real parameters $\\alpha$, $\\beta$ and $\\gamma$. In the case $\\alpha=0$ we prove that the only suitable values of $\\gamma/\\beta$ are $\\pm 5\\sqrt{2}$ ($\\beta$ is given below) which corresponds to the tetrahedrally symmetric solution. We then extend this result by continuity to non-zero values of the parameter $\\alpha$ and find finally a {\\em new} one-parameter family of monopole curves with $C_3$ symmetry.

  9. Iodo-gen-catalysed iodination for identification of surface-exposed outer membrane proteins of Escherichia coli K12

    Surface proteins of Escherichia coli K12 were identified by radiolabelling using 1,3,4,6 - tatrachloro, 3-alpha, 6-alpha - diphenylgycoluryl (Iodo-Gen) and 131I. Labelled proteins were localized in the outer membrane of the cells. Using this technique it has been possible to observe technique it has been possible to observe that the eletrophoretic pattern of surface proteins changes according to the growth phases in culture. Radiolabelling of E.coli cells inculbated at 420C showed that the syntheses of two surface proteins were temperature-inducible. At least one such protein may be involved in the process of cell division in E.coli K12. (author)

  10. Evidence That GABA Mediates Dopaminergic and Serotonergic Pathways Associated with Locomotor Activity in Juvenile Chinook Salmon (Oncorhynchus tshawytscha)

    Clements, S.; Schreck, C.B.

    2004-01-01

    The authors examined the control of locomotor activity in juvenile salmon (Oncorhynchus tshawytscha) by manipulating 3 neurotransmitter systems-gamma-amino-n-butyric acid (GABA), dopamine, and serotonin-as well as the neuropeptide corticotropin releasing hormone (CRH). Intracerebroventricular (ICV) injections of CRH and the GABAAagonist muscimol stimulated locomotor activity. The effect of muscimol was attenuated by administration of a dopamine receptor antagonist, haloperidol. Conversely, the administration of a dopamine uptake inhibitor (4???,4??? -difluoro-3-alpha-[diphenylmethoxy] tropane hydrochloride [DUI]) potentiated the effect of muscimol. They found no evidence that CRH-induced hyperactivity is mediated by dopaminergic systems following concurrent injections of haloperidol or DUI with CRH. Administration of muscimol either had no effect or attenuated the locomotor response to concurrent injections of CRH and fluoxetine, whereas the GABAA antagonist bicuculline methiodide potentiated the effect of CRH and fluoxetine.

  11. Is there A Role for Alpha-Linolenic Acid in the Fetal Programming of Health?

    Alicia I. Leikin-Frenkel

    2016-03-01

    Full Text Available The role of ω3 alpha linolenic acid (ALA in the maternal diet during pregnancy and lactation, and its effect on the prevention of disease and programming of health in offspring, is largely unknown. Compared to ALA, ω3 docosahexaenoic (DHA and eicosapentaenoic (EPA acids have been more widely researched due to their direct implication in fetal neural development. In this literature search we found that ALA, the essential ω3 fatty acid and metabolic precursor of DHA and EPA has been, paradoxically, almost unexplored. In light of new and evolving findings, this review proposes that ALA may have an intrinsic role, beyond the role as metabolic parent of DHA and EPA, during fetal development as a regulator of gene programming for the prevention of metabolic disease and promotion of health in offspring.

  12. Dynamics of solitons and quasisolitons of the cubic third-order nonlinear Schrödinger equation

    Karpman, V.I.; Juul Rasmussen, J.; Shagalov, A.G.

    2001-01-01

    the third derivative term) and vanish at alpha3 -->0. The most essential, at small alpha (3), is a quasisoliton emitting resonant radiation (resonantly radiating soliton). Its relationship with the other (steady) quasisoliton, called embedded soliton, is studied analytically and also in numerical......The dynamics of soliton and quasisoliton solutions of the cubic third-order nonlinear Schrodinger equation is studied. Regular solitons exist due to a balance between the nonlinear terms and (linear) third-order dispersion; they are not important at small alpha (3) (alpha (3) is the coefficient in...... experiments. It is demonstrated that the resonantly radiating solitons emerge in the course of nonlinear evolution, which shows their physical significance....

  13. Kerr-Newman Black Hole In Quintessence

    Xu, Zhaoyi

    2016-01-01

    We study the Kerr-Newman solutions of the Einstein-Maxwell equation in quintessence field around a black hole by Newman-Janis algorithm. From the horizon structure and stationary limit surfaces, we find that Kerr-Newman black hole exists an ergosphere with $r^{+} < r < r^{L}$, which is related to the parameters $\\omega$ and $\\alpha$. We obtain the general expression between $\\alpha$ and $\\omega$ if the cosmological horizon exists, in which for $\\omega=-1/2$, $\\alpha\\leq\\sqrt{2}/5$, and for $\\omega=-2/3$, $\\alpha\\leq 1/6$. For $\\omega=-2/3$, the result is same with rotational black hole in quintessence. The singularity of the black holes is the same with that of Kerr black hole. We also discuss the rotation velocity of the black holes on the equatorial plane for $\\omega =-2/3$ and $-1/2$.

  14. Genome wide high density SNP-based linkage analysis of childhood absence epilepsy identifies a susceptibility locus on chromosome 3p23-p14

    Chioza, Barry A; Aicardi, Jean; Aschauer, Harald;

    2009-01-01

    and the genes involved are yet to be fully established. A genome wide single nucleotide polymorphism (SNP)-based high density linkage scan was carried out using 41 nuclear pedigrees with at least two affected members. Multipoint parametric and non-parametric linkage analyses were performed using...... MERLIN 1.1.1 and a susceptibility locus was identified on chromosome 3p23-p14 (Z(mean)=3.9, p<0.0001; HLOD=3.3, alpha=0.7). The linked region harbours the functional candidate genes TRAK1 and CACNA2D2. Fine-mapping using a tagSNP approach demonstrated disease association with variants in TRAK1....

  15. Dicty_cDB: Contig-U10149-1 [Dicty_cDB

    Full Text Available AATAAAAAAAAAATAACTTTTTTT Gap no gap Contig length 1131 Chromosome number (1..6, M) 4 Chromosome length 5430582 Start...65 Number of sequences better than 10.0: 139 Length of query: 1131 Length of database: 95,242,211,685 Le...iones unguiculatus akr-L6 mRNA ... 76 5e-40 AK227354_1( AK227354 |pid:none) Arabidopsis thaliana mRNA for put.... 77 1e-33 AB045829_1( AB045829 |pid:none) Homo sapiens mRNA for 3alpha-hydro... 70 1e-33 AB264706_1( AB2647...( AE016877 |pid:none) Bacillus cereus ATCC 14579, com... 88 1e-32 ( P26690 ) RecName: Full=NAD(P)H-dependent 6'-deoxychalcone syntha

  16. The extreme limit of the generalized Chaplygin gas

    Piattella, Oliver F

    2009-01-01

    It is widely renown that adiabatic unified models of dark matter and dark energy have problems from the viewpoint of their perturbative behaviour because of their speed of sound. Indeed, the latter has to be very small in order the model to be able to reproduce the observed features of our Universe. In this paper we address the generalized Chaplygin gas and the Integrated Sachs Wolfe effect. Through a very simple argument concerning the matter-radiation equivalence scale and the Meszaros effect we probe the \\alpha parameter space of the generalized Chaplygin gas model. We find that in the interval 10^{-3} < \\alpha < 350, the ISW effect cannot be neglected. We then discuss what are the implications on the background evolution of the Universe when very large values of \\alpha are considered.

  17. A particle dark matter footprint on the first generation of stars

    Lopes, Ilidio

    2014-01-01

    Dark matter particles with properties identical to dark matter candidates that are hinted at by several international collaborations dedicated to experimental detection of dark matter (DAMA, COGENT, CRESST and CDMS-II, although not, most notably, by LUX), and which also have a dark matter asymmetry identical to the observed baryon asymmetry (Planck and Wilkinson Microwave Anisotropy Probe), may produce a significant impact on the evolution of the first generation of low-metallicity stars. The lifetimes of these stars in different phases of stellar evolution are significantly extended, namely, in the pre-main sequence, main sequence, and red giant phases. In particular, intermediate-mass stars in the red giant phase experience significant changes in their luminosity and chemical composition. The annihilations of dark matter particles affect the interior of the star in such a way that the $3\\alpha-$reaction becomes less efficient in the production of carbon and oxygen. This dark matter effect contradicts the ex...

  18. Formation mechanism of diamond nanocrystal from catalysed carbon black

    Wen Bin [Department of Materials Engineering, Dalian University of Technology, Dalian 116023 (China); Li Tingju [Laboratory of Special Processing of Raw Materials, Dalian University of Technology, Dalian 116023 (China); Dong Chuang [Department of Materials Engineering, Dalian University of Technology, Dalian 116023 (China); Zhang Xingguo [Laboratory of Special Processing of Raw Materials, Dalian University of Technology, Dalian 116023 (China); Yao Shan [Laboratory of Special Processing of Raw Materials, Dalian University of Technology, Dalian 116023 (China); Cao Zhiqiang [Laboratory of Special Processing of Raw Materials, Dalian University of Technology, Dalian 116023 (China); Wang Dehe [Department of Materials Engineering, Dalian University of Technology, Dalian 116023 (China); Ji Shouhua [Department of Materials Engineering, Dalian University of Technology, Dalian 116023 (China); Jin Junze [Laboratory of Special Processing of Raw Materials, Dalian University of Technology, Dalian 116023 (China)

    2004-10-06

    Recently, our group has synthesized nanocrystal n-diamond and diamond-like carbon (DLC) from catalysed carbon black. Based on the results of XRD, TGA and DTA, a formation mechanism has been proposed to explain the phase transformation from carbon black to diamond nanocrystal. With the increase of temperature and hence the carbon diffusion in iron, the phase sequence is from Fe(OH){sub 3} into Fe{sub 2}O{sub 3}, {alpha}-Fe, {gamma}-Fe, then liquid iron. When the carbon in the liquid iron is saturated, DLC or graphite separates out of the liquid iron. With decrease of temperature, the carbon in {gamma}-Fe is separated out, and n-diamond nuclei form and grow.

  19. Production of $\\alpha$-particle condensate states in heavy-ion collisions

    Raduta, Ad R; Geraci, E; Neindre, N Le; Napolitani, P; Rivet, M F; Alba, R; Amorini, F; Cardella, G; Chatterjee, M; De Filippo, E; Guinet, D; Lautesse, P; La Guidara, E; Lanzalone, G; Lanzano, G; Lombardo, I; Lopez, O; Maiolino, C; Pagano, A; Pirrone, S; Politi, G; Porto, F; Rizzo, F; Russotto, P; Wieleczko, J P

    2010-01-01

    The fragmentation of quasi-projectiles from the nuclear reaction $^{40}Ca$ + $^{12}C$ at 25 MeV/nucleon was used to produce excited states candidates to $\\alpha$-particle condensation. The experiment was performed at LNS-Catania using the CHIMERA multidetector. Accepting the emission simultaneity and equality among the $\\alpha$-particle kinetic energies as experimental criteria for deciding in favor of the condensate nature of an excited state, we analyze the $0_2^+$ and $2_2^+$ states of $^{12}$C and the $0_6^+$ state of $^{16}$O. A sub-class of events corresponding to the direct 3-$\\alpha$ decay of the Hoyle state is isolated.

  20. [Neuroprotection strategies: effect of vinpocetine in vitro oxidative stress models].

    Pereira, Cláudia; Agostinho, Paula; Moreira, Paula I; Duarte, Ana I; Santos, Maria S; Oliveira, Catarina R

    2003-01-01

    Reactive oxygen species (ROS) play an important role in neuronal damage and death that occurs in several neurodegenerative disorders, namely in Alzheimer's disease (AD). The observation that ROS neutralization may slow or reduce the neurodegenerative process associated with those pathologies stimulates the development of new drugs, more efficient and well tolerated, with antioxidant properties. Vinpocetine [14-etoxicarbonyl-3alpha,16alpha-ethyl)-14,15-eburnamine], a vincamine derivative, efficiently protects cells from ROS attack. Recently, the protective effect of vinpocetine was demonstrated using in vitro models of oxidative stress induced by the oxidant pair ascorbate/Fe2+ and by synthetic peptides of the AD-associated b-amyloid protein (Abeta). Results obtained from these in vitro experiences support that additional clinical trials should be carried out using vinpocetine, or vinpocetine derivatives, in order to test its therapeutical or preventive effects in diseases where oxidative stress plays a crucial role. PMID:15631851

  1. Low birth weight and zygosity status is associated with defective muscle glycogen and glycogen synthase regulation in elderly twins

    Poulsen, Pernille; Wojtaszewski, Jørgen; Richter, Erik; Beck-Nielsen, Henning; Vaag, Allan

    2007-01-01

    lower fractional GS activity amidst higher glycogen and GS protein levels compared with dizygotic twins. In addition, we demonstrated strong nongenetic associations between birth weight and defect muscle glycogen metabolism in elderly--but not in younger--twins. Thus, for every 100 g increase in birth......OBJECTIVE: An adverse intrauterine environment indicated by both low birth weight and monozygosity is associated with an age- or time-dependent reduction in glucose disposal and nonoxidative glucose metabolism in twins, suggesting impaired regulation of muscle glycogen synthesis. RESEARCH DESIGN...... weight within pairs, GS fractional activity, GS protein level, and glycogen content was increased by 4.2, 8.7, and 4.5%, respectively, in elderly twins. Similarly, for every 100 g increase in birth weight, GSK3 alpha activity and GS phosphorylation at the sites 2, 2+2a, and 3a+3b were decreased by 3.1, 9...

  2. In vitro metabolism of androstenedione and identification of endogenous steroids in Helix aspersa

    In vitro metabolism of androstenedione in gonads of juvenile and adult Helix aspersa has been investigated. The conversion of [3H]androstenedione into testosterone, 5 alpha-dihydrotestosterone, androsterone, and estriol was demonstrated. In juvenile animals testosterone (59.8%) is the major metabolite whereas in adult animals androsterone (18.8%) is. The following endogenous steroids have been identified by gas chromatography-mass spectrometry in adult gonads: androsterone, dehydroepiandrosterone, androstenedione, 3 alpha-androstanediol, estrone, estradiol-17 beta, and estriol. The levels of testosterone, 5 alpha-dihydrotestosterone, androstenedione, and progesterone have been measured by RIAs in gonads and hemolymph. Their levels vary with the physiological stage: the gonadal and circulating levels of testosterone decrease with the sexual maturation whereas the 5 alpha-dihydrotestosterone increases. These differences observed in metabolism and in level of steroids between the juvenile and the adult snails allow us to suppose that these steroids have a biological role

  3. Balancing omega-6 and omega-3 fatty acids in ready-to-use therapeutic foods (RUTF)

    Brenna, J Thomas; Akomo, Peter; Bahwere, Paluku;

    2015-01-01

    Ready-to-use therapeutic foods (RUTFs) are a key component of a life-saving treatment for young children who present with uncomplicated severe acute malnutrition in resource limited settings. Increasing recognition of the role of balanced dietary omega-6 and omega-3 polyunsaturated fatty acids...... with altered PUFA content and looked at the effects on circulating omega-3 docosahexaenoic acid (DHA) status as a measure of overall omega-3 status. Supplemental oral administration of omega-3 DHA or reduction of RUTF omega-6 linoleic acid using high oleic peanuts improved DHA status, whereas...... increasing omega-3 alpha-linolenic acid in RUTF did not. The results of these two small studies are consistent with well-established effects in animal studies and highlight the need for basic and operational research to improve fat composition in support of omega-3-specific development in young children as...

  4. 2alpha+t cluster feature of $3/2^-_3$ state in $^{11}$B

    Kanada-En'yo, Yoshiko

    2014-01-01

    We reanalyze $2\\alpha+t$ cluster features of $3/2^-$ states in $^{11}$B by investigating the $t$ cluster distribution around a $2\\alpha$ core in $^{11}$B, calculated with the method of antisymmetrized molecular dynamics (AMD). In the $3/2^-_3$ state, a $t$ cluster is distributed in a wide region around $2\\alpha$, indicating that the $t$ cluster moves rather freely in angular as well as radial motion. From the weak angular correlation and radial extent of the $t$ cluster distribution, we propose an interpretation of a $2\\alpha+t$ cluster gas for the $3/2^-_3$ state. In this study, we compare the $2\\alpha+t$ cluster feature in $^{11}$B($3/2^-_3$) with the $3\\alpha$ cluster feature in $^{12}$C($0^+_2$), and discuss their similarities and differences.

  5. Grassmann Duality and the Particle Spectrum

    Delbourgo, Robert

    2016-01-01

    Schemes based on anticommuting scalar coordinates, corresponding to properties, lead to generations of particles naturally. The application of Grassmannian duality cuts down the number of states substantially and is vital for constructing sensible Lagrangians anyhow. We apply duality to all of the subgroups within the {\\em classification} group SU(3)$\\times$SU(2)$_L\\times$SU(2)$_R$, which encompasses the standard model gauge group, and thereby determine the full state inventory; this includes the definite prediction of quarks with charge -4/3 and other exotic states. Assuming universal gravitational coupling to the gauge fields and parity even property curvature, we also obtain $4\\sin^2\\theta_w = 1 - 2\\alpha/3\\alpha_s$ which is not far from the experimental value around the $M_Z$ mass.

  6. Isoprenoid compounds from Euphorbia portlandica. X-ray structure of lupeportlandol, a new lupane triterpene

    Madureira, Ana M.; Ferreira, Maria-Jose U. [Universidade de Lisboa, Lisboa (Portugal). Faculdade de Farmacia. Centro de Estudos de Ciencias Farmaceuticas]. E-mail: mjuferreira@ff.ul.pt; Duarte, Maria Teresa; Ascenso, Jose R. [Instituto Superior Tecnico, Lisboa (Portugal). Centro de Quimica Estrutural; Piedade, Maria Fatima M. [Universidade de Lisboa, Campo Grande, Lisboa (Portugal). Faculdade de Ciencias. Dept. de Quimica e Bioquimica

    2004-10-01

    Phytochemical survey of the Me{sub 2}CO extracts of the whole dried plant Euphorbia portlandica led to the isolation of a new pentacyclic triterpene alcohol, with the lupane skeleton, named lupeportlandol. Its structure was established as 3{alpha}-hydroxy-19{alpha}H-lup-20(29)-ene. The known pentacyclic triterpene glutinol and the steroid {beta}-sitostenone were also isolated. The characterization of the new compound and its acetylated derivative was based on spectroscopic methods and an X-ray diffraction analysis. Lupeportlandol acetate was inactive in cytotoxicity assays in vitro against three human tumor cell lines: MCF-7 (breast cancer), NCI-H460 (non-small cell lung cancer) and SF-268 (CNS cancer). (author)

  7. Triterpenoids from Camellia japonica and their cytotoxic activity.

    Thao, Nguyen Thi Phuong; Hung, Tran Manh; Lee, Mi Kyoung; Kim, Jin Cheol; Min, Byung Sun; Bae, KiHwan

    2010-01-01

    From the ethyl acetate fraction of the stem bark of Camellia japonica, three new triterpenoids, 3beta-O-acetyl-16beta-hydroxy-12-oxoolean (6), 3beta-O-acetyl-16beta-hydroxy-11-oxoolean-12-ene (7), and 3beta-O-acetyl-16beta-hydroxyolean-12-ene (8), along with seven known compounds, 3alpha-hydroxy-1-oxofriedelan (1), friedelin (2), 3beta-friedelanol (3), canophyllol (4), 3-oxofriedelan-1(2)-ene (5), beta-amyrin (9), camellenodiol (10), and camelledionol (11) were isolated. Their structures were established on the basis of spectroscopic analysis and chemical evidence. The isolated compounds were tested in vitro for their cytotoxic activities against the A549, LLC, HL-60 and MCF-7 cancer cell lines. Among them, compound 8 showed cytotoxicity against LLC and HL-60 cancer cell lines with IC(50) values of 25.2 and 21.7 microM, respectively. PMID:20045980

  8. Particle acceleration in rotating and shearing jets from AGN

    Rieger, F M

    2002-01-01

    We model the acceleration of energetic particles due to shear and centrifugal effects in rotating astrophysical jets. The appropriate equation describing the diffusive transport of energetic particles in a collisionless, rotating background flow is derived and analytical steady state solutions are discussed. In particular, by considering velocity profiles from rigid, over flat to Keplerian rotation, the effects of centrifugal and shear acceleration of particles scattered by magnetic inhomogeneities are distinguished. In the case where shear acceleration dominates, it is confirmed that power law particle momentum solutions $f(p) \\propto p^{-(3+\\alpha)}$ exist, if the mean scattering time $\\tau_c \\propto p^{\\alpha}$ is an increasing function of momentum. We show that for a more complex interplay between shear and centrifugal acceleration, the recovered power law momentum spectra might be significantly steeper but flatten with increasing azimuthal velocity due to the increasing centrifugal effects. The possible ...

  9. Basement membrane abnormalities in human eyes with diabetic retinopathy

    Ljubimov, A V; Burgeson, R E; Butkowski, R J;

    1996-01-01

    human eyes obtained at autopsy (seven normal, five diabetic without DR, and 13 diabetic with DR) by immunofluorescence with antibodies to 30 BM and extracellular matrix components. In non-DR eyes, no qualitative changes of ocular BM components were seen. In some DR corneas, epithelial BM was stained......Vascular and parenchymal basement membranes (BMs) are thickened in diabetes, but alterations in individual BM components in diabetic eyes, especially in diabetic retinopathy (DR), are obscure. To identify abnormalities in the distribution of specific constituents, we analyzed cryostat sections of...... discontinuously for laminin-1, entactin/nidogen, and alpha3-alpha4 Type IV collagen, in contrast to non-DR corneas. Major BM alterations were found in DR retinas compared to normals and non-DR diabetics. The inner limiting membrane (retinal BM) of DR eyes had accumulations of fibronectin (including cellular) and...

  10. Steroid modulation of the chloride ionophore in rat brain: structure-activity requirements, regional dependence and mechanism of action

    Gee, K.W.; Bolger, M.B.; Brinton, R.E.; Coirini, H.; McEwen, B.S.

    1988-08-01

    Further in vitro studies of steroids active at the gamma-aminobutyric acidA (GABAA) receptor regulated Cl- channel labeled by (35S)-t-butylbicyclophosphorothionate ((35S)TBPS) reveal additional structural requirements necessary for activity. Evaluation of selected steroids for activity against TBPS-induced convulsions show similar requirements for activity. Interestingly, steroids (e.g., 5 alpha-pregnan-3 alpha, 20 alpha-diol) were identified that have high potency but limited efficacy as modulators of (35S)TBPS binding. These characteristics are reminiscent of the clinically useful benzodiazepines (BZs) such as clonazepam. However, interactions between the prototypical anesthetic-barbiturate, sodium pentobarbital, and steroids active at the Cl- channel suggest that they do not share a common site of action as allosteric modulators of (35S)TBPS and BZ receptor binding. The most potent steroid evaluated, 5 alpha-pregnan-3 alpha-ol-20-one, modulates (35S)TBPS binding at low concentrations (IC50 approximately 17 nM) in a regionally dependent manner. All (35S)TBPS binding sites appear to be functionally coupled to a steroid modulatory site. Because several of the active steroids are metabolites of progesterone, their ability to inhibit the binding of (3H)promegestrone to the cytosolic progestin receptor in rat uterus was evaluated. Those steroids showing potent activity at the GABAA receptor-Cl- ionophore were inactive at the intracellular progestin receptor. Such specificity coupled with their high potency provide additional support for the hypothesis that some of these steroids may be involved in the homeostatic regulation of brain excitability via the GABAA-BZ receptor complex.

  11. Steroid modulation of the chloride ionophore in rat brain: structure-activity requirements, regional dependence and mechanism of action

    Further in vitro studies of steroids active at the gamma-aminobutyric acidA (GABAA) receptor regulated Cl- channel labeled by [35S]-t-butylbicyclophosphorothionate ([35S]TBPS) reveal additional structural requirements necessary for activity. Evaluation of selected steroids for activity against TBPS-induced convulsions show similar requirements for activity. Interestingly, steroids (e.g., 5 alpha-pregnan-3 alpha, 20 alpha-diol) were identified that have high potency but limited efficacy as modulators of [35S]TBPS binding. These characteristics are reminiscent of the clinically useful benzodiazepines (BZs) such as clonazepam. However, interactions between the prototypical anesthetic-barbiturate, sodium pentobarbital, and steroids active at the Cl- channel suggest that they do not share a common site of action as allosteric modulators of [35S]TBPS and BZ receptor binding. The most potent steroid evaluated, 5 alpha-pregnan-3 alpha-ol-20-one, modulates [35S]TBPS binding at low concentrations (IC50 approximately 17 nM) in a regionally dependent manner. All [35S]TBPS binding sites appear to be functionally coupled to a steroid modulatory site. Because several of the active steroids are metabolites of progesterone, their ability to inhibit the binding of [3H]promegestrone to the cytosolic progestin receptor in rat uterus was evaluated. Those steroids showing potent activity at the GABAA receptor-Cl- ionophore were inactive at the intracellular progestin receptor. Such specificity coupled with their high potency provide additional support for the hypothesis that some of these steroids may be involved in the homeostatic regulation of brain excitability via the GABAA-BZ receptor complex

  12. HIV-1 efficient entry in inner foreskin is mediated by elevated CCL5/RANTES that recruits T cells and fuels conjugate formation with Langerhans cells.

    Zhicheng Zhou

    2011-06-01

    Full Text Available Male circumcision reduces acquisition of HIV-1 by 60%. Hence, the foreskin is an HIV-1 entry portal during sexual transmission. We recently reported that efficient HIV-1 transmission occurs following 1 h of polarized exposure of the inner, but not outer, foreskin to HIV-1-infected cells, but not to cell-free virus. At this early time point, Langerhans cells (LCs and T-cells within the inner foreskin epidermis are the first cells targeted by the virus. To gain in-depth insight into the molecular mechanisms governing inner foreskin HIV-1 entry, foreskin explants were inoculated with HIV-1-infeceted cells for 4 h. The chemokine/cytokine milieu secreted by the foreskin tissue, and resulting modifications in density and spatial distribution of T-cells and LCs, were then investigated. Our studies show that in the inner foreskin, inoculation with HIV-1-infected cells induces increased CCL5/RANTES (1.63-fold and decreased CCL20/MIP-3-alpha (0.62-fold secretion. Elevated CCL5/RANTES mediates recruitment of T-cells from the dermis into the epidermis, which is blocked by a neutralizing CCL5/RANTES Ab. In parallel, HIV-1-infected cells mediate a bi-phasic modification in the spatial distribution of epidermal LCs: attraction to the apical surface at 1 h, followed by migration back towards the basement membrane later on at 4 h, in correlation with reduced CCL20/MIP-3-alpha at this time point. T-cell recruitment fuels the continuous formation of LC-T-cell conjugates, permitting the transfer of HIV-1 captured by LCs. Together, these results reveal that HIV-1 induces a dynamic process of immune cells relocation in the inner foreskin that is associated with specific chemokines secretion, which favors efficient HIV-1 entry at this site.

  13. Choosing a mouse model to study the molecular pathobiology of Alport glomerulonephritis.

    Cosgrove, D; Kalluri, R; Miner, J H; Segal, Y; Borza, D-B

    2007-04-01

    Alport syndrome, caused by mutations that interfere with the normal assembly of the alpha3alpha4alpha5(IV) collagen network in the glomerular basement membrane (GBM), is the most common inherited glomerular disease leading to renal failure. A detailed knowledge of the underlying pathogenic mechanisms is necessary for developing new, more specific, and effective therapeutic strategies aimed at delaying the onset and slowing disease progression. Studies of several dog and mouse models of Alport syndrome have significantly enhanced our understanding of the disease mechanisms and provided systems for testing potential therapies. In the most widely used Col4a3-/- mouse models of autosomal-recessive Alport syndrome (ARAS), the genetic background strongly affects renal survival. One contributing factor may be the strong ectopic deposition of alpha5alpha6(IV) collagen in the GBM of Col4a3-/- mice on the C57BL/6J background, which is almost undetectable on the 129/Sv background. This isoform 'switch' has not been observed in human ARAS, although it had been reported in the dog model of ARAS. In human patients as well as dog and mouse models of X-linked Alport syndrome, the alpha3-alpha6(IV) collagen chains are absent from the GBM. These biochemical differences among Alport animal models provide an opportunity to determine how the molecular makeup of the GBM affects the glomerular function. At the same time, potentially confounding influences of characteristics unique to a particular strain or model should be carefully considered in the design of studies aiming to define key events underlying the pathobiology of Alport glomerular disease. PMID:17290292

  14. Structure and diversity of the T-cell receptor alpha chain in the Mexican axolotl.

    Fellah, J S; Kerfourn, F; Dumay, A M; Aubet, G; Charlemagne, J

    1997-01-01

    Polymerase chain reaction was used to isolate cDNA clones encoding putative T-cell receptor (TCR) alpha chains in an amphibian, the Mexican axolotl (Ambystoma mexicanum). Five TCRalpha-V chain-encoding segments were identified, each belonging to a separate family. The best identity scores for these axolotl TCRalpha-V segments were all provided by sequences belonging to the human TCRalpha-V1 family and the mouse TCRalpha-V3 and TCRalpha-V8 families. A total of 14 different TCRA-J segments were identified from 44 TCRA-V/TCRA-J regions sequenced, suggesting that a large repertoire of TCRA-J segments is a characteristic of most vertebrates. The structure of the axolotl CDR3 alpha chain loop is in good agreement with that of mammals, including a majority of small hydrophobic residues at position 92 and of charged, hydrophilic, or polar residues at positions 93 and 94, which are highly variable and correspond to the TCRA-V/J junction. This suggests that some positions of the axolotl CDR3 alpha chain loop are positively selected during T-cell differentiation, particularly around residue 93 that could be selected for its ability to makes contacts with major histocompatibility complex-associated antigenic peptides, as in mammals. The axolotl Calpha domain had the typical structure of mammalian and avian Calpha domains, including the charged residues in the TM segment that are thought to interact with other proteins in the membrane, as well as most of the residues forming the conserved antigen receptor transmembrane motif. PMID:9002443

  15. Rates of ubiquitin conjugation increase when muscles atrophy, largely through activation of the N-end rule pathway

    Solomon, V.; Baracos, V.; Sarraf, P.; Goldberg, A. L.

    1998-01-01

    The rapid loss of muscle mass that accompanies many disease states, such as cancer or sepsis, is primarily a result of increased protein breakdown in muscle, and several observations have suggested an activation of the ubiquitin-proteasome system. Accordingly, in extracts of atrophying muscles from tumor-bearing or septic rats, rates of 125I-ubiquitin conjugation to endogenous proteins were found to be higher than in control extracts. On the other hand, in extracts of muscles from hypothyroid rats, where overall proteolysis is reduced below normal, the conjugation of 125I-ubiquitin to soluble proteins decreased by 50%, and treatment with triiodothyronine (T3) restored ubiquitination to control levels. Surprisingly, the N-end rule pathway, which selectively degrades proteins with basic or large hydrophobic N-terminal residues, was found to be responsible for most of these changes in ubiquitin conjugation. Competitive inhibitors of this pathway that specifically block the ubiquitin ligase, E3alpha, suppressed most of the increased ubiquitin conjugation in the muscle extracts from tumor-bearing and septic rats. These inhibitors also suppressed ubiquitination in normal extracts toward levels in hypothyroid extracts, which showed little E3alpha-dependent ubiquitination. Thus, the inhibitors eliminated most of the differences in ubiquitination under these different pathological conditions. Moreover, 125I-lysozyme, a model N-end rule substrate, was ubiquitinated more rapidly in extracts from tumor-bearing and septic rats, and more slowly in those from hypothyroid rats, than in controls. Thus, the rate of ubiquitin conjugation increases in atrophying muscles, and these hormone- and cytokine-dependent responses are in large part due to activation of the N-end rule pathway.

  16. Anti-HIV activity in cervical-vaginal secretions from HIV-positive and -negative women correlate with innate antimicrobial levels and IgG antibodies.

    Mimi Ghosh

    Full Text Available We investigated the impact of antimicrobials in cervicovaginal lavage (CVL from HIV(+ and HIV(- women on target cell infection with HIV. Since female reproductive tract (FRT secretions contain a spectrum of antimicrobials, we hypothesized that CVL from healthy HIV(+ and (- women inhibit HIV infection.CVL from 32 HIV(+ healthy women with high CD4 counts and 15 healthy HIV(- women were collected by gently washing the cervicovaginal area with 10 ml of sterile normal saline. Following centrifugation, anti-HIV activity in CVL was determined by incubating CVL with HIV prior to addition to TZM-bl cells. Antimicrobials and anti-gp160 HIV IgG antibodies were measured by ELISA. When CXCR4 and CCR5 tropic HIV-1 were incubated with CVL from HIV(+ women prior to addition to TZM-bl cells, anti-HIV activity in CVL ranged from none to 100% inhibition depending on the viral strains used. CVL from HIV(- controls showed comparable anti-HIV activity. Analysis of CH077.c (clone of an R5-tropic, mucosally-transmitted founder virus viral inhibition by CVL was comparable to laboratory strains. Measurement of CVL for antimicrobials HBD2, trappin-2/elafin, SLPI and MIP3alpha indicated that each was present in CVL from HIV(+ and HIV(- women. HBD2 and MIP3alpha correlated with anti-HIV activity as did anti-gp160 HIV IgG antibodies in CVL from HIV(+ women.These findings indicate that CVL from healthy HIV(+ and HIV(- women contain innate and adaptive defense mechanisms that inhibit HIV infection. Our data suggest that innate endogenous antimicrobials and HIV-specific IgG in the FRT can act in concert to contribute toward the anti-HIV activity of the CVL and may play a role in inhibition of HIV transmission to women.

  17. a Combined Molecular Dynamics and NMR Spectroscopic Protocol for the Conformational Analysis of Oligosaccharides.

    Varma, Vikram

    A combined experimental and theoretical protocol for the conformational analysis of oligosaccharides is presented. Three disaccharides, methyl alpha - scD-mannopyranosyl-(1 to 3)-alpha- scD-mannopyranoside, methyl beta- scD-galactopyranosyl-(1 to 4)-beta- scD-glucopyranoside, and propyl beta- scD-2-acetamido -2-deoxy glucopyranosyl-(1 to 3)- alpha- scL-rhamnopyranoside, are used to evaluate a protocol for conformational analysis that makes use of molecular dynamics calculations with the CHARMM force field. Dynamics trajectories computed in vacuo and in water are used to calculate time-averaged NMR parameters such as spin-lattice relaxation times (T_1 ), Nuclear Overhauser Enhancements (NOE), and heteronuclear spin-spin coupling constants (^3J _{rm CH}). The calculated NMR parameters are then compared to experimental values and used to evaluate the computational procedure. The energetically accessible conformations are effectively sampled by the simulations. The method has been extended to the conformational analysis of higher-order oligosaccharides corresponding to the cell-wall polysaccharide of the Streptococcus Group A, and the Shigella flexneri Y O-antigen. The Streptococcus Group A cell-wall polysaccharide is comprised of a backbone of rhamnopyranosyl units connected by alternating alpha- scL-(1 to 3) and alpha- scL -(1 to 2) linkages, to which are attached N-acetyl-beta- scD-glucosamine ( beta- scD-GlcpNAc) residues at the 3 positions of the rhamnose backbone.rm A&rm B^'qquad A^'& rm Bqquad Acr[{-alpha}{-}L{-}Rha {it p}{-}(1to2){-alpha }{-}L{-}Rha{it p} {-}(1to3){-alpha}{ -}L{-}Rha{it p}-(1to2) -alpha-L-Rha{it p}{-}(1 to3){-alpha}{-}L{- }Rha{it p}{-}cr&uparrow(1 to3)&uparrow(1to3)crbeta {-}D{-}&rm Glc{it p }NAcqquadbeta{-}D{-}& rm Glc{it p}NAccr&rm C ^'&rm C] A branched trisaccharide (A^' -(C)B), a tetrasaccharide (A^' -(C)B-A), a pentasaccharide (C^' -B^'-A ^'-(C)B), and two hexasaccharides (C^'-B^ '-A^' -(C)B-A) and (A-(C^')B ^'-A^' -(C)B), have been chosen

  18. Origin and function of the multiple extracellular glucosyltransferase species from cultures of a serotype c strain of Streptococcus mutans.

    Asem, K G; Kenney, A C; Cole, J A

    1986-02-01

    Two methods were used to purify the bifunctional extracellular enzyme sucrose: (1-6)- and (1-3)-alpha-D-glucan-6-alpha-D-glucosyltransferase (EC 2.4.1.5; dextransucrase) from continuous cultures of a serotype c strain of Streptococcus mutans. The first method, based on a previously published report, involved Sepharose 6B gel filtration and DEAE cellulose anion exchange chromatography. This resulted in a dextransucrase preparation with an apparent molecular mass of 162 kDa and a specific activity of 125 mg of glucan formed from sucrose h-1 (mg of protein)-1, at 37 degrees C. It was almost homogeneous as judged by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The ratio of carbohydrate to protein was 0.14 and the recovery was 14% relative to the total glucosyltransferase activity in the original culture fluid. In the subsequently preferred method, hydroxyapatite-Ultrogel was used to purify dextransucrase with a 24% yield. The specific activity, 197 mg of glucan formed h-1 (mg of protein)-1, was the highest yet reported and this preparation contained less than 0.5 glucose-equivalent per subunit of molecular mass 162 kDa. Dextransucrase is therefore not a glycoprotein. Exogenous dextran stimulated activity, but was not essential for activity. The purified protein slowly degraded to multiple lower molecular mass forms during storage at 4 degrees C and 87% of the activity was lost after 20 days. The molecular mass of the most prominent, active degradation product was 140 kDa, similar to that of one of the multiple forms of dextransucrase detected in other laboratories. Preparations in which either the 140-kDa or the 162-kDa species predominated catalyzed the synthesis of a water-soluble glucan with sucrose alone, but catalyzed that of an insoluble glucan with sucrose and a high concentration of either (NH4)2SO4 or polyethylene glycol. The water-insoluble glucan was shown to lack sequences of 1,3-alpha-linked glycosyl residues typical of the insoluble glucan

  19. Nicotine induces fibrogenic changes in human liver via nicotinic acetylcholine receptors expressed on hepatic stellate cells

    Soeda, Junpei; Morgan, Maelle; McKee, Chad; Mouralidarane, Angelina; Lin, ChingI [University College London, Centre for Hepatology, Royal Free Hospital, London NW3 2PF (United Kingdom); Roskams, Tania [Department of Morphology and Molecular Pathology, University of Leuven (Belgium); Oben, Jude A., E-mail: j.oben@ucl.ac.uk [University College London, Centre for Hepatology, Royal Free Hospital, London NW3 2PF (United Kingdom); Department of Gastroenterology and Hepatology, Guy' s and St Thomas' Hospital, London SE1 7EH (United Kingdom)

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer Cigarette smoke may induce liver fibrosis via nicotine receptors. Black-Right-Pointing-Pointer Nicotine induces proliferation of hepatic stellate cells (HSCs). Black-Right-Pointing-Pointer Nicotine activates hepatic fibrogenic pathways. Black-Right-Pointing-Pointer Nicotine receptor antagonists attenuate HSC proliferation. Black-Right-Pointing-Pointer Nicotinic receptor antagonists may have utility as novel anti-fibrotic agents. -- Abstract: Background and aims: Cigarette smoke (CS) may cause liver fibrosis but possible involved mechanisms are unclear. Among the many chemicals in CS is nicotine - which affects cells through nicotinic acetylcholine receptors (nAChR). We studied the effects of nicotine, and involved pathways, on human primary hepatic stellate cells (hHSCs), the principal fibrogenic cells in the liver. We then determined possible disease relevance by assaying nAChR in liver samples from human non-alcoholic steatohepatitis (NASH). Methods: hHSC were isolated from healthy human livers and nAChR expression analyzed - RT-PCR and Western blotting. Nicotine induction of hHSC proliferation, upregulation of collagen1-{alpha}2 and the pro-fibrogenic cytokine transforming growth factor beta 1 (TGF-{beta}1) was determined along with involved intracellular signaling pathways. nAChR mRNA expression was finally analyzed in whole liver biopsies obtained from patients diagnosed with non-alcoholic steatohepatitis (NASH). Results: hHSCs express muscle type ({alpha}1, {beta}1, delta and epsilon) and neuronal type ({alpha}3, {alpha}6, {alpha}7, {beta}2 and {beta}4) nAChR subunits at the mRNA level. Among these subunits, {alpha}3, {alpha}7, {beta}1 and {epsilon} were predominantly expressed as confirmed by Western blotting. Nicotine induced hHSC proliferation was attenuated by mecamylamine (p < 0.05). Additionally, collagen1-{alpha}2 and TGF-{beta}1 mRNA expression were significantly upregulated by nicotine and inhibited by

  20. Glycogen synthase kinase-3 inhibition disrupts nuclear factor-kappaB activity in pancreatic cancer, but fails to sensitize to gemcitabine chemotherapy

    Aberrant activation NF-kappaB has been proposed as a mechanism of drug resistance in pancreatic cancer. Recently, inhibition of glycogen synthase kinase-3 has been shown to exert anti-tumor effects on pancreatic cancer cells by suppressing NF-kappaB. Consequently, we investigated whether inhibition of GSK-3 sensitizes pancreatic cancer cells to the chemotherapeutic agent gemcitabine. GSK-3 inhibition was achieved using the pharmacological agent AR-A014418 or siRNA against GSK-3 alpha and beta isoforms. Cytotoxicity was measured using a Sulphorhodamine B assay and clonogenic survival following exposure of six different pancreatic cancer cell lines to a range of doses of either gemcitabine, AR-A014418 or both for 24, 48 and 72 h. We measured protein expression levels by immunoblotting. Basal and TNF-alpha induced activity of NF-kappaB was assessed using a luciferase reporter assay in the presence or absence of GSK-3 inhibition. GSK-3 inhibition reduced both basal and TNF-alpha induced NF-kappaB luciferase activity. Knockdown of GSK-3 beta reduced nuclear factor kappa B luciferase activity to a greater extent than GSK-3 alpha, and the greatest effect was seen with dual knockdown of both GSK-3 isoforms. GSK-3 inhibition also resulted in reduction of the NF-kappaB target proteins XIAP, Bcl-XL, and cyclin D1, associated with growth inhibition and decreased clonogenic survival. In all cell lines, treatment with either AR-A014418, or gemcitabine led to growth inhibition in a dose- and time-dependent manner. However, with the exception of PANC-1 where drug synergy occurred with some dose schedules, the inhibitory effect of combined drug treatment was additive, sub-additive, or even antagonistic. GSK-3 inhibition has anticancer effects against pancreatic cancer cells with a range of genetic backgrounds associated with disruption of NF-kappaB, but does not significantly sensitize these cells to the standard chemotherapy agent gemcitabine. This lack of synergy might be context

  1. Role of the C-terminal YG repeats of the primer-dependent streptococcal glucosyltransferase, GtfJ, in binding to dextran and mutan.

    Kingston, Kim B; Allen, Donna M; Jacques, Nicholas A

    2002-02-01

    The recombinant primer-dependent glucosyltransferase GtfJ of Streptococcus salivarius possesses a C-terminal glucan-binding domain composed of eighteen 21 aa YG repeats. By engineering a series of C-terminal truncated proteins, the position at which truncation prevented further mutan synthesis was defined to a region of 43 aa, confirming that not all of the YG motifs were required for the formation of mutan by GtfJ. The role of the YG repeats in glucan binding was investigated in detail. Three proteins consisting of 3.8, 7.2 or 11.0 C-terminal YG repeats were expressed in Escherichia coli. Each of the three purified proteins bound to both the 1,6-alpha-linked glucose residues of dextran and the 1,3-alpha-linked glucose residues of mutan, indicating that a protein consisting of nothing but 3.8 YG repeats could attach to either substrate. Secondary structure predictions of the primary amino acid sequence suggested that 37% of the amino acids were capable of forming a structure such that five regions of beta-sheet were separated by regions capable of forming beta-turns and random coils. CD spectral analysis showed that the purified 3.8 YG protein possessed an unordered secondary structure with some evidence of possible beta-sheet formation and that the protein maintained this relatively unordered structure on binding to dextran. PMID:11832518

  2. Variation in total polyphenolics contents of aerial parts of Potentilla species and their anticariogenic activity.

    Tomczyk, Michał; Pleszczyńska, Małgorzata; Wiater, Adrian

    2010-07-01

    The aerial parts of selected Potentilla species (P. anserina, P. argentea, P. erecta, P. fruticosa, P. grandiflora, P. nepalensis, P. norvegica, P. pensylvanica, P. crantzii and P. thuringiaca) were investigated in order to determine their contents of polyphenolic compounds. The results showed that P. fruticosa has relatively high concentrations of tannins (167.3 +/- 2.0 mg/g dw), proanthocyanidins (4.6 +/- 0.2 mg/g dw) and phenolic acids (16.4 +/- 0.8 mg/g dw), as well as flavonoids (7.0 +/- 1.1 mg/g dw), calculated as quercetin. Furthermore, we investigated the in vitro inhibitory effects of aqueous extracts from these species against cariogenic Streptococcus spp. strains. It was found that the tested samples moderately inhibit the growth of oral streptococci. However, all the preparations exhibited inhibitory effects on water-insoluble alpha-(1-->3)-, alpha-(1-->6)-linked glucan (mutan) and artificial dental plaque formation. The extract from P. fruticosa showed the highest anti-biofilm activities, with minimum mutan and biofilm inhibition concentrations of 6.25-25 and 50-100 microg/mL, respectively. The results indicate that the studied Potentilla species could be a potential plant material for extracting biologically active compounds, and could become a useful supplement for pharmaceutical products as a new anticariogenic agent in a wide range of oral care products. PMID:20657382

  3. Roles of extracellular matrix in follicular development.

    Rodgers, R J; van Wezel, I L; Irving-Rodgers, H F; Lavranos, T C; Irvine, C M; Krupa, M

    1999-01-01

    The cellular biology and changes in the extracellular matrix of ovarian follicles during their development are reviewed. During growth of the bovine ovarian follicle the follicular basal lamina doubles 19 times in surface area. It changes in composition, having collagen IV alpha 1-26 and laminin alpha 1, beta 2 and gamma 1 at the primordial stage, and collagen IV alpha 1 and alpha 2, reduced amounts of alpha 3-alpha 5, and a higher content of laminin alpha 1, beta 2 and gamma 1 at the antral stage. In atretic antral follicles laminin alpha 2 was also detected. The follicular epithelium also changes from one layer to many layers during follicular growth. It is clear that not all granulosal cells have equal potential to divide, and we have evidence that the granulosal cells arise from a population of stem cells. This finding has important ramifications and supports the concept that different follicular growth factors can act on different subsets of granulosal cells. In antral follicles, the replication of cells occurs in the middle layers of the membrana granulosa, with older granulosal cells towards the antrum and towards the basal lamina. The basal cells in the membrana granulosa have also been observed to vary in shape between follicies. In smaller antral follicles, they were either columnar or rounded, and in follicles > 5 mm the cells were all rounded. The reasons for these changes in matrix and cell shapes are discussed in relation to follicular development. PMID:10692866

  4. HIF3A DNA Methylation Is Associated with Childhood Obesity and ALT.

    Shuo Wang

    Full Text Available Gene polymorphisms associated so far with body mass index (BMI can explain only 1.18-1.45% of observed variation in BMI. Recent studies suggest that epigenetic modifications, especially DNA methylation, could contribute to explain part of the missing heritability, and two epigenetic genome-wide analysis studies (EWAS have reported that Hypoxia Inducible Factor 3 Alpha Subunit (HIF3A methylation was associated with BMI or BMI change. We therefore assessed whether the HIF3A methylation is associated with obesity and other obesity-related phenotypes in Chinese children. The subjects included 110 severe obese cases aged 7-17y and 110 normal-weight controls matched by age and gender for measurement of blood DNA methylation levels at the HIF3A gene locus using the Sequenom's MassARRAY system. We observed significantly higher methylation levels in obese children than in controls at positions 46801642 and 46801699 in HIF3A gene (P<0.05, and found positive associations between methylation and alanine aminotransferase (ALT levels adjusted by gender, age and BMI at the position 46801699 (r = 0.226, P = 0.007. These results suggest that HIF3A DNA methylation is associated with childhood obesity, and has a BMI-independent association with ALT. The results provide evidence for identifying epigenetic factors of elivated ALT and may be useful for risk assessment and personalized medicine of liver diseases such as non-alcoholic fatty liver disease (NAFLD.

  5. Alpha-cluster structure and density wave in oblate nuclei

    Kanada-En'yo, Yoshiko

    2011-01-01

    Pentagon and triangle shapes in Si-28 and C-12 are discussed in relation with nuclear density wave. In the antisymmetrized molecular dynamics calculations, the $K^\\pi=5^-$ band in Si-28 and the $K^\\pi=3^-$ band in C-12 are described by the pentagon and triangle shapes, respectively. These negative-parity bands can be interpreted as the parity partners of the $K^\\pi=0^+$ ground bands and they are constructed from the parity-asymmetric-intrinsic states. The pentagon and the triangle shapes originate in 7alpha and 3alpha cluster structures, respectively. In a mean-field picture, they are described also by the static one-dimensional density wave at the edge of the oblate states. In analysis with ideal alpha cluster models using Brink-Bloch cluster wave functions and that with a simplified model, we show that the static edge density wave for the pentagon and triangle shapes can be understood by spontaneous breaking of axial symmetry, i.e., the instability of the oblate states with respect to the edge density wave....

  6. Characterization of local chemistry and disorder in synthetic and natural {alpha}-Al{sub 2}O{sub 3} materials by X-ray absorption near edge structure spectroscopy

    Mottana, A. [Rome, Univ. `Roma Tre` (Italy). Dip. di Scienze Geologiche]|[INFN, Laboratori Nazionali di Frascati, Rome (Italy); Murata, T. [Kyoto, Univ. of Education (Japan). Dept. of Physics; Marcelli, A. [INFN, Laboratori Nazionali di Frascati, Rome (Italy)] [and others

    1997-11-01

    X-ray absorption fine spectra at the Al K-edge were measured experimentally on and calculated theoretically via the multiple-scattering formalism for a chemically pure and physically perfect synthetic {alpha}-Al{sub 2}O{sub 3} ({alpha}-alumina), a natural `ruby/sapphire` (corundum) and a series of artificial `corundum` produced for technical purposes and used as geochemical standards. The Al K-edge spectra differ despite of the identical coordination (short-range arrangement) assumed by O around Al, and vary slightly in relation to the slightly different chemistries of the materials (substitutional defects) as well as on account of the location taken by foreign atoms in the structural lattices (positional defects). A quantitative treatment of the observed changes is made in terms of short-range modification of the coordination polyhedron and of medium- to long-range modifications in the overall structure; both of them induced by substitutions. In some technical `corundums`, the impurities of admixed `{beta}-alumina`, where Al is both in four- and six-fold coordination, produce another small but detectable effect on Al K-edges. Therefore, XAFS spectroscopy proves its potentials for both measuring a light element such as Al, and detecting minor coordination changes and substitutions (ca. 1{approx}3 wt.% as oxide) of the absorber by dilute other atoms, at least under favorable conditions as those occurring in this system are.

  7. Balancing omega-6 and omega-3 fatty acids in ready-to-use therapeutic foods (RUTF).

    Brenna, J Thomas; Akomo, Peter; Bahwere, Paluku; Berkley, James A; Calder, Philip C; Jones, Kelsey D; Liu, Lei; Manary, Mark; Trehan, Indi; Briend, André

    2015-01-01

    Ready-to-use therapeutic foods (RUTFs) are a key component of a life-saving treatment for young children who present with uncomplicated severe acute malnutrition in resource limited settings. Increasing recognition of the role of balanced dietary omega-6 and omega-3 polyunsaturated fatty acids (PUFA) in neurocognitive and immune development led two independent groups to evaluate RUTFs. Jones et al. (BMC Med 13:93, 2015), in a study in BMC Medicine, and Hsieh et al. (J Pediatr Gastroenterol Nutr 2015), in a study in the Journal of Pediatric Gastroenterology and Nutrition, reformulated RUTFs with altered PUFA content and looked at the effects on circulating omega-3 docosahexaenoic acid (DHA) status as a measure of overall omega-3 status. Supplemental oral administration of omega-3 DHA or reduction of RUTF omega-6 linoleic acid using high oleic peanuts improved DHA status, whereas increasing omega-3 alpha-linolenic acid in RUTF did not. The results of these two small studies are consistent with well-established effects in animal studies and highlight the need for basic and operational research to improve fat composition in support of omega-3-specific development in young children as RUTF use expands. PMID:25980919

  8. Present status of vacuum system of TARN-2

    TARN-2 is the synchrotron which was constructed after TARN-1 was disassembled, for the purpose of accelerating heavy ions, storing and cooling them. Since the beam circulating test in 1989, the experiments of acceleration, storage, electron cooling, beam taking-out and so on have been carried out, using the beams of P, D,He-3, alpha and others. The circumferential length of this ring is 78 m, but the vacuum exhaust system uses the titanium sublimation pump, ion pump and turbo molecular pump which were used for TARN-1. The mean vacuum at the time of ordinary experiment is 10-10 Torr. In 1991, for the experiment of the storage and electron cooling of heavy ion beam, the vacuum exhaust system was strengthened. The transition of the ring operation pressure is shown. The vacuum indication system was made by using PC 9800. The vacuum system of TARN-2 has been operated almost smoothly. As the problems for hereafter, the improvement of the pump system for further heightening vacuum, the uniform high temperature baking of the whole, the improvement of the transport system and others are pointed out. (K.I.)

  9. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A. [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States); Nusrat, Asma, E-mail: anusrat@emory.edu [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States)

    2010-07-02

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  10. Iron: a versatile element to produce materials for environmental applications

    Teixeira, Ana Paula C.; Araujo, Maria H.; Oliveira, Luiz C.A.; Moura, Flavia C.C.; Lago, Rochel M., E-mail: rochel@ufmg.br, E-mail: anapct@ufmg.br [Departamento de Quimica, Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil); Tristao, Juliana C. [Universidade Federal de Vicosa, Florestal, MG (Brazil); Ardisson, Jose D. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Fisica Aplicada; Amorim, Camila C., E-mail: juliana@ufv.br [Departamento de Engenharia Sanitaria e Ambiental, Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil)

    2012-09-15

    Iron is a versatile element forming several phases with different oxidation states and {sup s}tructures, such as Fe{sup 0}, FeO, Fe{sub 3}O{sub 4}, {gamma}-Fe{sub 2}O{sub 3}, {alpha}-Fe{sub 2}O{sub 3} and FeOOH. All these phases have unique physicochemical properties which can be used for different applications. In this work, it is described the use of different iron compounds, synthetic and also from natural and waste sources, in environmental and technological applications. Two main research areas are described. The first one is related to strategies to increase the reactivity of Fe phases, mainly by the formation of Fe{sup 0}/iron oxide composites and by the introduction of new metals in the iron oxide structure to promote new surface reactions. The second area is the use of the magnetic properties of some iron phases to produce versatile magnetic materials with focus in adsorption, catalysis and emulsions. (author)

  11. Determination of plutonium americium and curium in soil samples by solvent extraction with trioctylphosphine oxide

    A method of Pu, Am and Cm determination in soil samples, which was developed for analyzing samples from territories subjected to radioactive contamination as a result of the Chernobyl accident is described. After preliminary treatment the samples were leached by solution of 7 mol/l HNO23+0.3 mol/l KBrO3 during heating. Pu was isolated by extraction with 0.05 mol TOPO from 7 mol/l HNO3. 144Ce and partially remaining in water phase isotopes of Zr, U and Th were isolated in an extraction-chromatographic column with TOPO and PbO2. Then Am and Cm were extracted by 0.2 mol/l TOPO from solution 1 mol/l HLact+0.07 mol/l DTPA+1 mol/l Al(NO3)3. Alpha-activity of both extracted products was determined in liquid scintillation counter. Chemical yield of plutonium counted to 85±10%, that of americium and curium -75±10%. 17 refs

  12. Lysophospholipid presentation by CD1d and recognition by a human Natural Killer T-cell receptor

    López-Sagaseta, Jacinto; Sibener, Leah V.; Kung, Jennifer E.; Gumperz, Jenny; Adams, Erin J. (UC); (UW-MED)

    2014-10-02

    Invariant Natural Killer T (iNKT) cells use highly restricted {alpha}{beta} T cell receptors (TCRs) to probe the repertoire of lipids presented by CD1d molecules. Here, we describe our studies of lysophosphatidylcholine (LPC) presentation by human CD1d and its recognition by a native, LPC-specific iNKT TCR. Human CD1d presenting LPC adopts an altered conformation from that of CD1d presenting glycolipid antigens, with a shifted {alpha}1 helix resulting in an open A pocket. Binding of the iNKT TCR requires a 7-{angstrom} displacement of the LPC headgroup but stabilizes the CD1d-LPC complex in a closed conformation. The iNKT TCR CDR loop footprint on CD1d-LPC is anchored by the conserved positioning of the CDR3{alpha} loop, whereas the remaining CDR loops are shifted, due in part to amino-acid differences in the CDR3{beta} and J{beta} segment used by this iNKT TCR. These findings provide insight into how lysophospholipids are presented by human CD1d molecules and how this complex is recognized by some, but not all, human iNKT cells.

  13. L-Tetrahydropalamatine: A Potential New Medication for the Treatment of Cocaine Addiction

    Jia Bei, Wang; John R., Mantsch

    2013-01-01

    Levo-tetrahydropalmatine (l-THP) is an active constituent of herbal preparations containing plant species of the genera Stephania and Corydalis and has been approved and used in China for a number of clinical indications under the drug name Rotundine. The pharmacological profile of l-THP, which includes antagonism of dopamine D1 and D2 receptors and actions at dopamine D3, alpha adrenergic and serotonin receptors, suggests that it may have utility for treating cocaine addiction. In this review, we provide an overview of the pharmacological properties of l-THP and the evidence supporting its development as an anti-addiction medication. The results of preclinical work demonstrating that l-THP attenuates cocaine’s reinforcing/rewarding effects and reinstatement in rat models of cocaine relapse are summarized, and the outcomes of studies demonstrating efficacy in human addicts are described. Finally, an overview of the safety profile of l-THP is provided and challenges associated with FDA approval of l-THP are discussed. PMID:22300097

  14. Superburst Models for Neutron Stars with Hydrogen and Helium-Rich Atmospheres

    Keek, L; Zand, J J M in 't

    2012-01-01

    Superbursts are rare day-long Type I X-ray bursts due to carbon flashes on accreting neutron stars in low-mass X-ray binaries. They heat the neutron star envelope such that the burning of accreted hydrogen and helium becomes stable, and the common shorter X-ray bursts are quenched. Short bursts reappear only after the envelope cools down. We study multi-zone one-dimensional models of the neutron star envelope, in which we follow carbon burning during the superburst, and we include hydrogen and helium burning in the atmosphere above. We investigate both the case of a solar composition and a helium-rich atmosphere. This allows us to study for the first time a wide variety of thermonuclear burning behavior as well as the transitions between the different regimes in a self-consistent manner. For solar composition, burst quenching ends much sooner than previously expected. This is because of the complex interplay between the 3-alpha, hot CNO, and CNO breakout reactions. Stable burning of hydrogen and helium transi...

  15. Degradation of transuranic-contaminated wastes under geological isolation conditions

    Results of extensive experimental studies on the degradation of existing defense transuranic-contaminated (TRU) wastes are presented. Environmental conditions for waste degradation are representative of deep geological isolation of TRU wastes in a bedded-salt repository, as anticipated for the proposed Waste Isolation Pilot Plant in southeastern New Mexico. TRU-contaminated waste matrices investigated include cellulosics, plastics, rubbers, mixed organic composite, bitumen, a developmental concrete-TRU ash matrix, mild steel, and inorganic process sludges. Degradation mechanisms studied were alpha radiolysis, microbial action, thermal decomposition and dewatering, and chemical corrosion. Experimental variables are waste composition, alpha-contamination level, temperature, pressure, time, water or brine content, aerobic or anaerobic conditions, etc. Results of waste degradation are presented in terms of gas generation rates, gas compositions, container corrosion rates, effectiveness of anti-corrosion coatings, microbial formation and degradation of chelating agents. Based on experimental results, the relative quantities of gas generated by individual mechanisms acting on the organic matrix wastes can be ranked as follows: (1) microbial action, (2) thermal decomposition (at 400C and higher), (3) alpha radiolysis, and (4) corrosion. Corrosion of metallic waste canisters and realistic bedded-salt repository conditions was determined not to have a significant effect on potential waste retrievability. The technical data provided in these studies are used in assessments to determine whether existing forms of TRU wastes are acceptable for safe geological isolation. (author)

  16. Giant resonance spectroscopy of sup 4 sup 0 Ca with the (e,e'x) reaction (III): Direct versus statistical decay

    Carter, J; Helm, U; Herbert, G; Neumann-Cosel, P V; Richter, A; Schrieder, G; Strauch, S

    2001-01-01

    The present article is the third out of three on a study of the sup 4 sup 0 Ca(e,e'x) reaction discussing the role of direct and statistical contributions to the decay of the observed giant resonance strengths. The proton and alpha decay modes leading to low-lying final states in sup 3 sup 6 Ar and sup 3 sup 9 K were investigated. The branching ratios for the p sub 0 , p sub 1 sub 2 sub 3 , alpha sub 0 and alpha sub 1 channels are compared to statistical model calculations. In the excitation region of dominant isoscalar E2 strength (E sub x =12-18 MeV) good agreement is observed. Model predictions of direct E2 decay for the (alpha sub 0 +alpha sub 1)/(p sub 0 +p sub 1) ratio describe the data poorly. In the isovector E1 excitation region large excess strength is found in the population of low-lying states in sup 3 sup 9 K. A fluctuation analysis shows the direct contributions to the p sub 0 , p sub 1 channels to be >=85%. The presence of preequilibrium components is indicated by the significant nonstatistical...

  17. Measurements of the Ground-State Polarizabilities of Cs, Rb, and K using Atom Interferometry

    Gregoire, Maxwell D; Holmgren, William F; Trubko, Raisa; Cronin, Alexander D

    2015-01-01

    We measured the ground-state static electric-dipole polarizabilities of Cs, Rb, and K atoms using a three-nanograting Mach-Zehnder atom beam interferometer. Our measurements provide benchmark tests for atomic structure calculations and thus test the underlying theory used to interpret atomic parity non-conservation experiments. We measured $\\alpha_{\\mathrm{Cs}} = 4\\pi\\epsilon_0 \\times 59.45(11) \\AA^3$, $\\alpha_{\\mathrm{Rb}} = 4\\pi\\epsilon_0 \\times 47.44(9) \\AA^3$, and $\\alpha_{\\mathrm{K}} = 4\\pi\\epsilon_0 \\times 42.97(8) \\AA^3$. In atomic units, these measurements are $\\alpha_{\\mathrm{Cs}} = 401.2(7)$, $\\alpha_{\\mathrm{Rb}} = 320.1(6)$, and $\\alpha_{\\mathrm{K}} = 290.0(5)$. We report ratios of polarizabilities $\\alpha_{\\mathrm{Cs}}/\\alpha_{\\mathrm{Rb}} = 1.2532(10)$, $\\alpha_{\\mathrm{Cs}}/\\alpha_{\\mathrm{K}} = 1.3835(9)$, and $\\alpha_{\\mathrm{Rb}}/\\alpha_{\\mathrm{K}} = 1.1040(9)$ with smaller fractional uncertainty because the systematic errors for individual measurements are largely correlated. Since Cs atom...

  18. Method and apparatus for preparation of spherical metal carbonates and lithium metal oxides for lithium rechargeable batteries

    Kang, Sun-Ho; Amine, Khalil

    2008-10-14

    A number of materials with the composition Li.sub.1+xNi.sub..alpha.Mn.sub..beta.Co.sub..gamma.M'.sub..delta.O.sub.2-- zF.sub.z (M'=Mg,Zn,Al,Ga,B,Zr,Ti) for use with rechargeable batteries, wherein x is between about 0 and 0.3, .alpha. is between about 0.2 and 0.6, .beta. is between about 0.2 and 0.6, .gamma. is between about 0 and 0.3, .delta. is between about 0 and 0.15, and z is between about 0 and 0.2. Adding the above metal and fluorine dopants affects capacity, impedance, and stability of the layered oxide structure during electrochemical cycling. Another aspect of the invention includes materials with the composition Li.sub.1+xNi.sub..alpha.Co.sub..beta.Mn.sub..gamma.M'.sub..delta.O.sub.yF- .sub.z (M'=Mg,Zn,Al,Ga,B,Zr,Ti), where the x is between 0 and 0.2, the .alpha. between 0 and 1, the .beta. between 0 and 1, the .gamma. between 0 and 2, the .delta. between about 0 and about 0.2, the y is between 2 and 4, and the z is between 0 and 0.5.

  19. Gene expression analysis in cells of the dentine-pulp complex in healthy and carious teeth.

    McLachlan, Julia L; Smith, Anthony J; Sloan, Alastair J; Cooper, Paul R

    2003-04-01

    Knowledge of the molecular events that occur in carious disease has so far been constrained due to difficulties in obtaining sufficient quantities of the dental tissues and cells involved. Our histological findings indicate that a pulp-odontoblast cellular complex can be obtained from carious and healthy human teeth when exposed to low-temperatures prior to pulpal extirpation and from rodent teeth processed at room-temperature. In contrast, pulpal tissue extracted from room-temperature processed human teeth and low-temperature processed rodent teeth resulted in the odontoblast layer remaining attached to the pulp chamber. Semi-quantitative RT-PCR (sq-RT-PCR) analysis confirmed that markers previously shown to be preferentially expressed in odontoblasts, namely dentin sialophosphoprotein (DSPP) and Nestin, amplified more readily from the extracted pulp-odontoblast complex, as compared to pulpal tissue alone, in both human and rodent samples. Subsequent gene expression analysis of collagen-1alpha and collagen-3alpha indicated levels were significantly higher in carious pulpal tissue. In addition, analysis characterising the expression of members of the transforming growth factor and bone morphogenic protein families and their receptors indicated in general, that these genes were expressed by healthy odontoblasts and up-regulated in both pulpal cells and odontoblasts in response to carious injury. Use of this temperature-sensitive dental tissue preparation procedure allows detection of differential gene expression in odontoblasts and other pulpal cells in healthy and carious tissue. PMID:12663072

  20. Structural analysis of the exopolysaccharide produced by Streptococcus thermophilus ST1 solely by NMR spectroscopy

    Saewen, Elin [Arrhenius Laboratory, Stockholm University, Department of Organic Chemistry (Sweden); Huttunen, Eine; Zhang Xue [University of Helsinki, Department of Food Technology (Finland); Yang Zhennai [Northeast Agricultural Research Center of China, Center of Agro-food Technology (China); Widmalm, Goeran, E-mail: gw@organ.su.s [Arrhenius Laboratory, Stockholm University, Department of Organic Chemistry (Sweden)

    2010-06-15

    The use of lactic acid bacteria in fermentation of milk results in favorable physical and rheological properties due to in situ exopolysaccharide (EPS) production. The EPS from S. thermophilus ST1 produces highly viscous aqueous solutions and its structure has been investigated by NMR spectroscopy. Notably, all aspects of the elucidation of its primary structure including component analysis and absolute configuration of the constituent monosaccharides were carried out by NMR spectroscopy. An array of techniques was utilized including, inter alia, PANSY and NOESY-HSQC TILT experiments. The EPS is composed of hexasaccharide repeating units with the following structure: {yields} 3)[{alpha}-d-Glcp-(1 {yields} 4)]-{beta}-d-Galp-(1 {yields} 4)-{beta}-d-Glcp-(1 {yields} 4)[{beta}-d-Galf-(1 {yields} 6)]-{beta}-d-Glcp-(1 {yields} 6)-{beta}-d-Glcp-(1 {sup {yields}}, in which the residues in square brackets are terminal groups substituting backbone sugar residues that consequently are branch-points in the repeating unit of the polymer. Thus, the EPS consists of a backbone of four sugar residues with two terminal sugar residues making up two side-chains of the repeating unit. The molecular mass of the polymer was determined using translational diffusion experiments which resulted in M{sub w} = 62 kDa, corresponding to 64 repeating units in the EPS.

  1. MCAPM: All particle method generator and collision package

    MCAPM (Monte Carlo All Particle Method) is a collection of subroutines that read the data necessary for and perform the physics involved in collisions of neutrons, protons, deuterons, helium-3, alphas, and gammas with background material. These subroutines are divided into two packages. The first package, gen2000, reads the cross sections and distributions from binary libraries that describe in-flight reactions and formats them in a form appropriate for use by the second package. Libraries are organized by incident particle type, but contain information describing the attributes of all output particles. The method of tabulating cross section data depends on the incident particle type. Neutron and charged particle cross sections are multi-group; gamma cross sections are log-log interpolated from an energy grid consistent over all target elements. The second package, bang2000, uses these data to perform the collision physics. Each Monte Carlo particle possesses a discrete energy value allowing the kinematics of collisions to be performed on a continuous energy basis. The result of the kinematics is the attributes (type, number, energy, and direction) of all the particles emerging from the collision. MCAPM is modular and has been ported to a variety of platforms

  2. Ficusonic acid: a new cytotoxic triterpene isolated from Maytenus royleanus (Wall. ex M. A. Lawson) cufodontis

    Din, Ala Ud; Uddin, Ghias [Center for Phytomedicine and Medicinal Organic Chemistry, Institute of Chemical Sciences, University of Peshawar(Pakistan); Hussain, Nusrat; Choudary, Mohammad Iqbal, E-mail: allauddin77@yahoo.com [International Center for Chemical and Biological Sciences, HEJ Research Institute of Chemistry, University of Karachi (Pakistan)

    2013-04-15

    Phytochemical investigation of the roots of Maytenus royleanus resulted into the isolation of a new cytotoxic triterpene ficusonic acid, 3{beta},21{beta}-dihydroxyolean-12-en-29-oic acid, together with three known compounds, 3{alpha},22{beta}-dihydroxyolean-12-en-29-oic acid, salaspermic acid and orthosphenic acid, reported for the first time from this source. Their structures were established on the basis of extensive spectroscopic techniques. The cytotoxic activity of compound 3{beta},21{beta}-dihydroxyolean-12-en-29-oic acid was evaluated against two cancer cell lines, PC-3 prostate and HeLa cervical cancer lines. 3{beta},21{beta}-dihydroxyolean-12-en-29-oic acid showed weak activity against PC-3 (IC{sub 50} = 35.42 Greek-Small-Letter-Mu mol L{sup -1}) however against HeLa (IC{sub 50} = 20.47 Greek-Small-Letter-Mu mol L{sup -1}), its activity was moderate. (author)

  3. Skeletal muscle insulin signaling defects downstream of phosphatidylinositol 3-kinase at the level of Akt are associated with impaired nonoxidative glucose disposal in HIV lipodystrophy

    Haugaard, Steen B; Andersen, Ove; Madsbad, Sten; Frøsig, Christian; Iversen, Johan; Nielsen, Jens Ole; Wojtaszewski, Jørgen

    2005-01-01

    from 18 lipodystrophic nondiabetic patients (LIPO) and 18 nondiabetic patients without lipodystrophy (NONLIPO) before and during hyperinsulinemic (40 mU.m(-2).min(-1))-euglycemic clamps, were analyzed for insulin signaling effectors. All patients were on HAART. Both LIPO and NONLIPO patients were...... normoglycemic (4.9 +/- 0.1 and 4.8 +/- 0.1 mmol/l, respectively); however, NOGM(ins) was reduced by 49% in LIPO patients (P <0.001). NOGM(ins) correlated positively with insulin-stimulated glycogen synthase activity (I-form, P <0.001, n = 36). Glycogen synthase activity (I-form) correlated inversely with...... phosphorylation of glycogen synthase sites 2+2a (P <0.001, n = 36) and sites 3a+b (P <0.001, n = 36) during clamp. Incremental glycogen synthase-kinase-3alpha and -3beta phosphorylation was attenuated in LIPO patients (Ps <0.05). Insulin-stimulated Akt Ser473 and Akt Thr308 phosphorylation was decreased in LIPO...

  4. Skeletal muscle insulin signaling defects downstream of phosphatidylinositol 3-kinase at the level of akt are associated with impaired nonoxidative glucose disposal in HIV lipodystrophy

    Haugaard, Steen B.; Andersen, Ove; Madsbad, Sten; Frøsig, Christian; Iversen, Johan; Nielsen, Jens Ole; Wojtaszewski, Jørgen

    2005-01-01

    from 18 lipodystrophic nondiabetic patients (LIPO) and 18 nondiabetic patients without lipodystrophy (NONLIPO) before and during hyperinsulinemic (40 mU.m(-2).min(-1))-euglycemic clamps, were analyzed for insulin signaling effectors. All patients were on HAART. Both LIPO and NONLIPO patients were...... normoglycemic (4.9 +/- 0.1 and 4.8 +/- 0.1 mmol/l, respectively); however, NOGM(ins) was reduced by 49% in LIPO patients (P <0.001). NOGM(ins) correlated positively with insulin-stimulated glycogen synthase activity (I-form, P <0.001, n = 36). Glycogen synthase activity (I-form) correlated inversely with...... phosphorylation of glycogen synthase sites 2+2a (P <0.001, n = 36) and sites 3a+b (P <0.001, n = 36) during clamp. Incremental glycogen synthase-kinase-3alpha and -3beta phosphorylation was attenuated in LIPO patients (Ps <0.05). Insulin-stimulated Akt Ser473 and Akt Thr308 phosphorylation was decreased in LIPO...

  5. 异常凝血酶原和肝细胞癌%Des-gamma-carboxy-prothrombin and Hepatocellular carcinoma

    袁联文; 唐伟; 幕内·雅敏

    2002-01-01

    目前肝细胞癌(hepatocellular carcinoma,HCC)的诊断主要有影像学诊断和血清肿瘤标志物的检测.异常凝血酶原(des-gamma-carboxy-prothrombin,DCP)又被称为PIVKA-Ⅱ(protein induced by vita-min K absence or antagonist-Ⅱ),与AFP(alpha-fetoprotein)和AFP-L3(alpha-fetoprotein L3 fraction)一样被认为是一种很有价值的肝细胞癌血清肿瘤标志物.在HCC的检测诊断上,它们之间无明显相关关系,而表现为一定的互补性,结合影像学诊断,动态观测HCC高危(肝炎、肝硬化)人群,这些血清肿瘤标志物有助于HCC的早期发现,同时对HCC的手术疗效的评价、预后的估评有着一定的指导意义.

  6. In vitro metabolism of radioactive progesterone and testosterone by the gonads of the protandrous Rhabdosargus sarba at various sexual phases

    The in vitro steroidogenic capacity of the gonadal tissue in the protandrous Rhabdosargus sarba was studied. Testicular and ovarian tissues from various sexual phases were used either separately or combined. With progesterone as precursor, high yield of 5 beta-reduced metabolites, and no 11-ketotestosterone or 11 beta-hydroxytestosterone were found. The production of 5 beta-pregnan-3 alpha-ol-20-one and 5 beta-pregnane-3,20-dione was very high in incubations with testicular tissue from intersexes or males and was low in those with ovarian tissue only. The production of 17 alpha-hydroxyprogesterone was high in the female but was low in other sexual phases. With testosterone as precursor, 11-ketotestoterone and 11 beta-hydroxytestosterone were identified. 5 beta-Reductase activity was high in the male and relatively low in the female. 5 alpha-Reduced products, however, were absent. There was an increase in the production of androstenedione as the animal underwent sex reversal. The significance of this change in steroidogenesis in this protandrous fish is at present under investigation. Experimental results also indicated that in the intersexual gonad there may be interaction between the testicular component and the ovarian component in steroidgenesis

  7. Galectin-4 expression is down-regulated in response to autophagy during differentiation of rat trophoblast cells.

    Arikawa, Tomohiro; Liao, Shengjun; Shimada, Hiroki; Inoue, Tomoki; Sakata-Haga, Hiromi; Nakamura, Takanori; Hatta, Toshihisa; Shoji, Hiroki

    2016-01-01

    Placental development and trophoblast invasion of the maternal endometrium establish the maternal-fetal interface, which is critical for the developing embryo and fetus. Herein we show that overexpression of Galectin-4 (Gal-4) during trophoblast differentiation inhibited the enlargement of Rcho-1 cells (a model for rat trophoblast differentiation) and promoted cell-cell adhesion, whereas trophoblast specific markers and MMP-9 activity were not affected. In the rat placenta, microtubule associated protein 1 light chain 3 alpha (LC3) protein, an autophagy marker, is highly expressed on the maternal side of the decidua where Gal-4 expression is weak. In vitro assays showed that the expression of trophoblast-specific differentiation markers was reduced by 3-Methyladenine (3-MA) and Bafilomycin A1, known as autophagy inhibitors, compared to control cells. Furthermore, Gal-4 expression in Rcho-1 cells, which is normally down-regulated during differentiation, was not attenuated in the presence of autophagy inhibitors, suggesting that autophagy is upstream of Gal-4 expression. We herein describe a possible mechanism by which autophagy regulates trophoblast differentiation via regulation of Gal-4 expression in order to establish the maternal-fetal interface. PMID:27572741

  8. Effect of pressure on nanomaterials

    Sharma, Uma D. [Department of Physics, G.B. Pant University of Agriculture and Technology, Pantnagar-263145 (India); Kumar, M., E-mail: munish_dixit@yahoo.co [Department of Physics, G.B. Pant University of Agriculture and Technology, Pantnagar-263145 (India)

    2010-07-01

    A simple theory is proposed to predict the effect of pressure on nanomaterials, which gets support from the Mie-Gruneisen theory of thermal expansivity as formulated by Born and Huang. We considered LiAlSi{sub 2}O{sub 6} to study the effect of pressure in the light of other formulations, viz. Murnaghan, Birch-Murnaghan, Vinet and Kumar. The results obtained are found to present a good agreement with the experimental data as well as other formulations. To confirm the validity of the formulation, we applied the method to study the compression behaviour of a number of nanomaterials, viz. CdSe, Rb{sub 3}C{sub 60}, Ni(20 nm), carbon nanotube, {gamma}-Fe{sub 2}O{sub 3}, {epsilon}-Fe (Hexagonal iron), MgO, CuO, {gamma}-Al{sub 2}O{sub 3} (67 nm), {alpha}-Fe{sub 2}O{sub 3}, {alpha}-Fe (filled nanotube), TiO{sub 2} (anatase), 3C-SiC (30 nm), TiO{sub 2} (rutile phase), Zr{sub 0.1}Ti{sub 0.9}O{sub 2}, AlN (hexagonal), {gamma}-Si{sub 3}N{sub 4}, Ni-filled MWCNT and Fe-filled MWCNT. The results obtained are compared with the experimental data. A good agreement between theory and experiment demonstrates the validity of the present approach.

  9. Analysis of equation of state for nanomaterials

    Sharma, Uma D., E-mail: uma_sharma18@yahoo.co [Department of Physics, G.B. Pant University of Agriculture and Technology, Pantnagar 263145 (India); Kumar, Munish, E-mail: munish_dixit@yahoo.co [Department of Physics, G.B. Pant University of Agriculture and Technology, Pantnagar 263145 (India)

    2011-02-15

    An equation of state (EOS) recently proposed for nanomaterials is discussed critically. Different possible forms of the EOS are discussed with their correlations. We have considered 20 nanomaterials for this purpose, viz. CdSe, Rb{sub 3}C{sub 60}, carbon nanotube, {gamma}-Fe{sub 2}O{sub 3}, {epsilon}-Fe (hexagonal iron), MgO, {gamma}-Al{sub 2}O{sub 3} (67 nm), {alpha}-Fe{sub 2}O{sub 3}, {alpha}-Fe (filled nanotube), TiO{sub 2} (anatase), 3C-SiC (30 nm), TiO{sub 2} (rutile phase), Zr{sub 0.1}Ti{sub 0.9}O{sub 2}, {gamma}-Si{sub 3}N{sub 4}, Ni-filled MWCNT, Fe-filled MWCNT, CeO{sub 2} (cubic fluorite phase and orthorhombic phase), germanium (49 nm), GaN (wurtzite phase) and SnO{sub 2} (rutile phase) (14 nm). It is found that the change in the form of EOS does not improve the results. This demonstrates the validity of the EOS proposed for nanomaterials. The EOS is also used to study the effect of temperature on compression of Ni (20 nm). It is found that there is small shift in isotherm due to increase in the temperature. The results have been found to present a good agreement with the available experimental data.

  10. Assessing seasonal and spatial trends of persistent organic pollutants (POPs) in Indian agricultural regions using PUF disk passive air samplers

    Pozo, Karla [Atmospheric Science and Technology Directorate, Environment Canada, 4905 Dufferin Street, Toronto, Ontario M3H 5T4 (Canada); Environmental Science Department, University of Siena, Via Mattioli 4, 53100 Siena (Italy); Harner, Tom, E-mail: tom.harner@ec.gc.c [Atmospheric Science and Technology Directorate, Environment Canada, 4905 Dufferin Street, Toronto, Ontario M3H 5T4 (Canada); Lee, Sum Chi [Atmospheric Science and Technology Directorate, Environment Canada, 4905 Dufferin Street, Toronto, Ontario M3H 5T4 (Canada); Sinha, Ravindra K. [Centre for Environmental Science, School of Earth Biological and Environmental Sciences, Central University of Bihar, Patna (India); Sengupta, B. [Central Pollution Control Board, Parivesh Bhavan, East Arjun Nagar, Delhi (India); Loewen, Mark [Freshwater Institute, Department of Fisheries and Oceans, Winnipeg, Manitoba (Canada); Geethalakshmi, V. [Department of Agricultural Meteorology, Tamil Nadu Agricultural University, Coimbatore, Tamil Nadu (India); Kannan, Kurunthachalam [Wadsworth Center, New York State Department of Health and Department of Environmental Health Sciences, State University of New York at Albany, New York (United States); Volpi, Valerio [Environmental Science Department, University of Siena, Via Mattioli 4, 53100 Siena (Italy)

    2011-02-15

    The first survey of persistent organic pollutant (POP) concentrations in air across several Indian agricultural regions was conducted in 2006-2007. Passive samplers comprising polyurethane foam (PUF) disks were deployed on a quarterly basis at seven stations in agricultural regions, one urban site and one background site. The project was conducted as a sub-project of the Global Atmospheric Passive Sampling (GAPS) Network. In addition to revealing new information on air concentrations of several organochlorine pesticides (OCPs) and polychlorinated biphenyls (PCBs), the study has demonstrated the feasibility of conducting regional-scale monitoring for POPs in India using PUF disk samplers. The following analytes were detected with relatively high concentrations in air (mean for 2006 and 2007, pg/m{sup 3}): {alpha}- and {gamma}-hexachlorocyclohexane (HCH) (292 and 812, respectively); endosulfan I and II (2770 and 902, respectively); p,p'-DDE and p,p'-DDT (247 and 931, respectively); and for the sum of 48 PCBs, 12,100 (including a site with extremely high air concentrations in 2007) and 972 (when excluding data for this site). - New data on air concentrations of POPs across Indian agricultural regions is generated using cost-effective passive air samplers.

  11. Kocuria halotolerans sp. nov., an actinobacterium isolated from a saline soil in China.

    Tang, Shu-Kun; Wang, Yun; Lou, Kai; Mao, Pei-Hong; Xu, Li-Hua; Jiang, Cheng-Lin; Kim, Chang-Jin; Li, Wen-Jun

    2009-06-01

    A Gram-positive actinobacterium, designated strain YIM 90716(T), was isolated from a saline soil sample collected from Ganjiahu Suosuo Forest National Nature Reserve in Xinjiang Province, north-west China. The new isolate contained lysine, glutamic acid and alanine with peptidoglycan type Lys-Ala(3) (variation A3alpha). The major phospholipids were phosphatidylglycerol and diphosphatidylglycerol. The predominant menaqinone was MK-7(H(2)). The major fatty acids were anteiso-C(15 : 0), iso-C(16 : 0) and anteiso-C(17 : 0). The DNA G+C content of strain YIM 90716(T) was 68.0 mol%. Chemotaxonomic properties supported the affiliation of strain YIM 90716(T) to the genus Kocuria. Phylogenetic analysis based on 16S rRNA gene sequences revealed that the organism was related most closely to Kocuria kristinae DSM 20032(T) (96.8 % similarity) and showed lower levels of 16S rRNA gene similarity (Kocuria. The results of fatty acid analysis and physiological and biochemical tests allowed the genotypic and phenotypic differentiation of strain YIM 90716(T) from its closest relatives. On the basis of data from the present polyphasic study, strain YIM 90716(T) is considered to represent a novel species of the genus Kocuria, for which the name Kocuria halotolerans sp. nov. is proposed. The type strain is YIM 90716(T) (=DSM 18442(T)=KCTC 19172(T)=CCTCC AB 206069(T)). PMID:19502308

  12. A more general Dark Energy model and the current observational constraints

    Chen, Songbai

    2009-01-01

    We present a more general dark energy model in which the density of dark energy is a function of the Hubble parameter $H$ and its derivative with respect to time $\\dot{H}$ (i.e, $\\rho_{de}=3\\alpha \\dot{H}+3\\beta H^2$). The behavior of the dark energy and the expansion history of the Universe depend heavily on the parameters of the model $\\alpha$ and $\\beta$. This model can be reduced to the cosmology constant and the holographic Ricci dark energy. The constraints on the dark energy model has been studied by using the latest observational data including the Union sample of 307 Type Ia supernovae (SNIa), the shift parameter of the cosmic microwave background (CMB) given by the five-year Wilkinson Microwave Anisotropy Probe (WMAP) observations, and the baryon acoustic oscillation (BAO) measurement from the Sloan Digital Sky Survey (SDSS). The combined analysis gives the best-fit results (with $1\\sigma$ uncertainty): $\\alpha=0.586^{+0.142}_{-0.115}$ and $\\beta=0.949^{+0.151}_{-0.110}$. Moreover, we also examine t...

  13. Spectral properties of large gradual solar energetic particle events - II -Systematic Q/M-dependence of heavy ion spectral breaks

    Desai, M I; Dayeh, M A; Ebert, R W; McComas, D J; Li, G; Cohen, C M S; Mewaldt, R A; Schwadron, N A; Smith, C W

    2016-01-01

    We fit the $\\sim$0.1-500 MeV/nucleon H-Fe spectra in 46 large SEP events surveyed by Desai et al. (2016) with the double power-law Band function to obtain a normalization constant, low- and high-energy parameters $\\gamma_a$ and $\\gamma_b$; and break energy $E_B$. We also calculate the low-energy power-law spectral slope $\\gamma_1$. We find that: 1) $\\gamma_a$, $\\gamma_1$, and $\\gamma_b$ are species-independent within a given SEP event, and the spectra steepen with increasing energy; 2) $E_B$'s are well ordered by Q/M ratio, and decrease systematically with decreasing Q/M, scaling as (Q/M)$^\\alpha$ with $\\alpha$ varying between $\\sim$0.2-3; 3) $\\alpha$ is well correlated with Fe/O at $\\sim$0.16-0.23 MeV/nucleon and CME speed; 4) In most events: $\\alpha$3; and 5) Seven out of 9 extreme SEP events (associated with faster CMEs and GLEs) are Fe-rich, have $\\alpha >$1.4, have flatter spectra at low and high energies with $\\gamma_b$-$\\gamma_a <$3. The species-independence of $\\gamma_a$, $\\gamma_1$, and $\\gamma_b$...

  14. Integrin alpha3beta1, a novel receptor for alpha3(IV) noncollagenous domain and a trans-dominant Inhibitor for integrin alphavbeta3.

    Borza, Corina M; Pozzi, Ambra; Borza, Dorin-Bogdan; Pedchenko, Vadim; Hellmark, Thomas; Hudson, Billy G; Zent, Roy

    2006-07-28

    Exogenous soluble human alpha3 noncollagenous (NC1) domain of collagen IV inhibits angiogenesis and tumor growth. These biological functions are attributed to the binding of alpha3NC1 to integrin alphavbeta3. However, in some tumor cells that express integrin alphavbeta3, the alpha3NC1 domain does not inhibit proliferation, suggesting that integrin alphavbeta3 expression is not sufficient to mediate the anti-tumorigenic activity of this domain. Therefore, in the present study, we searched for novel binding receptors for the soluble alpha3NC1 domain in cells lacking alphavbeta3 integrin. In these cells, soluble alpha3NC1 bound integrin alpha3beta1; however, unlike alphavbeta3, alpha3beta1 integrin did not mediate cell adhesion to immobilized alpha3NC1 domain. Interestingly, in cells lacking integrin alpha3beta1, adhesion to the alpha3NC1 domain was enhanced due to activation of integrin alphavbeta3. These findings indicate that integrin alpha3beta1 is a receptor for the alpha3NC1 domain and transdominantly inhibits integrin alphavbeta3 activation. Thus integrin alpha3beta1, in conjunction with integrin alphavbeta3, modulates cellular responses to the alpha3NC1 domain, which may be pivotal in the mechanism underpinning its anti-angiogenic and anti-tumorigenic activities. PMID:16731529

  15. Polyunsaturated fatty acid-enriched diet therapy for a child with epilepsy.

    Yoon, Jung-Rim; Lee, Eun Joo; Kim, Heung Dong; Lee, Jae Hwan; Kang, Hoon-Chul

    2014-02-01

    The ketogenic diet (KD) is a high-fat, low-carbohydrate diet with an established efficacy for treating medically refractory epilepsy in children. Fatty acids are the most important constituent of the KD in all aspects of efficacy and complications. Among fatty acids, polyunsaturated fatty acids (PUFAs) increase anticonvulsant properties and reduce the complications associated with the high-fat diet. Here, we report a 7-year-old boy with Lennox-Gastaut syndrome combined with mitochondrial respiratory chain complex I deficiency, whose medically intractable seizures have been successfully controlled with a PUFA-enriched modified Atkins diet without any significant adverse events. The diet consists of canola oil and diverse menu items like fish and nuts instead of olive oil and has an ideal 1:2.8 ratio of omega-3 to omega-6. In addition, fractionation of this boy's plasma showed normal levels of fatty acids, including omega-3 (alpha-linoleic acid, eicosapentaenoic acid) and omega-6 (linoleic acid, arachidonic acid) as well as monounsaturated fatty acids (oleic acid). Plasma docosahexanoic acid remained low after PUFA-enriched diet therapy. PUFA-enriched diet therapy is likely to increase the efficacy of diet therapy and reduce complications of a high-fat diet in children with refractory epilepsy. PMID:23465587

  16. Relatedness of Indian flax genotypes (Linum usitatissimum L.): an inter-simple sequence repeat (ISSR) primer assay.

    Rajwade, Ashwini V; Arora, Ritu S; Kadoo, Narendra Y; Harsulkar, Abhay M; Ghorpade, Prakash B; Gupta, Vidya S

    2010-06-01

    The objective of this study was to analyze the genetic relationships, using PCR-based ISSR markers, among 70 Indian flax (Linum usitatissimum L.) genotypes actively utilized in flax breeding programs. Twelve ISSR primers were used for the analysis yielding 136 loci, of which 87 were polymorphic. The average number of amplified loci and the average number of polymorphic loci per primer were 11.3 and 7.25, respectively, while the percent loci polymorphism ranged from 11.1 to 81.8 with an average of 63.9 across all the genotypes. The range of polymorphism information content scores was 0.03-0.49, with an average of 0.18. A dendrogram was generated based on the similarity matrix by the Unweighted Pair Group Method with Arithmetic Mean (UPGMA), wherein the flax genotypes were grouped in five clusters. The Jaccard's similarity coefficient among the genotypes ranged from 0.60 to 0.97. When the omega-3 alpha linolenic acid (ALA) contents of the individual genotypes were correlated with the clusters in the dendrogram, the high ALA containing genotypes were grouped in two clusters. This study identified SLS 50, Ayogi, and Sheetal to be the most diverse genotypes and suggested their use in breeding programs and for developing mapping populations. PMID:20195799

  17. Solid phase microextraction of volatile constituents from individual fresh Eucalyptus leaves of three species.

    Betts, T J

    2000-03-01

    Methyl polysiloxane solid-phase microextraction fibres were used for ten minutes to adsorb volatile constituents from headspace above all or part of a single cut up fresh eucalyptus leaf kept warm at 37 degrees C. The fibres were desorbed at 200 degrees C for programmed gas chromatography (40-187 degrees C) on a methyl polysiloxane capillary. Substances were identified by mass spectra and/or authentic sample retention. Results do not correspond to published values for steam distilled oils, being richer in sesquiterpenes, of which three are common to three different species; and also in esters in two species. Five Eucalyptus citriodora leaves from the same tree over different months gave very similar analyses to a fibre in 10 min of 72.9-80.5% citronellal, 3.5-5.4% citronellol, 1.0-3.8% citronellyl acetate, 9.2-11.8% caryophyllene and 1.4-1.7% bicyclogermacrene. Six E. nicholii leaves yielded 67.2-73.7% cineole and 4.6-9.7% limonene along with 10.5-16.5% sesquiterpenes, mostly hydrocarbons, particularly bicyclogermacrene. E. globulus leaves gave only 54.0-61.3% cineole, with 19.5-24.3% alpha-pinene, 6.7-9.1% limonene and 2.1-5.4% alpha-terpinyl acetate; along with 3.6-7.7% sesquiterpenes, particularly aromadendrene, but no bicyclogermacrene. PMID:10763604

  18. An Alpha Motif at Tas3C Terminus Mediates RITS Cis Spreading and Promotes Heterochromatic Gene Silencing

    Li, H.; Motamedi, M; Yip, C; Wang, Z; Walz, T; Patel, D; Moazed, D

    2009-01-01

    RNA interference (RNAi) plays a pivotal role in the formation of heterochromatin at the fission yeast centromeres. The RNA-induced transcriptional silencing (RITS) complex, composed of heterochromatic small interfering RNAs (siRNAs), the siRNA-binding protein Ago1, the chromodomain protein Chp1, and the Ago1/Chp1-interacting protein Tas3, provides a physical tether between the RNAi and heterochromatin assembly pathways. Here, we report the structural and functional characterization of a C-terminal Tas3 {alpha}-helical motif (TAM), which self-associates into a helical polymer and is required for cis spreading of RITS in centromeric DNA regions. Site-directed mutations of key residues within the hydrophobic monomer-monomer interface disrupt Tas3-TAM polymeric self-association in vitro and result in loss of gene silencing, spreading of RITS, and a dramatic reduction in centromeric siRNAs in vivo. These results demonstrate that, in addition to the chromodomain of Chp1 and siRNA-loaded Ago1, Tas3 self-association is required for RITS spreading and efficient heterochromatic gene silencing at centromeric repeat regions.

  19. Parametric Evaluation of Thin, Transonic Circulation-Control Airfoils

    Schlecht, Robin; Anders, Scott

    2007-01-01

    Wind-tunnel tests were conducted in the NASA Langley Transonic Dynamics Tunnel on a 6 percent-thick, elliptical circulation-control airfoil with upper-surface and lower-surface blowing capability. Results for elliptical Coanda trailing-edge geometries, biconvex Coanda trailing-edge geometries, and leading-edge geometries are reported. Results are presented at subsonic and transonic Mach numbers of 0.3 and 0.8, respectively. When considering one fixed trailing-edge geometry, for both the subsonic and transonic conditions it was found that the [3.0:1] ratio elliptical Coanda surface with the most rounded leading-edge [03] performed favorably and was determined to be the best compromise between comparable configurations that took advantage of the Coanda effect. This configuration generated a maximum. (Delta)C(sub 1) = 0.625 at a C(sub mu) = 0.06 at M = 0.3, alpha = 6deg. This same configuration generated a maximum (Delta)C(sub 1) = 0.275 at a C(sub mu) = 0.0085 at M = 0.8, alpha = 3deg.

  20. Roles of Wnt/{beta}-catenin signaling in epithelial differentiation of mesenchymal stem cells

    Wang, Yajing; Sun, Zhaorui; Qiu, Xuefeng [Immunology and Reproductive Biology Laboratory, Medical College of Nanjing University, Nanjing 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing 210093 (China); Li, Yan [Jiangsu Centers for Diseases Prevention and Control, Nanjing 210009 (China); Qin, Jizheng [Immunology and Reproductive Biology Laboratory, Medical College of Nanjing University, Nanjing 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing 210093 (China); Han, Xiaodong, E-mail: hanxd@nju.edu.cn [Immunology and Reproductive Biology Laboratory, Medical College of Nanjing University, Nanjing 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing 210093 (China)

    2009-12-25

    Bone marrow-derived mesenchymal stem cells (MSCs) have been demonstrated to be able to differentiate into epithelial lineage, but the precise mechanisms controlling this process are unclear. Our aim is to explore the roles of Wnt/{beta}-catenin in the epithelial differentiation of MSCs. Using indirect co-culture of rat MSCs with rat airway epithelial cells (RTE), MSCs expressed several airway epithelial markers (cytokeratin 18, tight junction protein occudin, cystic fibrosis transmembrance regulator). The protein levels of some important members in Wnt/{beta}-catenin signaling were determined, suggested down-regulation of Wnt/{beta}-catenin with epithelial differentiation of MSCs. Furthermore, Wnt3{alpha} can inhibit the epithelial differentiation of MSCs. A loss of {beta}-catenin induced by Dickkopf-1 can enhance MSCs differentiation into epithelial cells. Lithium chloride transiently activated {beta}-catenin expression and subsequently decreased {beta}-catenin level and at last inhibited MSCs to differentiate into airway epithelium. Taken together, our study indicated that RTE cells can trigger epithelial differentiation of MSCs. Blocking Wnt/{beta}-catenin signaling may promote MSCs to differentiate towards airway epithelial cells.

  1. Hot accretion flow with radiative cooling: state transitions in black hole X-ray binaries

    Wu, Mao-Chun; Yuan, Ye-Fei; Gan, Zhao-Ming

    2016-01-01

    We investigate state transitions in black hole X-ray binaries through different parameters by using two-dimensional axisymmetric hydrodynamical simulation method. For radiative cooling in hot accretion flow, we take into account the bremsstrahlung, synchrotron and synchrotron-self Comptonization self-consistently in the dynamics. Our main result is that the state transitions occur when the accretion rate reaches a critical value $\\dot M \\sim 3\\alpha\\ \\dot M_{\\rm Edd}$, above which cold and dense clumpy/filamentary structures are formed, embedded within the hot gas. We argued this mode likely corresponds to the proposed two-phase accretion model, which may be responsible for the intermediate state of black hole X-ray binaries. When the accretion rate becomes sufficiently high, the clumpy/filamentary structures gradually merge and settle down onto the mid-plane. Eventually the accretion geometry transforms to a disc-corona configuration. In summary our results are consistent with the truncated accretion scenari...

  2. What do we really know about the ubiquitin-proteasome pathway in muscle atrophy?

    Jagoe, R. T.; Goldberg, A. L.

    2001-01-01

    Studies of many different rodent models of muscle wasting have indicated that accelerated proteolysis via the ubiquitin-proteasome pathway is the principal cause of muscle atrophy induced by fasting, cancer cachexia, metabolic acidosis, denervation, disuse, diabetes, sepsis, burns, hyperthyroidism and excess glucocorticoids. However, our understanding about how muscle proteins are degraded, and how the ubiquitin-proteasome pathway is activated in muscle under these conditions, is still very limited. The identities of the important ubiquitin-protein ligases in skeletal muscle, and the ways in which they recognize substrates are still largely unknown. Recent in-vitro studies have suggested that one set of ubquitination enzymes, E2(14K) and E3(alpha), which are responsible for the 'N-end rule' system of ubiquitination, plays an important role in muscle, especially in catabolic states. However, their functional significance in degrading different muscle proteins is still unclear. This review focuses on the many gaps in our understanding of the functioning of the ubiquitin-proteasome pathway in muscle atrophy, and highlights the strengths and limitations of the different experimental approaches used in such studies.

  3. Radioimmunoassay of steroids in homogenates and subcellular fractions of testicular tissue

    Radioimmunoassays for testosterone (T), dihydrotestosterone (DHT) and 5alpha-androstan-3alpha, 17beta-diol (DIOL) in homogenates of whole testis, interstitial tissue and seminiferous tubules as well as subcellular fractions of the latter were developed. Steroids were extracted with acetone, submitted to several solvent partitions and isolated by a celite: propylene glycol: ethylene glycol column chromatography. Anit-T serum was used for the assay of T and DTH, and a specific anti-Diol serum for DIOL. Subcellular fractions were separated by differential centrifugation. The nuclear fraction was purified by centrifugation in a dense sucrose buffer followed by several washings. Losses were corrected according to recovery of DNA. Optimal conditions for purification of acetone extracts at minimal losses were established. Validation of the method was studied testing linear regression of logit-log transformations of standard curves and parallelism with unknowns. T was the steroid present in higher concentrations in all samples studied. It is concluded that the present method for determination of endogenous androgen concentrations in testicular tissue is valid and might be useful in studing testicular function. (orig.)

  4. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  5. Breathing-like excited state of the Hoyle state in ${^{12}{\\rm C}}$

    Zhou, Bo; Horiuchi, Hisashi; Ren, Zhongzhou

    2016-01-01

    The existence of the $0_3^+$ and $0_4^+$ states around 10 MeV excitation energy in ${^{12}{\\rm C}}$ is confirmed by a fully microscopic 3$\\alpha$ cluster model. Firstly, a GCM (generator coordinate method) calculation is performed by superposing optimized 2$\\alpha$+$\\alpha$ THSR (Tohsaki-Horiuchi-Schuck-R\\"{o}pke) wave functions with the radius-constraint method. The obtained two excited $0^+$ states above the Hoyle state are consistent with the recently observed states by experiment. Secondly, a variational calculation using the single 2$\\alpha$+$\\alpha$ THSR wave function orthogonalized to the ground and Hoyle states is made and it also supports the existence of the $0_3^+$ state obtained by the GCM calculation. The analysis of the obtained $0_3^+$ state is made by studying its 2$\\alpha$-$\\alpha$ reduced width amplitude, its 2$\\alpha$ correlation function, and the large monopole matrix element between this state and the Hoyle state, which shows that this $0_3^+$ state is a breathing-like excited state of th...

  6. La filière lin oléagineux française : panorama et perspectives

    Labalette Françoise

    2011-05-01

    Full Text Available Linseed oil crop production does not succeed in reaching stable acreage in France and does not meet the demand coming from users which incorporate linseeds, which display high content in omega 3 (alpha-linolenic acid, in animal feeding in order to deliver food enriched in omega 3 by natural way (dairy products, eggs, ham.... However, several driving forces should encourage this crop, like the shortfall in linseeds in the European Union and the environmental changes expected from agriculture. That is why the French oilseed crop organisation (Onidol and the French technical institute for oilseed crops (Cetiom launched in 2008 a study about the linseed situation in France. Aim of this work was to get a better understanding of each stage of the linseed chain production from the linseed cultivation to the users and to draw perspectives for the future of this crop in France. To do that a large survey was carried out according to methods adapted to each considered sector. A great attention was given to the progress of the variety offer because the yield gap between linseed and other crops in the rotation is probably one of the most important factors explaining the crop stagnation in France. The synthesis presented in the present paper allows identifying encouraging signals for the future and points the major drawbacks to overcome and the main advantages to take advantage from for developing linseed in France.

  7. Preparations for parasitic production of biomedically useful positron-emitters

    The rebuilding of the old GWI-machine into a sector-focussing synchrocyclotron will hopefully be completed within 1985. External beams of protons, deuterons, Helium-3, alpha-particles and heavier ions will be available for physics and biomedical research, and also for direct radionuclide production (e.g. 40 μA of protons 45-110 MeV, less for higher energy protons). This being the principal Swedish accelerator undertaking of the eighties, the authors foresee, however, some difficulties in getting enough beamtime for the increasing demand for cyclotron-produced medical radionuclides (for PET-work etc.) Possibilities for parasitic production are therefore investigated. One example is given by the 11C-production by protons in the cooling water of planned spallation neutron sources and targets for the production of thermal neutrons (reaction: (p,3p3n) on oxygen). The extraction of 11C from cooling water was successfully tested at the thermal neutron facility of TRIUMF. These experiences are used in the construction of water beam dumps with provisions for extraction of medically useful, positron-emitting radionuclides during for instance (n,p) - experiments

  8. Triple tracks in CR-39 as the result of Pd-D Co-deposition: evidence of energetic neutrons.

    Mosier-Boss, Pamela A; Szpak, Stanislaw; Gordon, Frank E; Forsley, Lawrence P G

    2009-01-01

    Since the announcement by Fleischmann and Pons that the excess enthalpy generated in the negatively polarized Pd-D-D(2)O system was attributable to nuclear reactions occurring inside the Pd lattice, there have been reports of other manifestations of nuclear activities in this system. In particular, there have been reports of tritium and helium-4 production; emission of energetic particles, gamma or X-rays, and neutrons; as well as the transmutation of elements. In this communication, the results of Pd-D co-deposition experiments conducted with the cathode in close contact with CR-39, a solid-state nuclear etch detector, are reported. Among the solitary tracks due to individual energetic particles, triple tracks are observed. Microscopic examination of the bottom of the triple track pit shows that the three lobes of the track are splitting apart from a center point. The presence of three alpha-particle tracks outgoing from a single point is diagnostic of the (12)C(n,n')3alpha carbon breakup reaction and suggests that DT reactions that produce > or = 9.6 MeV neutrons are occurring inside the Pd lattice. To our knowledge, this is the first report of the production of energetic (> or = 9.6 MeV) neutrons in the Pd-D system. PMID:18828003

  9. Regulation of nicotinic receptor subtypes following chronic nicotinic agonist exposure in M10 and SH-SY5Y neuroblastoma cells

    Warpman, U; Friberg, L; Gillespie, A; Hellström-Lindahl, E; Zhang, X; Nordberg, Ana

    1998-01-01

    The present study further investigated whether nicotinic acetylcholine receptor (nAChR) subtypes differ in their ability to up-regulate following chronic exposure to nicotinic agonists. Seven nicotinic agonists were studied for their ability to influence the number of chick alpha4beta2 n......AChR binding sites stably transfected in fibroblasts (M10 cells) following 3 days of exposure. The result showed a positive correlation between the Ki values for binding inhibition and EC50 values for agonist-induced alpha4beta2 nAChR up-regulation. The effects of epibatidine and nicotine were further...... investigated in human neuroblastoma SH-SY5Y cells (expressing alpha3, alpha5, beta2, and beta4 nAChR subunits). Nicotine exhibited a 14 times lower affinity for the nAChRs in SH-SY5Y cells as compared with M10 cells, whereas epibatidine showed similar affinities for the nAChRs expressed in the two cell lines...

  10. Efecto de diferentes plaguicidas sobre el crecimiento de Azotobacter chroococcum

    Diego Rivera

    2010-06-01

    dichlorovinyl-2,2-dimethylcyclopropane carboxylate (RS-cyano-3-phenoxybenzyl; S-metolachlor:(S-2-chloro-N-(2-ethyl-6-methyl-phenyl-N-(2-methoxy-1-methyl-ethyl-acetamide; Fluometuron: 1,1-dimethyl-3 (alpha, alpha, alpha-trifluoro-m-tolyl urea and Glyphosate: (N-(phosphonomethyl glycine on the viability of biological inoculant Monibac ® - Corpoica whose active ingredient is based on non-symbiotic diazotrophic bacteria Azotobacter chroococcum AC1, applying the minimum inhibitory concentration and compatibility techniques. The results demonstrated the susceptibility of the organism Cypermethrin 50% and when it is mixed with other pesticides in the rate used in the field regularly. It was found that there were no significant effects (P< 0,05 of pesticides (Carboxin, Thiram, Imidacloprid, S-metolachlor, Fluometuron and Glyphosate under the different concentrations tested suggesting that this bacterium is able to tolerate these chemicals by different physiological mechanisms without affecting their growth in laboratory level. Key words: Azotobacter chroococcum, agrochemicals, bacteria, biofertilizer, inhibition

  11. Radio recombination lines from obscured quasars with the SKA

    Manti, Serena; Ferrara, Andrea; Feruglio, Chiara; Graziani, Luca; Bernardi, Gianni

    2015-01-01

    We explore the possibility of detecting hydrogen radio recombination lines from 0 < z < 10 quasars. We compute the expected Hnalpha flux densities as a function of absolute magnitude and redshift by considering (i) the range of observed AGN spectral indices from UV to X-ray bands, (ii) secondary ionizations from X-ray photons, and (iii) stimulated emission due to nonthermal radiation. All these effects are important to determine the line fluxes. We find that the combination of slopes: alpha_X,hard = -1.11, alpha_X,soft = -0.7, alpha_EUV = -1.3, alpha_UV = -1.7, maximizes the expected flux, f_Hnalpha = 10 microJy for z = 7 quasars with M_AB = -27 in the n = 50 lines; allowed SED variations produce variations by a factor of 3 around this value. Secondaries boost the line intensity by a factor of 2 to 4, while stimulated emission in high-z quasars with M_AB = -26 provides an extra boost to RRL flux observed at nu = 1 GHz if recombinations arise in HII regions with T_e = 10^3-5 K, n_e = 10^3-5 cm^-3. We com...

  12. Loss of GSK-3 Causes Abnormal Astrogenesis and Behavior in Mice.

    Jung, Eui-Man; Ka, Minhan; Kim, Woo-Yang

    2016-08-01

    Altered activity of glycogen synthase kinase-3 (GSK-3) is associated with psychiatric diseases and neurodegenerative diseases. GSK-3 is a key regulator in multiple aspects of neuronal differentiation in the brain. However, little is known about the role of GSK-3 in astrocyte development. To examine the role of GSK-3 in astrocytes, we generated a conditional knockout mouse using a glial fibrillary acidic protein (GFAP)-cre driver, in which the GSK-3 alpha and beta genes are deleted in astrocytes. We found that GFAP-cre-mediated GSK-3 deletion led to a larger brain. The number and size of astrocytes were increased in GSK-3 mutant brains. The levels of GFAP and phospho-STAT3, indicators of astrogenesis, were elevated in GSK-3 mutants. Furthermore, we found upregulation of astrocyte regulatory molecules such as phospho-AKT, phospho-S6, and cyclin D in GSK-3 mutant brains. Finally, GSK-3 mutant mice exhibited aberrant anxiety and social behavior. Our results suggest that GSK-3 plays a significant role in astrocyte development and behavioral control in mice. PMID:26179612

  13. A case of cerebellar hemangioblastoma with rhabdoid features.

    Tomono, Ayako; Hara, Shigeo; Hirose, Takanori; Itoh, Tomoo

    2015-04-01

    We present an unusual case of cerebellar hemangioblastoma characterized by rhabdoid features. The patient was a 35-year-old Japanese man with occipital neuralgia and exacerbating blurred vision. Magnetic resonance imaging revealed a left posterior cranial fossa tumor, which was isointense on T1-weighted images and hyperintense on T2-weighted images with marked homogeneous enhancement. Histology of the surgically resected tumor showed cellular-type hemangioblastoma with extensive proliferation of rhabdoid cells Immunohistochemistry analysis showed tumor cells positive for inhibin A, CD56, vimentin, INI-1, and vascular endothelial growth factor; negative for PAX8, CD10, epithelial membrane antigen, cytokeratin, (AE1/3), alpha-smooth muscle actin and D2-40; and had focal positivity for glial fibrillary acidic protein and S100. The Ki-67 labeling index was hemangioblastoma with focal rhabdoid features. After a 14-month follow-up, there was no evidence of recurrence. This is the first report of hemangioblastoma with rhabdoid features in the central nervous system. In addition, we discuss the possible pathogenesis. PMID:24880233

  14. Predictions on the alpha decay half lives of Superheavy nuclei with Z = 113 in the range 255 l.e. A l.e. 314

    Santhosh, K P; Nithya, C; Priyanka, B

    2016-01-01

    An intense study of the alpha decay properties of the isotopes of superheavy element Z=113 have been performed within the Coulomb and proximity potential model for deformed nuclei (CPPMDN) within the wide range 255 l.e. A l.e. 314. The predicted alpha decay half lives of $^{278}$113 and $^{282}$113 and the alpha half lives of their decay products are in good agreement with the experimental data. 6{\\alpha) chains and 4{\\alpha} chains predicted respectively for $^{278}$113 and $^{282}$113 are in agreement with the experimental observation. Our study shows that the isotopes in the mass range 278 l.e. A l.e. 286 will survive fission and can be synthesized and detected in the laboratory via alpha decay. In our study, we have predicted 6{\\alpha} chains from $^{279}$113, 4{\\alpha} chains from $^{286}$113, 3{\\alpha} chains from $^{280,281,283}$113, 2{\\alpha} chains from $^{284}$113 and 1{\\alpha} chain from $^{285}$113. We hope that these predictions will be a guideline for future experimental investigations.

  15. Comparative proteomic approach in rat model of absence epilepsy.

    Gürol, Gönül; Demiralp, Duygu Özel; Yılmaz, Ayça Kasapoğlu; Akman, Özlem; Ateş, Nurbay; Karson, Ayşe

    2015-03-01

    The aim of this study was to investigate cellular proteins in the pathogenesis of the genetic rat model of absence epilepsy. Protein spots were identified with peptide mass fingerprinting analysis using matrix-assisted laser desorption ionization time of flight mass spectrometry. Data were gathered from the frontoparietal cortex and thalamus of Wistar Albino Glaxo/Rij (WAG/Rij) and Wistar by using two-dimensional gel electrophoresis (2D-PAGE). Six proteins (Clathrin light chain-A protein, Transmembrane EMP24 Domain-Containing Protein, Stathmin-4, Myosin Light Chain4, Rheb, phosphoserine phosphatase) were found to be differentially expressed in the frontoparietal cortex of WAG/Rij and Wistar rats in both age groups. Another set of six proteins (Protein FAM89A and Oasl1, Gemin2, NuDEL1, Pur-beta, 3-alpha HSD) were found to be differentially expressed in the thalamus of WAG/Rij and Wistar rats. Findings from the frontoparietal cortex suggest the presence of altered serine metabolism and increased vesicular trafficking in the frontoparietal cortex of WAG/Rij rats compared with Wistar rats. These differences in the protein levels might reflect the crucial role of these proteins and related pathways in the generation of absence seizures. In the thalamic specimens, age-dependent changes in protein expression were remarkable, suggesting that this phenomenon may be a precursor or a consequence of absence seizures. Our findings further highlight the potential role of the mTOR signaling pathway in absence epilepsy. PMID:25323782

  16. Structural investigations of the Bacillus subtilis SPP1 phage G39P helicase inhibitor loading protein

    Bailey, S

    2002-01-01

    The Bacillus subtilis SPPI phage encoded protein G39P is a loader and inhibitor of the phage G40P replicative helicase involved in the initiation of phage DNA replication. The 2.4A crystal structure of a C-terminal truncated variant of G39P was solved using multiple wavelength anomalous dispersion exploiting the anomalous signal of seleno- methionine substituted protein. Inspection of the electron density maps revealed the asymmetric unit contained three independent G39P monomers, composed of 3 alpha-helices and their connecting loops. However, the model only accounted for the first 67 residues of the protein, as there was no interpretable electron density for residues 68 to 112. A preliminary NMR investigation revealed the C-terminal region of the protein had rapid internal motion and formed no well-defined stable fold that involved immobilized side chains. This is consistent with the X-ray analysis that displayed no electron density for these residues. A detailed comparison of NMR spectra from the C-termina...

  17. Improved yields of cyclic nigerosylnigerose from starch by pretreatment with a thermostable branching enzyme.

    Aga, Hajime; Okamoto, Iwao; Taniguchi, Mituki; Kawashima, Akira; Abe, Hiroko; Chaen, Hiroto; Fukuda, Shigeharu

    2010-04-01

    Cyclic nigerosylnigerose (CNN) is produced enzymatically from starch by the combined action of 6-alpha-glucosyltransferase and 3-alpha-isomaltosyltransferase. In our previous study, alpha-1,6-branching chains found in the structure of amylopectin and glycogen were shown to be favorable for CNN formation by the two enzymes. Therefore, we examined whether the introduction of alpha-1,6-branch points into starch using the action of branching enzyme (BE) could improve the yield of CNN from starch. Thermostable BE from Geobacillus stearothermophilus TC-91 was prepared as a purified recombinant protein. Pretreatment of amylose with BE considerably increased the CNN yield from 5% to 38%. When BE acted on tapioca starch, the CNN yield was elevated from 47% to 60%. Conversely, BE treatment of waxy corn starch containing very little amylose resulted in a negligible increase in CNN yield. In addition, BE exerted a beneficial effect when starch with a lower degree of hydrolysis was used as a substrate. The present results indicate that the addition of alpha-1,6-glucosidic linkages to starch using BE is an effective strategy to improve the yield of CNN from starch. PMID:20226381

  18. Neutron- and proton-induced nuclear data evaluation of thorium, uranium and curium isotopes for energies up to 250 MeV

    Young, Ouk Lee; Jonghwa, Chang; Konobeyev, A Yu

    2004-01-01

    The evaluation of neutron- and proton nuclear data for thorium-232, U-233,234,236, and Cm-243,244,245,246 isotopes have been performed at energies up to 250 MeV. Neutron data was evaluated at energies from 20 MeV to 250 MeV, and combined with the JENDL-3.3 data at 20 MeV while proton data was obtained for energies from 1 to 250 MeV. Nuclear model parameters are largely based on the IAEA-RIPL recommendation, and adjusted to better reproduce the available measurements. The coupled channel optical model was applied to calculate the total, reaction, elastic, and direct inelastic cross sections, and to obtain the transmission coefficients. Decay of excited nuclei was described with the Hauser-Feshbach and exciton models using the GNASH code to simultaneously handle neutron, proton, deuteron, triton, helium-3, alpha , gamma emissions and fissions. Special attention was paid on the fission cross sections for energies where experimental data are scant, using appropriate systematics and fittings. Particles and gamma e...

  19. Intracellular modifications of rat alpha 1 inhibitor3. Formation of disulphides, internal thiolester and sulphation.

    Sjöberg, M; Esnard, F; Fries, E

    1991-04-10

    alpha 1 Inhibitor3 (alpha 1I3) is a monomeric protease inhibitor of about 190 kDa which is secreted by rodent hepatocytes. We have studied intracellular modifications of this protein in [35]methionine-labelled rat hepatocytes by pulse/chase experiments followed by immunoprecipitation and gel electrophoresis under reducing and nonreducing conditions. Directly after the pulse, most of the unreduced alpha 1I3 migrated faster than the reduced form, indicating that disulphide bridges are formed during or shortly after synthesis yielding a compact structure. With increasing chase time however, an increasing portion of the unreduced alpha 1I3 migrated with a mobility lower than that of the reduced protein, half-maximal conversion occurring after about 10 min. This finding suggests that alpha 1I3 undergoes a conformational change in the endoplasmic reticulum, possibly becoming more elongated. During 10-30 min of chase, the protein acquired the capacity to undergo autolytic cleavage upon heating, a property due to the existence of an internal thiolester bond [Howard, J. B., Vermeulen, M. & Swenson, R. P. (1980) J. Biol. Chem. 255, 3820-3823; Esnard, F., Gutman, N., El Moujahed, A. & Gauthier, F. (1985) FEBS Lett. 182, 125-129]. Analysis by subcellular fractionation indicated that this bond is formed in the endoplasmic reticulum. Finally, we show that secreted alpha 1I3 is sulphated, presumably at Tyr618. PMID:2015826

  20. A Highly Tilted Binding Mode by a Self-Reactive T Cell Receptor Results in Altered Engagement of Peptide and MHC

    D Sethi; D Schubert; A Anders; A Heroux; D Bonsor; C Thomas; E Sundberg; J Pyrdol; K Wucherpfennig

    2011-12-31

    Self-reactive T cells that escape elimination in the thymus can cause autoimmune pathology, and it is therefore important to understand the structural mechanisms of self-antigen recognition. We report the crystal structure of a T cell receptor (TCR) from a patient with relapsing-remitting multiple sclerosis that engages its self-peptide-major histocompatibility complex (pMHC) ligand in an unusual manner. The TCR is bound in a highly tilted orientation that prevents interaction of the TCR-{alpha} chain with the MHC class II {beta} chain helix. In this structure, only a single germline-encoded TCR loop engages the MHC protein, whereas in most other TCR-pMHC structures all four germline-encoded TCR loops bind to the MHC helices. The tilted binding mode also prevents peptide contacts by the short complementarity-determining region (CDR) 3{beta} loop, and interactions that contribute to peptide side chain specificity are focused on the CDR3{alpha} loop. This structure is the first example in which only a single germline-encoded TCR loop contacts the MHC helices. Furthermore, the reduced interaction surface with the peptide may facilitate TCR cross-reactivity. The structural alterations in the trimolecular complex are distinct from previously characterized self-reactive TCRs, indicating that there are multiple unusual ways for self-reactive TCRs to bind their pMHC ligand.

  1. Measurement of differential (n,x{alpha}) cross section using 4{pi} gridded ionization chamber

    Sanami, Toshiya; Baba, Mamoru; Matsuyama, Shigeo; Kiyosumi, Takehide; Nauchi, Yasushi; Saito, Keiichiro; Hirakawa, Naohiro [Tohoku Univ., Sendai (Japan). Faculty of Engineering; Kawano, Toshihiko

    1997-03-01

    We carried out the measurements of high resolution {alpha} emission spectra of {sup 58}Ni and {sup nat}Ni between 4.5 and 6.5 MeV, and {sup 12}C(n,x{alpha}) cross section using a 4{pi} gridded ionization chamber. In Ni measurement, overall energy resolution was improved to around 200 keV by optimizing a sample thickness and a neutron source width. Measured alpha spectra showed separate peaks corresponding to the ground and low-lying excited states of the residual nucleus ({sup 55}Fe). These results were compared with another direct measurement and statistical model calculations. In {sup 12}C measurement, GIC was applied for (n,x{alpha}) reactions of light nuclei. This application is difficult to (n,x{alpha}) cross sections of light nuclei, because of the influences of large recoil energy and multi-body break-up. We developed new methods which eliminate the effects of recoil nuclei and multi-body break-up and applied them to {sup 12}C(n,x{alpha}) reaction at En=14.1 MeV. In our experiment, the {sup 12}C(n,{alpha}{sub 0}){sup 9}Be angular differential cross section and {sup 12}C(n,n`3{alpha}) cross section were obtained. (author)

  2. Nucleotide insertion initiated by van der Waals interaction during polymerase beta DNA replication

    Arulsamy, Andrew Das

    2011-01-01

    Immortality will remain a fantasy for as long as aging is determined by the erroneous biochemical reactions during a particular DNA replication. The replication and base excision repair mechanism, associated to eukaryotic DNA polymerase-beta enzyme are central to maintaining a healthy cell. Here, we give a series of unambiguous theoretical analyses and prove that the exclusive biochemical reaction involved in a single nucleotide insertion into the DNA primer can be efficiently tracked using the renormalized van der Waals interaction of the stronger type, and the Hermansson blue-shifting hydrogen bond effect. We found that there are two biochemical steps involved to complete the insertion of a single dCTP into the 3' end of a DNA primer. First, the O3' (from a DNA primer) initiates the nucleophilic attack on P_alpha?(from an incoming dCTP), in response, O3_alpha (bonded to P_alpha) retaliates by interacting with H' (bonded to O3'). These interactions are shown to be strongly interdependent and require the form...

  3. Signatures of L\\'evy flights with annealed disorder

    Baudouin, Q; Eloy, A; Nunes-Pereira, E J; Cuniasse, P -A; Mercadier, N; Kaiser, R

    2014-01-01

    We present theoretical and experimental results of L\\'evy flights of light originating from a random walk of photons in a hot atomic vapor. In contrast to systems with quenched disorder, this system does not present any correlations between the position and the step length of the random walk. In an analytical model based on microscopic first principles including Doppler broadening we find anomalous L\\'evy-type superdiffusion corresponding to a single-step size distribution P(x) proportional to x^(-1-alpha), with alpha=1. We show that this step size distribution leads to a violation of Ohm's law [T_(diff) proportional to L^(-alpha/2) different from 1/L], as expected for a L\\'evy walk of independent steps. Furthermore the spatial profile of the transmitted light develops power law tails [I(r) proportional to r^(-3-alpha)]. In an experiment using a slab geometry with hot rubidium vapor, we measured the total diffuse transmission T_(diff) and the spatial profile of the transmitted light I(r). We obtained the micr...

  4. Solvability of fractional multi-point boundary-value problems with p-Laplacian operator at resonance

    Tengfei Shen

    2014-02-01

    Full Text Available In this article, we consider the multi-point boundary-value problem for nonlinear fractional differential equations with $p$-Laplacian operator: $$\\displaylines{ D_{0^+}^\\beta \\varphi_p (D_{0^+}^\\alpha u(t = f(t,u(t,D_{0^+}^{\\alpha - 2} u(t,D_{0^+}^{\\alpha - 1} u(t, D_{0^+}^\\alpha u(t,\\quad t \\in (0,1, \\cr u(0 = u'(0=D_{0^+}^\\alpha u(0 = 0,\\quad D_{0^+}^{\\alpha - 1} u(1 = \\sum_{i = 1}^m {\\sigma_i D_{0^+}^{\\alpha - 1} u(\\eta_i } , }$$ where $2 < \\alpha \\le 3$, $0 < \\beta \\le 1$, $3 < \\alpha + \\beta \\le 4$, $\\sum_{i = 1}^m {\\sigma_i } = 1$, $D_{0^+}^\\alpha$ is the standard Riemann-Liouville fractional derivative. $\\varphi_{p}(s=|s|^{p-2}s$ is p-Laplacians operator. The existence of solutions for above fractional boundary value problem is obtained by using the extension of Mawhin's continuation theorem due to Ge, which enrich konwn results. An example is given to illustrate the main result.

  5. Eupha-7,9(11),24-trien-3beta-ol ("antiquol C") and other triterpenes from Euphorbia antiquorum latex and their inhibitory effects on Epstein-Barr virus activation.

    Akihisa, Toshihiro; Kithsiri Wijeratne, E M; Tokuda, Harukuni; Enjo, Fumio; Toriumi, Masakazu; Kimura, Yumiko; Koike, Kazuo; Nikaido, Tamotsu; Tezuka, Yasuhiro; Nishino, Hoyoku

    2002-02-01

    The structures of three triterpene alcohols isolated from the latex of Euphorbia antiquorum were established to be eupha-7,9(11),24-trien-3beta-ol (2; antiquol C), 19(10-->9)abeo-8alpha,9beta,10alpha-eupha-5,24-dien-3beta-ol (3; antiquol B), and 24-methyltirucalla-8,24(24(1))-dien-3beta-ol (4; euphorbol) on the basis of spectroscopic methods. Compounds 3 and 4 have previously been assigned the erroneous structures of 10alpha-cucurbita-5,24-dien-3alpha-ol and 24-methyleupha-8,24(24(1))-dien-3beta-ol, respectively. Compounds 2-4 and four other known compounds isolated from the latex, euphol (1), lemmaphylla-7,21-dien-3beta-ol (5), isohelianol (6), and camelliol C (7), showed potent inhibitory effects on Epstein-Barr virus early antigen (EBV-EA) activation induced by the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA). PMID:11858748

  6. Morphological effects on IR band profiles: Experimental spectroscopic analysis with application to observed spectra of oxygen-rich AGB stars

    Tamanai, A; Blum, J; Posch, Th; Koike, C; Ferguson, J W

    2009-01-01

    To trace the source of the unique 13, 19.5, and 28 $\\mu$m emission features in the spectra of oxygen-rich circumstellar shells around AGB stars, we have compared dust extinction spectra obtained by aerosol measurements. We have measured the extinction spectra for 19 oxide powder samples of eight different types, such as Ti-compounds (TiO, TiO$_2$, Ti$_2$O$_3$, Ti$_3$O$_5$, Al$_2$TiO$_5$, CaTiO$_3$), $\\alpha$-, $\\gamma$-, $\\chi$-$\\delta$-$\\kappa$-Al$_2$O$_3$, and MgAl$_2$O$_4$ in the infrared region (10 - 50 $\\mu$m) paying special attention to the morphological (size, shape, and agglomeration) effects and the differences in crystal structure. Anatase (TiO$_2$) particles with rounded edges are the possible 13, 19.5 and 28 $\\mu$m band carriers as the main contributor in the spectra of AGB stars, and spherically shaped nano-sized spinel and Al$_2$TiO$_5$ dust grains are possibly associated with the anatase, enhancing the prominence of the 13 $\\mu$m feature and providing additional features at 28 $\\mu$m. The extin...

  7. Antifungal activity of the extracts and saponins from Sapindus saponaria L.

    Joyce K. Tsuzuki

    2007-12-01

    Full Text Available Extracts from the dried pericarp of Sapindus saponaria L. (Sapindaceae fruits were investigated for their antifungal activity against clinical isolates of yeasts Candida albicans and C. non-albicans from vaginal secretions of women with Vulvovaginal Candidiasis. Four clinical isolates of C. albicans, a single clinical isolated of each of the species C. parapsilosis, C. glabrata, C. tropicalis, and the strain of C. albicans ATCC 90028 were used. The hydroalcoholic extract was bioactivity-directed against a clinical isolate of C. parapsilosis, and showed strong activity. The n-BuOH extract and one fraction showed strong activity against all isolates tested. Further column-chromatography on silica gel separation of this fraction afforded two pure triterpene acetylated saponins: 3-O-(4-acetyl-beta-D-xylopyranosyl-(1->3-alpha-Lrhamnopyranosyl-(1->2-alpha-L-arabinopyranosyl-hederagenin (1 and 3-O-(3,4-di-acetyl-beta-D-xylopyranosyl-(1->3-alpha-L-rhamnopyranosyl-(1->2-alpha-L-arabynopyranosyl-hederagenin (2. The structures of the compounds were based on spectral data (¹H and 13C NMR, HSQC, HMBC and MS, and on with literature. The saponins isolated showed strong activity against C. parapsilosis.Extratos do pericarpo de frutos de Sapindus saponaria L. (Sapindaceae foram testados para a atividade antifúngica sobre isolados clínicos de leveduras de Candida albicans e C. não-albicans obtidos de secreção vaginal de mulheres com Candidíase Vulvovaginal. Foram avaliados quatro isolados clínicos de C. albicans, um de cada uma das espécies C. glabrata, C. parapsilosis, C. tropicalis e uma cepa referência de C. albicans ATCC 90028. O extrato hidroalcoólico foi biomonitorado contra um isolado clínico de C. parapsilosis, apresentando forte atividade. O extrato butanólico e uma fração apresentaram forte atividade contra todos os isolados testados. Posterior análise desta fração via cromatografia em sílica gel (CHCl3:CH3OH, 1:1, v/v resultou no

  8. Concepts and strategies for management of nuclear wastes

    Three modes of reactor strategies are chosen and discussed; (1) Once-through type light water reactor, (2) U-Pu cycle light water reactor, and (3) U-Pu cycle fast breeder reactor. The arising of wastes in each mode of nuclear fuel cycle is first estimated for unit nuclear power generation of 1 GWe.year and the amount of wastes to be managed in each year is then calculated. Assuming the 2nd and the 3rd reprocessing plants are not operative, the decrease of waste arising is also estimated, which, nevertheless, claims the need for spent fuel storage pools. In addition, the arisings of decommissioning wastes are evaluated to identify their effect on waste management. Based on above fact, a generic logic of waste management is brought about, placing major emphasis on volume reduction, barrier- and decay-effects. According to the characteristics, the wastes arisen at each stage of nuclear fuel cycle can be categorized into (1) extremely low-level waste, (2) low- and intermediate-level waste, (3) alpha-waste and (4) high-level waste, and the suitable isolation periods for the specified categories can be set by the aid of hazard index, suggesting that the disposal options may possibly be selected. The waste disposal gives environmental impacts through dispersion and migration of contained nuclides into biosphere; the dispersion and migration paths are investigated and a mathematical expression to evaluate the impacts as dose commitment is presented. A multi-barrier concept is proposed since combined artificial and natural barriers have possibility of lengthening the migration path to enable safe disposal. Finally, items of research/development in waste management are represented from the viewpoints of (1) establishment of management system, (2) safety assessment covering verification of technology and system, and (3) regulation, giving recommendations for national policy making as well as for international co-operation. (JPN)

  9. Regions flanking exon 1 regulate constitutive expression of the human antithrombin gene.

    Fernandez-Rachubinski, F A; Weiner, J H; Blajchman, M A

    1996-11-15

    We have identified cis-acting elements and trans-acting factors that regulate constitutive expression of the human antithrombin gene. The activity of the sequences flanking the first exon of the gene was investigated using a luciferase-based reporter assay in transiently transfected HepG2, COS1, BSC40, and HeLa cells. Deletion analysis allowed the mapping of two elements able to promote antithrombin gene transcription in HepG2 and COS1 cells. The first element is located upstream of the first exon (-150/+68 nucleotides). The second element is in the first intervening sequence (+300/+700 nucleotides) and functions in an orientation opposite to that of the first. Footprint analysis showed three protected areas in the 5' upstream element at -92/-68 (element A), -14/+37 (element B), and -126/-100 nucleotides (element C). These elements acted as enhancers in luciferase reporter assays. Gel retardation analysis demonstrated that two liver-enriched transcription factors, hepatocyte nuclear factor 4 (HNF4) and CCAAT enhancer-binding protein (C/EBPa), bound to the 5' upstream element. HNF4 bound to elements A and C, whereas C/EBPa bound to element B. Element A also interacted with the ubiquitous nuclear hormone receptors chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1), thyroid hormone receptor alpha (TRalpha), peroxisome proliferator-activated receptor alpha(PPARalpha), and retinoid X receptor alpha (RXRalpha). In HepG2 and BSC40 cells, HNF4, C/EBPalpha, and RXRalpha activated luciferase expression from a reporter construct containing the 5'-upstream minimal antithrombin gene promoter, while COUP-TF1, TRalpha, and HNF3 (alpha or beta) repressed such expression. Our results show that constitutive expression of the human antithrombin gene depends in part upon the interplay of these transcription factors and suggest that signaling pathways regulated by these factors can modulate antithrombin gene transcription. PMID:8910619

  10. GSK3 inactivation is involved in mitochondrial complex IV defect in transforming growth factor (TGF) {beta}1-induced senescence

    Byun, Hae-Ok; Jung, Hyun-Jung; Seo, Yong-Hak; Lee, Young-Kyoung [Department of Biochemistry and Molecular Biology, Ajou University School of Medicine, Suwon 443-721 (Korea, Republic of); Department of Molecular Science and Technology, The Graduate School, Ajou University, Suwon 443-721 (Korea, Republic of); Hwang, Sung-Chul [Department of Pulmonary and Critical Care Medicine, Ajou University School of Medicine, Suwon 443-721 (Korea, Republic of); Seong Hwang, Eun [Department of Life Science, University of Seoul, Seoul 130-743 (Korea, Republic of); Yoon, Gyesoon, E-mail: ypeace@ajou.ac.kr [Department of Biochemistry and Molecular Biology, Ajou University School of Medicine, Suwon 443-721 (Korea, Republic of); Department of Molecular Science and Technology, The Graduate School, Ajou University, Suwon 443-721 (Korea, Republic of)

    2012-09-10

    Transforming growth factor {beta}1 (TGF {beta}1) induces Mv1Lu cell senescence by persistently producing mitochondrial reactive oxygen species (ROS) through decreased complex IV activity. Here, we investigated the molecular mechanism underlying the effect of TGF {beta}1 on mitochondrial complex IV activity. TGF {beta}1 progressively phosphorylated the negative regulatory sites of both glycogen synthase kinase 3 (GSK3) {alpha} and {beta}, corresponding well to the intracellular ROS generation profile. Pre-treatment of N-acetyl cysteine, an antioxidant, did not alter this GSK3 phosphorylation (inactivation), whereas pharmacological inhibition of GSK3 by SB415286 significantly increased mitochondrial ROS, implying that GSK3 phosphorylation is an upstream event of the ROS generation. GSK3 inhibition by SB415286 decreased complex IV activity and cellular O{sub 2} consumption rate and eventually induced senescence of Mv1Lu cell. Similar results were obtained with siRNA-mediated knockdown of GSK3. Moreover, we found that GSK3 not only exists in cytosol but also in mitochondria of Mv1Lu cell and the mitochondrial GSK3 binds complex IV subunit 6b which has no electron carrier and is topologically located in the mitochondrial intermembrane space. Involvement of subunit 6b in controlling complex IV activity and overall respiration rate was proved with siRNA-mediated knockdown of subunit 6b. Finally, TGF {beta}1 treatment decreased the binding of the subunit 6b to GSK3 and subunit 6b phosphorylation. Taken together, our results suggest that GSK3 inactivation is importantly involved in TGF {beta}1-induced complex IV defects through decreasing phosphorylation of the subunit 6b, thereby contributing to senescence-associated mitochondrial ROS generation.